Fc-binding protein, method for producing said protein, and antibody adsorbent using said protein, and methods for purifying and identifying antibody using said adsorbent
10611817 ยท 2020-04-07
Assignee
Inventors
Cpc classification
C07K1/22
CHEMISTRY; METALLURGY
C07K16/283
CHEMISTRY; METALLURGY
C07K14/70535
CHEMISTRY; METALLURGY
C07K17/00
CHEMISTRY; METALLURGY
C07K2317/10
CHEMISTRY; METALLURGY
International classification
C07K1/00
CHEMISTRY; METALLURGY
C12N15/00
CHEMISTRY; METALLURGY
C07K1/22
CHEMISTRY; METALLURGY
C07K16/28
CHEMISTRY; METALLURGY
C12N5/00
CHEMISTRY; METALLURGY
C12P21/06
CHEMISTRY; METALLURGY
Abstract
The present invention addresses the first problem of providing an Fc-binding protein having improved stability, especially stability to heat and acid, of the Fc-binding protein, a method for producing this protein, and an antibody adsorbent using this protein. The present invention also addresses the second problem of providing a method that makes it possible to identify the presence or absence of glycosylation of an antibody, and a material to be used in this method. The first problem is solved by an Fc-binding protein having improved stability to heat and acid obtained by substituting amino acid residues at specific positions in the extracellular domain within human FcRIIIa with other specific amino acids, a method for producing this protein, and an antibody adsorbent using this protein. The second problem is solved by using an adsorbent capable of specifically adsorbing an antibody having a sugar chain, the adsorbent being obtained by immobilizing human FcRIIIa on an insoluble carrier.
Claims
1. An Fc-binding protein comprising the amino acid residues from position 17 to position 192 of the amino acid sequence of SEQ ID NO: 1, wherein one of the following (1) to (10) amino acid substitutions occurs in the amino acid residues from position 17 to position 192: (1) A substitution of aspartic acid, asparagine, glycine, lysine, leucine, proline, serine, or threonine for tyrosine at position 35 of SEQ ID NO: 1; (2) A substitution of glutamic acid for valine at position 27 of SEQ ID NO: 1 and a substitution of asparagine for tyrosine at position 35 of SEQ ID NO: 1; (3) A substitution of glutamine for leucine at position 30 of SEQ ID NO: 1 and a substitution of asparagine for tyrosine at position 35 of SEQ ID NO: 1; (4) A substitution of histidine for tyrosine at position 35 of SEQ ID NO: 1 and a substitution of aspartic acid for glutamic acid at position 54 of SEQ ID NO: 1; (5) A substitution of histidine for tyrosine at position 35 of SEQ ID NO: 1 and a substitution of threonine for serine at position 155 of SEQ ID NO: 1; (6) A substitution of asparagine for tyrosine at position 35 of SEQ ID NO: 1 and a substitution of glycine for serine at position 169 of SEQ ID NO: 1; (7) A substitution of asparagine for tyrosine at position 35 of SEQ ID NO: 1, a substitution of leucine for glutamine at position 48 of SEQ ID NO: 1, and a substitution of glutamine for leucine at position 110 of SEQ ID NO: 1; (8) A substitution of serine for tyrosine at position 35 of SEQ ID NO: 1, a substitution of tyrosine for phenylalanine at position 151 of SEQ ID NO: 1, and a substitution of glycine for serine at position 167 of SEQ ID NO: 1; (9) A substitution of asparagine for tyrosine at position 35 of SEQ ID NO: 1, a substitution of valine for glutamic acid at position 120 of SEQ ID NO: 1, and a substitution of lysine for glutamine at position 192 of SEQ ID NO: 1; and (10) A substitution of aspartic acid for tyrosine at position 35 of SEQ ID NO: 1, a substitution of glycine for glutamic acid at position 54 of SEQ ID NO: 1, a substitution of valine for aspartic acid at position 82 of SEQ ID NO: 1, and a substitution of glutamic acid for lysine at position 119 of SEQ ID NO: 1.
2. The Fc-binding protein according to claim 1 (1), wherein tyrosine at position 35 of SEQ ID NO: 1 is substituted with aspartic acid, glycine, lysine, leucine, proline, serine, or threonine.
3. An Fc-binding protein comprising the amino acid residues from position 17 to position 192 of the amino acid sequence of SEQ ID NO: 1, wherein the Fc-binding protein comprises at least one amino acid substitution of tyrosine at position 35 with asparagine.
4. The Fc-binding protein according to claim 3, wherein at least valine at position 27 is substituted with glutamic acid.
5. The Fc-binding protein according to claim 4, wherein the Fc-binding protein comprises the amino acid sequences selected from the group consisting of SEQ ID NO: 27, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 37, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 47, and SEQ ID NO: 49.
6. The Fc-binding protein according to claim 5, consisting of the amino acid sequence of any one selected from SEQ ID NO: 27, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 37, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 47, and SEQ ID NO: 49.
7. An adsorbent comprising the Fc-binding protein according to claim 3 and an insoluble support, the Fc-binding protein being immobilized on the insoluble support.
8. A polynucleotide coding for the Fc-binding protein according to claim 1.
9. An expression vector including the polynucleotide according to claim 8.
10. A transformant comprising a host and the expression vector according to claim 9, the host expressing the expression vector.
11. The transformant according to claim 10, wherein the host is E. coli.
12. A method for producing an Fc-binding protein, wherein the Fc-binding protein is expressed by culturing the transformant according to claim 10 to obtain an expressed Fc-binding protein, and the expressed Fc-binding protein is recovered from the cultured product.
13. An adsorbent comprising the Fc-binding protein according to claim 2 and an insoluble support, the Fc-binding protein being immobilized on the insoluble support.
14. An adsorbent comprising the Fc-binding protein according to claim 1 and an insoluble support, the Fc-binding protein being immobilized on the insoluble support.
15. An adsorbent comprising the Fc-binding protein according to claim 4 and an insoluble support, the Fc-binding protein being immobilized on the insoluble support.
16. An adsorbent comprising the Fc-binding protein according to claim 5 and an insoluble support, the Fc-binding protein being immobilized on the insoluble support.
17. An adsorbent comprising the Fc-binding protein according to claim 6 and an insoluble support, the Fc-binding protein being immobilized on the insoluble support.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
EXAMPLES
(10) Examples will now be provided for further explanation of the invention, with the understanding that the invention is not limited to these examples.
Example 1
Preparation of Fc-Binding Protein or Human FcRIIIa Expression Vector
(11) (1) A nucleotide sequence with codons converted from the human type to the E. coli type, was designed based on the amino acid sequence from glycine (Gly) at position 17 to glutamine (Gln) at position 192 of the amino acid sequence of human FcRIIIa of SEQ ID NO: 1, by using the DNAworks method (Nucleic Acids Res., 30, e43, 2002). The designed nucleotide sequence is SEQ ID NO: 2.
(12) (2) For construction of a polynucleotide including the sequence of SEQ ID NO: 2, oligonucleotides consisting of the sequences of SEQ ID NO: 3 to 20 were synthesized, and the oligonucleotides were used for the two-step PCR described below.
(13) (2-1) In the first step of the PCR, a reaction mixture with the composition shown in Table 1 was prepared and the reaction mixture was heat treated at 98 C. for 5 minutes, after which 10 cycles of reaction were repeated, where one cycle consisted of a first step at 98 C. for 10 seconds, a second step at 62 C. for 5 seconds and a third step at 72 C. for 90 seconds, to synthesize a polynucleotide, which was designated as FcRp1. The DNA mix in Table 1 is a mixed solution of the 18 different oligonucleotides comprising the sequences of SEQ ID NO: 3 to 20, each sampled in a fixed amount.
(14) TABLE-US-00001 TABLE 1 Concentration/ Composition volume DNA mix (SEQ ID NO: 3 to 20) 2.5 mM each 5 Prime STAR buffer 10 L (Takara Bio, Inc.) 2.5 mM dNTPs 4 L 2.5 U/L Prime STAR HS 0.5 L (Takara Bio, Inc.) H.sub.2O Up to 50 L
(15) (2-2) In the second step of the PCR, the FcRp1 synthesized in (2-1) was used as template and the oligonucleotides comprising the sequences of SEQ ID NO: 21 (5-TAGCCATGGGCATGCGTACCGAAGATCTGCCGAAAGC-3) and SEQ ID NO: 22 (5-CCCAAGCTTAATGATGATGATGATGATGGCCCCCTTGGGTAATGGTAATATTCACGG TCTCGCTGC-3) were used as PCR primers. Specifically, a reaction mixture with the composition shown in Table 2 was prepared and the reaction mixture was heat treated at 98 C. for 5 minutes, after which 30 cycles of reaction were repeated, where one cycle consisted of a first step at 98 C. for 10 seconds, a second step at 62 C., for 5 seconds and a third step at 72 C. for 1.5 minutes.
(16) TABLE-US-00002 TABLE 2 Concentration/ Composition volume Template DNA 2 L Forward primer 0.4 M Reverse primer 0.4 M 5 Prime STAR buffer 10 L (Takara Bio, Inc.) 2.5 mM dNTPs 4 L 2.5 U/L Prime STAR HS 0.5 L (Takara Bio, Inc.) H.sub.2O Up to 50 L
(17) (3) The polynucleotide obtained in (2) was purified and digested with restriction enzymes NcoI and HindIII, and ligated with the expression vector pETMalE that had been previously digested with restriction enzymes NcoI and HindIII (Japanese Unexamined Patent Publication No. 2011-206046), and the ligation product was used for transformation of E. coli BL21 (DE3).
(18) (4) The obtained transformants were cultured in LB medium containing 50 g/mL kanamycin, and then a QIAprep Spin Miniprep kit (product of Qiagen Inc.) was used for extraction of the expression vector pET-eFcR.
(19) (5) From the expression vector pET-eFcR constructed in (4), the polynucleotide coding for human FcRIIIa and its surrounding regions were supplied for cycle sequencing reaction using a Big Dye Terminator Cycle Sequencing Ready Reaction kit (product of Life Technologies Corp.) based on the chain terminator method, and the nucleotide sequence was analyzed with a fully automatic DNA sequencer, ABI Prism 3700 DNA analyzer (product of Life Technologies Corp.). For the analysis, oligonucleotides comprising the sequences of SEQ ID NO: 23 (5-TAATACGACTCACTATAGGG-3) or SEQ ID NO: 24 (5-TATGCTAGTTATTGCTCAG-3) were used as the sequencing primers.
(20) The amino acid sequence of the polypeptide expressed in expression vector pET-eFcR is of SEQ ID NO: 25, and the sequence of the polynucleotide coding for that polypeptide is of SEQ ID NO: 26, In SEQ ID NO: 25, the region from methionine (Met) at position 1 to alanine (Ala) at position 26 is the MalE signal peptide, the region from lysine (Lys) at position 27 to methionine (Met) at position 32 is the linker sequence, the region from glycine (Gly) at position 33 to glutamine (Gln) at position 208 is the extracellular domain of the human FcRIIIa (the region from position 17 to position 192 of SEQ ID NO: 1), the region of glycine (Gly) from position 209 to position 210 is the linker sequence, and the region of histidine (His) from position 211 to position 216 is the tag sequence.
Example 2
Mutagenesis in Fc-Binding Protein and Construction of Library
(21) For the Fc-binding protein expression vector pER-eFcR constructed in Example 1, mutation transfer was conducted randomly by error-prone PCR in the polynucleotide portion coding for the Fc-binding protein.
(22) (1) Error-prone PCR was conducted using pET-eFcR constructed in Example 1 as template. The error-prone PCR was carried out by preparing a reaction mixture with the composition shown in Table 3, and then heat treating the reaction mixture at 95 C. for 2 minutes, carrying out 35 cycles of reaction where one cycle consisted of a first step at 95 C. for 30 seconds, a second step at 60 C. for 30 seconds and a third step at 72 C. for 90 seconds, and finally conducting heat treatment at 72 C. for 7 minutes. As a result of the error-prone PCR, mutations were satisfactorily introduced into the polynucleotide coding for Fc-binding protein, with an average mutagenesis rate of 1.26%.
(23) TABLE-US-00003 TABLE 3 Concentration/ Composition volume Template DNA (pET-eFcR) 0.12 ng/L 10 M PCR primer 4 L (SEQ ID NO: 21) 10 M PCR primer 4 L (SEQ ID NO: 22) 2.5 mM MgCl.sub.2 12 L 10 mM dATP 2 L 10 mM dGTP 2 L 10 mM dCTP 10 L 10 mM dTTP 10 L 10 mM MnCl.sub.2 4 L 10 Ex Taq Buffer 1 (Takara Bio, Inc.) Go Taq Polymerase 1 L (Promega Corp.) H.sub.2O Up to 100 L
(24) (2) After purifying the PCR product obtained in (1), it was digested with restriction enzymes NcoI and HindIII, and ligated with expression vector pETMalE that had been previously digested with the same restriction enzymes (Japanese Unexamined Patent Publication No. 2011-206046).
(25) (3) Upon completion of the ligation reaction, the reaction mixture was introduced into E. coli BL21(DE3) by an electroporation method, and culturing was conducted. (at 37 C. for 18 hours) on LB plate culture medium containing 50 g/mL kanamycin, after which the colonies formed on the plate were used as a random mutant library.
Example 3
Screening of Heat-Stabilized Fc-Binding Protein
(26) (1) The random mutant library (of transformants) prepared in Example 2 was inoculated into 200 L of 2YT liquid medium. (16 g/L peptone, 10 g/L yeast extract, 5 g/L sodium chloride) containing 50 g/mL kanamycin, and a 96-well deep well plate was used for shake culturing overnight at 30 C.
(27) (2) After culturing, 5 L of culture solution was inoculated into 50 g/mL of 2YT liquid medium containing 0.05 mM IPTG (isopropyl--D-thiogalactopyranoside), 0.3% glycine and 50 g/mL kanamycin, and a 96-well deep well plate was used for shake culturing overnight at 20 C.
(28) (3) After culturing, the culture supernatant obtained by centrifugation was diluted 2-fold with 20 mM Tris-HCl buffering solution (pH 7.4) containing 150 mM sodium chloride. The diluted solution was heat treated at 45 C. for 10 minutes.
(29) (4) The antibody binding activity of the Fc-binding protein after the heat treatment of (3) and the antibody binding activity of the Fc-binding protein without the heat treatment of (3) were each measured by the ELISA method described below, and the antibody binding activity of the Fc-binding protein after heat treatment was divided by the antibody binding activity of the Fc-binding protein without heat treatment to calculate the residual activity.
(30) (4-1) A gammaglobulin preparation (by Kaketsuken) as the human antibody, was immobilized in the wells of a 96-well microplate at 1 g/well (at 4 C. for 18 hours), and after complete immobilization, blocking was performed with 20 mM Tris-HCl buffering solution (pH 7.4) containing 2% (w/v) SKIM MILK (product of BD) and 150 mM sodium chloride.
(31) (4-2) After wash with rinsing buffer (20 mM Tris-HCl buffer (pH 7.4) containing 0.05%[w/v] Tween 20 and 150 mM NaCl), a solution containing Fc-binding protein for evaluation of the antibody binding activity was added, and reaction was conducted between the Fc-binding protein and the immobilized gammaglobulin (at 30 C. for 1 hour).
(32) (4-3) Upon completion of the reaction, it was rinsed with wash buffer, and anti-6His antibody (product of Bethyl Laboratories) diluted to 100 ng/mL was added at 100 L/well.
(33) (4-4) Reaction was conducted at 30 C. for 1 hour, and after wash with rinsing buffer, IME Peroxidase Substrate (product of KPL) was added at 50 L/well. Coloration was stopped by adding 1M phosphoric acid at 50 L/well, and the absorbance at 450 nm was measured with a microplate reader (product of Tecan).
(34) (5) Approximately 2700 transformants were evaluated by the method of (4), and among these there were selected transformants expressing Fc-binding protein and having increased thermal stability compared to the wild type Fc-binding protein (without amino acid substitutions). The selected transformants were cultured, and an expression vector was prepared using a QIAprep Spin Miniprep kit (product of Qiagen Inc.).
(35) (6) The nucleotide sequence of the polynucleotide region coding for Fc-binding protein, inserted into the obtained expression vector, was analyzed by the same method described in Example 1 (5), and the amino acid mutation sites were identified.
(36) Table 4 shows a summary of the amino acid substitution positions with respect to the wild type Fc-binding protein (without amino acid substitution), in the Fc-binding protein expressed by the transformants selected in (5), as well as the post-heat treatment residual activities (%). An Fc-bindinq protein including the amino acid residues from glycine at position 17 to glutamine at position 192, of the amino acid sequence of SEQ ID NO: 1, and having at least one amino acid substitution from among Met18Arg (a designation indicating that the methionine at position 18 of SEQ ID NO: 1 is substituted by arginine, same hereunder), Val27Glu, Phe29Leu, Phe20Ser, Leu30Gln, Tyr35Asn, Tyr35Asp, Tyr35Ser, Tyr35His, Lys46Ile, Lys46Thr, Gln48His, Gln48Leu, Ala50His, Tyr51Asp, Tyr51His, Glu54Asp, Glu54Gly, Asn56Thr, Gln59Arg, Phe61Tyr, Glu64Asp, Ser65Arg, Ala71Asp, Phe75Leu, Phe75Ser, Phe75Tyr, Asp77Asn, Ala78Ser, Asp82Glu, Asp82Val, Gln90Arg, Asn92Ser, Leu93Arg, Leu93Met, Thr95Ala, Thr95Ser, Leu110Gln, Arg115Gln, Trp116Leu, Phe118Tyr, Lys119Glu, Glu120Val, Glu121Asp, Glu121Gly, Phe151Ser, Phe151Tyr, Ser155Thr, Thr163Ser, Ser167Gly, Ser169Gly, Phe171Tyr, Asn180Lys, Asn180Ser, Asn180Ile, Thr185Ser and Gln192Lys, among the amino acid residues from position 17 to position 192, can be said to have increased thermal stability compared to the wild type Fc-binding protein.
(37) TABLE-US-00004 TABLE 4 Residual Residual Amino acid- activity Amino acid- activity substituted (%) substituted (%) Lys46Ile 33.6 Tyr35His, Ser155Thr 65.8 Gln59Arg 59.6 Tyr35Asn, Ser169Gly 44.8 Phe61Tyr 48.2 Lys46Thr, Asn92Ser 57.6 Glu64Asp 45.1 Ala50His, Thr95Ser 65.3 Phe75Ser 47.3 Tyr51His, Thr95Ser 56.5 Asp82Glu 43.1 Asp77Asn, Ala78Ser 51.7 Asn92Ser 55.5 Gln90Arg, Asn92Ser 58.8 Leu93Met 42.9 Phe151Ser, Asn180Lys 33.0 Glu121Asp 46.2 Phe29Ser, Gln90Arg, 46.1 Thr163Ser Thr163Ser 33.2 Phe29Leu, Trp116Leu, 81.0 Phe118Tyr Asn180Ser 43.6 Tyr35Asn, Gln48Leu, 74.6 Leu110Gln Asn180Ile 50.6 Tyr35Ser, Phe151Tyr, 45.0 Ser167Gly Thr185Ser 39.3 Tyr35Asn, Glu120Val, 75.1 Gln192Lys Met18Arg, Glu64Asp 53.3 Gln48Leu, Phe75Tyr, 38.9 Arg115Gln Val27Glu, Tyr35Asn 96.0 Tyr51Asp, Phe75Leu, 94.8 Glu121Gly Phe29Leu, Asn56Thr 38.5 Ala71Asp, Phe75Leu, 93.9 Glu121Gly Phe29Ser, Thr95Ala 58.7 Tyr35Asp, Glu54Gly, 63.0 Asp82Val, Lys119Glu Phe29Leu, Phe118Tyr 56.6 Gln48His, Ser65Arg, 44.7 Leu93Arg, Phe171Tyr Leu30Gln, Tyr35Asn 88.1 Wild type 31.3 Tyr35His, Glu54Asp 67.1
(38) Of the amino acid-substituted Fc-binding proteins shown in Table 4, the Fc-binding protein. exhibiting the highest remaining activity, having the amino acid substitutions Val27Glu and Tyr35Asn, was designated as FcR2, and the expression vector containing the polynucleotide coding for FcR2 was designated as pET-FcR2, The amino acid. sequence of FcR2 is of SEQ ID NO: 27, and the sequence of the polynucleotide coding for FcR2 is of SEC) ID NO: 28. In SEQ ID NO: 27, the region from methionine (Met) at position 1 to alanine (Ala) at position 26 is the MalE signal peptide, the region from lysine (Lys) at position. 27 to methionine (Met) at position 32 is the linker sequence, the region from caycine (Gly) at position 33 to glutamine (Gln) at position 208 is the amino acid sequence of FcR2 (corresponding to the region from position 17 to position 192 of SEQ ID NO: 1), the region of glycine (Gly) from position 209 to position 210 is the linker sequence, and the region of histidine (His) from position 211 to position 216 is the tag sequence. Also, in SEQ ID NO: 27, the glutamic acid of Val27Glu is at position 43, and the asparagine of Tyr35Asn is at position 51.
Example 4
Construction of Amino Acid-Substituted Fc-Binding Protein
(39) Even greater increased stability was attempted by accumulating amino acid substitutions related to increased thermal stability of Fc-binding protein as demonstrated in Example 3. The accumulation of substituted amino acids was accomplished mainly using PCR, and the 7 types of Fc-binding proteins described by (a) to (g) below were constructed. (a) FcR3 further having the amino acid substitution Phe75Leu in FcR2
(40) (b) FcR4 further having the amino acid. substtutions Phe75Leu and Glu121Gly in FcR2
(41) (c) FcR5a further having the amino acid substitution Asn92Ser in FcR4
(42) (d) FcR5b further having the amino acid substitution Glu54Asp in FcR4
(43) (e) FcR6a further having the amino acid substitution Glu54Asp in FcR5a
(44) (f) FcR6b further having the amino acid substitution Glu120Val in FcR5b
(45) (g) FcR7 further having the amino acid substitution Glu120Val in FcR6a
(46) The method for constructing each Fc-binding protein. will now be described in detail.
(47) (a) FcR3
(48) Val27Glu, Tyr35Asn and Phe75Leu were selected among the amino acid substitutions relating to increased thermal stability as demonstrated in Example 3, and FcR3 having these substitutions accumulated in the wild type Fc-binding protein was constructed. Specifically, FcR3 was constructed by mutagenesis in which Phe75Leu was introduced into the polynucleotide coding for FcR2.
(49) (a-1) PCR was conducted using the pET-FcR2 obtained in Example 3 as template. The primers used for the PCR were oligonucleotides having the sequences of SEQ ID NO: 24 and SEQ ID NO: 29 (5-AGCCAGGCGAGCAGCTACCTTATTGATGCG-3). The PCR was carried out by preparing a reaction mixture with the composition shown in Table 5, and then heat treating the reaction mixture at 98 C. for 5 minutes, carrying out 30 cycles of reaction where one cycle consisted of a first step at 98 C. for 10 seconds, a second step at 55 C. for 5 seconds and a third step at 72 C. for 1 minute, and finally conducting heat treatment at 72 C. for 7 minutes. The amplified PCR product was supplied to agarose gel electrophoresis and purified from the gel using a QIAquick Gel Extraction kit (product of Qiagen Inc.). The purified PCR product was designated as m3F.
(50) TABLE-US-00005 TABLE 5 Concentration/ Composition volume Template DNA 2 L 10 M Forward primer 1 L 10 M Reverse primer 1 L 5 Prime STAR buffer 4 L (Takara Bio, Inc.) 2.5 mM dNTPs 2 L 2.5 U/L Prime STAR HS 0.5 L (Takara Bio, Inc.) H.sub.2O Up to 20 L
(51) (a-2) This was conducted in the same manner as (a-1), using the pET-FcR2 obtained in Example 3 as template, and except that the PCR primers were oligonucleotides comprising the sequences of SEQ ID NO: 23 and SEQ ID NO: 30 (5T-CCACCGTCGCCGCATCAATAAGGTAGCTGC-3). The purified PCR product was designated as m3R.
(52) (a-3) The two PCR products obtained in (a-1) and (a-2) (m3F and m3R) were mixed to prepare a reaction mixture having the composition shown in Table 6. The reaction mixture was then heat treated at 98 C. for 5 minutes, and then PCR was conducted with 5 cycles of reaction where one cycle consisted of a first step at 98 C. for 10 seconds, a second step at 55 C. for 5 seconds and a third step at 72 C. for 1 minute, to obtain a PCR product m3p comprising m35 and m3R in linkage.
(53) TABLE-US-00006 TABLE 6 Concentration/ Composition volume PCR product Equimolar 2.5 U/L Prime STAR HS 0.5 L (Takara Bio, Inc.) 5 Prime STAR buffer 4 L (Takara Bio, Inc.) 2.5 mM dNTPs 2 L H.sub.2O Up to 20 L
(54) (a-4) The PCR product m3p obtained in (a-3) was used as template for PCR, using oligonucleotides comprising the sequences of SEQ ID NO: 23 and of SEQ ID NO: 24 as the PCR primers. The PCR was carried out by preparing a reaction mixture with the composition shown in Table 7, and then heat treating the reaction mixture at 98 C. for 5 minutes, and conducting 30 cycles of reaction, where one cycle consisted of a first step at 98 C. for 10 seconds, a second step at 55 C. for 5 seconds and a third step at 72 C. for 1 minute. Thus was constructed a polynucleotide coding for EcR3 having one amino acid substitution introduced, into FcR2.
(55) TABLE-US-00007 TABLE 7 Concentration/ Composition volume PCR product 2 L 10 M Forward primer 2 L 10 M Reverse primer 2 L 5 Prime STAR buffer 10 L (Takara Bio, Inc.) 2.5 mM dNTPs 4 L 2.5 U/L Prime STAR HS 1 L (Takara Bio, Inc.) H.sub.2O Up to 50 L
(56) (a-5) The polynucleotide obtained in (a-4) was purified and then digested with restriction enzymes NcoI and HindIII and ligated with the expression vector pETMalE previously digested with restriction enzymes NcoI and HindIII (Japanese Unexamined Patent Publication No. 2011-206046), and the ligation product was used for transformation of E. coli B121 (DE3).
(57) (a-6) The obtained transformants were cultured on LB medium containing 50 g/mL kanamycin. By extracting the plasmids from the recovered cells (transformants), there was obtained plasmid pET-FcR3 containing a polynucleotide coding for FcR3, which was a polypeptide with amino acid substitutions at 3 locations of the wild type Fc-binding protein.
(58) (a-7) Analysis of the nucleotide sequence of pET-FcR3 was conducted by the same method as Example 1 (5).
(59) The amino acid sequence of FcR3 with the signal sequence and polyhistidine tag added is of SEQ ID NO: 31, and the sequence of the polynucleotide coding for FcR3 is of SEQ ID NO: 32. In SEQ ID NO: 31, the region from methionine (Met) at position 1 to alanine (Ala) at position 26 is the MalE signal peptide, the region from lysine (Lys) at position 27 to methionine (Met) at position 32 is the linker sequence, the region from glycine (Gly) at position 33 to glutamine (Gln) at position 208 is the amino acid sequence of FcR3 (corresponding to the region from position 17 to position 192 of SEQ ID NO: 1), the region of glycine (Gly) from position 209 to position. 210 is the linker sequence, and the region of histidine (His) from position 211 to position 216 is the tag sequence. Also, in SEQ ID NO: 31, the glutamic acid of Val27Glu is at position 43, the asparagine of Tyr35Asn is at position 51, and the leucine of Phe75Leu is at position 91.
(60) (b) FcR4
(61) Val27Glu, Tyr35Asn, Phe75Leu and Glu121Gly were selected among the amino acid substitutions relating to increased stability of Fc-binding protein as demonstrated in Example 3, and FcR4 having these substitutions accumulated in the wild type Fc-binding protein was constructed. Specifically, FcR4 was constructed by mutagenesis in which Phe75Leu and Glu121Gly were introduced into the polynucleotide coding for FcR2.
(62) (b-1) The PCR product m3F was obtained by the same method as (a-1). Also, a plasmid expressing Fc-binding protein including the amino acid substitutions Ala71Asp, Phe75Leu and Glu121Gly, obtained in Example 3 (Table 4) was used as template and oligonucleotides comprising the sequences of SEQ ID NO: 24 and SEQ ID NO: 29 were used as PCR primers, for PCR by the same method as in (a-1), to obtain PCR product m4R.
(63) (b-2) After mixing the two PCR products obtained in (b-1) (m3F and m4R), PCR was conducted in the same manner as (a-3), and m3F and m4R were linked. The obtained PCR product was designated as m4p.
(64) (b-3) The PCR product m4p obtained in (b-2) was used as template, and oligonucleotides comprising the sequences of SEQ ID NO: 23 and SEQ ID NO: 2-1 were used as PCR primers, for PCR by the same method as (a-4). Thus was constructed a polynucleotide coding for FcR4.
(65) (b-4) The polynucleotide obtained in (b-3) was purified and then digested with restriction enzymes NcoI and HindIII and ligated with the expression vector pETMalE that had been previously digested with restriction enzymes NcoI and HindIII (Japanese Unexamined Patent Publication No. 2011-206046), and the ligation product was used for transformation of E. coli BL21 (DE3).
(66) (b-5) The obtained transformants were cultured on LB medium containing 50 g/mL kanamycin. By extracting the plasmids from the recovered cells (transformants), there was obtained plasmid pET-FcR4 containing a polynucleotide coding for FcR4, which was a polypeptide with amino acid substitutions at 4 locations of the wild type Fc-binding protein.
(67) (b-6) Analysis of the nucleotide sequence of pET-FcR4 was conducted by the same method as Example 1 (5).
(68) The amino acid sequence of FcR4 with the signal sequence and polyhistidine tag added is of SEQ ID NO: 33, and the sequence of the polynucleotide coding for FcR4 is of SEQ. ID NO: 34. In SEQ ID NO: 33, the region from methionine (Met) at position 1 to alanine (Ala) at position 26 is the MalE signal peptide, the region from lysine (Lys) at position 27 to methionine (Met) at position 32 is the linker sequence, the region from glycine (Gly) at position 33 to glutamine (Gln) at position 208 is the amino acid sequence of FcR4 (corresponding to the region from position 17 to position 192 of SEQ ID NO: 1), the region of glycine (Gly) from position 209 to position. 210 is the linker sequence, and the region of histidine (His) from position. 211 to position 216 is the tag sequence. Also, in SEQ ID NO: 33, the glutamic acid of Val27Glu is at position 43, the asparagine of Tyr35Asn is at position 51, the leucine of Phe75Leu is at position 91 and the glycine of Glu121Gly is at position 137.
(69) (c) FcR5a
(70) Val27Glu, Tyr35Asn, Phe75Leu, Asn92Ser and Glu121Gly were selected among the amino acid substitutions relating to increased stability of Fc-binding protein as demonstrated in Example 3, and FcR5a having these substitutions accumulated in the wild type Fc-binding protein was constructed. Specifically, FcR5a was constructed by mutagenesis in which Asn92Ser was introduced into the polynucleotide coding for FcR4 constructed in (b).
(71) (c-1) PCR was conducted by the same method as (a-1), except that pET-FcR4 constructed in (b) was used as template and oligonucleotides comprising the sequences of SEQ ID NO: 22 and SEQ. ID NO: 35 (5-GAATATCGTTGCCAGACCAGCCTGAGCACC-3) were used as PCR primers. The purified. PCR product was designated as m5aF.
(72) (c-2) PCR was conducted by the same method as (a-1), except that pET-FcR4 constructed in (b) was used as template and oligonucleotides comprising the sequences of SEQ ID NO: 21 and SEQ ID NO: 36 (5-GATCGCTCAGGGIGCTCAGGCTGGTCTGGC-3 were used as PCR primers. The purified PCR product was designated as m5aR.
(73) (c-3) After mixing the two PCR products obtained in (c-1) and (c-2) (m5aF and m5aR), PCR was conducted in the same manner as (a-3), and m5aF and m5aR were linked. The obtained PCR product was designated as m5ap.
(74) (c-4) The PCR product m5ap obtained in (c-3) was used as template, and oligonucleotides comprising the sequences of SEQ ID NO: 21 and of SEQ ID NO: 22 were used as PCR primers, for PCR by the same method as (a-4). Thus was constructed a polynucleotide coding for FcR5a.
(75) (c-5) The polynucleotide obtained in (c-4) was purified and then digested with restriction enzymes NcoI and HindIII and ligated with the expression vector pETMalE that had been previously digested with restriction enzymes NcoI and HindIII (Japanese Unexamined Patent Publication No. 2011-206046), and the ligation product was used for transformation of E. coli B121 (DE3).
(76) (c-6) The obtained transformants were cultured on LB medium containing 50 g/mL kanamycin. By extracting the plasmids from the recovered cells (transformants), there was obtained plasmid pET-FcR5a containing a polynucleotide coding for FcR5a, which was a polypeptide with amino acid substitutions at 5 locations of the wild type Fc-binding protein.
(77) (c-7) Analysis of the nucleotide sequence of pET-FcR5a was conducted by the same method as Example 1 (5).
(78) The amino acid sequence of FcR5a with the signal sequence and polyhistidine tag added is of SEQ ID NO: 37, and the sequence of the polynucleotide coding for FcR5a is of SEQ ID NO: 38. In SEQ ID NO: 37, the region from methionine (Met) at position 1 to alanine (Ala) at position 26 is the MalE signal peptide, the region from lysine (Lys) at position 27 to methionine (Met) at position 32 is the linker sequence, the region from glycine (Gly) at position 33 to glutamine (Gln) at position 208 is the amino acid sequence of FcR5a (corresponding to the region from position 17 to position 192 of SEQ ID NO: 1), the region of glycine (Gly) from position 209 to position 210 is the linker sequence, and the region of histidine (His) from position 211 to position 216 is the tag sequence. Also, in SEQ ID NO: 37, the glutamic acid of Val27Glu is at position 43, the asparagine or Tyr35Asn is at position 51, the leucine of Phe75Leu is at position 91, the serine of Asn92Ser is at position 108 and the glycine of Glu121Gly is at position 137.
(79) (d) FcR5b
(80) Val27Glu, Tyr35Asn, Glu54Asp, Phe75Leu and Glu121Gly were selected among the amino acid substitutions relating to increased stability of Fc-binding protein as demonstrated in Example 3, and FcR5b having these substitutions accumulated in the wild type Fc-binding protein was constructed. Specifically, FcR5b was constructed by mutagenesis in which Glu54Asp was introduced into the polynucleotide coding for FcR4 constructed in (b).
(81) (d-1) PCR was conducted by the same method as (a-1), except that pET-FcR4 constructed in (b) was used as template and oligonucleotides comprising the sequences of SEQ ID NO: 22 and SEQ. ID NO: 39 (5-CAGGGCGCGTATAGCCCGGATGATAACAGC-3) were used as PCR primers. The purified. PCR product was designated as m5bF.
(82) (d-2) PCR was conducted by the same method as (a-1), except that pET-FcR4 constructed in (b) was used as template and oligonucleotides comprising the sequences of SEQ ID NO: 21 and SEQ ID NO: 40 (5-CACTGGGTGCTGITATCATCCGGGCTATAC-3) were used as PCR primers. The purified PCR product was designated as m5bR.
(83) (d-3) After mixing the two PCR products obtained in (d-1) and (d-2) (m5bF and m5bR), PCR was conducted in the same manner as (a-3), and m5bF and m5bR were linked. The obtained PCR product was designated as m5bp.
(84) (d-4) The PCR product m5bp obtained in (d-3) was used as template, and oligonucleotides comprising the sequences of SEQ ID NO: 21 and of SEQ ID NO: 22 were used as 5CR primers, for 5CR by the same method as (a-4). Thus was constructed a polynucleotide coding for FcR5b.
(85) (d-5) The polynucleotide obtained in (d-4) was purified and then digested with restriction enzymes NcoI and HindIII and ligated with the expression vector pETMalE previously digested with restriction enzymes NcoI and HindIII (Japanese Unexamined Patent Publication No. 2011-206046), and the ligation product was used for transformation of E. coli BL21 (DE3).
(86) (d-6) The obtained transformants were cultured on LB medium containing 50 g/mL kanamycin. By extracting the plasmids from the recovered cells (transformants), there was obtained plasmid pET-FcR5b containing a polynucleotide coding for FcR5b, which was a polypeptide with amino acid substitutions at 5 locations of the wild type Fc-binding protein.
(87) (d-7) Analysis of the nucleotide sequence of pET-FcR5b was conducted by the same method as Example 1 (5).
(88) The amino acid sequence of FcR5b with the signal sequence and polyhistidine tag added is shown as SEQ ID NO: 41, and the sequence of the polynucleotide coding for FcR5b is shown as SEQ ID NO: 42. In SEC) ID NO: 41, the region from methionine (Met) at position 1 to alanine (Ala) at position 26 is the MalE signal peptide, the region from lysine (Lys) at position 27 to methionine (met) at position 32 is the linker sequence, the region from glycine (Gly) at position 33 to glutamine (Gln) at position 208 is the amino acid sequence of FcR5b (corresponding to the region from position 17 to position 192 of SEQ ID NO: 1), the region of glycine (Gly) from position 209 to position 210 is the linker sequence, and the region of histidine (His) from position 211 to position 216 is the tag sequence. Also, in SEQ ID NO 41, the glutamic acid of Val27Glu is at position 43, the asparagine of Tyr35Asn is at position 51, the aspartic acid of Glu54Asp is at position 70, the leucine of Phe75Leu is at position 91 and the glycine of Glu121Gly is at position 137.
(89) (e) FcR6a.
(90) Val27Glu, Tyr35Asn, Glu54Asp, Phe75Leu, Asn92Ser and Glu121Gly were selected among the amino acid substitutions relating to increased stability of Fc-binding protein as demonstrated in Example 3, and FcR6a having these substitutions accumulated in the wild type Fc-binding protein was constructed. Specifically, FcR6a was constructed by mutagenesis in which Glu54Asp was introduced into the polynucleotide coding for FcR5a constructed in (c).
(91) (e-1) PCR was conducted by the same method as (a-1), except that pET-FcR5a constructed in (c) was used as template and oligonucleotides comprising the sequences of SEQ ID NO: 22 and SEQ ID NO: 39 were used as PCR primers. The purified PCR product was designated as m6aF.
(92) (e-2) PCR was conducted by the same method as (a-1), except that pET-FcR4 constructed in (b) was used as template and oligonucleotides comprising the sequences of SEQ ID NO: 21 and SEQ ID NO: 40 were used as PCR primers. The purified PCR product was designated as m6aR.
(93) (e-3) After mixing the two PCR products obtained in (e-1) and (e-2) (m6aF and m6aR), PCR was conducted in the same manner as (a-3), and m6aF and m6aR were linked. The obtained PCR product was designated as m6ap.
(94) (e-4) The PCR product m6ap obtained in (e-3) was used as template, and oligonucleotides comprising the sequences of SEQ ID NO: 21 and of SEQ ID NO: 22 were used as PCR primers, for PCR by the same method as (a-4) Thus was constructed a polynucleotide coding for FcR6a.
(95) (e-5) The polynucleotide obtained in (e-4) was purified and then digested with restriction enzymes NcoI and HindIII and ligated with the expression vector pETMalE previously digested with restriction enzymes NcoI and HindIII (Japanese Unexamined Patent Publication No. 2011-206046), and the ligation product was used for transformation of E. coli BL21 (DE3).
(96) (e-6) The obtained transformants were cultured on LB medium containing 50 g/mL kanamycin. By extracting the plasmids from the recovered cells (transformants), there was obtained plasmid pET-FcR6a containing a polynucleotide coding for FcR6a, which was a polypeptide with amino acid substitutions at 6 locations of the wild type Fc-binding protein.
(97) (e-7) Analysis of the nucleotide sequence of pET-FcR6a was conducted by the same method as Example 1 (5).
(98) The amino acid sequence of FcR6a with the signal sequence and polyhistidine tag added is of SEQ ID NO: 43, and the sequence of the polynucleotide coding for FcR6a is of SEQ ID NO: 44. In SEQ ID NO: 43, the region from methionine (Met) at position 1 to alanine (Ala) at position 26 is the MalE signal peptide, the region from lysine (Lys) at position 27 to methionine (Met) at position 32 is the linker sequence, the region from glycine (Gly) at position 33 to glutamine (Gin) at position 208 is the amino acid sequence of FcR6a (corresponding to the region from position 17 to position 192 of SEQ ID NO: 1), the region of glycine (Gly) from position 209 to position 210 is the linker sequence, and the region of histidine (His) from position 211 to position 216 is the tag sequence. Also, in SEQ ID NO: 43, the glutamic acid of Val27Glu is at position 43, the asparagine of Tyr35Asn is at position 51, the aspartic acid of Glu54Asp is at position 70, the leucine of Phe75Leu is at position 91, the serine of Asn92Ser is at position 108 and the glycine of Glu121Gly is at position 137.
(99) (f) FcR6b
(100) Val27Glu, Tyr35Asn, Glu54Asp, Phe75Leu, Glu120Val and Glu121Gly were selected among the amino acid substitutions relating to increased stability of Fc-binding protein as demonstrated in Example 3, and FcR6b having these substitutions accumulated in the wild type Fc-binding protein was constructed. Specifically, FcR6b was constructed by mutagenesis in which Glu120Val was introduced into the polynucleotide coding for FcR5b constructed in (d).
(101) (f-1) PCR was conducted by the same method as (a-1), except that pET-FcR5b constructed in (d) was used as template and oligonucleotides comprising the sequences of SEQ ID NO: 22 and SEQ ID NO: 45 (5-GTGTTCAAAGTGGGGGATCCGATTCATCTG-3) were used as PCR primers. The purified PCR product was designated as m6bF.
(102) (f-2) PCR was conducted by the same method as (a-1), except that pET-FcR5b constructed in (d) was used as template and oligonucleotides comprising the sequences of SEQ ID NO: 21 and SEQ ID NO: 46 (5-AATCGGATCCCCCACTTTGAACACCCACCG-3) were used as PCR primers. The purified. PCR product was designated as m6bR.
(103) (f-3) After mixing the two PCR products obtained in (f-1) and (f-2) (m6bF and m6bR), PCR was conducted in the same manner as (a-3), and m6bF and m6bR were linked. The obtained PCR product was designated as m6bp.
(104) (f-4) PCR was conducted by the same method as (a-4), except that the PCR product m6bp obtained in (f-3) was used as template, and oligonucleotides comprising the sequences of SEQ ID NO: 21 and of SEQ ID NO: 22 were used as PCR primers. Thus was constructed a polynucleotide coding for FcR6b.
(105) (f-5) The polynucleotide obtained in (f-4) was purified and then digested with restriction enzymes NcoI and HindIII and ligated with the expression vector pETMalE that had been previously digested with restriction enzymes NcoI and HindIII (Japanese Unexamined Patent Publication No. 2011-206046), and the ligation product was used for transformation of E. coli B121 (DE3).
(106) (f-6) The obtained transformants were cultured on LB medium containing 50 g/mL kanamycin. By extracting the plasmids from the recovered cells (transformants), there was obtained plasmid pET-FcR6b containing a polynucleotide coding for FcR6b, which was a polypeptide with amino acid substitutions at 6 locations of the wild type Fc-binding protein.
(107) (f-7) Analysis of the nucleotide sequence of pET-FcR6b was conducted by the same method as Example 1 (5).
(108) The amino acid sequence of FcR6b with the signal sequence and polyhistidine tag added is of SEQ ID NO: 47, and the sequence of the polynucleotide coding for FcR6b is of SEQ ID NO: 48. In SEQ ID NO: 47, the region from methionine (Met) at position 1 to alanine (Ala) at position 26 is the MalE signal peptide, the region from lysine (Lys) at position 27 to methionine (Met) at position 32 is the linker sequence, the region from glycine (Gly) at position 33 to glutamine (Gln) at position 208 is the amino acid sequence of FcR6b (corresponding to the region from position 17 to position 192 of SEQ ID NO: 1), the region of glycine (Gly) from position 209 to position 210 is the linker sequence, and the region of histidine (His) from position 211 to position 216 is the tag sequence. Also, in SEQ ID NO: 47, the glutamic acid of Val27Glu is at position 43, the asparagine of Tyr35Asn is at position 51, the aspartic acid of Glu54Asp is at position 70, the leucine of Phe75Leu is at position 91, the valine of Glu120Val is at position 136 and the glycine of Glu121Gly is at position 137.
(109) (g) FcR7
(110) Val27Glu, Tyr35Asn, Glu54Asp, Phe75Leu, Asn92Ser, Glu120Val and Glu121Gly were selected among the amino acid substitutions relating to increased stability of Fc-binding protein as demonstrated in Example 3, and FcR7 having these substitutions accumulated in the wild type Fc-binding protein was constructed. Specifically, FcR7 was constructed by mutagenesis in which Glu120Val was introduced into the polynucleotide coding for FcR6a constructed in (e.).
(111) (g-1) PCR was conducted by the same method as (a-1), except that pET-FcR6a constructed in (e) was used as template and oligonucleotides comprising the sequences of SEQ ID NO: 22 and SEQ ID NO: 45 were used as PCR primers. The purified PCR product was designated as m7F,
(112) (g-2) PCR was conducted by the same method as (a-1), except that pET-FcR6a constructed in (e) was used as template and oligonucleotides comprising the sequences of SEQ ID NO: 21 and SEQ ID NO: 46 were used as PCR primers. The purified PCR product was designated as m7R,
(113) (g-3) After mixing the two PCR products obtained in (g-1) and (g-2) (m7F and m7R), PCR was conducted in the same manner as (a-3), and m7F and m7R were linked. The obtained PCR product was designated as m7p.
(114) (g-4) PCR was conducted in the same manner as (a-4), except that the PCR product m7p obtained in (g-3) was used as template, and oligonucleotides comprising the sequences of SEQ ID NO: 21 and of SEQ ID NO: 22 were used as PCR primers. Thus was constructed a polynucleotide coding for FcR7.
(115) (g-5) The polynucleotide obtained in (g-4) was purified and then digested with restriction enzymes NcoI and HindIII and ligated with the expression vector pETMalE that had been previously digested with restriction enzymes NcoI and HindIII (Japanese Unexamined Patent Publication No. 2011-206046), and the ligation product was used for transformation of E. coli BL21 (DE3).
(116) (g-6) The obtained transformants were cultured on LB medium containing 50 g/mL kanamycin. By extracting the plasmids from the recovered cells (transformants), there was obtained plasmid pET-FcR7 containing a polynucleotide coding for FcR7, which was a polypeptide with amino acid substitutions at 7 locations of the wild type Fc-binding protein.
(117) (g-7) Analysis of the nucleotide sequence of pET-FcR7 was conducted by the same method as Example 1 (5).
(118) The amino acid sequence of FcR7 with the signal sequence and polyhistidine tag added is of SEQ ID NO: 49, and the sequence of the polynucleotide coding for FcR7 is of SEQ ID NO: 50, In SEQ ID NO: 49, the region from methionine (Met) at position 1 to alanine (Ala) at position 26 is the MalE signal peptide, the region from lysine (Lys) at position 27 to methionine (Met) at position 32 is the linker sequence, the region from glycine (Gly) at position 33 to glutamine (Gln) at position 208 is the amino acid sequence of FcR7 (corresponding to the region from position 17 to position 192 of SEQ ID NO: 1), the region of glycine (Gly) from position 209 to position. 210 is the linker sequence, and the region of histidine (His) from position 211 to position 216 is the tag sequence. Also, in SEQ ID NO: 49, the glutamic acid of Val27Glu is at position 43, the asparagine of Tyr35Asn is at position 51, the aspartic acid of Glu54Asp is at position 70, the leucine of Phe75Leu is at position 91, the serine of Asn92Ser is at position 108, the valine of Glu120Val is at position 136, and the glycine of Glu121Gly is at position 137.
Example 5
Evaluation of Thermal Stability of Modified Fc-Binding Proteins
(119) (1) Transformants expressing the wild type Fc-binding protein prepared in Example 1, the variant Fc-binding protein selected in Example 3 (FcR2) and the variant Fc-binding proteins prepared in Example 4 (FcR3, FcR4, FcR5a, FcR5b, FcR6a, FcR6b and FcR7) were each inoculated onto 3 ml of 2YT liquid medium containing 50 g/mL kanamycin, and aerobically shake cultured overnight at 37 C. as preculturing.
(120) (2) This preculture solution was inoculated at 200 L, into 20 mL of 2YT liquid medium (16 g/L peptone, 10 g/L yeast extract and 5 g/L sodium chloride) containing 50 g/mL kanamycin, and aerobically shake cultured at 37 C.
(121) (3) At 1.5 hours after the start of culturing, the culturing temperature was lowered to 20 C. and shake culturing was continued for 30 minutes. Next, IPTG was added to a final concentration of 0.01 mM, and aerobic shake culturing was continued overnight at 20 C.
(122) (4) Upon completion of culturing, the cells were collected by centrifugal separation and a BugBuster Protein extraction kit (product of Takara Bio, Inc.) was used to prepare a protein extract.
(123) (5) The antibody binding activity of the wild type Fc-binding protein and the variant Fc-binding protein in the protein extract prepared in (4) was measured by ELISA, according to Example 3 (4). A calibration curve was plotted using the extracellular domain of commercially available FcRIIIa (4325-FC-050, by R&D Systems), and the concentration was measured.
(124) (6) Diluton was performed with 20 mM Tris buffer (pH 7.4) containing 150 mM sodium chloride, to a concentration of 5 g/mL for each protein. This was divided into aliquots, one of which was heat treated at 45 C. for 10 minutes using a thermal cycler (product of Eppendorf AG), and the other of which was not heat treated. The antibody binding activity of the heat-treated or non-heat-treated protein was measured by ELISA according to Example 3 (4), and the remaining activity was calculated by dividing the antibody binding activity when heat treatment was carried out by the antibody binding activity when no heat treatment was carried out.
(125) The results are shown in Table 8. The variant Fc-binding proteins evaluated here (FcR2, FcR3, FcR4, FcR5a, FcR5b, FcR6a, FcR6b and FcR7) had higher remaining activity than the wild type Fc-binding protein, confirming that the thermal stability was increased with the variant Fc-binding proteins.
(126) TABLE-US-00008 TABLE 8 Remaining Fc binding protein activity Designation SEQ ID NO: (%) Example 3 FcR2 27 37.8 Example 4 (a) FcR3 31 51.2 Example 4 (b) FcR4 33 88.1 Example 4 (c) FcR5a 37 95.7 Example 4 (d) FcR5b 41 93.5 Example 4 (e) FcR6a 43 94.1 Example 4 (f) FcR6b 47 93.6 Example 4 (g) FcR7 49 95.1 Example 1 Wild type 25 27.7
Example 6
Evaluation of Acid Stability of Modified Fc-Binding Proteins
(127) (1) Modified Fc-binding proteins were prepared by the same method as Example 5 (1) to (5).
(128) (2) Dilution was performed with 20 mM Tris buffer (pH 7.4) containing 150 mM sodium chloride, to a concentration of 30 g/mL for each protein. After mixing 60 L of each diluted Fc-binding protein and 120 L of 0.1 M glycine hydrochloride buffer (pH 3.0), the mixture was allowed to stand at 30 C. for 2 hours.
(129) (3) The antibody binding activity of the protein after acid treatment with glycine hydrochloride buffer (pH 3.0) and the antibody binding activity of the protein without acid treatment were measured by the ELISA method described in Example 3 (4). Next, the antibody binding activity with acid treatment was divided by the antibody binding activity without acid treatment, to calculate the residual activity.
(130) The results are shown in Table 9. The variant Fc-binding proteins evaluated here (FcR2, FcR3, FcR4, FcR5a, FcR5b, FcR6a, FcR6b and FcR7) had higher residual activity than the wild type Fc-binding protein, confirming that the acid stability was increased with the variant Fc-binding proteins.
(131) TABLE-US-00009 TABLE 9 Residual Fc binding protein activity Designation SEQ ID NO: (%) Example 3 FcR2 27 27.2 Example 4 (a) FcR3 31 57.1 Example 4 (b) FcR4 33 76.4 Example 4 (c) FcR5a 37 85.9 Example 4 (d) FcR5b 41 71.4 Example 4 (e) FcR6a 43 89.8 Example 4 (f) FcR6b 47 76.4 Example 4 (g) FcR7 49 84.6 Example 1 Wild type 25 14.5
Example 7
Construction of Fc-Binding Protein with One Amino Acid Substitution
(132) Among the amino acid substitutions associated with increased stability of Fc-binding protein as demonstrated in Example 3, Fc-binding proteins having valine (Val) at position 27, tyrosine (Tyr) at position 35 and glutamic acid (Glu) at position 121 of SEQ ID NO: 1 substituted with other amino acids were constructed by the following methods. (A) Construction of Fc-binding protein with valine (Val) at position 27 of SEQ ID NO: 1 substituted with other amino acids.
(133) (A-1) PCR was conducted by the same method as Example 4 (a-1), except that the pET-eFcR constructed in Example 1 was used as template and oligonucleotides comprising the sequences of SEQ ID NO: 24 and SEQ ID NO: 51 (5-CTGCCGAAAGCGNNKGIGTTTCTGGAACCG-3) were used as PCR primers. The purified. PCR product was designated as 27 pF.
(134) (A-2) PCR was conducted by the same method as Example 4 (a-1), except that the pET-eFcR constructed in Example 1 was used as template and oligonucleotides comprising the sequences of SEQ ID NO: 23 and SEQ ID NO: 52 (5-TTCCAGAAACACMNNCGCTTTCGGCAGATC-3) were used as PCR primers. The purified. PCR product was designated as 27p R.
(135) (A-3) After mixing the two PCR products obtained in (A-1) and (A-2) (27pF and 27pR), PCR was conducted in the same manner as Example 4 (a-3), and 27pF and 27pR were linked. The obtained PCR product was designated as 27p.
(136) (A-4) PCR was conducted by the same method as Example 4 (a-4), except that the PCR product 27p obtained in (A-3) was used as template, and oligonucleotides comprising the sequences of SEQ ID NO: 23 and SEQ ID NO: 24 were used as PCR primers. Thus were constructed polynucleotides coding for Fc-binding proteins having valine at position 27 of SEQ ID NO: 1 substituted with different amino acids.
(137) (A-5) The polynucleotide obtained in (A-4) was purified and then digested with restriction enzymes NcoI and HindIII and ligated with the expression vector pETMalE that had been previously digested with restriction enzymes NcoI and HindIII (Japanese Unexamined Patent Publication No. 2011-206046), and the ligation product was used for transformation of E. coli BL21 (DE3).
(138) (A-6) The obtained transformants were cultured on LB medium containing 50 g/mL kanamycin. The plasmids were extracted from the harvested cells (transformants), and the nucleotide sequences were analyzed by the same method as Example 1 (5).
(139) As a result, there were obtained polynucleotides coding for Fc-binding proteins having the amino acid substitutions Val27Gly (V27G), Val27Lvs (V27K), Val27Thr Val27Ala (V27A), Val27Trp (V27W) and Val27Arg W27R). (B) Construction of Fc-binding protein with tyrosine (Tyr) at position 35 of SEQ ID NO: 1 substituted with other amino acids.
(140) (B-1) PCR was conducted by the same method as Example 4 (a-1), except that the pET-eFcR constructed in Example 1 was used as template and oligonucleotides comprising the sequences of SEQ ID NO: 24 and SEQ ID NO:53 (5-AACCGCAGTGGNNKCGCGTGCTGGAGAAAG-3) were used as PCR primers. The purified PCR product was designated as 35 pF.
(141) (B-2) PCR was conducted by the same method as Example 4 (a-1), except that the pET-eFcR constructed in Example 1 was used as template and oligonucleotides comprising the sequences of SEQ ID NO: 23 and SEQ ID NO: 54 (5-AGCACGCGMNNCCACTGCGGTTCCAGAAAC-3) were used as PCR primers. The purified. PCR product was designated as 35pR.
(142) (B-3) After mixing the two PCR products obtained in (B-1) and (B-2) (35pF and 35pR), PCR was conducted in the same manner as Example 4 (a-3), and 35pF and 35pR were linked. The obtained PCR product was designated as 35p.
(143) (B-4) PCR was conducted by the same method as Example 4 (a-4), except that the PCR product 35p obtained in (B-3) was used as template, and oligonucleotides comprising the sequences of SEQ ID NO: 23 and SEQ ID NO: 24 were used as PCR primers. Thus were constructed polynucleotides coding for Fc-binding proteins having tyrosine at position 35 of SEQ ID NO: 1 substituted with different amino acids.
(144) (B-5) The polynucleotide obtained in (B-4) was purified and then digested with restriction enzymes NcoI and HindIII and ligated with the expression vector pETMalE previously digested with restriction enzymes NcoI and HindIII (Japanese Unexamined Patent Publication No. 2011-206046), and the ligation product was used for transformation of E. coli BL21 (DE3).
(145) (B-6) The obtained transformants were cultured on LB medium containing 50 g/mL kanamycin. The plasmids were extracted from the harvested cells (transformants), and the nucleotide sequences were analyzed by the same method as Example 1 (5).
(146) As a result there were obtained polynucleotides coding for Fc-binding proteins having the amino acid substitutions Tyr35Cys (Y35C), Tyr35Asp (Y35D), Tyr35Phe (Y35F), Tyr35Gly (Y35G), Tyr35Lys (Y35K), Tyr35Leu (Y35 L), Tyr35Asn (Y35N), Tyr35Pro (Y35P), Tyr35Arg (Y35R), Tr35Ser (Y35S), Tyr35Thr (Y35T), Tyr35Val (Y35V) and Tyr35Trp (35W). (C) Construction of Fc-binding protein with glutamic acid (Glu) at position 121 of SEQ ID NO: 1 substituted with other amino acids.
(147) (C-1) PCR was conducted by the same method as Example 4 (a-1), except that pET-eFcR constructed in Example 1 was used as template and oligonucleotides comprising the sequences of SEQ ID NO: 24 and SEQ ID NO: 5 (5-GTGITCAAAGAGNNKGATCCGATTCATCTG-3) were used as PCR primers. The purified. PCR product was designated as 121pF.
(148) PCR was conducted by the same method as Example 4 (a-1), except that pET-eFcR constructed in Example 1 was used as template and oligonucleotides comprising the sequences of SEQ ID NO: 23 and SEQ ID NO: 56 (5-AATCGGATCMNNCTCTTTGAACACCCACCG-3) were used as PCR primers. The purified. PCR product was designated as 121pR.
(149) (C-3) After mixing the two PCR products obtained in (C-1) and (C-2) (121pF and 121pR), PCR was conducted in the same manner as Example 4 (a-3), and 121pF and 121pR were linked. The obtained PCR product was designated as 121p.
(150) (C-4) PCR was conducted by the same method as Example 4 (a-4), except that the PCR product 121p obtained in (C-3) was used as template, and oligonucleotides comprising the sequences of SEQ ID NO: 23 and SEQ ID NO: 24 were used as PCR primers. Thus were constructed polynucleotides coding for Fc-binding proteins having glutamic acid at position 121 of SEQ ID NO: 1 substituted with different amino acids, (C-5) The polynucleotide obtained in (C-4) was purified and then digested with restriction enzymes NcoI and HindIII and ligated with the expression vector pETMalE that had been digested with restriction enzymes NcoI and HindIII (Japanese Unexamined Patent Publication No. 2011-206046), and the ligation product was used for transformation of E. coli BL21 (DE3).
(151) (C-6) The obtained transformants were cultured on LB medium containing 50 g/mL kanamycin. The plasmids were extracted from the harvested cells (transformants), and the nucleotide sequences were analyzed by the same method as Example 1 (5).
(152) As a result there were obtained polynucleotides coding for Fc-binding proteins having the amino acid substitutions Glu121Lys (E121K), Glu121Pro (E121P), Glu121Arg (E121R), Glu121Gly (E121G), Glu121His (E121H) and Glu121Val (E121V).
Example 8
Evaluation of Antibody Binding Activities of Fc-Binding Proteins with 1 Amino Acid Substitution
(153) (1) Transformants expressing the wild type Fc-binding protein constructed in Example 1 and the Fc-binding proteins with amino acid substitutions at one location constructed in Example 7, were each cultured by the same method described in Example 3 (1) and (2), and the wild type Fc-binding protein and the Fc-binding proteins with 1 amino acid substitution were expressed.
(154) (2) The antibody-binding activity of the expressed Fc-binding proteins with 1 amino acid substitution was examined by the ELISA method described in Example 3 (4).
(155) The results are shown in
(156) Substitution of tyrosine at position 35 of SEQ ID NO: 1 with aspartic acid (Y35D), phenylalanine (Y35F), glycine (Y3SG), lysine (Y35K), leucine (Y35L), asparagine (Y35N), proline (Y35P), serine (Y35S), threonine (Y35T), valine (Y35V) or tryptophan (Y35W) resulted in increased antibody binding activity compared to the wild type Fc-binding protein. Among these, Y35D, Y35G, Y35K, Y35L, Y35N, Y358, Y35S, Y35T and Y35W had greatly increased antibody binding activity compared to the wild type Fc-binding protein. On the other hand, substitution of tyrosine at position 35 of SEQ ID NO: 1 with cysteine (Y35C) or arginine (Y35R) resulted in approximately equal antibody binding activity to the wild type Fc-binding protein.
(157) Substitution of glutamic acid at position 121 of SEQ ID NO: 1 with lysine (E121K), arginine (E121R), glycine (E121G) or histidine (E121H) resulted in increased antibody binding activity compared to the wild type Fc-binding protein. Among these, E121G had greatly increased antibody binding activity compared to the wild type Fc-binding protein. On the other hand, when glutamic acid at position 121 of SEQ ID NO: 1 was substituted with valine (E121V), the antibody binding activity was approximately equal to that of the wild type Fc-binding protein, and when substituted with proline (E121P), the antibody binding activity was reduced compared to the wild type Fc-binding protein.
Example 9
Evaluation of Thermal Stability of Fc-Binding Proteins with 1 Amino Acid Substitution
(158) In order to compare the thermal stabilities of the Fc-binding proteins with 1 amino acid substitution that were evaluated in Example 8, heat treatment was carried out by the same method as Example 3 (3) (45 C., 10 minutes), and the remaining activity was calculated.
(159) The results are shown in
Example 10
Large-Volume Preparation of FcR5a
(160) (1) Transformants expressing the FcR5a constructed in Example 4 (c) were inoculated into 400 ml of 2YT liquid medium (16 g/L peptone, 10 g/L yeast extract and 5 g/L sodium chloride) containing 50 g/mL kanamycin in a 2 L baffle flask, and aerobically shake cultured overnight at 37 C., as preculturing.
(161) (2) After inoculating 180 ml of the culture solution of (1) into 1.8 L of liquid medium containing 10 g/L glucose, 20 g/L yeast extract, 3 g/L trisodium phosphate dodecahydrate, 9 g/L disodium hydrogen phosphate dodecahydrate, 1 g/L ammonium chloride and 50 mg/L kanamycin sulfate, a 3 L fermenter (product of Baiotto) was used for main culturing. The conditions were set to a temperature of 30 C., a pH of 6.9 to 7.1, an aeration rate of 1 VVM and a dissolved oxygen concentration at 30% saturated concentration, and main culturing was commenced. For pH regulation, 50% phosphoric acid was used as the acid and 14% ammonia water was used as the alkali, the dissolved oxygen was controlled by varying the agitation speed, and the stirring rotational speed was set with a lower limit of 500 rpm and an upper limit of 1000 rpm. After the start of culturing, and when the glucose concentration was no longer measurable, feeding culture medium (248.9 g/L glucose, 83.3 g/L yeast extract, 7.2 g/L magnesium sulfate heptahydrate) was added while controlling the dissolved oxygen. (DO).
(162) (3) When the absorbance at 600 nm (OD.sub.600 nm) reached about 150 as a measure of the cell mass, the culturing temperature was lowered to 25 C. and upon confirming that the preset temperature had been reached, IPTG was added to a final concentration of 0.5 mM and culturing was continued at 25 C.
(163) (4) Culturing was terminated at about 48 hours after the start of culturing, and the cells were recovered by centrifugation of the culture solution at 8000 rpm for 20 minutes at 4 C.
(164) (5) A portion of the cells recovered in (4) were suspended in 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride, to 5 mL/1 g (cells), and an ultrasonic generator (INSONATOR 201M, trade name of Kubota Corp.) was used to disrupt the cells at 4 C. for about 10 minutes, with an output of about 150 W. The cell disruptate was centrifuged twice at 4 C. for 20 minutes, 10,000 rpm, and the supernatant was collected.
(165) (6) After adding imidazole to the disruptate obtained in (5) to a final concentration of 20 mM, it was applied to an XK 26/20 column (product of GE Healthcare) packed with 50 mL, of Ni Sepharose 6 Fast Flow (product of GE Healthcare) previously equilibrated with 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride and 20 mM imidazole. After rinsing with the buffer used for equilibration, 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride and 0.5 M imidazole was used for elution of the FcR5a.
(166) (7) The eluate obtained in (6) was applied to an HR 16/10 column (product of GE Healthcare) packed with 30 ml of IgG Sepharose (product of GE Healthcare) previously equilibrated with 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride. After rinsing with the buffer used for equilibration, the FcR5a was eluted with 0.1 M glycine hydrochloride buffer (pH 3.0). The eluate was restored to nearly neutral pH by addition of 1 M Tris-HCl buffer (pH 7.0) at the volume of the eluate.
Example 11
Preparation of FcR5a-Immobilizing Gel
(167) (1) The FcR5a prepared in Example 10 was concentrated and exchanged with buffer using an ultrafiltration membrane (Amicon Ultra-15, product of Millipore), and then concentrated to 8.37 mg/mL in 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride.
(168) (2) An epoxy Toyopearl gel was prepared by reacting 1,6-hexanediol diglycidyl ether with the hydroxyl groups of a hydrophilic vinyl polymer (Toyopearl, product of Tosoh. Corp.), as the support.
(169) (3) There were prepared h spin columns (product of Bio-Rad Laboratories, Inc.) housing 100 L of the epoxy Toyopearl gel prepared in (2), and rinsing was performed 3 times with 0.5 mL of 0.1 M borate buffer (pH 9.0) containing 0.5 M sodium chloride.
(170) (4) A solution comprising a mixture of 0.3 mL of the FcR5a solution prepared in (1) and 0.45 mL of 0.1 M borate buffer (pH 9.0) containing 0.5 M sodium chloride was added to each of the spin columns packed with gel described in (3), and shake cultured at 35 C. for 3 hours.
(171) (5) After collecting the mixed solutions of FcR5a solution and 0.1 M borate buffer containing 0.5 M sodium chloride, which had been added to the gel, rinsing was performed 3 times with 0.2 mL of 0.1 M glycine hydrochloride buffer (pH 3.0). Next, the pH was restored to near neutral by rinsing 3 times with 0.5 mL of 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride, and 0.5 mL of FcR5a-immobilizing gel was prepared.
(172) The protein concentrations in the solution collected in (5) and in the rinsing solution were measured, and the amount of FcR5a immobilized on the gel was calculated to determine the immobilization rate, by which it was found that 33.7% of the added FcR5a had been immobilized on the gel.
Example 12
Antibody Separation with FcR5a-Immobilizing Gel
(173) (1) After packing 0.5 ml of the FcR5a-immobilizing gel prepared in Example 11 into an HP16/5 column (product of GE Healthcare), it was connected to an AKTAprime plus (product of GE Healthcare). It was then equilibrated with 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride.
(174) (2) The 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride was passed through at a flow rate of 0.1 mL, and then 0.5 ml of a solution of human IgG1 (I5154-1 MG, product of Sigma Corp.) prepared to 1 mg/ml, was applied with 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride, to adsorb the human IgG1 onto the FcR5a-immobilizing gel. This was followed by equilibration by passing through 20 mM acetate buffer (pH 5.0), and the adsorbed human IgG1 was eluted with a pH gradient using 20 mM glycine hydrochloride buffer (pH 3.0). The eluted human IgG1 was recovered in 0.5 mL fractions.
(175) The elution pattern and recovered fractions of the human IgG1 are shown in
Example 13
Sugar Chain Structure Analysis of Isolated Antibodies
(176) (1) After denaturing the pre-purification human IgG1 and elution fractions (FrA and FrB) used in Example 12, by heat treatment at 100 C. for 10 minutes, they were treated with glycoamidase A/pepsin and pronase in that order, and subjected to a purification procedure by gel filtration to obtain the sugar chain fraction.
(177) (2) The sugar chains obtained in (1) were concentrated and dried with an evaporator, and then reacted with 2-aminopyridine and dimethylamineborane in that order, in an acetic acid solvent to obtain fluorescent-labeled sugar chains, which were purified by gel filtration.
(178) (3) The fluorescent-labeled sugar chains obtained in (2) were separated into a neutral sugar chain fraction and a monosialylated sugar chain fraction, using an anion exchange column (TSKgel DEAF-5PW, 7.5 mm7.5 cm, product of Tosoh Corp.).
(179) (4) The neutral sugar chain fraction and monosialylated sugar chain fraction obtained in (3) were isolated into individual sugar chains using an ODS column. After obtaining molecular weight information for the isolated sugar chains by MALDI-TOF-MS analysis, the sugar chain structures were assigned taking into account the retention time of the ODS column chromatograph.
(180) The compositional ratios of the neutral sugar chains are shown in Table 10, and the compositional ratios of the monosialylated sugar chains are shown in Table 11. The assigned sugar chain structures (N1 to N8 and M1 and M2) are shown in
(181) TABLE-US-00010 TABLE 10 Pre-purification Structure sugar chains FrA FrB designation (compositional (compositional (compositional in FIG. 5 ratio %) ratio %) ratio %) N1 3.7 16.7 2.7 N2 2.1 Not detected 2.0 N3 21.8 14.6 13.6 N4 39.1 29.2 37.2 N5 10.2 8.3 10.9 N6 15.5 20.8 19.6 N7 1.9 Not detected 2.2 N8 5.8 10.4 11.7
(182) TABLE-US-00011 TABLE 11 Pre-purification Structure sugar chains FrA FrB designation (compositional (compositional (compositional in FIG. 5 ratio %) ratio %) ratio %) M1 25.1 26.7 25.0 M2 74.9 73.3 75.0
Example 14
Antibody Purification with FcR5a-Immobilizing Gel
(183) The FcR5a-immobilizing gel prepared in Example 11 was used for purification of human IgG1 and human IgG3.
(184) (1) A 0.2 mL portion of FcR5a-immobilizing gel was prepared by the same method as Example 11. A 0.1 mL portion of the prepared FcR5a-immobilizing gel was packed into a spin column.
(185) (2) The column packed with the FcR5a-immobilizing gel prepared in (1) was rinsed 3 times with 0.5 mL of 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride.
(186) (3) A model culture solution was prepared by adding human IgG1 (I5154-1 MG, product of Sigma) or human IgG3 (14639-1 MG, product of Sigma) at 0.3 mg/mL to culture medium containing 10% fetal calf serum (FCS) added to DMEM/F12 culture medium (Life Technologies) as a medium for animal cells.
(187) (4) The model culture solution prepared in (3) was added at 0.4 ml to the column rinsed in (2), and was shaken at 25 C. for 2 hours.
(188) (5) The model culture solution was removed and rinsed 4 times with 0.5 mL of 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride, and then eluted with 500 L of 0.1 M glycine hydrochloride buffer (pH 3.0), recovering 100 L fractions.
(189) (6) The model culture solution and elution fractions were each heat treated with addition of 2 sample buffer (50 mM Tris-HCl buffer (pH 6.8) containing 2 (w/v) % sodium dodecyl sulfate, 6 (w/v) % -mercaptoethanol, 10 (w/v) % glycerin and 0.005 (w/v) % bromophenol blue). Next, each treated sample was separated by electrophoresis using a 5-20% gradient SDS-PAGE gel (by Atto Corp.). For comparison, human IgG1 and human IgG3 added to the model culture solution (concentration: 0.2 mg/mL) were also treated in the same manner and analyzed by SDS-PAGE.
(190)
Example 15
Preparation of Sugar Chain-Removed Human IgG1
(191) The N-linked sugar chains were removed from human IgG1 by the method described below.
(192) (1) Human IgG1 (31-AI17, product of Fitzgerald) was diluted with 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride, to a concentration of 3 mg/mL.
(193) (2) After adding 100 L of 1 M Tris-HCl buffer (pH 8.6) to 100 L of the diluted solution of (1), 10 L of N-glycosidase F (500 mU/L, 4450, product of Takara Bio, Inc.) was added, and then the mixture was allowed to stand at 37 C. for 24 hours to remove the N-linked sugar chains of the IgG1.
(194) (3) The treatment solution of (2) was applied to an open column (product Bio-Rad Laboratories, Inc.) packed with 100 L of Toyopearl AF-rProtein A-650F (22803, product of Tosoh Corp.) that had been previously equilibrated with 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride.
(195) (4) After rinsing 3 times with 500 L of 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride, elution was performed 7 times with 100 L of 0.1 N glycine hydrochloride buffer (pH 3.0), for purification of the N-linked sugar chain-removed human IgG (hereunder referred to simply as sugar chain-removed human IgG1). The eluate was neutralized by adding 1 M Tris-HCl buffer (pH 8.0) at the volume of the eluate.
(196) (5) To the sugar chain-removed human IgG solution obtained in (4) there was added an equivalent of sample buffer (50 mM Tris-HCl buffer (pH 6.8) containing 2 (w/v) % sodium dodecyl sulfate, 6 (w/v) -mercaptoethanol, 10 (w/v) % glycerin and 0.005 (w/v) % bromophenol blue), and heat treatment was performed for reduction of the sugar chain-removed human IgG1.
(197) (6) The human IgG1 was separated by electrophoresis using a 5-20% gradient SDS-PAGE gel (by Atto Corp.). For comparison, an aqueous solution of human IgG1 without sugar chain treatment. (hereunder referred to as sugar chain-bearing human IgG1) (concentration: 0.5 mg/mL) was also subjected to reduction treatment in the same manner as (5), and separated by SDS-PAGE.
(198) The results are shown in
Example 16
Large-Volume Preparation of Human FcRIIIa
(199) (1) Transformants capable of expressing the human FcRIIIa obtained in Example 1 were inoculated into 400 mL of 2YT liquid medium (16 g/L peptone, 10 g/L yeast extract and 5 g/L sodium chloride) containing 50 g/mL kanamycin in a 2 L baffle flask, and aerobically shake cultured overnight at 37 C., as preculturing.
(200) (2) After inoculating 180 mL of the preculture solution of (1) into 1.8 L of liquid medium containing 10 g/L glucose, 20 g/L yeast extract, 3 g/L trisodium phosphate dodecahydrate, 9 g/L disodium hydrogenphosphate dodecahydrate, 1 g/L ammonium chloride and 50 mg/L kanamycin sulfate, a 3 L fermenter was used for main culturing. The conditions were set to a temperature of 30 C., a pH of 6.9 to 7.1, an aeration rate of 1 VVM and a dissolved oxygen concentration at 30% saturated concentration, and main culturing was commenced. For pH regulation, 50% phosphoric acid was used as the acid and 14% ammonia water was used as the alkali, the dissolved oxygen was controlled by varying the agitation speed, and the agitation rotational speed was set with a lower limit of 500 rpm and an upper limit of 1000 rpm. After the start of culturing, and when the glucose concentration was no longer measurable, feeding culture medium (248.9 g/L glucose, 63.3 g/L yeast extract, 7.2 g/L magnesium sulfate heptahydrate) was added while controlling the dissolved oxygen (DO).
(201) (3) When the absorbance at 600 nm (OD.sub.600 nm) reached about 150 as a measure of the cell mass, the culturing temperature was lowered to 25 C., and upon confirming that the preset temperature had been reached, IPTG (isopropyl--thiogalactopyranoside) was added to a final concentration of 0.5 mM and culturing was continued at 25 C.
(202) (1) Culturing was terminated at about 48 hours after the start of culturing, and the cells were harvested by centrifugation of the culture solution at 8000 rpm for 20 minutes.
(203) (5) The cells harvested in (4) were suspended in 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride, to 5 mL/1 g (cells), and an ultrasonic generator (INSONATOR 201M, trade name of Kubota Corp.) was used to disrupt the cells at 4 C. for about 10 minutes, with an output of about 150W. The cell disruptate was centrifuged twice at 4 C. for 20 minutes, 10,000 rpm, and the supernatant was collected.
(204) (6) After adding imidazole to the disruptate obtained in (5) to a final concentration of 20 mM, it was applied to an XK 26/20 column (product of GE Healthcare) packed with 50 mL of Ni Sepharose 6 Fast Flow (product of GE Healthcare) previously equilibrated with 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride and 20 mM imidazole.
(205) (7) After rinsing with the buffer used for equilibration, 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride and 0.5 M imidazole was used for elution of the human FcRIIIa.
(206) (8) The eluate obtained in (7) was applied to an HR 16/10 column (product of GE Healthcare) packed with 10 mL of IgG Sepharose (product of GE Healthcare) previously equilibrated with 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride. After rinsing with the buffer used for equilibration, the human FcRIIIa was eluted with 0.1 M glycine hydrochloride buffer (pH 3.0). The eluate was restored to nearly neutral pH by addition of 1 M Tris-HCl buffer (pH 8.0) at the volume of the eluate.
Example 17
Measurement of Affinity of Human FcRIIIa for Antibodies
(207) (1) The human FcRIIIa prepared in Example 16 was dialyzed against phosphate buffer (buffer at pH 7.4 containing 137 mM NaCl, 8.1 M Na.sub.2HPO.sub.4, 2.68 mM KCl and 1.47 mid KH.sub.2PO.sub.4) for buffer exchange, and the concentration of the human FcRIIIa was measured from the absorbance at 280 nm.
(208) (2) After diluting the human FcRIIIa whose concentration was measured in (1), to 10 g/mL using 20 mM acetate buffer (pH 5.5), an amine coupling kit (product of GE Healthcare) was used for immobilization on a sensor chip CM5 (product of GE Healthcare), and a Biacore T-100 (product of GE Healthcare) was used to measure the amount of human FcRIIIa immobilized. As a result, the amount of human. FcRIIIa immobilized was found to be 488.2 RU (1 RU=1 pg/mm.sup.2). In addition, Protein A (product of ProteNova Co., Ltd.) was diluted to 10 g/mL with 20 mM acetate buffer (pH 5.5) in the same manner and immobilized on CM5 (product of GE Healthcare). The result of measurement of the amount immobilized with Biacore T-100 was an immobilization amount of 290.0 RU.
(209) (3) The sugar chain-bearing human IgG1 and the sugar chain-removed human IgG1 prepared in Example 15 were diluted to 128 g/mL, 64 g/mL, 32 g/mL, 16 g/mL, 8 g/mL, 4 g/mL, 2 g/ml, and 1 g/mL using HBS-EP(+) (solution at pH 7.4, containing 10 mM HEPES, 150 mM MaCl, 3 mM EDTA and 0.005 (v/v) Surfactant 920 (product of GE Healthcare)).
(210) (4) Using the protein-immobilizing chips prepared in (2), sugar chain-bearing human IgG1 or sugar chain-removed human IgG1 in amounts of 4 g/ml, to 128 g/mL were passed through at a flow rate of 30 L/min, for the human FcRIIIa-immobilizing chip, and sugar chain-hearing human. IgG1 or sugar chain-removed human IgG1 was passed through in amounts of 1 g/mL to 16 g/mL at a flow rate of 30 L/min, for the Protein A-immobilizing chip, to cause binding between the human IgG1 and the proteins immobilized on the chips, and measurement was performed with Biacore 1-100 under conditions with a contact time of 210 seconds and a dissociation time of 400 seconds, to measure the affinity between the human IgG1 and the proteins immobilized on the chips.
(211) The measurement results are shown in
Example 18
Preparation of Human FcRIIIa-Immoblizing Gel
(212) (1) The human FcRIIIa prepared in Example 16 was concentrated and exchanged with buffer using an ultrafiltration membrane (Amicon Ultra-15, product of Millipore), and then concentrated to 2.6 mg/mL in 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride.
(213) (2) An epoxy Toyopearl gel was prepared by reacting 1,6-hexanediol diglycidyl ether with the hydroxyl groups of a hydrophilic vinyl polymer (Toyopearl, product of Tosoh Corp.), as the support.
(214) (3) A 70 L portion of the epoxy Toyopearl gel prepared in (2) was introduced into a spin column (Bio-Rad Laboratories, Inc.), and rinsing was performed 3 times with 0.5 mL of 0.1 M borate buffer (pH 9.0) containing 0.5 M sodium chloride.
(215) (4) A solution comprising a mixture of 0.4 mL of the human FcRIIIa solution prepared in (1) and 0.6 mL of 0.1 M borate buffer (pH 9.0) containing 0.5 M sodium chloride was added to the gel of (2), and shaken at 35 C. for 3 hours.
(216) (5) After rinsing the gel prepared in (4) 3 times with 0.2 ml of 0.1 M glycine hydrochloride buffer (pH 3.0), the pH was restored to near neutral by rinsing 3 times with 0.5 ml of 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride, and 0.2 ml of human FcRIIIa-immobilizing gel was prepared.
(217) (6) The protein concentrations in the solution added to the gel of (2) and in the rinsing solution were measured, and the amount of human FcRIIIa immobilized on the gel was calculated to determine the immobilization rate, by which it was found that 84% of the added human FcRIIIa had been immobilized on the gel.
Example 19
Isolation of Antibody Using Human FcRIIIa-Immobilizing Gel
(218) (1) The human FcRIIIa-immobilizing gel prepared in Example 18 was packed into an HR16/5 column (product of GE Healthcare), and the column was connected to an AKTAprime liquid chromatography apparatus (product of GE Healthcare).
(219) (2) The column prepared in (1) was equilibrated with 20 mM Tris-HCl buffer (pH 7.4) containing 150 mM sodium chloride, and human IgG1 (31-AI17, product of Fitzgerald) or the sugar chain-removed human IgG1 prepared in Example 2 (both with solution concentrations of 1 mg/mL) was added at 0.1 mL at a flow rate of 0.1 mL/min. After rinsing with the buffer used for equilibration, elution was performed with 0.1 N glycine hydrochloride buffer (pH 3.5).
(220) The results are shown in
INDUSTRIAL APPLICABILITY
(221) The adsorbent of the invention specifically adsorbs antibodies with sugar chains and can therefore isolate and purify antibodies with sugar chains to a high degree of purity. The adsorbent of the invention can therefore be utilized for antibody drug production and for quality control.