DNA methylation editing kit and DNA methylation editing method

10612044 ยท 2020-04-07

Assignee

Inventors

Cpc classification

International classification

Abstract

A DNA methylation editing kit comprises: (1) a fusion protein of inactivated CRISPR-associated endonuclease Cas9 (dCas9) having no nuclease activity and a tag peptide array in which plural tag peptides are linked by linkers, or an RNA or DNA coding therefor; (2) a fusion protein(s) of a tag peptide-binding portion and a methylase or demethylase, or an RNA(s) or DNA(s) coding therefor; and (3) a guide RNA(s) (gRNA(s)) comprising a sequence complementary to a DNA sequence within 1 kb of a desired site of methylation or demethylation, or a DNA(s) expressing the gRNA(s).

Claims

1. A DNA methylation editing kit comprising: (1) a first fusion protein comprising (i) inactivated CRISPR-associated endonuclease Cas9 (dCas9) having no nuclease activity and (ii) a tag peptide array comprising a plurality of tag peptides and peptide linkers which consist of 15 to 50 amino acids and link said tag peptides, or an RNA or DNA coding the first fusion protein, wherein the tag peptides are peptide epitopes, and the tag peptide-binding portion is an anti-peptide-epitope antibody, and wherein the peptide epitopes are general control non-derepressible 4 (GCN4) peptide epitopes, and the anti-peptide-epitope antibody is an anti-GCN4 peptide epitope antibody; (2) a second fusion protein(s) comprising a tag peptide-binding portion and a methylase or demethylase, or an RNA(s) or DNA(s) coding the second fusion protein, wherein the demethylase is a catalytic domain of ten-eleven translocation 1 (TET1CD) and the methylase is DNA methyltransferase 3 beta (DNMT3B); and (3) a guide RNA(s) (gRNA(s)) comprising a sequence complementary to a DNA sequence within 1 kb from a desired site of methylation or demethylation, or a DNA(s) expressing the gRNA(s).

2. The DNA methylation editing kit according to claim 1, wherein the antibody is a single-chain antibody (scFv).

3. The DNA methylation editing kit according claim 1, wherein the linkers consist of 15 to 40 amino acids.

4. The DNA methylation editing kit according to claim 1, wherein the fusion proteins of the (1) and/or (2) further comprise a selection marker as a part of the fusion protein.

5. The DNA methylation editing kit according to claim 1, which contains plural gRNAs.

6. The DNA methylation editing kit according to claim 1, wherein all the DNAs of the (1) to (3) are contained in a single vector.

7. A set of vectors each comprising the following (1) to (3): (1) RNA(s) or DNA(s) encoding a first fusion protein wherein the first fusion protein comprising inactivated CRISPR-associated endonuclease Cas9 (dCas9) having no nuclease activity and a tag peptide array in which a plurality of tag peptides are linked by peptide linkers consisting of 15 to 50 amino acids; (2) RNA(s) or DNA(s) encoding a second fusion protein, wherein the second fusion protein(s) comprises a tag peptide-binding portion and a methylase or demethylase, wherein the demethylase is a catalytic domain of ten-eleven translocation 1 (TET1CD) and the methylase is DNA methyltransferase 3 beta (DNMT3B); and (3) a guide RNA(s) (gRNA(s)) comprising a sequence complementary to a DNA sequence within 1 kb of a desired site of methylation or demethylation, or a DNA(s) expressing the gRNA(s).

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIG. 1 is a view illustrating the components of transfected vectors (Example 1).

(2) FIG. 2 Section (a) at FIG. 2 is a view illustrating a STAT3 banding site and a mouse Gfap site. The STAT3 binding site has a methylation-sensitive CpG site (CG in TTCCGAGAA)). Targets 1 to 3 used as gRNAs (Gfap1-3) are indicated by black thick bars. Section (b) of FIG. 2 is a graph illustrating the demethylation activity dCas9 (system 1) directly bound to a TET1 catalytic domain (TET1CD) in which gRNAs targeting Gfap1-3 are used. The ordinate represents a value calculated by the Numerical Formula in the table (the same the Numerical Formula 1 shown below) as a standardized demethylation percentage (%).

(3) FIG. 3A is a view illustrating a scheme of demethylation amplification based on dCas9 and a repeating peptide array. Inactivated Cas9 (dCas9) fused with the repeating peptide array and having no nuclease activity can recruit plural pieces of scFv antibody-fused TET1CD. Therefore, the plural pieces of TET1CD can more effectively demethylate a target.

(4) FIG. 3B is a view illustrating a case in which the length of a linker separating each GCN4 peptide epitope fused with dCas9 is too short (left), a case in which the length is appropriate (center), and a case in which the length is too long (right).

(5) FIG. 4 In section (a) of FIG. 4, the ordinate represents a value calculated by the Numerical Formula 1 shown below as a standardized demethylation percentage (%). The abscissa represents the system of a vector used and the presence or absence of sorting. Target 2 of Gfap was used as a gRNA. Section (b) of FIG. 4 is a view illustrating the methylation in the peripheries of target sites. ESCs transfected with gRNAs targeting system 3 and Gfap2 or a control gRNA were sorted by GFP, and methylation was analyzed by bisulfite sequencing. A black-and-white-style circle represents the percentage of the methylation, and the black represents methylation while the white represents unmethylation. The number under the circle represents each position. Statistical significances between all CpG site sets in the two groups (Gfap and control) were evaluated by Mann-Whitney U test.

(6) FIG. 5 is a view illustrating the methylation in the peripheries of off-target sites 1 to 3 of a gRNA targeting Gfap2. ESCs transfected with gRNAs targeting system 3 and Gfap2 were sorted by GFP, and the methylation of the peripheries of the off-target sites 1 to 3 was analyzed by bisulfite sequencing. A black-and-white-style circle represents the percentage of the methylation, and the black represents methylation while the white represents unmethylation. The number under the circle represents each position. Statistical significances between all CpG site sets in the two groups (Gfap and control) were evaluated by Mann-Whitney U test. The underlined portions of the sequences represent portions in which Gfap2 targets and nucleotide sequences match with each other.

(7) FIG. 6 Section (a) of FIG. 6 illustrates CTCF binding sites and a mouse H19 site. The CTCF binding sites have methylation-sensitive CpG sites (m1 to m4). Sites 1 to 4 used in the targets of gRNAs are illustrated under vertically long bars representing m1 to m4. Section (b) of FIG. 6 illustrates the demethylation of m2 in the CTCF binding sites using systems 1 and 3, and system 3+sorting. The ordinate represents a value calculated by the Numerical Formula 1 shown below as a standardized demethylation percentage (%). The abscissa represents the system of a vector used and the presence or absence of sorting. Section (c) of FIG. 6 is a graph illustrating the demethylation is the CTCF binding sites (m1 to m4) in the case of using system 3+sorting. Left and right bars in each site of m1 to m4 represent demethylation in the case of using the target site 2 as a gRNA and demethylation in the case of using all the gRNAs of the target sites 1 to 4 together, respectively. The ordinate represents a value calculated by the Numerical Formula 1 shown below as a standardized demethylation percentage (%).

(8) FIG. 7 is a view illustrating the components of transfected vectors (Example 2).

(9) FIG. 8 Section (a) of FIG. 8 illustrates CTCF binding sites and a mouse H19 site. The CTCF binding sites have methylation-sensitive CpG sites (m1 to m4). In Example 2, m2 was used as a target. Section (b) of FIG. 8 illustrates, the methylation of m2 in the CTCF binding sites using system 3+sorting. The ordinate represents a value calculated by the following Numerical Formula 2 as a standardized methylation percentage (%).

DESCRIPTION OF EMBODIMENTS

(10) Embodiments of the present invention will be described in detail below.

(11) In CRISPR/Cas, Cas9, which is a DNA-cleaving enzyme, forms a complex with a short RNA (guide RNA (gRNA)) comprising an about-20-bp sequence complementary to a target, and cleaves DNA as a target (Non Patent Literature 2). In such a case, when a mutant enzyme having no DNA cleavage activity, referred to as dCas9, is used, only binding to a target can be achieved without cleaving the target. Thus, recruitment of factors that perform methylation and demethylation by linking various components to dCas9 enables the methylation of a particular gene to be regulated. When a system where dCas9 linked with a tag peptide array comprising plural tag peptides, and a is peptide-binding portion such as a single-chain antibody (scFv) for a tag peptide fused with a factor performing methylation and demethylation are used, and plural methylation factors or demethylation factors can be recruited for one molecule of dCas9, and an ability to perform the methylation or demethylation can be enhanced (FIG. 3a).

(12) In the present invention, first, a sequence (target sequence) complementary to a DNA sequence within 1 kb from a desired site of methylation or demethylation is produced, and a gRNA comprising the target sequence is produced. The gRNA has a property of forming a complex, with dCas9 having no nuclease activity. When a fusion protein of dCas9 and a tag peptide array is produced, the gRNA forms a complex with the fusion protein, through dCas9, and therefore, a gRNA-dCas9-tag peptide array complex is formed. The gRNA is bound to a sequence complementary to a target sequence included in the gRNA, and therefore, the gRNA-dCas9-tag peptide array complex is bound to a DNA sequence within 1 kb from a desired site of methylation or demethylation. A fusion protein of a tag peptide-binding portion and a methylase or demethylase is recruited within 1 kb from the desired site of methylation or demethylation by binding of the tag peptide-binding portion to the tag peptide array. The recruited methylase or demethylase methylates or demethylates a site within 1 kb from its recruited portion (FIG. 3a).

(13) (DNA Methylation Editing Kit and DNA Methylation Editing Method)

(14) The present invention relates to a DNA methylation editing kit comprising: (1) a fusion protein of inactivated CRISPR-associated endonuclease Cas9 (dCas9) having no nuclease activity and a tag peptide array in which plural tag peptides such as GCN4 are linked by linkers, or an RNA or DNA coding therefor; (2) a fusion protein(s) of a tag peptide-binding portion such, as an anti-tag peptide antibody and a methylase or demethylase, or an RNA(s) or DNA(s) coding therefor; and (3) a guide RNA(s) (gRNA(s)) comprising a sequence complementary to a DNA sequence within 1 kb from a desired site of demethylation, or a DNA(s) expressing the gRNA(s). In addition, the present invention relates to a DNA methylation editing method comprising transfecting a cell with the (1) to (3) described above.

(15) The DNA methylation editing includes both of the methylation of a DNA unmethylated site and the demethylation of a DNA methylated site.

(16) (Inactivated Cas9 Having No Nuclease Activity)

(17) CRISPR-associated end nuclease Cas9 (Cas9) includes two lobes of a RLC lobe (REC: recognition) and a NUC lobe (NUC: nuclease), in which the NUC lobe is a site responsible for nuclease activity (Non Patent Literature 2). Thus, inactivated Cas9 (dCas9) having no nuclease activity in the present invention can be produced by introducing a mutation into the NUC lobe of Cas9. As a result, the nuclease activity of Cas9 can be inactivated while maintaining the capacity of binding to a target site. A site in which the mutation is introduced into the NUC lobe is not limited as long as only the nuclease activity can be inactivated. For example, mutation of Asp10 to alanine (D10A), mutation of His840 to alanine (H840A), and mutation of Asn863 to alanine (N863A) in Cas9 (UniProtKB/Swiss-Prot Q99ZW2) are preferred. Such mutations may be one kind or a combination of two or more kinds thereof.

(18) DNAs encoding dCas9 can be produced by introducing mutations into DNAs encoding Cas9 that can be obtained from GenBank and the like. Alternatively, plasmids comprising commercially available dCas9 may be obtained from Addgene and the like and used, DNAs encoding dCas9 may be obtained by PCR with the plasmids as templates or may be artificially produced using an artificial gene synthesis technology known to those skilled in the art, and methods of obtaining the DNAs are not limited. RNAs encoding dCas9 may be obtained by known molecular biological techniques, of which any may be used. For example, such an RNA may be obtained by using a DNA encoding the dCas9 as a template and triggering an RNA polymerase.

(19) (Tag Peptide Array)

(20) The tag peptide array in the present invention refers to a tag peptide array in which plural tag peptides are linked by linkers.

(21) The tag peptides can be optionally selected in combination with a tan peptide-binding portion described later. Examples of the combination of the tag peptides and the tag peptide-binding portion include a combination of a peptide epitope and an antibody recognizing the peptide epitope, and a combination of the small fragment and large fragment of a split protein.

(22) Examples of the combination of a peptide epitope and an antibody recognizing the peptide epitope include: GCN4 and an anti-GCN4 antibody; a His tag and an anti-His tag antibody, an EE hexapeptide and an anti-EE hexapeptide antibody; a c-Myc tag and an anti-c-Myc tag antibody; an HA tag and an anti-HA tag antibody; an S tag and an anti-S tag antibody; and a FLAG tag and an anti-FLAG tag antibody (Protein Engineering, Design & Selection vol. 24 no. 5 pp. 419-428, 2011). Among them, a peptide included in GCN4 is preferably used, the amino acid sequence of GCN4 can be obtained from, for example, PDB, and the DNA sequence of GCN4 can be obtained from GenBank or the like. Those skilled in the art can also obtain an RNA sequence corresponding to the DNA sequence on the basis of information on the DNA sequence by using nucleotide sequence conversion software and the like. The GCN4 peptide epitope can be used without limitation as long as being an epitope in GCN4, and an amino acid sequence represented by SEQ ID NO: 1 is preferred. Information on the amino acid sequences of the other tag peptides and the nucleotide sequences encoding the amino acid sequences can be obtained from known databases and the like.

(23) The split protein refers to a pair of proteins in which, in the case of dividing a certain protein into two portions, the two portions of the protein are reassociated, thereby enabling formation of the same structure as that of the original protein. Particularly in the case of dividing the original protein into the two portions, one portion as a short peptide (small fragment) may be used with a tag peptide, and the other longer portion (large fragment) may be used as a tag peptide-binding portion (Current Opinion in Chemical Biology 2011, 15: 789-797). A known split protein can be used as the split protein which can be used for such a purpose, and examples thereof include GFP (green fluorescent protein).

(24) Further, binding of a peptide and a protein domain is compiled into a database, and a combination of a tag peptide and a tag peptide-binding portion can be found with reference to, for example, Peptide Binding Proteins Database (http://pepbind.bicpu.edu.in/home.php). For example, since PDZAlpha-Syntrophin PDZ protein interaction domain can be bound to GVKESLV (SEQ ID NO: 44), GVKESLV can be used with a tag peptide, and the PDZ domain can be used as a tag peptide-binding portion.

(25) Further, the binding strength of a pair of a peptide and a peptide binding portion can be increased by connecting another unrelated domain with a linker and performing domain interface evolution. Methylation cart be further efficiently regulated by using such a pair (Prot. Natl. Acad. Sci. USA, 2008, vol, 105 no. 18, 6578-6583).

(26) Linkers interposed in a tag peptide array comprising such plural tag peptides as described above include any sequence as long as the linkers do not inhibit binding of the peptides and peptide-binding portions or the desired effect of the present invention. Examples of the linkers include a repeating sequence of glycine and serine. The length of such a linker can be set as appropriate according to the kind of a methylase or demethylase and the like, and is preferably 5 to 100 amino acids, more preferably 5 to 50 amino acids, and still more preferably 10 to 50 amino acids. In the case of TET and DNMT described later, the length is more preferably 15 to 40 amino acids, still more preferably 17 to 30 amino acids, and most preferably 22 amino acids. When the length of the linker is 10 amino acids in the case of the repeating sequence of glycine (G) and serine (S), for example, the linker sequence may be GSGSG (SEQ ID NO: 45), GSGSGGSGSGSGGSGSGGSGSG (SEQ ID NO: 46), or GSGSGGSGSGGSGSGGSGSGGSGGSGSGGSGSGGSGSGGSGSG (SEQ ID NO: 47).

(27) The tag peptide array in the present invention refers to a tag peptide array in which assuming that a combination of a tag peptide and a linker is one unit, one or plural units are repeatedly linked. The plural units mean two or more units. The number of repeated units can be increased or decreased as appropriate depending on the distance between a target site and a methylated or demethylated site, the kind of a methylase or demethylase, and the like, and may be, for example, 3 to 5.

(28) DNA encoding a tag peptide array can be produced by adding a DNA sequence encoding a desired linker to DNA encoding a tag peptide that can be obtained from GenBank or the like. A method of obtaining the DNA by a molecular biological technique based on information on a DNA sequence is known. For example, the DNA can be artificially produced using an artificial gene synthesis technology known to those skilled in the art, and the method of obtaining the DNA is not limited. Those skilled in the art can also obtain an RNA sequence corresponding to the DNA sequence on the basis of information on the DNA sequence by using nucleotide sequence conversion software and the like.

(29) (Fusion Protein of dCas9 and Tag Peptide Array, or RNA or DNA Coding Therefor)

(30) DNA encoding a fusion protein of dCas9 and a tag peptide array can be produced by binding of DNA encoding the dCas9 defined above and DNA encoding the tag peptide array by using an optional method including a well-known gene manipulation method, and is not particularly limited. A DNA sequence encoding a selection marker may also be inserted into the DNA encoding the fusion protein. The selection marker enables cells into which the DNA encoding the fusion protein is introduced to be selected by cell sorting or the like. Examples of the selection marker include, but are not limited to, genes encoding fluorescent proteins such as GFP Ds-Red, and mCherry, and drug resistance genes such as puromycin resistance genes and neomycin resistance genes. The fusion protein or RNA encoding the fusion protein can be obtained by a known molecular biological technique using DNA encoding the fusion protein, and can be obtained by, for example, inserting DNA encoding the fusion protein into an appropriate expression vector and expressing the protein or the RNA.

(31) (Tag Peptide-Binding Portion)

(32) As the tag peptide-binding portion, an anti-tag peptide (peptide epitope) antibody, the large fragment of a split protein, or the like can be used depending on the kind of tag peptide, as described above. The anti tag peptide antibody means an antibody that specifically recognizes a tag peptide. The anti-tag peptide antibody includes polyclonal antibodies and monoclonal antibodies. The monoclonal antibodies include monoclonal antibodies, the fragments of monoclonal antibodies, f(ab).sub.2 antibodies, F(ab) antibodies, short-chain antibodies (scFv), diabodies, and minibodies. DNA encoding the anti-tag peptide antibody can be obtained by a known molecular biological technique, can be obtained by amplifying, for example, a commercially available plasmid such as Addgene plasmid 60904 by PCR, or may be artificially produced using an artificial gene synthesis technology known to those skilled in the art, and a method of obtaining the DNA is not limited. The anti-tag peptide antibody or RNA encoding the anti-tag peptide antibody can be obtained by inserting the DNA encoding the anti-tag peptide antibody into an appropriate expression vector and expressing the protein or the RNA.

(33) (Methylase and Demethylase)

(34) The methylase in the present is can be used without limitation as long as being an enzyme that catalyzes the methylation of an unmethylated site, and includes a methylase which is an enzyme that methylates a particular base on a DNA nucleotide sequence, and a methyltransferase which is an enzyme transferring a methyl group to a particular base, and more specific examples thereof include DNA methyltransferase 3 beta (DNMT3B), DNA methyltransferase 3 alpha (DNMT3A), and DNA methyltransferase 1 (DNMT1). The demethylase in the present invention can be used without limitation as long as being an enzyme catalyzing a series of reaction leading to the demethylation of a methylation site, and includes ten-eleven translocation 1 (TET1), ten-eleven translocation 2 (TET2), ten-eleven translocation 3 (TET3), and thymine-DNA glycosylase (TDG). These enzymes may be a portion or the whole of an enzyme protein. Preferred examples of the portion of the enzyme protein include a catalytic domain of an enzyme. Information on the sequence of DNAs encoding the enzymes can be obtained from GenBank and the like, and the DNAs can be produced from the cDNAs of target animals such as human by PCR. Alternatively, the DNAs encoding the enzymes may be artificially produced using an artificial gene synthesis technology known to those skilled in the art, and methods of obtaining the DNAs are not limited. The enzymes or RNAs encoding the enzymes can be obtained by inserting the DNAs into appropriate expression vector and expressing the proteins or RNAs.

(35) (Fusion Protein of Tag Peptide-Binding Portion and Methylase or Demethylase, or RNA or DNA Encoding Fusion Protein)

(36) DNA encoding a fusion protein of a tag peptide-binding portion such as an anti-peptide-epitope antibody and a methylase or demethylase can be produced by linking DNA encoding the tag peptide-binding portion defined above with DNA encoding a methylase or demethylase by using an optional method including a well-known gene manipulation method, and is not particularly limited. A DNA sequence encoding a selection marker may also be inserted into DNA encoding the fusion protein. The selection marker enables cells into which the DNA encoding the fusion protein is introduced to be selected by cell sorting or the like. Examples of the selection marker include, but are not limited to, genes encoding fluorescent proteins such as GFP, Ds-Red, and mCherry, and drug resistance genes such as puromycin resistance genes and neomycin resistance genes. When a DNA sequence encoding a selection marker is inserted into the DNA encoding the fusion protein of the dCas9 and the tag peptide array, a selection marker different from the selection marker may be inserted into DNA encoding a fusion protein of a tag peptide-binding portion and a methylase or demethylase. The fusion protein or RNA encoding the fusion protein can be obtained by a known molecular biological technique using DNA encoding the fusion protein, and can be obtained by, for example, inserting DNA encoding the fusion protein into an appropriate expression vector and expressing the protein or the RNA.

(37) (Guide RNA (gRNA) or DNA Expressing Guide RNA)

(38) The guide RNA (gRNA) in the present invention is a guide RNA in which a tracrRNA and a crRNA are artificially linked in a CRISPER method. By a known technique based on an RNA sequence described in Non Patent Literature 2 (p. 1698), DNA corresponding to the RNA sequence can be obtained as DNA expressing tracrRNA. For example the DNA may be artificially produced using an artificial gene synthesis technology known to those skilled in the art, and a method of obtaining the DNA is not limited. Alternatively, a plasmid that enables a desired gRNA to be expressed by inserting a DNA sequence corresponding to an arbitrary crRNA is commercially available (Addgene plasmid 41824 or the like) and may be therefore used. A sequence complementary to a DNA sequence within 1 kb from a desired site of methylation or demethylation is used as the crRNA. One kind of the gRNA is acceptable, or plural gRNAs each comprising different crRNAs may be used.

(39) (All-In-One Vector)

(40) The DNAs encoding the two fusion proteins described above may be further linked, resulting in DNA encoding a fusion protein of dCas9, a tag peptide array, a tag peptide-binding portion, and a methylase or demethylase, which may be incorporated into a vector and may be used. The vector comprising the DNA is referred to as an all-in-one vector. A linker may be inserted as appropriate into the DNA encoding the fusion protein. For example, when a 2A peptide derived from a virus is inserted as a linker between a fusion protein (regarded as a component 1) of dCas9 and a tag peptide array and a fusion protein (regarded as a component 2) of a tag peptide-binding portion and a methylase or demethylase, the 2A peptide is cleaned by the 2A peptidase in a cell, and therefore, the components 1 and 2 are prevented from being linked and expressed as two separated proteins. The all-in-one vector may also include a gRNA.

(41) Examples of vectors composing desired genes in the present invention include a vector that can be replicated in a eukaryotic cell, a vector which maintaining an episome, and a vector incorporated into a host cell genome, and viral vectors are preferred, and adenovirus vectors, lentiviral vectors, and adeno-associated virus vectors are more preferred. Such a vector may include a selection marker. Selection marker refers to a genetic element which provides a selectable phenotype to a cell into which the selection marker is introduced, and is commonly a gene of which a gene product imparts resistance to an agent that inhibits cell proliferation or kills or wounds a cell. Specific examples thereof include Neo gene, Hyg gene, hisD gene, Gpt gene, and Ble gene. Examples of a drug useful for selecting the presence of the selection marker include G418 for Neo, hygromycin for Hyg, histidinol for hisD, xanthine for Gpt, and bleomycin for Ble.

(42) (Transfection Into Cell)

(43) Transfection of DNA, RNA, and a protein into a cell can be performed by using known optional means or may be performed using a commercially available reagent for transfection. For example, electroporation, Lipofectamine 2000 (Invitrogen), jetPRIME Kit (Polyplus-transfection), DreamFect (OZ Biosciences), GenePorter3000 (OZ Biosciences), Calcium Phosphate Transfection Kit (OZ Biosciences), and the like can be used for transfection of DNA. Electroporation, Lipofectamine 3000 (Invitrogen), RNAi Max (Invitrogen) MessengerMAX (Invitrogen), and the like can be used for transfection of RNA. Electroporation, Lipofectamine CRISPRMAX (Invitrogen), PULSin (Polyplus-transfection), Pro-DeliverIN (OZ Biosciences), BioPORTER Protein Delivery Reagent (Genlantis), and the like can be used for transfection of a protein. Transection into a cell may also performed by forming a complex of a gRNA and a fusion protein of dCas9 and a tag peptide array, in advance, and transfecting the complex into the cell. DNA, RNA, or a protein can also be introduced into a fertilized egg by microinjection or electroporation.

EXAMPLES

(44) The present invention will be further described below with reference to non-limiting examples. In the present examples, GCN4 was used as a tag peptide. However, the GCN4 can be replaced with another tag peptide.

Example 1. Demethylation of Target Using TET1CD

(45) <Plasmid Construction for Target Demethylation>

(46) A dCas9-TET1 catalytic domain (CD) fusion protein expression vector (pCAG-dCas9TET1CD) was produced by fusing cDNA encoding codon-optimized S. pyogenes Cas9 (dCas9) as a catalytically inactive nuclease to a catalytic domain in the N-terminus of human TET1CD (System 1). A dCas9 fragment was amplified from Addgene plasmid 48240 by PCR. A TET1CD fragment was amplified from human cDNA by PCR.

(47) The dCas9 fragments of Systems 1 to 4 in FIG. 1 were amplified from Addgene plasmid 60903 by PCR. The amino acid sequence of used GCN4 was EELLSKNYHLENEVARLKK (SEQ ID NO: 1). Linker sequences between GCN4 tire GSGSG (SEQ ID NO: 2: System GSGSGGSGSGSGGSGSGGSGSG (SEQ ID NO 3: System 3), and GSGSGCSGSGGSGSGGSGSGGSGGSGSGGSGSGGSGSGGSGSG (SEQ ID NO: 4: System 4). A GFP fragment was amplified from Addgene plasmid 60904. An ScFv fragment was also amplified from Addgene plasmid 60904. All the fusion proteins were expressed under the control of a CAG promoter. An all-in-one vector was produced by fusing a 2A peptide (SEQ ID NO: 5: GSGATNFSLLKQAGDVEENPGP) into between the components 1 and 2 of System 3. Vector sequences are shown in SEQ ID NOS. 6 to 11 (which are System 1 (pCAG-dCas9TET1CD), dCas9-GCN4 fusion protein of System 2 (pCAG-dCas9-10xGCN4_v4), scFv-TET1CD fusion protein of Systems 2 to 4 (pCAG-scFvGCN4sfGFPTET1CD), dCas9-GCN4 fusion protein of System 3 (pCAG-dCas9-5xPlat2AflD, dCas9-GCN4 fusion protein of System 4 (pCAG-dCas9-3.5xSuper), and all-in-one vector (pPlatTET-gRNA2), respectively).

(48) <Construction of gRNA>

(49) A RNA vector for Gfap or H19 was produced by inserting a target sequence into Addgene plasmid 41834. Cloning was performed by Gibson assembly system via the linearization of an AflII site and the insertion of a gRNA fragment.

(50) Target sequences are set forth in Table 1.

(51) TABLE-US-00001 TABLE1 TargetSequence Target Methylation- Name TargetSequence SensitivesitearoundTarget Gfap_1 ATAGACATAATGGTCAGGGGTGG GfapSTAT3-bindingsite (SEQIDNO:12) Gfap_2 GGATGCCAGGATGTCAGCCCCGG GfapSTAT3-bindingsite (SEQIDNO:13) Gfap_3 ATATGGCAAGGGCAGCCCCGTGG GfapSTAT3-bindingsite (SEQIDNO:14) H19DMR_1 GTGGGGGGGCTCTTTAGGTTTGG H19DMRCTCF-bindingsite1 (SEQIDNO:14) H19DMR_2 ACCCTGGTCTTTACACACAAAGG H19DMRCTCF-bindingsite2 (SEQIDNO:16) H19DMR_3 GAAGCTGTTATGTGCAACAAGGG H19DMRCTCF-bindingsite3 (SEQIDNO:17) H19DMR_4 CAGATTTGGCTATAGCTAAATGG H19DMRCTCF-bindingsite4 (SEQIDNO:18) The underlines show PAM sequences.

(52) TABLE-US-00002 UnrelatedgRNASequence TargetName gRNASequence UR_1 CCATTATTGCATTAATCTGA (SEQIDNO:19) UR_2 TAATGCAGCCAGAAAATGAC (SEQIDNO:20) UR_3 TCAGGGATCAAATTCTGAGC (SEQIDNO:21)

(53) <Cell Culture>

(54) Embryonic stem cells (ESCs) were cultured in Dulbecco's modified Eagle's medium-high-concentration glucose (D6429-500 ML, Sigma) to which 1% FBS, 17.5% KSR100 (10828028, Gibco), 0.2% of 2-mercaptoethanol (21985-023, Gibco), and 110.sup.3 unit/mL (ESG1107, Millipore) of ESGRO mLIF were added under 37 C. and 5% CO.sub.2. The ESCs were transfected using Lipofectamine 2000 (Invitrogen) according to an attached protocol, and the cells were collected 48 hours after the transfection and directly used for an assay and a sort by FACSAriaII (BD Biosciences).

(55) <DNA Methylation Analysis>

(56) Genomic DNA was treated using Epitect Plus DNA Bisulfite Kit (QIAGEN) according to an attached instruction. The modified DNA was amplified using the following PCR primers in Table 2.

(57) TABLE-US-00003 TABLE2 PCRPrimerSequenceforBisulfiteSequence Methylation-SensitiveSite PrimerName PrimerSequence aroundTarget GfapSTAT3-B3 TTGGTTAGTTTTTAGGATTTTTTTT GfapSTAT3-bindingsite(ES) (SEQIDNO:22) GfapSTAT3-B4 AAAACTTCAAACCCATCTATCTCTTC (SEQIDNO:23) H19DMR-B1 AAGGAGATTATGTTTTATTTTTGGA CTCF-bindingsite1 (SEQIDNO:24) H19DMR-B2 AAAAAAACTCAATCAATACAATCC (SEQIDNO:25) Gfap_O1B1 TTGTAAAGGTAGGATTAATAAGGGAATT Gfapoff-targetsite1 (SEQIDNO:26) Gfap_O1B2 AAAAAAAACCCTTCAAAAAAAATCTA (SEQIDNO:27) Gfap_O2B1 TTATTATTTATATTTGGAGGGAGGG Gfapoff-targetsite2 (SEQIDNO:28) Gfap_O2B2 ATTACACCAAAAAAATTTTAAAAAC (SEQIDNO:29) Gfap_O3B1 TTTAAATTTTTTTATGTGAATATGG Gfapoff-targetsite3 (SEQIDNO:30) Gfap_O3B2 AAACATTTAATTCATTAATACACAC (SEQIDNO:31)

(58) The percentages of the demethylation of the STAT3 site of Gfap and the m1 to m4 sites of H19 were determined by Combined Bisulfite Restriction Analysis (COBRA). The fragments amplified using the primers in Table 3 were cleaved with restriction enzymes having recognition sites in the sites and set forth in Table 3 below and subjected to polyacrylamide gel electrophoresis.

(59) TABLE-US-00004 TABLE3 COBRAPrimerSequence primer primer Restriction methylationsensitivesite name sequence enzyme nearthetargets GfapSTAT3-B1 GTTGAAGATTTGGTAGTGTTGAGTT Hpy188III GfapSTAT3-bindingsite (SEQIDNO:32) GfapSTAT3-B2 TAAAACATATAACAAAAACAACCCC (SEQIDNO:33) H19DMR-B1 AAGGAGATTATGTTTTATTTTTGGA BstUI H19DMRCTCF-bindingsite1 (SEQIDNO:24) H19DMR-B2 AAAAAAACTCAATCAATTACAATCC (SEQIDNO:25) H19DMR-B1 AAGGAGATTATGTTTTATTTTTGGA RsaI H19DMRCTCF-bindingsite2 (SEQIDNO:24) H19DMR-B2 AAAAAAACTCAATCAATTACAATCC (SEQIDNO:25) H19DMR-B3 GGGTTTTTTTGGTTATTGAATTTTAA BstUI H19DMRCTCF-bindingsite3 (SEQIDNO:34) H19DMR-B4 AATACACACATCTTACCACCCCCTATA (SEQIDNO:35) H19DMR-B5 TTTTTGGGTAGTTTTTTTAGTTTTG BstUI H19DMRCTCF-bindingsite4 (SEQIDNO:36) H19DMR-B6 ACACAAATACCATAATCCCTTTATTAAAC (SEQIDNO:37)

(60) The methylation was calculated as the ratio of cleaved DNA by densitometry analysis of a gel stained with ethidium bromide. In each assay, the methylation of cells transfected with a control vector (empty gRNA vector) was defined as 100% methylation (0% demethylation), and the demethylation of each sample was standardized by the control using the following Numerical Formula 1.
Demethylation of sample (%)=methylation of controlmethylation of sample)/methylation of control100Numerical Formula 1

(61) Bisulfite sequencing was carried out for the methylation analysis and off-target analysis of a peripheral region. The amplified fragment was ligated into a TOPO vector (Invitrogen), and sequencing of at least 14 clones was carried out. The sequencing was analyzed by a methylation analysis tool referred to as QUantification tool for Methylation Analysis (QUMA). Statistical significance between two groups of all sets in CpG sites was evaluated using Mann-Whitney U test (also referred to as Wilcoxon matched pairs signed ranks test is called) used for a test of nonparametric statistical significance.

(62) <Results>

(63) First, a simple design which was a direct fusion protein of inactivated Cas9 nuclease (dCas9) and TET1 was produced for methylation treatment. TET1 has a catalytic domain preserved in a C-terminus, and this domain has higher catalytic activity than that of a full-length protein. Therefore, the TET1 catalytic domain (TET1CD) was fused to dCas9 having inactive catalytic action (System 1 in FIG. 1).

(64) A cytosine residue in a STAT3-binding site located upstream of a gene encoding glial fibrillary acidic protein (GFAP) which is an astrocyte-specific marker was used as a target. The site is methylated in many cell types excluding astrocytes, and the demethylation of the site plays an important role in differentiation of neural precursor cells (NPCs) into astrocytes. Three targets around the STAT3-binding site were designed (FIG. 2a), and a gRNA vector for the targets was produced. The gRNA vector was transiently introduced, together with a dCAS9-TET1CD fusion protein expression vector (pCAG-dCas9TET1CD), into embryonic stem cells (ESCs). The methylation of the STAT3-binding site was analyzed by Combined Bisulfite Restriction Analysis (COBRA). In each assay, the methylation of cells into which a gene was introduced together with a control vector (empty gRNA vector) was defined as 0% demethylation (100% methylation), and the demethylation of each sample was standardized by the control.

(65) In the STAT3 site, the three gRNAs, Ffap1, Gfap2 and Gfap3, showed demethylations of 3%, 14%, and 9%, respectively (FIG. 2b). In contrast, the unrelated gRNAs (UR1, UR2, and UR3) showed no demethylation. Thus, this simple system induced gRNA-dependent specific demethylation, but the degree of the demethylation was shown to be at most 14%.

(66) Then, an attempt to amplify a demethylation ability was made using dCas9 fused in a repeating peptide sequence in order to recruit plural copies of the antibody fused TET1 hydroxylase catalytic domain (FIG. 3a). For the demethylation of the Gfap STAT3 site, an expression vector of Gfap2gRNA, dCas9 having 10 copies of GCN4 peptides, and a GCN4 peptide antibody (scFv)-superfolder green fluorescent protein (sfGFP)-TET1CD fusion protein was used in ESCs (System 2 in FIG. 1). However, the use of this System 2 did not allow the degree of the demethylation to be improved (FIG. 4a).

(67) The length of a linker by which the sequence of a GCN4 peptide epitope comprising 19 amino acids was separated was examined in order to investigate the reason why System 2 failed to improve the degree of the demethylation. If the length of the linker is too short, it is considered that for the antibody-TET1CD fusion protein, a space for approaching and binding to the GCN4 peptide sequence is too narrow, and therefore, demethylation activity becomes insufficient. If the length of the linker is too long, it is considered that the antibody-TET1CD fusion protein is incapable of approaching a target methylated site (FIG. 3b). The length of the linker of System 2 was 5 amino acids (System 2 in FIG. 1).

(68) A dCas9-GCN4 fusion protein having a linker of which the length was 22 amino acids (System 3 in FIG. 1) and a dCas9-GCN4 fusion protein having a linker of which the length was 43 amino acids (System 4 in FIG. 1) were produced, and the demethylation activities thereof were compared. Because of technological limitation in a synthetic gene technology, the numbers of copies of GCN4 peptides having a linker of which the length was 22 amino acids and a linker of which the length was 43 amino acids were decreased to 5 and 4, respectively. In spite of the decreases in the numbers of the copies of the GCN4 peptides, the linker of which the length was 22 amino acids showed a best demethylation of 43%. The linker of which the length was 44 amino acids showed a second highest activity, and the linker, as a prototype, of which the length was 5 amino acids showed the lowest activity (FIG. 4a).

(69) These results suggested that the length of a linker by which each GCN4 peptide unit sequence fused with dCas9 is separated is more important for demethylation activity than the number of copies of GCN4. The demethylation activity was prominently improved by increasing the length of the linker from 5 amino acids to 22 amino acids. This is considered to be because the 22 amino acids have a width enough for the antibody-TET1CD fusion protein to approach a peptide sequence. In contrast, the linker of which the length was 43 amino acids was considered to be long for the antibody-TET1CD fusion protein to approach a methylated site which was a target.

(70) Cells into which GFP expression vector was introduced were selected using fluorescence activated cell sorting (FACS) for the purpose of further improving demethylation efficiency. For this purpose, an all-in-one vector comprising a gRNA, dCas9 comprising the GCN4 sequence of System 3, and an antibody-sfGFP-TET1CD fusion protein was produced (FIG. 1). The all-in-one introduced ESCs sorted by GFP showed roughly complete demethylation (FIG. 4). The ESCs into which System 3 was introduced and which was sorted by GFP also unexpectedly showed roughly complete demethylation (FIG. 4). Complete demethylation in a target region was achieved by the promotion of the demethylation ability and the sorting technology.

(71) Then, the range of the demethylation of a used sorted sample from a target site was investigated by bisulfite sequencing. The demethylation occurred even at a site located at least 100 bp or more apart from the target site (FIG. 4b). Investigation of off-target activity by bisulfite sequencing using the same sample resulted in no observation of noticeable off-target activity (FIG. 5).

(72) Then, a similar experiment was conducted using a differential methylation region (DMR) of H19 as a paternal methylated imprinting gene. The DMR of H19 includes four methylation-sensitive CTCF binding sites (m1 to m4), which are important for adjusting H19 imprinting (FIG. 6a). A gRNA (H19DMR2) targeting m2 was introduced, together with dCas9-TET1CD or System 3, into ESCs. The cells into which System 3 bad been introduced and which were subjected to cell sorting after the introduction were also produced.

(73) As a result, noticeable improvement in methylation in System 3 was observed in comparison with dCas9-TET1CD. Complete demethylation was observed at the m2 site in the cells sorted by GFP (FIG. 6b). Further analyzation of the cells sorted by GFP for the methylation of a peripheral region showed complete demethylation at the m1 site located 200 bp apart from the target region (FIG. 6c). In contrast, the slight demethylation of the m3 and m4 sites located 1 kb or more apart from the target site merely occurred (FIG. 6c), and it was suggested that the effect of the demethylation was not greater than that of a site located 1 kb or more apart. In order to test the possibility of targeting of plural of sites, the gRNAs of m1 to m4 were introduced together with System 3 (H19DMR1-4). As a result, roughly complete demethylation was observed in all of the four sites (m1 to m4) in the cells sorted by GFP (FIG. 6c). This showed that plural sites can be demethylated by using plural gRNAs.

Example 2. Methylation of Target Using Dnmt3b

(74) The m2 site of H19 was methylated using System 3 (linker 22aa) in order to introduce methylation into a target. Experiments were conducted using (1) Dnmt3b, (2) Dnmt3bNLS, and (3) Dnmt3bNLS_N662R instead of TET1CD (FIG. 7). (1) is a De novo methylase Dnmt3b, (2) is obtained by adding NLS (nuclear localization signal) to the C terminus of the Dnmt3b of (1), and (3) is obtained by changing the 662nd amino acid of (2) from asparagine (N) to arginine (R). This amino acid substitution has been reported to improve methylation activity (Shen L et al. below). The plasmids used are as follows.

(75) (1) Dnmt3b: pCAG-scFvGCN4sfGFPDnmt3bF (SEQ ID NO: 41)

(76) (2) Dnmt3bNLS: pCAG-scFvGCN4sfGFPDnmt3bFNLS (SEQ ID NO: 42)

(77) (3) Dnmt3bNLS_N662R: pCAG-scFvGCN4sfGFPDnmt3bS1 (SEQ ID NO: 43)

(78) Only cells into which genes were introduced and which emitted fluorescence were isolated based on fluorescence of GFP by a cell sorter 2 days after introduction of these systems of (1) to (3) into ES cells, and the methylation of the m2 of H19 was examined in a manner similar to that in the demethylation. The methylation was calculated as a methylation (%) standardized by a control, as shown in Numerical Formula 2. As a result, the methylations of the targets were (1) 54%, (2) 74%, and (3) 84%, revealing that methylation efficiency in the case of adding NLS was higher than that in the case of only Dnmt3b, and methylation efficiency in the case of the amino acid substitution of N662R was further higher (FIG. 8).
Methylation (%) standardized by control=(methylation of samplemethylation of control/methylation of control100Numerical Formula 2

REFERENCES

(79) Shen L, Gao G, Mann Y, Zhang; H, Ye Z, Huang S, Huang J, Kang J. A single amino acid substitution confers enhanced methylation activity of mammalian Dnmt3b on chromatin DNA, Nucleic Acids Res. 38:6054-6064, 2010, doi: 10.1093/nar/gkq456.

(80) SEQ ID NO: 1: GCN4

(81) SEQ ID NO: 2: linker 5

(82) SEQ ID NO: 3: linker 22

(83) SEQ ID NO: 4: linker 43

(84) SEQ ID NO: 5: 2A peptide

(85) SEQ ID NO: 6: pCAG-dCas9TET1 CD

(86) SEQ ID NO: 7: pCAG-dCas9-10GCN4_v4

(87) SEQ ID NO: 8: pCAG-scFvGCN4sfGFPTET1CD

(88) SEQ ID NO: 9: pCAG-dCas9-5xPlat2AflD

(89) SEQ ID NO: 10: pCAG-dCas9-3.5xSuper

(90) SEQ ID NO: 11: pPlatTET-gRNA2

(91) SEQ ID NO: 12: Gfap_1

(92) SEQ ID NO: 13: Gfap_2

(93) SEQ ID NO: 14: Gfap_3

(94) SEQ ID NO: 15: H19DMR_1

(95) SEQ ID NO: 16: H19DMR_2

(96) SEQ ID NO: 17: H19DMR_3

(97) SEQ ID NO: 18: H19DMR_4

(98) SEQ ID NO: 19: UR_1

(99) SEQ ID NO: 20: UR_2

(100) SEQ ID NO: 21: UR_3

(101) SEQ ID NO: 22: GfapSTAT3-B3

(102) SEQ ID NO: 23: GfapSTAT3-B4

(103) SEQ ID NO: 24: G19DMR-B1

(104) SEQ ID NO: 25: H19DMR-B2

(105) SEQ ID NO: 26: Gfap_O1B1

(106) SEQ ID NO: 27: Gfap_O1B2

(107) SEQ ID NO: 28: Gfap_O2B1

(108) SEQ ID NO: 29: Gfap_O2B2

(109) SEQ ID NO: 30: Gfap_O3B1

(110) SEQ ID NO: 31: Gfap_O3B2

(111) SEQ ID NO: 32: GfapSTAT3-B1

(112) SEQ ID NO: 33: GfapSTAT3-B2

(113) SEQ ID NO: 34: H19DMR-B3

(114) SEQ ID NO: 35: H19DMR-B4

(115) SEQ ID NO: 36: H19DMR-B5

(116) SEQ ID NO: 37: H19DMR-B6

(117) SEQ ID NO: 38: off target 1

(118) SEQ ID NO: 39: off target 2

(119) SEQ ID NO: 40: off target 3

(120) SEQ ID NO: 41: pCAG-scFvGCN4sfGFPDnmt3bF

(121) SEQ ID NO: 42: pCAG-scFvGCN4sfGFPDnmt3bFNLS

(122) SEQ ID NO: 43: pCAG-scFvGCN4sfGFPDnmt3bS1

(123) SEQ ID NO: 44: tag peptide GVKESLV

(124) SEQ ID NO: 45: GS linker

(125) SEQ ID NO: 46: GS linker

(126) SEQ ID NO: 47: GS linker

INDUSTRIAL APPLICABILITY

(127) The methylation of a particular gene can be controlled according the present invention. As a result, model cells and animals with diseases (epigenome diseases) occurring due to DNA methylation abnormality, such as cancers and imprinting diseases, can be produced. In addition, virus vectors and other delivery systems can be used for treatment of the diseases. In production of iPS cells, the iPS cells can be effectively produced by demethylating and activating a pluripotent gene such as Oct-4 according to the present invention.