PROCESS OF PRODUCING MONOTERPENES

20200102585 ยท 2020-04-02

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to a process of producing a monoterpene and/or derivatives thereof. The process comprises the steps of: a) providing a host microorganism genetically engineered to express a bacterial monoterpene synthase (mTS); and b) contacting geranyl pyrophosphate (GPP) with said bacterial mTS to produce said monoterpene and/or derivatives thereof. The present invention also relates to a microorganism for use in producing a monoterpene and/or derivatives thereof and a recombinant microorganism adapted to conduct the step of converting geranyl pyrophosphate (GPP) into a monoterpene and/or derivatives thereof by expression of a bacterial mTS. It was shown to produce 1,8 cineole using 1,8 cineole synthase and to produce linalool using linalool synthase, both from Streptomyces clavuligerus.

    Claims

    1. A process of producing a monoterpene and/or derivatives thereof in a host microorganism comprising the following steps: (a) providing a host microorganism genetically modified to express a bacterial monoterpene synthase (mTS); and (b) contacting geranyl pyrophosphate (GPP) with said bacterial mTS to produce said monoterpene and/or derivatives thereof.

    2. The process according to claim 1 wherein the host microorganism comprises E. coli.

    3. The process according to claim 1 wherein the bacterial mTS comprises a Streptomyces mTS.

    4. The process according to claim 1 wherein the bacterial mTS comprises a Streptomyuces clavuligerus mTS.

    5. The process according to claim 1 wherein the bacterial mTS comprises cineole-1,8 synthase or linalool synthase.

    6. The process according to claim 1 wherein the process results in a monoterpene yield of at least 100 mg/L.sub.org.sup.1.

    7. The process according to claim 1 wherein the process results in a monoterpene yield of at least 300 mg/L.sub.org.sup.1.

    8. A microorganism for use in producing a monoterpene and/or derivatives thereof according to the process of claim 1.

    9. A recombinant microorganism adapted to conduct the following step: converting geranyl pyrophosphate (GPP) into a monoterpene and/or derivatives thereof by expression of a bacterial monoterpene synthase (mTS).

    10. The use of a bacterial mTS to improve the yield and/or purity of a monoterpene and/or derivatives thereof obtained from GPP.

    Description

    DETAILED DESCRIPTION OF THE INVENTION

    [0087] The present invention will now be further described with reference to the following figures which show:

    [0088] FIG. 1: GC-MS analysis using bacterial 1,8-cineole synthase (bCinS) and bacterial linalool synthase (bLinS). A) bCinS platform product profile. B) bCinS conversion of GPP (20 mM). C) 1,8-cineole standard (0.1 mg/ml). D) bLinS platform product profile. E) bLinS conversion of GPP (20 mM). F) R-linalool standard (0.1 mg/ml). G) cis- and trans-nerolidol standards (0.1 mg/ml). IS=internal standard (sec-butyl benzene).

    [0089] FIG. 2: Structure of bCinS-FNPP complex. Superposition of plant cineole synthase (dark) and bCinS (light). The N-terminal and C-terminal domains of the plant CinS are labelled. An arrow indicates the conformational difference in the helix-break motif.

    [0090] Materials and Methods

    [0091] Expression and Purification of Bacterial 1, 8-Cineole Synthase (bCinS) and Bacterial Linalool Synthase (bLinS)

    [0092] The full-length genes coding for 1,8-cineole synthase (WP_003952918) and linalool synthase (WP_0003957954) from Streptomyces clavuligerus ATCC 27064 were codon optimized and synthesized from GeneArt (Life Technologies). The genes were amplified using PCR and sub-cloned into double digested (Ncol and Xhol) pETM11 vector using Infusion cloning (Clontech). The final construct coded for either 1,8-cineole synthase (bCinS) or linalool synthase (bLinS) with a 6X-His tag followed by a TEV protease cleavage site at the N-terminus. The expression and purification method explained below was identical for both the proteins.

    [0093] The plasmid was transformed into ArcticExpress (DE3) cells (Agilent) and few colonies were inoculated into 100 ml 2X-YT media containing 40 g/ml of kanamycin and 20 g/ml of gentamycin and grown for 3-4 hours at 37 C. The culture was diluted into 3 l of fresh 2-YT media containing 40 g/ml of kanamycin and allowed to grow at 37 C. until the OD at 600 nm reached 0.6-0.8. At this stage, the temperature was reduced to 16 C. and 0.1 mM Isopropyl -D-1-thiogalactopyranoside was added and incubated for 14-18 hours. The cells were harvested by centrifugation at 6000 g for 10 minutes and the pellet was resuspended in buffer A (25 mM Tris pH 8.0, 150 mM NaCl, 1 mM DTT, 4 mM MgCl.sub.2 and 5% (v/v) glycerol). The cells were lysed by sonication and the debris was removed by centrifugation at 30,000 g for 30 minutes. The supernatant was filtered through a 0.2 m filter and loaded onto a 5 ml HisTrap column (GE Healthcare) pre-equilibrated with buffer A. The column was washed with buffer A containing 10 mM imidazole (pH 8.0) and increasing up to 40 mM imidazole by step gradients with 3 column volume for each concentration. Increasing the concentration of imidazole to 200-500 mM eluted the protein. The purified protein was desalted using Centripure P100 column (emp biotech) equilibrated with buffer A. To remove the His tag, TEV protease was added (1:1000 (w/w)) to the protein and incubated at 4 C. with gentle mixing for 24 hours. The TEV protease was removed by passing the protein mixture through a 5 ml HisTrap column and the flow through was collected. The His-tag removed protein was concentrated and loaded onto a Hiload Superdex (26/60) S75 column (GE Healthcare) pre-equilibrated with buffer A. Pure fractions from the gel filtration column were concentrated to 13-15 mg/ml and stored at 80 C. as aliquots.

    [0094] Biotransformations

    [0095] The 0.25 ml reactions were prepared using buffer A and setup in glass vials containing 2 mM GPP and 20 M of bCinS or bLinS. The vials were incubated at 25 C. with gentle shaking for 16 hours. The vials were cooled down to 4 C. and 0.25 ml of ethyl acetate containing 0.01% sec-butyl benzene as internal standard was added. The samples were vortexed for 2 min and then spun at 18,000 g for 5 min. The supernatant fractions containing the ethyl acetate layer were carefully removed and dried over anhydrous magnesium sulfate. The samples were analysed by GC-MS.

    [0096] Linalool and 1,8-Cineole Production in E. coli

    [0097] Both bLinS and bCinS genes, including RBS, were amplified from their respective pETM-11 expression vectors using primers pET_IF_Fw (5-CATCCCCACTACTGAGAATC-3) (SEQ ID No: 1) and pET_IF_Rv (5-GGTGGTGGTGCTCGAGTTA-3) (SEQ ID No: 2) and cloned using InFusion (Takara) into plasmid pGPPSmTS15, which was PCR linearised using the primer pair Vector_IF_Fw (5-TAACTCGAGCACCACCACCACC-3) (SEQ ID No: 3) and Vector_IF_Rv (5-TCAGTAGTGGGGATGTCGTAATCG-3) (SEQ ID No: 4) resulting in plasmids pGPPSmTS38 and pGPPSmTSS39, respectively. Correct insertion was confirmed by automated sequencing (Eurofins).

    [0098] For monoterpenoid production the pGPPSmTS plasmids were co-transformed with pMVA into E. coli DH5a and grown as described previously (Leferink, N. G. H. et al. A Plug and Play Platform for the Production of Diverse Monoterpene Hydrocarbon Scaffolds in Escherichia coli. (2016)). Briefly, expression strains were inoculated in terrific broth (TB) supplemented with 0.4% glucose in glass screw capped vials, and induced for 72 h at 30 C. with 50 M (isopropyl -D-1-thiogalactopyranoside) IPTG and 25 nM anhydro-tetracycline (aTet). A 20% n-nonane layer was added to capture the volatile terpenoids products. After induction, the nonane overlay was collected, dried over anhydrous MgSO.sub.4 and mixed at a 1:1 ratio with ethyl acetate containing 0.1% (v/v) sec-butyl benzene as internal standard.

    [0099] GC-MS Analysis

    [0100] The samples were injected onto an Agilent Technologies 7890B GC equipped with an Agilent Technologies 5977A MSD. The products were separated on a DB-WAX column (30 m0.32 mm i.d., 0.25 M film thickness, Agilent Technologies). The injector temperature was set at 240 C. with a split ratio of 20:1 (1 l injection). The carrier gas was helium with a flow rate of 1 ml min1 and a pressure of 5.1 psi. The following oven program was used: 50 C. (1 min hold), ramp to 68 C. at 5 C. min.sup.1 (2 min hold), and ramp to 230 C. at 25 C. min.sup.1 (2 min hold). The ion source temperature of the mass spectrometer (MS) was set to 230 C. and spectra were recorded from m/z 50 to m/z 250. Compound identification was carried out using authentic standards and comparison to reference spectra in the NIST library of MS spectra and fragmentation patterns as described previously (Leferink, N. G. H. et al. A Plug and Play Platform for the Production of Diverse Monoterpene Hydrocarbon Scaffolds in Escherichia coli. (2016)).

    [0101] Chemical Synthesis of FGPP and FNPP

    [0102] A Horner-Wadsworth-Emmons reaction was performed by treating ethyl (diethoxyphosphoryl)fluoroacetate with sodium hydride followed by 6-methyl-5-hepten-2-one resulting in a mixture of 2-fluoronerol and 2-fluorogeranoil in almost equal ratio (1:1.08) with an 86% yield. The isolated products were then treated with H.sub.3PO.sub.4(Et.sub.3N).sub.2 salt to give the corresponding mono and dephosphorylated products.

    [0103] Crystallization of bCinS and bLinS

    [0104] The crystallization trials containing 200 nl of protein and 200 nl of precipitant solution were setup in 3-well swissci plates using mosquito robot (TTP Labtech). Five screensMorpheus I and II, JCSG+, PACT premier and SG1 (Molecular Dimensions Ltd) were used for initial trails. For bCinS and bLinS, three variants were screenedApo, with 2 mM FGPP and with 2 mM FNPP. The bCinS-FNPP crystallized in Morpheus II A4 condition (90 mM of LiNaK (0.3 M Lithium sulphate, 0.3 M Sodium sulphate, 0.3 M Potassium sulphate), 0.1 M of buffer system 4 (1 M MOPSO, 1 M Bis-Tris) pH 6.5, and 50% precipitant mix 8 (10% PEG 20000, 50% Trimethyl propane, 2% NDSB 195)). The bLinS-FNPP crystallized in Morpheus D7 condition (0.12 M Alcohols (0.2 M 1,6-Hexanediol; 0.2 M 1-Butanol; 0.2 M 1,2-Propanediol; 0.2 M 2-Propanol; 0.2 M 1,4-Butanediol; 0.2 M 1,3-Propanediol) 0.1 M Buffer System 2 7.5 (1.0 M Sodium HEPES; MOPS (acid)) 50% v/v Precipitant Mix 3 (40% v/v Glycerol; 20% w/v PEG 4000)). LinS-apo crystallized in SG1 E2 condition (25% w/v PEG3350). Although bCinS-apo crystallized, optimization of growth conditions failed to produce single crystals of sufficient size for harvesting. The bCinS-FNPP and bLinS-FGPP crystals were cryo-protected by soaking in mother liquor. The bLinS-apo crystals were cryo-protected by soaking in mother liquor supplemented with 20% glycerol. For FGPP and FNPP complexes, the ligands were included in the cryo-solution. The crystals were harvested and cryo-cooled by plunging in liquid nitrogen.

    [0105] Structure Solutions

    [0106] The bLinS and bCinS X-ray datasets were collected at Diamond Light Source (DLS). The images were integrated and scaled by xia2 automated data processing pipeline, using XDS and XSCALE. Crystals of bCinS belonged to the triclinic system (spacegroup P1) and contained two molecules in the asymmetrical unit (ASU), whereas bLinS crystals belonged to the tetragonal system (spacegroup 14) and also contained two molecules in ASU. The bLinS structures (bLinS-apo and bLinS-FGPP) were solved by molecular replacement using Pentalenene synthase structure (PDB 1PS1) as the search model in Phaser. The bCinS-FNPP structure was solved by model replacement using the bLinS-apo structure as the search model. The bLinS-apo, bLinS-FGPP and bCinS-F-NPP models were built using Autobuild in Phenix. The structures were completed using iterative rounds of manual model building in coot and refinement in phenix.refine. The structures were validated using molprobity tools and PDB_REDO.

    [0107] Plasmids

    [0108] Table 1 below shows the plasmids used in this study.

    TABLE-US-00001 TABLE 1 Plasmids used in this study Description (Origin of replication, Antibiotic marker, Reference(s), Plasmid Promoters reference Plasmid name and Operons) Source pMVA BbA5a-MTSAe- p15A, Kanr, Leferink T1f-MBI(f)- PlacUV5, MTSA, et al, T1002i T1, MBI-f, T1002 2016 pGPPSmTS15 pBbB2a- pBBR, Ampr, Ptet, Leferink trAgGPPS(co)- trAgGPPS(co)- et al, 2016 trSLimS_Ms trSLimS_Ms pGPPSmTS38 pBbB2a- pBBR, Ampr, Ptet, This study trAgGPPS(co)- trAgGPPS(co)- bLinS bLinS pGPPSmTS39 pBbB2a- pBBR, Ampr, Ptet, This study trAgGPPS(co)- trAgGPPS(co)- bCinS bCinS

    [0109] Results

    [0110] The present inventors undertook significant testing to determine how monoterpenes might be produced in bacterial hosts with greater efficiency. In particular, the experiments undertaken by the inventors surprisingly identified a number of bacterial mTS, including bLinS and bCinS from Streptomyces clavuligerus, whose expression in an E. coli system resulted in much higher monoterpene production, and in greater purity, than when plant mTS were utilised.

    [0111] Linalool and 1,8-Cineole Production in E. coli

    [0112] When expressed in E. coli, large quantities (>100 mg/litre) of bLinS and bCinS were produced and the enzymes were stable and soluble, when compared to plant mTS which mostly resulted in insoluble or partially soluble material. Biotransformation reactions showed bLinS and bCinS produced linalool and 1,8-cineole respectively when supplied with GPP. No by-products were observed when analyzed by GC-MS (FIG. 1).

    [0113] To test for suitability in synthetic biology approaches, both bLinS and bCinS were inserted in an E. coli plug-and-play monoterpenoid production platform, devised by the inventors, which consists of two gene modules (Leferink, N. G. H. et al. A Plug and Play Platform for the Production of Diverse Monoterpene Hydrocarbon Scaffolds in Escherichia coli. (2016)). The first module (pMVA) contains a hybrid MVA pathway under regulation of IPTG-inducible promoters and the second (plasmid series pGPPSmTS, table 1) consists of a refactored, N-terminally truncated geranyl diphosphate synthase (GPPS) gene from Abies grandis (AgtrGPPS2) followed by an mTS gene (for example bLinS or bCinS) under control of a tetracycline-inducible promoter.

    [0114] Strains containing both pMVA and a pGPPSmTS plasmid were grown in a two-phase shake flask system using glucose as the feedstock and n-nonane as the organic phase. Products, which accumulated in the organic phase, were identified and quantified by GC-MS analysis.

    [0115] Product profiles and titres obtained with bLinS and bCinS were compared with previously obtained product profiles using mTSs from plant sources (FIG. 1), i.e. LinS from Artemisia annua (RLinS_Aa) and CinS from Salvia fruticosa (CinS_Sf), Arabidopsis thaliana (CinS_At), and Citrus unshiu (CinS_Cu) (Leferink, N. G. H. et al. A Plug and Play Platform for the Production of Diverse Monoterpene Hydrocarbon Scaffolds in Escherichia coli. (2016)).

    [0116] The inventors surprisingly found that both bacterial mTS outperformed the plant enzymes. BLinS produced about 300-fold more linalool than RLinS_Aa, 363.357.9 mg vs 1.3 mg L.sub.org.sup.1. Without wishing to be bound by theory, it is thought that this high yield can be attributed to the high solubility of BLinS, compared to corresponding plant mTS.

    [0117] Both bCinS and bLinS also produced much purer monoterpenes that plant mTS. bCinS produced 116.836.4 mg L.sub.org.sup.1 (96% pure) 1,8-cineole compared to the plant enzymes: 118.2 mg L.sub.org.sup.1 (67% pure) for CinS_Sf; 46.6 mg L.sub.org.sup.1 (42% pure) for CinS_At; and 18.2 mg L.sub.org.sup.1 (63% pure) for CinS_Cu.

    [0118] In addition to the formation of GPP via the heterologous GPPS, E. coli natively produces the sesquiterpene precursor farnesyl diphosphate (FPP). Interestingly, plugged into the inventors platform, bLinS was able to convert FPP to nerolidol (159.17.3 mg L.sub.org.sup.1), in addition to the formation of linalool from GPP, suggesting that bLinS acts as both monoterpene and sesquiterpene synthase. No sesquiterpene products were detected for bCinS under the specified conditions when plugged into the platform.

    [0119] Structure of bCinS Substrate Analog Complex and Comparison with Plant Cineole Synthase

    [0120] The inventors solved the bCinS structure in complex with a 2-fluoro derivative of GPP isomer (FNPP). The FNPP acts as a substrate inhibitor by blocking the ionisation step, which in turn stops the diphosphate release and formation of the geranyl cation. The structure revealed a dimer with the active sites located in an anti-parallel fashion.

    [0121] The present inventors then compared the structure of bCinS to the structure of 1,8-cineole synthase from a plant in a ligand free state (PDB 2J5C). Compared to the plant enzyme, the bacterial enzyme lacks an N-terminal -barrel domain (FIG. 2). Comparing the C-terminal domain of the plant enzyme (apo form) with bCinS-FNPP complex (sequence similarly 25%) shows conformational changes around the active site. In the plant enzyme, the kink region of helix break motif of helix G, which encompasses the residues described for induced-fit mechanism, is observed to have the most movement where it is protruding inwards towards the active site and almost reaching the location of the diphosphate in bCinS-FNPP complex (FIG. 2).

    [0122] It will be appreciated that numerous modifications to the above described process, microorganisms and use thereof may be made without departing from the scope of the invention as defined in the appended claims. For example although the specific examples described have focussed on the monoterpene synthases bCinS and bLinS from Streptomyces clavuligerus, it will be appreciated that other monoterpene synthases from alternative bacterial species could be utilised.

    TABLE-US-00002 Sequencelisting SEQIDNo.1: catccccactactgagaatc 20 SEQIDNo.2: ggtggtggtgctcgagtta 19 SEQIDNo.3: taactcgagcaccaccaccacc 22 SEQIDNo.4: tcagtagtggggatgtcgtaatcg 24