Fertility gene and use thereof
10612040 ยท 2020-04-07
Assignee
- SHENZHEN INSTITUTE OF MOLECULAR CROP DESIGN (Guangdong, CN)
- HUNAN WANGHUA AGRICULTERAL BIOTECHNOLOGY CO., LTD. (Hunan, CN)
- SHENZHEN XINGWANG BIOSEED CO., LTD. (Guangdong, CN)
- Xingwang Investment Co., Ltd. (Beijing, CN)
Inventors
- Xiaoyan Tang (Guangdong, CN)
- Zhufeng Chen (Guangdong, CN)
- Gang Xie (Guangdong, CN)
- Na Wang (Guangdong, CN)
- Jiawei Lu (Guangdong, CN)
- Zaoxia Li (Guangdong, CN)
Cpc classification
C12N15/8231
CHEMISTRY; METALLURGY
A01H5/00
HUMAN NECESSITIES
C12N15/00
CHEMISTRY; METALLURGY
International classification
A01H5/00
HUMAN NECESSITIES
Abstract
The present disclosure relates to an expression vector for restoring male sterility in a plant. The expression vector comprises a regulatory region sequence operably linked to a heterologous nucleotide sequence.
Claims
1. An expression vector comprising: a regulatory region sequence selected from SEQ ID NO: 3 and SEQ ID NO: 9; and a heterologous nucleotide sequence, wherein said regulatory region sequence is operably linked to the heterologous nucleotide sequence.
2. A plant cell comprising the expression vector of claim 1.
3. The expression vector of claim 1, wherein the vector further comprises a promoter operably linked to a nucleotide sequence encoding a selection marker, wherein the promoter is selected from the group consisting of Ubi promoter, CaMV35S promoter, Actin promoter and 5126 promoter.
4. A plant cell comprising the expression vector of claim 3.
5. The expression vector of claim 1, wherein the heterologous nucleotide sequence comprises SEQ ID NO:1 or 5.
6. A plant cell comprising the expression vector of claim 5.
7. A method for specifically expressing a heterologous nucleotide sequence in male tissue of a plant, comprising: introducing the expression vector of claim 1 into the plant; and expressing the heterologous nucleotide sequence in the male tissue of the plant.
8. The method of claim 7, wherein the heterologous nucleotide sequence comprises SEQ ID NO:1 or 5.
9. The method of claim 7, wherein the plant is a monocotyledon.
10. The method of claim 9, wherein the monocotyledon is a gramineous plant.
11. The method of claim 10, wherein the gramineous plant is rice, maize, sorghum, barley, millet or Brachypodium distachyon.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
DETAILED DESCRIPTION
(18) All references mentioned herein are incorporated herein by reference.
(19) Unless specifically defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Unless defined otherwise, the technologies used or cited in the present disclosure are standard technologies well known by one of ordinary skill in the art to which this invention belongs.
(20) The materials, methods and embodiments described herein are explanatory, illustrative only, which shall not be construed to limit the scope of the present disclosure.
(21) The present disclosure provides a fertility gene, a nucleotide sequence, a protein sequence thereof, and use of the fertility gene in regulation of plant male fertility. By way of non-limiting examples, any method described below may be used together with the corresponding nucleotide sequence of the present disclosure, for example, any method selected from the following may be used: introducing the mutant sequence of the fertility gene into a plant to obtain plant male sterility, mutating a plant endogenous sequence, introducing an antisense sequence of the fertility gene into the plant, utilizing a form of hairpin, ligating the corresponding nucleotide sequence with other nucleotide sequence to regulate a plant phenotype, or any method for influencing the plant male fertility known to persons skilled in the art.
(22) The fertility gene FL2 provided herein is a gene involved in pollen development. The fertility gene FL2 locates in chromosome 10 of the rice plant. The fertility gene FL2 has a nucleotide sequence of SEQ ID NO: 1, 4 or 27 in Oryza Sativa ssp. indica, and the corresponding amino acid sequence is SEQ ID NO: 2. The fertility gene FL2 has a nucleotide sequence of SEQ ID NO: 5 in Oryza japonica, and the corresponding amino acid sequence is SEQ ID NO: 6. The fertility gene FL2 has a nucleotide sequence of SEQ ID NO: 10 or 11 in barley, and the corresponding amino acid sequence is SEQ ID NO: 12. The fertility gene FL2 has a nucleotide sequence of SEQ ID NO: 13 or 14 in sorghum, and the corresponding amino acid sequence is SEQ ID NO: 15. The fertility gene ZmFL2 has a nucleotide sequence of SEQ ID NO: 13 or 14 in maize, and the corresponding amino acid sequence is SEQ ID SEQ ID NO: 15. The fertility gene ZmFL2 has a nucleotide sequence of SEQ ID NO: 16 or 17 in maize, and the corresponding amino acid sequence is SEQ ID SEQ ID NO: 18. The fertility gene FL2 has a nucleotide sequence of SEQ ID NO: 19 in millet, and the corresponding amino acid sequence is SEQ ID NO: 20. The fertility gene FL2 has a nucleotide sequence of SEQ ID NO: 21 or 22 in Brachypodium distachyon, and the corresponding amino acid sequence is SEQ ID NO: 23.
(23) The present disclosure also provides one of the following sequences: a) a DNA sequence with at least 90% (preferably at least 95%) sequence similarity of FL2 gene described above and a homologous function, b) an DNA sequence hybridizable with the DNA sequence of a) under a stringent condition; c) an DNA sequence complementary to any one of the DNA sequence described above in a)-b).
(24) The fertility gene described above may be isolated from various plants. As known by one skilled in the art, the fertility gene of the present disclosure comprises functionally equivalent sequences which are highly homologous to FL2 gene and regulate fertility likewise. The highly homologous and functionally equivalent sequences include DNA sequences hybridizable with FL2 gene of the present disclosure under a stringent condition. A stringent condition used in the present disclosure is commonly understood by one of ordinary skill in the art and may comprise: hybridizing in a hybridization solution consisting of 400 mM NaCl, 40 mM PIPES (pH6.4) and 1 mM EDTA at 60 C. for 12-16 h, then washed with the wash solution consisting of 0.1% SDS and 0.1SSC at 65 C. for 15-60 min.
(25) The functionally equivalent sequence also includes a DNA sequence regulating plant fertility with at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence similarity of FL2 gene in the present disclosure, which may be isolated from any plant. A percentage of sequence similarity may be obtained by bioinformatic algorithms commonly known by a person skilled in the art, including Myers and Miller algorithm (Bioinformatics, 4(1): 11-17, 1988), Needleman-Wunsch global alignment method (J. Mol. Biol., 48(3):443-53, 1970), Smith-Waterman local alignment method (J. Mol. Biol., 147: 195-197, 1981), Pearson and Lipman similarity search method (PNAS, 85(8): 2444-2448, 1988), Karlin and Altschul algorithm (Altschul et al, J. Mol. Biol., 215(3): 403-410, 1990; PNAS, 90: 5873-5877, 1993), which are well known to those skilled in the art.
(26) The nucleotide sequence of the fertility gene of present disclosure may be isolated from any plant, including but not limited to, Brassica, maize, wheat, sorghum, Crambe Zinn, Sinapis alba, castor bean, sesame, cottonseed, linseed, soybean, Arabidopsis, Phaseolus, peanut, alfalfa, oat, rapeseed, barley, oat, rye, millet, dhurra, riticale, einkorn, Spelt, emmer, flax, Gramma grass, Tripsacum, euchlaena Mexicana, Festuca ovina, Perennial wheatgrass, sugarcane, Vaccinium oxycoccos, papaya, banana, Safflower, oil palm, muskmelon, apple, cucumber, dendrobe, gladiolus, chrysanthemum, Liliaceae, cotton, eucalyptus, sunflower, Brassica rapa, beet, coffee, ornamental plant, conifer and so on. Preferably, the plant includes maize, soybean, Safflower, mustard, wheat, barley, rye, rice, cotton, and sorghum.
(27) Also provided in the present disclosure is a method of influencing plant fertility by influencing a nucleotide sequence of FL2 or by regulating the transcription and expression of FL2 gene. The expression of influencing plant fertility means changing the fertility of a plant, for example obtaining male sterility, by regulating the expression of FL2 gene. Particularly, depending on the specific application, the FL2 gene expression in plant may be influenced by many methods to regulate the plant male fertility. More particularly, the expression of FL2 gene may be manipulated by all kinds of tools available to one of ordinary skill in the art. For example, mutation, mutagenesis, introduction of an antisense gene, co-suppression, introduction of hairpin, and alike can be used to interfere the normal expression of FL2 gene, and to obtain the male sterile plant. In other embodiments, the present disclosure also includes the way of recovering the male fertility to the plant with disturbed FL2 expression by introducing the wild-type nucleotide sequence of FL2 to the plant.
(28) Further provided in the present disclosure are the mutant nucleotide sequence of FL2 gene that leads to male sterility and a male sterile mutant material. More particularly, the male sterile mutant material is obtained by a process of mutating endogenous FL2 gene of rice, or mutating of the nucleotide sequence of a gene highly homologous to FL2 gene, leading to loss of male fertility. The term of mutating includes, but is not limited to the following methods, for example gene mutation induced by physical or chemical method. The chemical method includes mutagenesis induced by mutagen such as EMS etc. The mutation may be point mutation, nucleotide deletion, or nucleotide insertion, or gene silencing by means of RNAi, site-directed mutagenesis and so on.
(29) Particularly, also provided in the present disclosure is a male sterile mutant of rice, containing the mutant FL2 gene. The nucleotide sequence of the mutant male sterility gene is shown as SEQ ID NO: 7 and the amino acid sequence thereof is SEQ ID NO: 8. Compared with wild-type, in the male-sterile mutant, G is mutated into A at the 1688.sup.th nucleotide of the coding sequence of the mutant male sterility gene (
(30) Further provided in the present disclosure is the promoter of FL2 gene with a function of specific expression in anther, and the corresponding nucleotide sequence of the promoter is a nucleotide sequence 700 bp to 2500 bp upstream of ATG of the FL2 gene. More particularly, in rice, the nucleotide sequence of the promoter of OsFL gene is SEQ ID NO: 3 or SEQ ID NO: 9. The nucleotide sequence shown as SEQ ID NO: 3 and SEQ ID NO: 9 were ligated with the reporter gene GUS and transformed into plants respectively. The resulting transgenic plants were analyzed. Specifically, the roots, stems, leaves, and flowers were stained for GUS activity. It was found that the GUS gene driven by the promoter of OsFL2 gene is mostly expressed in rice anthers, particularly expressed highly specifically at the P7 stage of anther development. Therefore, the promoter of SEQ ID NO: 3 or SEQ ID NO:9 provided in the present disclosure is be an anther-specific promoter.
(31) The anther-specific promoter provided in the present disclosure includes the nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO: 9, a nucleotide sequence with at least 90% sequence similarity to the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO: 9, or a sequential nucleotide fragment of at least 100 bp from the nucleotide sequence of SEQ ID NO: 3 or SEQ ID NO: 9, which may activate the expression of nucleotide sequences operably linked to the promoter in plant anther. An expression vector, a transgenic cell line, a host bacterium, and so on containing the nucleotide sequence described above also fall in the protection scope of the present disclosure. A primer pair for amplifying any one of the nucleotide sequences of the promoter of SEQ ID NO: 3 and SEQ ID NO: 9 also fall in the protection scope of the present disclosure.
(32) The nucleotide sequence of the promoter provided in the present disclosure may be used to isolate corresponding nucleotide sequences from plants other than rice, particularly, by homology-based cloning from other monocotyledons. These corresponding nucleotide sequences may be isolated and identified by means of PCR, hybridization etc. based on the homology between these corresponding nucleotide sequences and the promoter of the present disclosure or the promoter. Therefore, the embodiments of present disclosure also comprise the corresponding fragments, which have sequence similarities to the promoter sequence of SEQ ID NO: 3 or SEQ ID NO: 9 (or fragments thereof) and may be isolated based on the similarities.
(33) The term promoter used herein means a regulatory DNA region, commonly including TATA box guiding RNA polymerase II to initiate RNA synthesis at a proper transcriptional start site of a specific coding sequence. The promoter may also include other recognition sequences commonly located upstream of the TATA box, named as an upstream promoter element with a function of regulating transcriptional efficiency. As known to those skilled in the art, although the nucleotide sequence of the promoter region of the present disclosure has been identified, the isolation and identification of other regulatory element in upstream region of the TATA box of a specific promoter region identified in the present disclosure also falls in the scope of the present disclosure. Therefore, the promoter of the present disclosure may be generally further defined to include the upstream regulatory elements that regulate spatial and temporal expression patterns of the coding sequence. The promoter elements expressed in a target tissue (such as male reproductive organs) may be identified and isolated in the same way, and these promoter elements may be used together with a core promoter to examine the preferential expression in male-specific tissues. The core promoter means a minimal sequence for transcriptional onset, for example, a sequence known as the TATA box, which commonly exists in the promoter of gene encoding a protein. Therefore, alternatively, the upstream promoter of FL2 gene may be used in association with the core promoter of the FL2 gene or core promoters from other sources.
(34) The core promoter may be one of the known core promoters, such as 35S or 1 9S promoter of Cauliflower Mosaic Virus (U.S. Pat. No. 5,352,605), Ubiquitin promoter (U.S. Pat. No. 5,510,474), IN2 core promoter (U.S. Pat. No. 5,364,780), or figwort mosaic virus promoter.
(35) The function of the gene promoter may be analyzed by the following methods: the nucleotide sequence of the promoter is operably linked to reporter gene to form a transformable construct, then the construct is transformed into plants to obtain transgenic progeny, and the expression of reporter gene in the transgenic progeny is examined for the expression pattern of the promoter. Alternatively, the promoter sequence linked to a reporter gene is subcloned into an expression vector, and the function of the promoter or other regulatory regions thereof is detected through the transient expression experiment.
(36) The selection of suitable expression vectors for testing the function of the promoter or regulatory regions thereof depends on the host and the method of introducing the expression vector into the host, and the method is well known to one of ordinary skill in the art. For a eukaryotic gene, the sequence that should be subcloned into the expression vector comprises a region controlling transcription initiation and regulation. These regions are operably linked to a reporter gene including GFP, UidA, GUS gene or luciferase. The expression vector with a putative regulatory region located in the genome may be transformed into a whole organ, such as pollen at specific stages, or callus to examine its functions.
(37) Furthermore, the promoter of the present disclosure may be linked to heterogenous nucleotide sequences other than the FL2 gene for to drive their expression. The nucleotide sequence of the promoter of the present disclosure and fragment and variant thereof and the heterogenous nucleotide sequence may be assembled into an expression cassette for expressing in target plants, more particularly in male organs of the plant. The expression cassette has a proper restriction site for inserting the promoter and the heterogenous nucleotide sequence. The expression cassettes may be used to genetically manipulate any plant to obtain desired corresponding phenotype.
(38) The FL2 gene promoter of the present disclosure, more particularly the FL2 gene promoter of rice, may be used to activate the expression of several heterogenous nucleotide sequences to make the transformed plant male sterile. Specifically, the heterogenous nucleotide sequence may encode enzymes accelerating carbohydrate degradation, carbohydrate modification enzyme, amylase, debranching enzyme, or pectinase, such as thea-amylase gene, auxin, rot B, cytotoxin gene, diphtheria toxin, DAM methylase, avidin, or heterogenous nucleotide sequences selected from a prokaryotic regulation control system. The heterogenous nucleotide sequence can also be dominant male sterility gene.
(39) In some embodiments, the nucleic acid operably linked to the downstream of the promoter in the present disclosure may be operably linked to a structural gene, a regulatory gene, an antisense sequence of the structural gene, an antisense sequence of the regulator gene or micro RNA interfering with the expression of a particular endogenous gene.
(40) More explicitly, the gene of SEQ ID NO: 1 and SEQ ID NO: 5 regulating plant fertility provided in the present disclosure may be constructed into the downstream of the promoter of SEQ ID NO: 3 and SEQ ID NO: 9 to drive the specific expression of the gene in anther, or may be used to construct an RNAi vector targeting the gene of SEQ ID NO: 1 driven by the promoter of SEQ ID NO: 3 or SEQ ID NO: 9 to silence the FL2 gene expression and to obtain the male sterile mutant of SEQ ID NO:1 gene.
(41) The nucleotide sequence of the promoter of the present disclosure may be isolated from any plant, including but not limited to, Brassica, maize, wheat, sorghum, Crambe Linn, Sinapis alba, castor bean, sesame, cottonseed, linseed, soybean, Arabidopsis, Phaseolus, peanut, alfalfa, oat, rapeseed, barley, oat, rye, millet, dhurra, riticale, einkom, Spelt, emmer, flax, Gramma grass, Tripsacum, euchlaena Mexicana, Festuca ovina, Perennial wheatgrass, sugarcane, Vaccinium oxycoccos, papaya, banana, Safflower, oil palm, muskmelon, apple, cucumber, dendrobe, gladiolus, chrysanthemum, Liliaceae, cotton, eucalyptus, sunflower, Brassica rapa, beet, coffee, ornamental plant, conifer and so on. Preferably, the plant includes maize, soybean, Safflower, mustard leaf, wheat, mustard leaf, barley, rye, rice, cotton and sorghum.
(42) The present disclosure also provides a construct comprising FL2 gene and/or the promoter of FL2 gene, which includes a so-called vector or an expression cassette. The promoter of the construct driving the linked nucleotide sequence to express in the plant may be a natural promoter or a substituted promoter. The promoter of the construct may be an inducible promoter. The nucleotide sequence of FL2 gene may be linked to an anther-specific promoter, preferably, which may drive the nucleotide sequence of FL2 gene to fully express in the early development of anther, for example specifically in P7 of anther development. Particularly, the useful promoter types include a constitutive viral promoter, such as 35S promoter of Cauliflower Mosaic Virus (CaMV), 19s promoter of Cauliflower Mosaic Virus (CaMV), 35S promoter of figwort mosaic virus, and ubiquitin promoter.
(43) A tissue-specific promoter may be used to enhance the transcription and/or expression targeted a specific plant tissue. The promoter may express in both the target tissue and other plant tissues, or express mainly in the target tissue, or express lower in the target tissue than the other plant tissues, or express highly preferably in the target tissue. In one embodiment, the promoter prefers to express particularly in plant male tissues or plant female tissues. For the method of present disclosure, the promoter may not be limited to any specific promoter with male tissue preference, and many promoters of such type known by the person skilled in the art may be used.
(44) The natural FL2 promoter described herein is an example of the useful promoters. Another type of such promoters comprise 5126 promoter, MS45 promoter, MS26 promoter, BS92-7promoter, SGB6 regulatory element and TA29 promoter and so on, which drive the linked gene to express in plant male tissues. The construct also comprises the promoter with gamete expression specificity. The promoters with gamete tissue expression specificity includes PG47 promoter and ZMI 3 promoter.
(45) The construct described above may also comprise other components depending on the purpose and use of the vector construct. For example the construct may further comprise a selection marker gene, a targeting or regulatory sequence, a stabling sequence, a guiding sequence, or an intron. The expression cassette includes a target heterogenous nucleotide sequence with a transcriptional terminator and a translational terminator functioning in a plant at the 3 end thereof. The terminator may be the terminator of the gene of the present disclosure, or an exogenous terminator. More particularly, the above-mentioned terminator may be a termination region of nopaline synthase or octopine synthase.
(46) If it is desired to target the expression product of the heterogenous nucleotide sequence to a specific organelle, such as plastid, amyloplast, endoplasmic reticulum or cell surface or extracellular secretion, the expression cassette may also comprise a nucleotide sequence that encodes a transit peptide. The transit peptide is known by the person skilled in the art and can be but not limited to a small subunit of Rubisco, a plant EPSP synthase, a maize Brittle-I chloroplast transit peptide etc.
(47) In the process of preparing the expression cassette, multiple DNA fragments may be manipulated to provide a DNA sequence in a proper direction or in a correct reading frame. In order to reach this aim, DNA fragments may be linked together via an adapter or a linker, or other convenient multiple cloning sites through other operations etc.
(48) Further, the construct provided in the present disclosure also includes a selection marker gene for selecting transformed cells or transformed tissues. The selection marker gene includes an antibiotic-resistance gene or an herbicide-resistance gene. The proper selection marker gene includes, but is not limited to a chloramphenicol resistant gene, a hygromycin resistant gene, a streptomycin resistant gene, a miramycin resistant gene, a sulfonamides resistant gene, a glyphosate resistant gene, a phosphinothricin resistant gene. The selection marker gene may be also a red fluorescent protein gene, a cyan fluorescent protein gene, a yellow fluorescent protein gene, a luciferase gene, a green fluorescent protein gene, and an anthocyanin biosynthetic gene etc.
(49) The expression cassette or the vector provided in the present disclosure may be inserted into a plasmid, a cosmid, a yeast artificial chromosome, a bacteria artificial chromosome or any other vector suitable to be transformed into a host cell. Preferably the host cell is a bacteria cell especially the cell used to clone polynucleotide, maintain polynucleotide, or transform a plant cell, such as Escherichia Coli, Agrobacterium tumefaciens and Hair root soil bacteria. In the case of the host cell being a plant cell, the expression cassette or the vector may be inserted into a genome of the transformed plant cell, and the insertion may be either site-specific or random. Preferably, the insertion may be realized through homologous recombination. In addition, the expression cassette or the vector may be free from any chromosome. The expression cassette or the vector of the present disclosure can be in the nucleus, chloroplast, mitochondria and/or plastid of a plant cell. Preferably, the expression cassette or the vector may be inserted into a chromosome DNA in the plant cell nucleus.
(50) The present disclosure also comprises the use of the FL2 gene disclosed in the present disclosure and the promoter thereof. In some embodiments of applications, the FL2 gene or the promoter thereof may be used to propagate and maintain the male sterile line obtained by mutating the FL2 gene or other genes related to fertility.
(51) In details, the propagation and maintenance of the above-mentioned male sterile line involves using a male sterile mutant with a homozygous recessive nuclear gene as a transgenic acceptor and transformation of three tightly linked target genes into the male sterile mutant. The three tightly linked genes comprise a fertility restoration gene, a pollen inactivation gene, and a color/fluorescence-label screening gene. The fertility restoration gene may recover the fertility of the sterile transgenic acceptor. The pollen inactivation gene may inactivate any pollen containing the transformed exogenous gene. And the color/fluorescence-label screening gene may be used to sort the transgenic seeds from the non-transgenic seeds, and the sorted non-transgenic seeds may be used as a sterile line to produce hybrid seeds, while the sorted transgenic seeds may be used as a maintainer line to produce a sterile line continuously and steadily.
(52) More explicitly, according to one embodiment of the present disclosure, rice recessive nuclear sterile fl2 (fl2 mutant may be used as a receptor, and 3 tightly linked genes are transformed into the sterile line, wherein a fertility restoration gene OsFL2 may recover fertility of the transformed acceptor, a pollen inactivation gene Zm-PA may inactivate pollen, and a fluorescence screening (color sorting) gene RFP(r) is used to sort transgenic seeds from non-transgenic seeds, and the sorted non-transgenic seeds may be used as a sterile line to produce hybrid seeds, and the sorted transgenic seeds may be used as a maintainer line to produce a sterile line continuously and steadily. This technology produces non-transgenic product and bypasses the bottleneck problem in the process of rice hybrid seed preparation that low resource utilization in the three-line method and unstable fertility of the sterile line in the two-line method.
(53) An anther-specific promoter provided in the present disclosure may be used to drive the specific expression of an exogenous gene in anther to avoid the continuous expression of the exogenous gene in other tissues of the plant and any adverse effects caused by that. The anther-specific promoter may also be used in the functional analysis and identification of genes related to the plant pollen development, the establishment of the male sterile line and the restorer line, and pollen abortion experiment, and the biosafety problem caused by a plant transgene flow or pollen escape may be avoided, which is important to establish the male sterile line and the restorer line.
(54) The present invention also provides a method of producing a plant, comprising:
(55) (1) constructing an expression cassette provided herein,
(56) (2) introducing the resulting expression cassette of step (1) into plant cells,
(57) (3) regenerating transgenic plants from transformed plant cells, and screening through the transgenic plants, and
(58) (4) optionally, propagating the plant of step (4) to obtain progenies.
(59) The transgenic plant of the present disclosure is prepared by transformation methods known to those skilled in the art of a plant biotechnology. Any method may be used to transform a recombinant expression vector into the plant cell to generate the transgenic plant of the present disclosure. The transformation methods include a direct transformation method and an indirect transformation method. The proper direct transformation method includes DNA intake induced by polyethylene glycol, lipidosome-mediated transformation, introduction by particle gun, electroporation and micro-injection and so on. In some embodiments of the present disclosure, the present disclosure uses transformation technology based on Agrobacteria (referring to Horsch R B et al (1985) Science 225: 1229; White F F, Vectors for Gene Transfer in Higher Plants, Transgenic plants, Volume 1, Engineering and Utilization, Academic Press, 1993, pp. 15-38; Jenes Bet al. Techniques for Gene Transfer, Transgenic plants, Volume 1, Engineering and Utilization, Academic Press, 1993, pp. 128-143, etc). Agrobacterium strains (such as Agrobaterium twnefaciens or Agrobacterium rhizogenes) contain a plasmid (Ti plasmid or Ri plasmid) with a T-DNA element. The plasmid with the T-DNA is transferred into plant after Agrobacterium transfection, with the T-DNA eventually integrated into the plant cell genome. T-DNA is located in the Ri-plasmid or the Ti-plasmid, or contained in a binary vector. An Agrobacterium-mediated transformation method is described in the examples. The Agrobacterium-mediated transformation method is most suitable for dicotyledons, but also suitable for monocotyledons. The way of transforming Agrobacterium into plants is described in the examples. Transformation may lead to both transient transformation and expression, and stable transformation and expression. Although the nucleotide sequence of the present disclosure may be inserted into various plants and various plant cell types, it is especially suitable for crop cells.
(60) Compared with the prior art, the present disclosure has the following benefits: a rice anther development gene and the male sterile line generated by the mutation of the rice anther development gene are provided in the present disclosure. The male sterility is not influenced by environment and may be recovered by wild-type transgene. The rice anther development gene and the male sterile line generated by the mutation of the rice pollen development gene provide necessary components for constructing the third generation hybrid breeding system. The male sterile line generated by the mutation of the rice pollen development gene can be used to produce hybrid seeds, and is vital to improve the existing three-line and two-line methods.
EXAMPLES
(61) The invention is now described with reference to the following Examples. The Examples are provided for the purpose of illustration only, and the invention is not limited to these Examples, but rather encompasses all variations which are evident as a result of the teachings herein.
Example 1: Screening for a Rice Male Sterile Mutant (Osfl2)
(62) The seeds of the rice variety (Oryza sativa L. spp. Indica) Huanghuazhan (MO) were mutagenized by EMS (0.7%) for 12 hours to obtain the mutagenized population (M1). The seeds generated by the mutagenized plants from the M1 seeds were harvested and mixed to obtain a mutant library (M2). The plants from the M2 generation seed were screened to obtain male sterile plants at the seed maturation stage. The sterile plant was reproduced by cutting off rice stubbles, and pollen development in the reproduced plant was tested by I2-KI staining in reproductive period. A male sterile mutant showed no pollen and was named as Osfl2.
Example 2: Genetic Analysis of the Rice Male Sterile Mutant (Osfl2)
(63) The sterile plant of the Osfl2 mutant was crossed with wild-type Huanghuazhan, and 80 Fl generation plants were all fertile. The Fl generation plants were self-fertilized to obtain 300 F2 plants, of which 78 plants manifested no pollen sterility and 222 plants showed complete fertility. The segregation ratio between the sterile plants and the fertile plants is very close to 1:3, which revealed the phenotype to be controlled by a recessive nuclear gene.
Example 3: Stability Analysis of the Rice Male Sterile Mutant (0412)
(64) To confirm whether the sterility of the osfl2 mutant was influenced by environmental conditions such as light or temperature etc., the F2 generation plants obtained through crossing the sterile plant with wild-type Huanghuazhan were grown in Shenzhen, Sanya, Hunan, Beijing to further observe the sterility and the segregation ratio. In all areas, the segregation ratio between the sterile plants and the fertile plants is 1:3 (
(65) TABLE-US-00001 TABLE 1 The segregation ratio in the F2 generation plant obtained by self- fertilization of the F1 plants (the progeny of Osfl2 mutants and the wild type Huanghuazhan). Number of Number of fertile plants sterile plants 2 (3:1) Shenzhen 88 31 0.034 Sanya 104 29 0.150 Hunan 65 21 0.000 Beijing 61 19 0.033
Example 4: Phenotypic Analysis of the Reproductive Organ of the Rice Male Sterile Mutant (osfl2)
(66) Compared with the wild-type plant, the mutant plant grew and developed normally, blooming at the same stage. The size, morphology, opening size and opening time of lemma and glum of the mutant plant were not different from the wild-type plant (
Example 5: Gene Cloning of the Rice Male Sterile Mutant
(67) Cloning of the mutant gene was based on the Mutmap method, which involves constructing F2 progenies by crossing the mutant with the wild-type parent, and mapping the gene by re-sequencing. The sterile plant was crossed with wild-type Huanghuazhan, then 30 sterile plants of F2 generation were selected for extraction of genomic DNA, and the genomic DNA was mixed equally for high-throughput genome sequencing to get 20 Gb sequence data amounting to 50rice genome. The mutant gene may be Os10g38050 allele located on the 10th chromosome compared with the genomic sequence of wild-type Huanghuazhan. The full-length coding sequence of the gene of wild-type Huanghuazhan is 1767 bp, and the nucleotide sequence of the gene was shown as SEQ ID NO:1. The protein encoded by SEQ ID NO:1 contains 588 amino acids and the sequence of amino acids was shown as SEQ ID NO:2. In the sterile mutant, G was mutated into A at the 1688th nucleotide of the coding sequence of the gene (
Example 6: Expression Pattern Analysis of OsFL2 Gene in Different Organs of the Rice
(68) A pair of primers were designed based on the cDNA sequence of OsFL2, with the forward primer Fl 5 GCCTCACCGTCCTCCTCTAC 3 (SEQ ID NO: 33) and the reverse primer R1 5 CGGGTCCGAGAACACCAC 3 (SEQ ID NO: 34). Meanwhile, primers for internal controls were designed against a rice gene Actin, with a forward primer 5 GCTATGTACGTCGCCATCCA 3 (SEQ ID NO: 35) and a reverse primer 5 GGACAGTGTGGCTGACACCAT 3 (SEQ ID NO: 36). Total RNA was extracted from Huanghuazhan rice and used as the template for the synthesis of the 1.sup.st strand cDNA. Real-time quantitative PCR was used to analyze OsFL2 gene expression profile in the root, stem, leaf, lemma, palea, glume, pistil and young anther at primordium differentiation stage (stage 6), young anther at early pollen mother cell meiotic stage (stage 7), tetrad formation stage (stage 8), early microspore stage (stage 9), middle and late microspore stage (stage 10), pollen maturing stage (stage 12), and the result as depicted in
Example 7: Construction of OsFL2 Gene Expression Vector and Functional Analysis of the Gene Promoter
(69) The OsFL2 gene expression vector (
Example 8: Complementation Test of the Rice Male Sterile Mutant (Osf/2)
(70) To confirm that the OsFL2 mutation was responsible for the male sterile phenotype in the mutant, a complementation vector containing the full-length wild type OsFL2 gene was constructed and transformed into plants to complement the Osjl2 phenotype. Specifically, the full-length genomic fragment from 2500 bp bases upstream of OsFL2 initiation codon ATG to approximate 497 bp bases downstream of OsFL2 termination codon TGA (SEQ ID NO:4), was amplified using the primer OsFL2-Res-F (gtttaaacGGATTTCGAGGATCAAGCT, SEQ ID NO:39) and the primer OsFL2-Res-R (ggatccACCCTGCATTTTTTATGCC, SEQ ID NO:40). The fragment was digested by Pmel and BamHI and ligated into a complementation vector to obtain pOsFL2-Res vector (plasmid). The obtained pOsFL2-Res vector was transformed into the callus induced from Huanghuazhan osfl2 mutant seeds by the Agrobacterium-mediated transformation method, and the transgenic plants were selected and regenerated. 8 positive transgenic plants were obtained and all of them showed restored fertility. This analysis further demonstrated OsFL2 gene was involved in pollen development regulation and the mutation in OsFL2 gene led to the non-pollen phenotype.
Example 9: Acquisition and Phenotypic Analysis of OsFL2 Gene RNAi Line
(71) To further confirm that disturbed expression of OsFL2 gene results in male sterility, an RNAi line to specifically knockout OsFL2 was constructed. Specifically, a 474 bp OsFL2 cDNA fragment was amplified using the primer OsFL2-Flag-F (GCGTCGCCGACAACCC, SEQ ID NO:41) and the primer OsFL2-Flag-R (TGGAGAAGGCCCGCGAC, SEQ ID NO:42). The amplified product was further amplified with two pairs of amplification primers to obtain a forward OsFL2 gene fragment 1 with a Kpnl site and a reverse OsFL2 gene fragment 2 with a BamHI site. The two fragments were digested, ligated, and incorporated into a pRNAi vector to obtain pOsFL2-RNAi. The obtained pOsFL2-RNAi was transformed into Nipponbare callus by the Agrobacterium-mediated transformation method, and 10 transgenic plants were selected and regenerated and the male fertility in 7 of the transgenic plants reduced significantly. Real-time quantitative PCR using the prime pair of example 6 based on OsFL2 and Actin cDNA was conducted to analyze expression level of OsFL2 gene in young anther at pollen mother cell meiosis stage and tetrad formation stage (P7) of the RNAi plants, and the result showed RNA expression level of OsFL2 gene of the transgenic sterile plants reduced significantly (
Example 10: Cross-Pollination Analysis of the OsFL2 Mutant Plant with the Restorer Line
(72) Huanghuazhan OsFL2 mutant plant may be cross-pollinated by several frequently-used restorer lines for the production of hybrid seeds. Hybrid seeds from some combinations showing obvious heterosis, demonstrating Huanghuazhan mutant is valuable in hybrid-breeding and can be used as a candidate material for the sterile line. Huanghuazhan OsFL2 mutant plant was crossed to several restorer lines, and that stigmas of the F2 generation sterile plant were still highly exposed (exposure rate of stigma was up to 60-88%) demonstrated a linkage inheritance existing in the mutant gene and a stigma exposure trait. High exposure of stigma was beneficial to cross-pollination and improved efficiency of hybrid seed production.
Example 11 Alignment of the OsFL2 Protein with the Predicted Protein Homologues from Barley, Sorghum and Maize
(73) In NCBI database, using protein blast, the complete rice OsFL2 protein sequence was used as the query to search in the protein database for its protein homologues in the genomes of barley, sorghum, maize, millet and Brachypodium distachyon. The obtained protein sequences were aligned, and the result showed that they were highly homologous with each other (
(74) Herein, the nucleotide sequence of the fertility gene of barley was shown as SEQ ID NO:10 or 11, and the amino acid sequence of the fertility gene of barley was shown as SEQ ID NO:12, the nucleotide sequence of the fertility gene of sorghum was shown as SEQ ID NO:13 or 14, and the amino acid sequence of the fertility gene of sorghum was shown as SEQ ID NO:15, the nucleotide sequence of the fertility gene ZmFL2 of maize was shown as SEQ ID NO:16 or 17, and the amino acid sequence of the fertility gene ZmFL2 of maize was shown as SEQ ID NO:18, the nucleotide sequence of the fertility gene of millet was shown as SEQ ID NO:19, and the amino acid sequence of the fertility gene of millet was shown as SEQ ID NO:20, the nucleotide sequence of the fertility gene of Brachypodium distachyon was shown as SEQ ID NO:21 or 22, and the amino acid sequence of the fertility gene of Brachypodium distachyon was shown as SEQ ID NO: 23.
Example 12: The Application of OsFL2 Gene in the Innovation of a New Hybrid Breeding Technique
(75) OsFL2 gene may be applied in new generation of hybrid breeding technique, and the core idea of the technique was: the recessive rice nuclear male sterile mutant was used as the transformation acceptor material, and three closely-linked genes were transformed into the sterile mutant. Therefore, a fertility-recovering gene can recover the fertility of the transformation acceptor, an pollen-inactivation gene can inactivate pollen containing the transgene, a color-label gene can be used for sorting of a transgenic seed from a non-transgenic seed, and the sorted non-transgenic seed was used as the sterile line, while the transgenic seed was used as the maintainer line. The maintainer line may pollinate the sterile line to propagate the sterile line, while the maintainer line can self-pollinate. As the technique utilizes biotechnology to produce a non-transgenic product, the bottleneck problem in the rice hybrid seed production is solved, especially the low resource utilization of three-line method and the instability of the sterile line of two-line method.
(76) Based on the above-mentioned principle, the inventors used the OsFL2 gene of the rice to construct the expression vector pZN3. Before constructing the rice expression vector, the inventors firstly transformed each of the three expression cassettes, Zm-PA, OsFL2 and RFP, into the rice plant respectively and further verified the function of each expression cassette. The result indicated that each expression cassette can work well as initially designed when transformed into the rice alone.
(77) Further, the inventor constructed pZN3 vector depicted in
(78) 1) pCAMBIA2300 vector as the backbone;
(79) 2) expression cassette LTP2:RFP(r)-PINI1, an open reading frame of RFP(r) gene (SEQ ID NO:24) were linked between the promoter of LTP2 (SEQ ID NO:25) and the terminator of PINII (SEQ ID NO: 26) to recombine the expression cassette of RFP(r)) (LTP2:RFP(r):PINI1),
(80) 3) OsFL2 expression cassette that comprises the full length of OsFL2 from the gene promoter to the gene terminator as SEQ ID NO:27. The complete nucleotide sequence between the promoter and the terminator of marker gene of OsFL2 gene was SEQ ID NO:4, and the promoter of OsFL2 gene was SEQ ID NO:3, the terminator of OsFL2 gene was SEQ ID NO:28, the genomic DNA sequence of OsFL2 gene was SEQ ID NO:27, the amino acid sequence of the protein encoded by the nucleotide sequence was SEQ ID NO: 2,
(81) 4) expression cassette of PG47:ZM-BT1:ZM-PA:IN2-1, the open reading frame of the pollen-inactivation gene ZM-PA (the nucleotide sequence was SEQ ID NO:29) was linked to the promoter of PG47 (the nucleotide sequence was SEQ ID NO:30), the downstream region of a transit peptide of ZM-BT1 (the nucleotide sequence was SEQ ID NO: 31), the upstream region of the terminator of IN2-1 (the nucleotide sequence was SEQ ID NO:32).
(82) Rice transformation: plasmid pZN3 was transformed into Ag10 strain of Agrobacterium by electroporation, and the genetic transformation was carried out on the rice callus of Huanghuazhan homozygous for the recessive male sterile OsFL2 mutation through Agrobacterium-mediated transformation. 26 independent single-copy transgenic plants were obtained. The specific transformation acceptor material was obtained through the following process: Huanghuazhan seed homozygous for the OsFL2 recessive mutation was distinguished from the heterozygous seed by HRM (high resolution melting), and the callus of the homozygous Osfl2 mutant seed was induced and transformed.
(83) Examination of the pollen fertility of the transgenic rice plant: 26 obtained single-copy transgenic rice (with the homozygous OsFL2 recessive sterile site) were analyzed and it was found that there was no significant morphological difference between the transgenic plant and the non-transgenic plant, while the fertility was significantly different. Analysis of pollen stainability was carried out on the transgenic plant described above, using the wild-type rice as the control (
(84) Segregation analysis of fluorescent seeds and non-fluorescent seeds of the transgenic rice plant: the ratio of fluorescent segregation of the Tl generation seeds from 26 obtained single copy-transgenic rice (with the homozygous OsFL2 recessive sterile site) described above was analyzed, and the result indicated the segregation ratio of these seeds was 1:1 (