COMPOSITIONS AND METHODS FOR INCREASING SHELF-LIFE OF BANANA
20200102570 ยท 2020-04-02
Assignee
Inventors
- Eyal Maori (Cambridge, GB)
- Yaron Galanty (Cambridge, GB)
- Cristina Pignocchi (Norwich, GB)
- Angela Chaparro Garcia (Norwich, GB)
- Ofir Meir (Norwich, GB)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N15/8249
CHEMISTRY; METALLURGY
C12N2800/80
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
International classification
C12N15/82
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
Abstract
A banana plant comprising a genome comprising a loss of function mutation in a nucleic acid sequence encoding a component in an ethylene biosynthesis pathway of the banana is provided. Also provides is a method of increasing shelf-life of banana.
Claims
1. (canceled)
2. A method of increasing shelf-life of banana, the method comprising: (a) subjecting a banana plant cell to a DNA editing agent directed at a nucleic acid sequence encoding a component in an ethylene biosynthesis pathway of the banana to result in a loss of function mutation in said nucleic acid sequence encoding said ethylene biosynthesis pathway and (b) regenerating a plant from said plant cell.
3. The method of claim 2 further comprising harvesting fruit from said plant.
4. The method of claim 2, wherein the plant is devoid of a transgene encoding the DNA editing agent.
5. The method of claim 2, wherein said mutation is in a homozygous form.
6. (canceled)
7. The method of claim 2, wherein said mutation is selected from the group consisting of a deletion, an insertion an insertion/deletion (Indel) and a substitution.
8. The method of claim 2, wherein said component in said ethylene biosynthesis pathway is selected from the group consisting of 1-aminocyclopropane-1-carboxylate synthase (ACS) and ACC oxidase (ACO).
9. (canceled)
10. The method of claim 2, wherein said DNA editing agent is of a DNA editing system selected from the group consisting of meganucleases, Zinc finger nucleases (ZFNs), transcription-activator like effector nucleases (TALENs) and CRISPR-Cas.
11. The method of claim 2, wherein said DNA editing agent is of a DNA editing system comprising CRISPR-Cas.
12. The method of claim 2, wherein said component in said ethylene biosynthesis pathway is selected from the group consisting of Ma04_g35640 (SEQ ID NO: 9) and Ma07_g19730 (SEQ ID NO: 27).
13. The method of claim 2, wherein said component in said ethylene biosynthesis pathway is selected from the group consisting of: Ma09_g19150 (SEQ ID NO: 13), Ma04_g35640 (SEQ ID NO: 9), Ma04_g31490 (SEQ ID NO: 8), Ma01_g11540 (SEQ ID NO: 20) and Ma07_g19730 (SEQ ID NO: 27).
14. (canceled)
15. The method of claim 2, wherein said component in said ethylene biosynthesis pathway is selected from the group consisting of Ma09_g19150 (SEQ ID NO: 13), Ma04_g31490 (SEQ ID NO: 8) and Ma01_g11540 (SEQ ID NO: 20).
16. (canceled)
17. The method of claim 2, wherein said DNA editing agent comprises a nucleic acid sequence at least 99% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NO: 47-54.
18. The method of claim 2, wherein said DNA editing agent comprises a nucleic acid sequence at least 99% identical to a nucleic acid sequence as set forth in SEQ ID NO: 47.
19. The method of claim 2, wherein said DNA editing agent comprises a nucleic acid as set forth in SEQ ID NO: 47.
20. The method of claim 2, wherein said DNA editing agent comprises a plurality of nucleic acid sequences as set forth in: SEQ ID NO: 47-54.
21. The method of claim 2, wherein said DNA editing agent comprises a plurality of nucleic acid sequences as set forth in SEQ ID NO: 47, 49 or 50.
22. The method of claim 2, wherein said DNA editing agent comprises a plurality of nucleic acid sequences set forth in SEQ ID NO: 51 and 53.
23-27. (canceled)
28. The method of claim 2, wherein the banana plant is non-transgenic.
29. The method of claim 8, wherein the ACO is Ma01_g11540.1 (SEQ ID NO: 20) and/or Ma07_g19730.1 (SEQ ID NO: 27).
30. A banana plant generated by the method of claim 2.
Description
BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWING(S)
[0095] Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.
[0096] In the drawings:
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION
[0127] The present invention, in some embodiments thereof, relates to compositions and methods for increasing shelf-life of banana.
[0128] Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.
[0129] Ethylene, the simplest unsaturated hydrocarbon (two carbons with a double bond) is a gaseous plant hormone which regulates essentially all physiological processes during the plant's life cycle. It is responsible for signaling changes in: seed dormancy and germination, root growth and nodulation, shoot and leaf formation, flower and fruit development, different organs senescence and abscission, plant defense mechanisms, and a number of interactions with other plant hormones. Although, ethylene is undoubtedly essential for proper plant growth, development, and survival, it may also be deleterious to plants in some instances. Increased ethylene levels in plants exposed to various types of stress including chilling, heat, nutrient deprivation, anaerobiosis, wounding, and pathogen infection with increased damage to plant growth and health as the result has been reported. There is thus a considerable commercial interest in genetically modifying the amount of ethylene produced under ripening, senescing or stress conditions and thereby creating plants with more robust and/or desirable trait
[0130] The most established method of plant genetic engineering using CRISPR-Cas genome editing technology requires the insertion of new DNA into the host's genome. This insert, a transfer DNA (T-DNA), carries several transcriptional units in order to achieve successful CRISPR-Cas-mediated genome edits. These commonly consist of an antibiotic resistance gene to select for transgenic plants, the Cas machinery, and several sgRNA units. Because of the integration of foreign DNA into the genome, plants generated this way are classified as transgenic or genetically modified (GM). Once a genome edit has been established in the host, the T-DNA can be removed through sexual propagation and breeding, as the CRISPR Cas9 machinery is no longer needed to maintain the phenotype. However, for parthenocarpic crops, such as banana, that do not produce viable seeds, removal of T-DNA by sexual reproduction is impossible.
[0131] Embodiments of the invention relate to the identification of targets for genome editing in the ethylene biosynthesis pathway of the banana.
[0132] Thus, to reduce ethylene levels in banana plants, which may result in extended shelf-life of banana fruits, knockout of genes involved in the biosynthesis of ethylene, including ACS and ACO (
[0133] In order to identify superior target genes within the banana genome, which encode functional ACS and ACO, homologous sequences from characterized pathways in model or crop species were identified. The process involved a series of sequential steps for comparative analysis of DNA and protein sequences that aim at reconstructing the evolutionary history of genes through phylogenetic analysis, filtering candidates by validating their expression in general and target tissue, and sequencing of candidate genes to ensure appropriate sgRNA design (to avoid mismatches). This procedure allowed the selection of genes, the identification of optimized target regions for knockout (conserved and potentially catalytic domains) and the design of appropriate sgRNAs.
[0134] Following transfection of banana protoplasts with sgRNAs directed at a plurality of genes in the ethylene biosynthesis pathway, the present inventors were able to identify robust genome editing in key genes e.g., Ma07_g19730 and Ma04_g35640 as well as in other genes of the families to avoid compensation by redundancy. Such protoplasts were also subjected to regeneration protocols so as to obtain a banana plant having a long shelf-life (see
[0135] Thus, according to as aspect there is provided a method of increasing shelf-life of banana, the method comprising: [0136] (a) subjecting a banana plant cell to a DNA editing agent directed at a nucleic acid sequence encoding a component in an ethylene biosynthesis pathway of the banana to result in a loss of function mutation in said nucleic acid sequence encoding said ethylene biosynthesis pathway and [0137] (b) regenerating a plant from said plant cell.
[0138] As used herein the term banana refers to a plant of the genus Musa, including Plantains.
[0139] According to a specific embodiment, the banana is triploid.
[0140] Other ploidies are also contemplated, including, diploid and tetraploid.
[0141] As used herein plant refers to whole plant(s), a grafted plant, ancestors and progeny of the plants and plant parts, including seeds, fruits, shoots, stems, roots (including tubers), rootstock, scion, and plant cells, tissues and organs.
[0142] According to a specific embodiment, the plant part is a fruit.
[0143] According to a specific embodiment, the plant part is a seed.
[0144] Seed, refers to a flowering plant's unit of reproduction, capable of developing into another such plant.
[0145] According to a specific embodiment, the cell is a germ cell.
[0146] According to a specific embodiment, the cell is a somatic cell.
[0147] The plant may be in any form including suspension cultures, protoplasts, embryos, meristematic regions, callus tissue, leaves, gametophytes, sporophytes, pollen, and microspores.
[0148] According to a specific embodiment, the plant part comprises DNA.
[0149] Following is a non-limiting list of cultivars that can be used according to the present teachings.
[0150] AA Group [0151] Diploid Musa acuminata, both wild banana plants and cultivars [0152] Chingan banana [0153] Lacatan banana [0154] Lady Finger banana (Sugar banana) [0155] Pisang jari buaya (Crocodile fingers banana) [0156] Seorita banana (Monkoy, Arnibal banana, Cuarenta dias, Cariosa, Pisang Empat Puluh Hari, Pisang Lampung).sup.[12] [0157] Sinwobogi banana
[0158] AAA Group [0159] Triploid Musa acuminata, both wild banana plants and cultivars [0160] Cavendish Subgroup [0161] Dwarf Cavendish [0162] Giant Cavendish (Williams) [0163] Grand Nain (Chiquita) [0164] Masak Hijau [0165] Robusta [0166] Red Dacca [0167] Dwarf Red banana [0168] Gros Michel banana [0169] East African Highland bananas (AAA-EA subgroup)
[0170] AAAA Group [0171] Tetraploid Musa acuminata, both wild bananas and cultivars [0172] Bodles Altafort banana [0173] Golden Beauty banana
[0174] AAAB Group [0175] Tetraploid cultivars of Musa x paradisiaca [0176] Atan banana [0177] Goldfinger banana
[0178] AAB Group
[0179] Triploid cultivars of Musa x paradisiaca. This group contains the Plantain subgroup, composed of true plantains or African Plantainswhose centre of diversity is Central and West Africa, where a large number of cultivars were domesticated following the introduction of ancestral Plantains from Asia, possibly 2000-3000 years ago.
The Iholena and Maoli-Popo'ulu subgroups are referred to as Pacific plantains. [0180] Iholena subgroupsubgroup of cooking bananas domesticated in the Pacific region [0181] Maoli-Popo'ulu subgroupsubgroup of cooking bananas domesticated in the Pacific region [0182] Maqueo banana [0183] Popoulu banana [0184] Mysore subgroupcooking and dessert bananas.sup.[15] [0185] Mysore banana [0186] Pisang Raja subgroup [0187] Pisang Raja banana [0188] Plantain subgroup [0189] French plantain [0190] Green French banana [0191] Horn plantain & Rhino Horn banana [0192] Nendran banana [0193] Pink French banana [0194] Tiger banana [0195] Pome subgroup [0196] Pome banana [0197] Prata-an banana (Dwarf Brazilian banana, Dwarf Prata) [0198] Silk subgroup [0199] Latundan banana (Silk banana, Apple banana)
Others
[0200] Pisang Seribu banana [0201] plu banana
[0202] AABB Group [0203] Tetraploid cultivars of Musa x paradisiaca [0204] Kalamagol banana [0205] Pisang Awak (Ducasse banana)
[0206] AB Group [0207] Diploid cultivars of Musa x paradisiaca [0208] Ney Poovan banana
[0209] ABB Group [0210] Triploid cultivars of Musa x paradisiaca [0211] Blue Java banana (Ice Cream banana, Ney mannan, Ash plantain, Pata hina, Dukuru, Vata) [0212] Bluggoe Subgroup [0213] Bluggoe banana (also known as orinoco and burro) [0214] Silver Bluggoe banana [0215] Pelipita banana (Pelipia, Pilipia) [0216] Saba Subgroup [0217] Saba banana (Cardaba, Dippig) [0218] Cardaba banana [0219] Benedetta banana
[0220] ABBB Group [0221] Tetraploid cultivars of Musa x paradisiaca [0222] Tiparot banana
[0223] BB Group [0224] Diploid Musa balbisiana, wild bananas
[0225] BBB Group [0226] Triploid Musa balbisiana, wild bananas and cultivars [0227] Kluai Lep Chang Kut
[0228] According to a specific embodiment, the plant is a plant cell e.g., plant cell in an embryonic cell suspension.
[0229] According to a specific embodiment, the plant cell is a protoplast.
[0230] The protoplasts are derived from any plant tissue e.g., roots, leaves, embryonic cell suspension, calli or seedling tissue.
[0231] As used herein component in the ethylene biosynthesis pathway refers to a polypeptide that is essential for ethylene biosynthesis in banana e.g., an enzyme. Specifically, ethylene biosynthesis begins from S-adenosylmethionine (SAM) and includes two key steps (
[0232] The biosynthesis pathway of ethylene comprises of conversion of methionine into S-Adenosyl-methionine (AdoMet, SAM) with the aid of AdoMet synthase. 1-aminocyclopropane-1-carboxylate synthase (ACS) [EC 4.4.1.14] catalyses the cyclization of SAM to 1-aminocyclopropane-1-carboxylic acid (ACC), which is often considered the rate-limiting reaction in the pathway. ACS also produces 5-methylthioadenosine (MTA) which is recycled to regenerate methionine. The final step, oxygen-dependent conversion of ACC to ethylene, is catalyzed by ACC oxidase (ACO) [EC 1.14.17.4]. ACC is converted to ethylene by a modification of carbons C-2 and C-3 of ACC, while C-1 is converted to cyanide and the carboxyl group converted into carbon dioxide.
[0233] According to a specific embodiment, the AdoMet synthase is banana AdoMet.
[0234] All accession numbers correspond to the publicly available genome M. acuminata doubled-haploid of the germplasm collection accession named Pahang (2n=22) assembly version 2.
[0235] All accession numbers correspond to the publicly available genome M. acuminata doubled-haploid of the germplasm collection accession named Pahang (2n=22) assembly version 2.
[0236] According to a specific embodiment, the ACS is:
[0237] Ma01_g07800.1 (SEQ ID NO: 1
[0238] Ma01_g12130.1 (SEQ ID NO: 2);
[0239] Ma02_g10500.1 (SEQ ID NO: 3);
[0240] Ma03_g12030.1 (SEQ ID NO: 4);
[0241] Ma03_g27050.1 (SEQ ID NO: 5);
[0242] Ma04_g01260.1 (SEQ ID NO: 6);
[0243] Ma04_g24230.1 (SEQ ID NO: 7);
[0244] Ma04_g31490.1 (SEQ ID NO: 8);
[0245] Ma04_g35640.1 (SEQ ID NO: 9);
[0246] Ma04_g37400.1 (SEQ ID NO: 10);
[0247] Ma05_g08580.1 (SEQ ID NO: 11);
[0248] Ma05_g13700.1 (SEQ ID NO: 12);
[0249] Ma09_g19150.1 (SEQ ID NO: 13); or
[0250] Ma10_g27510.1 (SEQ ID NO: 14);
[0251] According to a specific embodiment, the ACO is
[0252] Ma09_g04370.1 (SEQ ID NO: 15);
[0253] Ma06_g17160.1 (SEQ ID NO: 16);
[0254] Ma11_g05490.1 (SEQ ID NO: 17);
[0255] Ma00_g04490.1 (SEQ ID NO: 18);
[0256] Ma07_g15430.1 (SEQ ID NO: 19);
[0257] Ma01_g11540.1 (SEQ ID NO: 20);
[0258] Ma10_g16100.1 (SEQ ID NO: 21);
[0259] Ma05_g08170.1 (SEQ ID NO: 22);
[0260] Ma06_g14430.1 (SEQ ID NO: 23);
[0261] Ma05_g09360.1 (SEQ ID NO: 24);
[0262] Ma11_g22170.1 (SEQ ID NO: 25);
[0263] Ma05_g31690.1 (SEQ ID NO: 26);
[0264] Ma07_g19730.1 (SEQ ID NO: 27);
[0265] Ma06_g02600.1 (SEQ ID NO: 28);
[0266] Ma10_g05270.1 (SEQ ID NO: 29);
[0267] Ma06_g14370.1 (SEQ ID NO: 30);
[0268] Ma11_g05480.1 (SEQ ID NO: 31);
[0269] Ma06_g14410.1 (SEQ ID NO: 32);
[0270] Ma06_g14420.1 (SEQ ID NO: 33);
[0271] Ma06_g34590.1 (SEQ ID NO: 34);
[0272] Ma02_g21040.1 (SEQ ID NO: 35);
[0273] Ma11_g04210.1 (SEQ ID NO: 36);
[0274] Ma05_g12600.1 (SEQ ID NO: 37);
[0275] Ma04_g23390.2 (SEQ ID NO: 38);
[0276] Ma03_g06970.1 (SEQ ID NO: 39);
[0277] Ma05_g09980.1 (SEQ ID NO: 40);
[0278] Ma04_g36640.1 (SEQ ID NO: 41);
[0279] Ma11_g04180.1 (SEQ ID NO: 42);
[0280] Ma11_g02650.1 (SEQ ID NO: 43); or
[0281] Ma00_g04770.1 (SEQ ID NO: 44);
[0282] According to a specific embodiment, the ACO is Ma01_g11540.1 (SEQ ID NO: 20) and/or Ma07_g19730.1 (SEQ ID NO: 27):
[0283] According to a specific embodiment, the ACS is Ma09_g19150.1 (SEQ ID NO: 13), Ma04_g35640.1 (SEQ ID NO: 9) and/or Ma04_g31490.1 (SEQ ID NO: 8):
[0284] Also contemplated are naturally occurring functional homologs of each of the above genes e.g., exhibiting at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% 98% or 99% identity to the above-mentioned genes and having an ACS or ACO activity, as defined above.
[0285] As used herein, sequence identity or identity or grammatical equivalents as used herein in the context of two nucleic acid or polypeptide sequences includes reference to the residues in the two sequences which are the same when aligned. When percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g. charge or hydrophobicity) and therefore do not change the functional properties of the molecule. Where sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences which differ by such conservative substitutions are considered to have sequence similarity or similarity. Means for making this adjustment are well-known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., according to the algorithm of Henikoff S and Henikoff J G. [Amino acid substitution matrices from protein blocks. Proc. Natl. Acad. Sci. U.S.A. 1992, 89(22): 10915-9].
[0286] Identity can be determined using any homology comparison software, including for example, the BlastN software of the National Center of Biotechnology Information (NCBI) such as by using default parameters.
[0287] According to some embodiments of the invention, the identity is a global identity, i.e., an identity over the entire nucleic acid sequences of the invention and not over portions thereof.
[0288] As used herein plant refers to whole plant(s), a grafted plant, ancestors and progeny of the plants and plant parts, including seeds, fruits, shoots, stems, roots (including tubers), rootstock, scion, and plant cells, tissues and organs.
[0289] The plant may be in any form including suspension cultures, protoplasts, embryos, meristematic regions, callus tissue, leaves, gametophytes, sporophytes, pollen, and microspores.
[0290] According to a specific embodiment, the plant part comprises DNA.
[0291] According to a specific embodiment, the banana plant is of a banana breeding line, more preferably an elite line.
[0292] According to a specific embodiment, the banana plant is of an elite line.
[0293] According to a specific embodiment, the banana plant is of a purebred line.
[0294] According to a specific embodiment, the banana plant is of a banana variety or breeding germplasm.
[0295] The term breeding line, as used herein, refers to a line of a cultivated banana having commercially valuable or agronomically desirable characteristics, as opposed to wild varieties or landraces. The term includes reference to an elite breeding line or elite line, which represents an essentially homozygous, usually inbred, line of plants used to produce commercial F.sub.1 hybrids. An elite breeding line is obtained by breeding and selection for superior agronomic performance comprising a multitude of agronomically desirable traits. An elite plant is any plant from an elite line. Superior agronomic performance refers to a desired combination of agronomically desirable traits as defined herein, wherein it is desirable that the majority, preferably all of the agronomically desirable traits are improved in the elite breeding line as compared to a non-elite breeding line. Elite breeding lines are essentially homozygous and are preferably inbred lines.
[0296] The term elite line, as used herein, refers to any line that has resulted from breeding and selection for superior agronomic performance. An elite line preferably is a line that has multiple, preferably at least 3, 4, 5, 6 or more (genes for) desirable agronomic traits as defined herein.
[0297] The terms cultivar and variety are used interchangeable herein and denote a plant with has deliberately been developed by breeding, e.g., crossing and selection, for the purpose of being commercialized, e.g., used by farmers and growers, to produce agricultural products for own consumption or for commercialization. The term breeding germplasm denotes a plant having a biological status other than a wild status, which wild status indicates the original non-cultivated, or natural state of a plant or accession.
[0298] The term breeding germplasm includes, but is not limited to, semi-natural, semi-wild, weedy, traditional cultivar, landrace, breeding material, research material, breeder's line, synthetic population, hybrid, founder stock/base population, inbred line (parent of hybrid cultivar), segregating population, mutant/genetic stock, market class and advanced/improved cultivar. As used herein, the terms purebred, pure inbred or inbred are interchangeable and refer to a substantially homozygous plant or plant line obtained by repeated selfing and-or backcrossing.
[0299] As used herein modifying a genome refers to introducing at least one mutation in at least one allele encoding a component in the ethylene biosynthesis pathway in banana. According to some embodiments, modifying refers to introducing a mutation in each allele of a component in the ethylene biosynthesis pathway. According to at least some embodiments, the mutation on the two alleles of the component in the ethylene biosynthesis pathway is in a homozygous form.
[0300] According to some embodiments, mutations on the two alleles encoding the component in the ethylene biosynthesis pathway are noncomplementary.
[0301] According to a specific embodiment, the DNA editing agent modifies the target sequence of the component in the ethylene biosynthesis pathway and is devoid of off target activity, i.e., does not modify other sequences in the banana genome.
[0302] According to a specific embodiment, the DNA editing agent comprises an off target activity on a non-essential gene in the banana genome.
[0303] Non-essential refers to a gene that when modified with the DNA editing agent does not affect the phenotype of the target genome in an agriculturally valuable manner (e.g., nutritional value, flavor, biomass, yield, biotic/abiotic stress tolerance and the like).
[0304] Off-target effects can be assayed using methods which are well known in the art and are described herein.
[0305] As used herein loss of function mutation refers to a genomic aberration which results in reduced ability (i.e., impaired function) or inability of the component of the ethylene biosynthesis pathway to facilitate in the synthesis of ethylene or precursor thereof.
[0306] As used herein reduced ability refers to reduced activity of the component in the ethylene biosynthesis pathway activity (i.e., synthesis of ethylene) as compared to that of the wild-type enzyme devoid of the loss of function mutation. According to a specific embodiment, the reduced activity is by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or even more as compared to that of the wild-type enzyme under the same assay conditions. Ethylene biosynthesis can be measured in small plantlets via gas chromatography (GC) or laser-based assays (Cristescu S M, Mandon J, Arslanov D, De Pessemier J, Hermans C, Harren F J M. Current methods for detecting ethylene in plants. Ann Bot-London. 2013; 111(3):347-60)
[0307] According to a specific embodiment, the loss of function mutation results in no expression of the component of the ethylene biosynthesis pathway mRNA or protein (dependent on the location of the aberration in the gene encoding the component of the ethylene biosynthesis pathway).
[0308] According to a specific embodiment, the loss of function mutation results in expression of the component of the ethylene biosynthesis pathway but which is incapable or inefficient of synthesizing ethylene or a precursor thereof.
[0309] According to a specific embodiment, the loss of function mutation is selected from the group consisting of a deletion, insertion, insertion-deletion (Indel), inversion, substitution and a combination of same (e.g., deletion and substitution e.g., deletions and SNPs).
[0310] According to a specific embodiment, the loss of function mutation is smaller than 1 Kb or 0.1 Kb.
[0311] According to a specific embodiment, the loss-of-function mutation is in the 5 of gene encoding the component of the ethylene biosynthesis pathway so as to inhibit the production of any expression product (e.g., exon 1).
[0312] According to a specific embodiment, the loss-of-function mutation is anywhere in the gene that allows the production of the expression product, while being unable to facilitate (contribute to) synthesis of ethylene or precursor thereof i.e., inactive protein. Also provided herein is a mutation in regulatory elements of the gene e.g., promoter.
[0313] As mentioned, the banana plant comprises the loss of function mutation in at least one allele of a gene encoding the component of the ethylene biosynthesis pathway.
[0314] According to a specific embodiment, the mutation is homozygous.
[0315] According to an aspect, there is provided a method of increasing shelf-life of banana, the method comprising: [0316] (a) subjecting a banana plant cell to a DNA editing agent directed at a nucleic acid sequence encoding a component in an ethylene biosynthesis pathway of the banana to result in a loss of function mutation in the nucleic acid sequence encoding the ethylene biosynthesis pathway and [0317] (b) regenerating a plant from the plant cell.
[0318] According to a specific embodiment, the method further comprises harvesting fruits from the plant.
[0319] According to a specific embodiment fruit is harvested still green and firm, 7-14 days prior to ripening. Each banana adult plant produces a single bunch, which is formed by many banana fruits or fingers and clustered in several hands (FAO, 2014). Banana bunches are cut by hand (usually involving 2-3 people) using a sharp curved knife or a machete.
[0320] As used herein increasing shelf-life refers to at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90% or even 95%, increase of shelf-life of harvested banana fruit having the loss of function mutation in the genome (as described herein) as compared to that of a banana plant of the same genetic background not comprising the loss of function mutation and as manifested by shelf life, as assayed by methods which are well known in the art (see Examples section which follows). Shelf-life is estimated by following the color and consistency of the fruit.
[0321] Following is a description of various non-limiting examples of methods and DNA editing agents used to introduce nucleic acid alterations to a gene of interest and agents for implementing same that can be used according to specific embodiments of the present disclosure.
[0322] Genome Editing using engineered endonucleasesthis approach refers to a reverse genetics method using artificially engineered nucleases to typically cut and create specific double-stranded breaks at a desired location(s) in the genome, which are then repaired by cellular endogenous processes such as, homologous recombination (HR) or non-homologous end-joining (NHEJ). NHEJ directly joins the DNA ends in a double-stranded break, while HR utilizes a homologous donor sequence as a template (i.e. the sister chromatid formed during S-phase) for regenerating the missing DNA sequence at the break site. In order to introduce specific nucleotide modifications to the genomic DNA, a donor DNA repair template containing the desired sequence must be present during HR (exogenously provided single stranded or double stranded DNA).
[0323] Genome editing cannot be performed using traditional restriction endonucleases since most restriction enzymes recognize a few base pairs on the DNA as their target and these sequences often will be found in many locations across the genome resulting in multiple cuts which are not limited to a desired location. To overcome this challenge and create site-specific single- or double-stranded breaks, several distinct classes of nucleases have been discovered and bioengineered to date. These include the meganucleases, Zinc finger nucleases (ZFNs), transcription-activator like effector nucleases (TALENs) and CRISPR/Cas system.
[0324] MeganucleasesMeganucleases are commonly grouped into four families: the LAGLIDADG family, the GIY-YIG family, the His-Cys box family and the HNH family. These families are characterized by structural motifs, which affect catalytic activity and recognition sequence. For instance, members of the LAGLIDADG family are characterized by having either one or two copies of the conserved LAGLIDADG motif. The four families of meganucleases are widely separated from one another with respect to conserved structural elements and, consequently, DNA recognition sequence specificity and catalytic activity. Meganucleases are found commonly in microbial species and have the unique property of having very long recognition sequences (>14 bp) thus making them naturally very specific for cutting at a desired location.
[0325] This can be exploited to make site-specific double-stranded breaks in genome editing. One of skill in the art can use these naturally occurring meganucleases, however the number of such naturally occurring meganucleases is limited. To overcome this challenge, mutagenesis and high throughput screening methods have been used to create meganuclease variants that recognize unique sequences. For example, various meganucleases have been fused to create hybrid enzymes that recognize a new sequence.
[0326] Alternatively, DNA interacting amino acids of the meganuclease can be altered to design sequence specific meganucleases (see e.g., U.S. Pat. No. 8,021,867). Meganucleases can be designed using the methods described in e.g., Certo, M T et al. Nature Methods (2012) 9:073-975; U.S. Pat. Nos. 8,304,222; 8,021,867; 8, 119,381; 8, 124,369; 8, 129,134; 8,133,697; 8,143,015; 8,143,016; 8, 148,098; or 8, 163,514, the contents of each are incorporated herein by reference in their entirety. Alternatively, meganucleases with site specific cutting characteristics can be obtained using commercially available technologies e.g., Precision Biosciences' Directed Nuclease Editor genome editing technology.
[0327] ZFNs and TALENsTwo distinct classes of engineered nucleases, zinc-finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), have both proven to be effective at producing targeted double-stranded breaks (Christian et al., 2010; Kim et al., 1996; Li et al., 2011; Mahfouz et al., 2011; Miller et al., 2010).
[0328] Basically, ZFNs and TALENs restriction endonuclease technology utilizes a non-specific DNA cutting enzyme which is linked to a specific DNA binding domain (either a series of zinc finger domains or TALE repeats, respectively). Typically a restriction enzyme whose DNA recognition site and cleaving site are separate from each other is selected. The cleaving portion is separated and then linked to a DNA binding domain, thereby yielding an endonuclease with very high specificity for a desired sequence. An exemplary restriction enzyme with such properties is FokI. Additionally FokI has the advantage of requiring dimerization to have nuclease activity and this means the specificity increases dramatically as each nuclease partner recognizes a unique DNA sequence. To enhance this effect, FokI nucleases have been engineered that can only function as heterodimers and have increased catalytic activity. The heterodimer functioning nucleases avoid the possibility of unwanted homodimer activity and thus increase specificity of the double-stranded break.
[0329] Thus, for example to target a specific site, ZFNs and TALENs are constructed as nuclease pairs, with each member of the pair designed to bind adjacent sequences at the targeted site. Upon transient expression in cells, the nucleases bind to their target sites and the FokI domains heterodimerize to create a double-stranded break. Repair of these double-stranded breaks through the non-homologous end-joining (NHEJ) pathway often results in small deletions or small sequence insertions. Since each repair made by NHEJ is unique, the use of a single nuclease pair can produce an allelic series with a range of different deletions at the target site.
[0330] In general NHEJ is relatively accurate (about 85% of DSBs in human cells are repaired by NHEJ within about 30min from detection) in gene editing erroneous NHEJ is relied upon as when the repair is accurate the nuclease will keep cutting until the repair product is mutagenic and the recognition/cut site/PAM motif is gone/mutated or that the transiently introduced nuclease is no longer present.
[0331] The deletions typically range anywhere from a few base pairs to a few hundred base pairs in length, but larger deletions have been successfully generated in cell culture by using two pairs of nucleases simultaneously (Carlson et al., 2012; Lee et al., 2010). In addition, when a fragment of DNA with homology to the targeted region is introduced in conjunction with the nuclease pair, the double-stranded break can be repaired via homologous recombination (HR) to generate specific modifications (Li et al., 2011; Miller et al., 2010; Urnov et al., 2005).
[0332] Although the nuclease portions of both ZFNs and TALENs have similar properties, the difference between these engineered nucleases is in their DNA recognition peptide. ZFNs rely on Cys2- His2 zinc fingers and TALENs on TALEs. Both of these DNA recognizing peptide domains have the characteristic that they are naturally found in combinations in their proteins. Cys2-His2 Zinc fingers are typically found in repeats that are 3 bp apart and are found in diverse combinations in a variety of nucleic acid interacting proteins. TALEs on the other hand are found in repeats with a one-to-one recognition ratio between the amino acids and the recognized nucleotide pairs. Because both zinc fingers and TALEs happen in repeated patterns, different combinations can be tried to create a wide variety of sequence specificities. Approaches for making site-specific zinc finger endonucleases include, e.g., modular assembly (where Zinc fingers correlated with a triplet sequence are attached in a row to cover the required sequence), OPEN (low-stringency selection of peptide domains vs. triplet nucleotides followed by high-stringency selections of peptide combination vs. the final target in bacterial systems), and bacterial one-hybrid screening of zinc finger libraries, among others. ZFNs can also be designed and obtained commercially from e.g., Sangamo (Richmond, Calif.).
[0333] Method for designing and obtaining TALENs are described in e.g. Reyon et al. Nature Biotechnology 2012 May;30(5):460-5; Miller et al. Nat Biotechnol. (2011) 29: 143-148; Cermak et al. Nucleic Acids Research (2011) 39 (12): e82 and Zhang et al. Nature Biotechnology (2011) 29 (2): 149-53. A recently developed web-based program named Mojo Hand was introduced by Mayo Clinic for designing TAL and TALEN constructs for genome editing applications (can be accessed through www(dot)talendesign(dot)org). TALEN can also be designed and obtained commercially from e.g., Sangamo Biosciences (Richmond, Calif.).
[0334] T-GEE system (TargetGene's Genome Editing Engine)A programmable nucleoprotein molecular complex containing a polypeptide moiety and a specificity conferring nucleic acid (SCNA) which assembles in-vivo, in a target cell, and is capable of interacting with the predetermined target nucleic acid sequence is provided. The programmable nucleoprotein molecular complex is capable of specifically modifying and/or editing a target site within the target nucleic acid sequence and/or modifying the function of the target nucleic acid sequence. Nucleoprotein composition comprises (a) polynucleotide molecule encoding a chimeric polypeptide and comprising (i) a functional domain capable of modifying the target site, and (ii) a linking domain that is capable of interacting with a specificity conferring nucleic acid, and (b) specificity conferring nucleic acid (SCNA) comprising (i) a nucleotide sequence complementary to a region of the target nucleic acid flanking the target site, and (ii) a recognition region capable of specifically attaching to the linking domain of the polypeptide. The composition enables modifying a predetermined nucleic acid sequence target precisely, reliably and cost-effectively with high specificity and binding capabilities of molecular complex to the target nucleic acid through base-pairing of specificity-conferring nucleic acid and a target nucleic acid. The composition is less genotoxic, modular in their assembly, utilize single platform without customization, practical for independent use outside of specialized core-facilities, and has shorter development time frame and reduced costs.
[0335] CRISPR-Cas system (also referred to herein as CRISPR)Many bacteria and archaea contain endogenous RNA-based adaptive immune systems that can degrade nucleic acids of invading phages and plasmids. These systems consist of clustered regularly interspaced short palindromic repeat (CRISPR) nucleotide sequences that produce RNA components and CRISPR associated (Cas) genes that encode protein components. The CRISPR RNAs (crRNAs) contain short stretches of homology to the DNA of specific viruses and plasmids and act as guides to direct Cas nucleases to degrade the complementary nucleic acids of the corresponding pathogen. Studies of the type II CRISPR/Cas system of Streptococcus pyogenes have shown that three components form an RNA/protein complex and together are sufficient for sequence-specific nuclease activity: the Cas9 nuclease, a crRNA containing 20 base pairs of homology to the target sequence, and a trans-activating crRNA (tracrRNA) (Jinek et al. Science (2012) 337: 816-821.).
[0336] It was further demonstrated that a synthetic chimeric guide RNA (gRNA) composed of a fusion between crRNA and tracrRNA could direct Cas9 to cleave DNA targets that are complementary to the crRNA in vitro. It was also demonstrated that transient expression of Cas9 in conjunction with synthetic gRNAs can be used to produce targeted double-stranded brakes in a variety of different species (Cho et al., 2013; Cong et al., 2013; DiCarlo et al., 2013; Hwang et al., 2013a,b; Jinek et al., 2013; Mali et al., 2013).
[0337] The CRIPSR/Cas system for genome editing contains two distinct components: a gRNA and an endonuclease e.g. Cas9.
[0338] The gRNA is typically a 20 nucleotide sequence encoding a combination of the target homologous sequence (crRNA) and the endogenous bacterial RNA that links the crRNA to the Cas9 nuclease (tracrRNA) in a single chimeric transcript. The gRNA/Cas9 complex is recruited to the target sequence by the base-pairing between the gRNA sequence and the complement genomic DNA. For successful binding of Cas9, the genomic target sequence must also contain the correct Protospacer Adjacent Motif (PAM) sequence immediately following the target sequence. The binding of the gRNA/Cas9 complex localizes the Cas9 to the genomic target sequence so that the Cas9 can cut both strands of the DNA causing a double-strand break. Just as with ZFNs and TALENs, the double-stranded breaks produced by CRISPR/Cas can be repaired by HR (homologous recombination) or NHEJ (non-homologous end-joining) and are susceptible to specific sequence modification during DNA repair.
[0339] The Cas9 nuclease has two functional domains: RuvC and HNH, each cutting a different DNA strand. When both of these domains are active, the Cas9 causes double strand breaks in the genomic DNA.
[0340] A significant advantage of CRISPR/Cas is that the high efficiency of this system coupled with the ability to easily create synthetic gRNAs. This creates a system that can be readily modified to target modifications at different genomic sites and/or to target different modifications at the same site. Additionally, protocols have been established which enable simultaneous targeting of multiple genes. The majority of cells carrying the mutation present biallelic mutations in the targeted genes.
[0341] However, apparent flexibility in the base-pairing interactions between the gRNA sequence and the genomic DNA target sequence allows imperfect matches to the target sequence to be cut by Cas9.
[0342] Modified versions of the Cas9 enzyme containing a single inactive catalytic domain, either RuvC- or HNH-, are called nickases. With only one active nuclease domain, the Cas9 nickase cuts only one strand of the target DNA, creating a single-strand break or nick. A single-strand break, or nick, is mostly repaired by single strand break repair mechanism involving proteins such as but not only, PARP (sensor) and XRCC1/LIG III complex (ligation). If a single strand break (SSB) is generated by topoisomerase I poisons or by drugs that trap PARP1 on naturally occurring SSBs then these could persist and when the cell enters into S-phase and the replication fork encounter such SSBs they will become single ended DSBs which can only be repaired by HR. However, two proximal, opposite strand nicks introduced by a Cas9 nickase are treated as a double-strand break, in what is often referred to as a double nick CRISPR system. A double-nick which is basically non-parallel DSB can be repaired like other DSBs by HR or NHEJ depending on the desired effect on the gene target and the presence of a donor sequence and the cell cycle stage (HR is of much lower abundance and can only occur in S and G2 stages of the cell cycle). Thus, if specificity and reduced off-target effects are crucial, using the Cas9 nickase to create a double-nick by designing two gRNAs with target sequences in close proximity and on opposite strands of the genomic DNA would decrease off-target effect as either gRNA alone will result in nicks that are not likely to change the genomic DNA, even though these events are not impossible.
[0343] Modified versions of the Cas9 enzyme containing two inactive catalytic domains (dead Cas9, or dCas9) have no nuclease activity while still able to bind to DNA based on gRNA specificity. The dCas9 can be utilized as a platform for DNA transcriptional regulators to activate or repress gene expression by fusing the inactive enzyme to known regulatory domains. For example, the binding of dCas9 alone to a target sequence in genomic DNA can interfere with gene transcription.
[0344] There are a number of publically available tools available to help choose and/or design target sequences as well as lists of bioinformatically determined unique gRNAs for different genes in different species such as the Feng Zhang lab's Target Finder, the Michael Boutros lab's Target Finder (E-CRISP), the RGEN Tools: Cas-OFFinder, the CasFinder: Flexible algorithm for identifying specific Cas9 targets in genomes and the CRISPR Optimal Target Finder.
[0345] Non-limiting examples of a gRNA that can be used in the present disclosure include those described in the Example section which follows.
[0346] In order to use the CRISPR system, both gRNA and Cas9 should be in a target cell or delivered as a ribonucleoprotein complex. The insertion vector can contain both cassettes on a single plasmid or the cassettes are expressed from two separate plasmids. CRISPR plasmids are commercially available such as the px330 plasmid from Addgene. Use of clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas)-guide RNA technology and a Cas endonuclease for modifying plant genomes are also at least disclosed by Svitashev et al., 2015, Plant Physiology, 169 (2): 931-945; Kumar and Jain, 2015, J Exp Bot 66: 47-57; and in U.S. Patent Application Publication No. 20150082478, which is specifically incorporated herein by reference in its entirety.
[0347] Hit and run or in-outinvolves a two-step recombination procedure. In the first step, an insertion-type vector containing a dual positive/negative selectable marker cassette is used to introduce the desired sequence alteration. The insertion vector contains a single continuous region of homology to the targeted locus and is modified to carry the mutation of interest. This targeting construct is linearized with a restriction enzyme at a one site within the region of homology, introduced into the cells, and positive selection is performed to isolate homologous recombination events. The DNA carrying the homologous sequence can be provided as a plasmid, single or double stranded oligo. These homologous recombinants contain a local duplication that is separated by intervening vector sequence, including the selection cassette. In the second step, targeted clones are subjected to negative selection to identify cells that have lost the selection cassette via intrachromosomal recombination between the duplicated sequences. The local recombination event removes the duplication and, depending on the site of recombination, the allele either retains the introduced mutation or reverts to wild type. The end result is the introduction of the desired modification without the retention of any exogenous sequences.
[0348] The double-replacement or tag and exchange strategyinvolves a two-step selection procedure similar to the hit and run approach, but requires the use of two different targeting constructs. In the first step, a standard targeting vector with 3 and 5 homology arms is used to insert a dual positive/negative selectable cassette near the location where the mutation is to be introduced. After the system components have been introduced to the cell and positive selection applied, HR events could be identified. Next, a second targeting vector that contains a region of homology with the desired mutation is introduced into targeted clones, and negative selection is applied to remove the selection cassette and introduce the mutation. The final allele contains the desired mutation while eliminating unwanted exogenous sequences.
[0349] Site-Specific RecombinasesThe Cre recombinase derived from the P1 bacteriophage and Flp recombinase derived from the yeast Saccharomyces cerevisiae are site-specific DNA recombinases each recognizing a unique 34 base pair DNA sequence (termed Lox and FRT, respectively) and sequences that are flanked with either Lox sites or FRT sites can be readily removed via site-specific recombination upon expression of Cre or Flp recombinase, respectively. For example, the Lox sequence is composed of an asymmetric eight base pair spacer region flanked by 13 base pair inverted repeats. Cre recombines the 34 base pair lox DNA sequence by binding to the 13 base pair inverted repeats and catalyzing strand cleavage and re-ligation within the spacer region. The staggered DNA cuts made by Cre in the spacer region are separated by 6 base pairs to give an overlap region that acts as a homology sensor to ensure that only recombination sites having the same overlap region recombine.
[0350] Basically, the site specific recombinase system offers means for the removal of selection cassettes after homologous recombination events. This system also allows for the generation of conditional altered alleles that can be inactivated or activated in a temporal or tissue-specific manner. Of note, the Cre and Flp recombinases leave behind a Lox or FRT scar of 34 base pairs. The Lox or FRT sites that remain are typically left behind in an intron or 3 UTR of the modified locus, and current evidence suggests that these sites usually do not interfere significantly with gene function.
[0351] Thus, Cre/Lox and Flp/FRT recombination involves introduction of a targeting vector with 3 and 5 homology arms containing the mutation of interest, two Lox or FRT sequences and typically a selectable cassette placed between the two Lox or FRT sequences. Positive selection is applied and homologous recombination events that contain targeted mutation are identified. Transient expression of Cre or Flp in conjunction with negative selection results in the excision of the selection cassette and selects for cells where the cassette has been lost. The final targeted allele contains the Lox or FRT scar of exogenous sequences.
[0352] According to a specific embodiment, the DNA editing agent is CRISPR-Cas9. Exemplary gRNA sequences are provided herein.
TABLE-US-00001 >Ma04_g31490 (SEQIDNO:45) GACTCTAAGATCAGGGTTAAAGG; >Ma09_g19150/Ma04_g35640/Ma04_g31490 (SEQIDNO:46) GCAGCTAACATCAGGGTTAAAGG.
[0353] According to a specific embodiment, the component in said ethylene biosynthesis pathway is selected from the group consisting of Ma09_g19150 (SEQ ID NO: 13), Ma04_g35640 (SEQ ID NO: 9), Ma04_g31490 (SEQ ID NO: 8), Ma01_g11540 (SEQ ID NO: 20) and Ma07_g19730 (SEQ ID NO: 27).
[0354] According to a specific embodiment, the component in said ethylene biosynthesis pathway is selected from the group consisting of Ma04_g35640 (SEQ ID NO: 9) and Ma07_g19730 (SEQ ID NO: 27).
[0355] According to a specific embodiment, the component in said ethylene biosynthesis pathway is selected from the group consisting of Ma09_g19150 (SEQ ID NO: 13), Ma04_g31490 (SEQ ID NO: 8) and Ma01_g11540 (SEQ ID NO: 20).
[0356] According to a specific embodiment, the DNA editing agent is directed at nucleic acid coordinates which specifically target more than one nucleic acid sequence encoding said component in said ethylene biosynthesis pathway.
[0357] According to a specific embodiment, the DNA editing agent comprises a nucleic acid sequence at least 99% identical to a nucleic acid sequence selected from the group consisting of SEQ ID NO: 47-54 (sgRNAs: 183, 184, 188, 189, 190, 191, 194 and 195).
[0358] According to a specific embodiment, the DNA editing agent comprises a nucleic acid sequence at least 99% identical to a nucleic acid sequence set forth in SEQ ID NO: 47 (sgRNA: 183).
[0359] According to a specific embodiment, the DNA editing agent comprises a nucleic acid set forth in SEQ ID NO: 47 (sgRNA: 183).
[0360] According to a specific embodiment, the DNA editing agent comprises a plurality of nucleic acid sequences set forth in SEQ ID NO: 47-54 (sgRNAs: 183, 184, 188, 189, 190, 191, 194 and 195)
[0361] According to a specific embodiment, the DNA editing agent comprises a plurality of nucleic acid sequences set forth in SEQ ID NO: 47, 49 and/or 50 (sgRNAs: 183, 188, 189).
[0362] According to a specific embodiment, the DNA editing agent comprises a plurality of nucleic acid sequences set forth in SEQ ID NO: 51 and/or 53 (sgRNAs: 190 and 194).
[0363] The DNA editing agent is typically introduced into the plant cell using expression vectors.
[0364] Thus, according to an aspect of the invention there is provided a nucleic acid construct comprising a nucleic acid sequence coding for a DNA editing agent capable of hybridizing to a gene encoding a component of the biosynthesis of ethylene of a banana and facilitating editing of said gene, said nucleic acid sequence being operably linked to a cis-acting regulatory element for expressing said DNA editing agent in a cell of a banana.
[0365] Embodiments of the invention relate to any DNA editing agent, such as described above.
[0366] According to a specific embodiment, the genome editing agent comprises an endonuclease, which may comprise or have an auxiliary unit of a DNA targeting module (e.g., sgRNA, or also as referred to herein as gRNA).
[0367] According to a specific embodiment, the DNA editing agent is CRISPR/Cas9 sgRNA.
[0368] According to a specific embodiment, the nucleic acid construct further comprises a nucleic acid sequence encoding an endonuclease of a DNA editing agent (e.g., Cas9 or the endonucleases described above).
[0369] According to another specific embodiment, the endonuclease and the sgRNA are encoded from different constructs whereby each is operably linked to a cis-acting regulatory element active in plant cells (e.g., promoter).
[0370] In a particular embodiment of some embodiments of the invention the regulatory sequence is a plant-expressible promoter.
[0371] Constructs useful in the methods according to some embodiments may be constructed using recombinant DNA technology well known to persons skilled in the art. Such constructs may be commercially available, suitable for transforming into plants and suitable for expression of the gene of interest in the transformed cells.
[0372] As used herein the phrase plant-expressible refers to a promoter sequence, including any additional regulatory elements added thereto or contained therein, is at least capable of inducing, conferring, activating or enhancing expression in a plant cell, tissue or organ, preferably a monocotyledonous or dicotyledonous plant cell, tissue, or organ. Examples of promoters useful for the methods of some embodiments of the invention include, but are not limited to, Actin, CANV 35S, CaMV19S, GOS2. Promoters which are active in various tissues, or developmental stages can also be used.
[0373] Nucleic acid sequences of the polypeptides of some embodiments of the invention may be optimized for plant expression. Examples of such sequence modifications include, but are not limited to, an altered G/C content to more closely approach that typically found in the plant species of interest, and the removal of codons atypically found in the plant species commonly referred to as codon optimization.
[0374] Plant cells may be transformed stably or transiently with the nucleic acid constructs of some embodiments of the invention. In stable transformation, the nucleic acid molecule of some embodiments of the invention is integrated into the plant genome and as such it represents a stable and inherited trait. In transient transformation, the nucleic acid molecule is expressed by the cell transformed but it is not integrated into the genome and as such it represents a transient trait.
[0375] According to a specific embodiment, the plant is transiently transfected with a DNA editing agent.
[0376] According to a specific embodiment, promoters in the nucleic acid construct comprise a Pol3 promoter. Examples of Pol3 promoters include, but are not limited to, AtU6-29, AtU626, AtU3B, AtU3d, TaU6.
[0377] According to a specific embodiment, promoters in the nucleic acid construct comprise a Pol2 promoter. Examples of Pol2 promoters include, but are not limited to, CaMV 35S, CaMV 19S, ubiquitin, CVMV.
[0378] According to a specific embodiment, promoters in the nucleic acid construct comprise a 35S promoter.
[0379] According to a specific embodiment, promoters in the nucleic acid construct comprise a U6 promoter.
[0380] According to a specific embodiment, promoters in the nucleic acid construct comprise a Pol 3 (e.g., U6) promoter operatively linked to the nucleic acid agent encoding at least one gRNA and/or a Pol2 (e.g., CamV35S) promoter operatively linked to the nucleic acid sequence encoding the genome editing agent or the nucleic acid sequence encoding the fluorescent reporter (as described in a specific embodiment below).
[0381] According to a specific embodiment, the construct is useful for transient expression by Agrobacterium-mediated transformation (Helens et al., 2005, Plant Methods 1:13). Methods of transient transformation are further described herein.
[0382] According to a specific embodiment, the nucleic acid sequences comprised in the construct are devoid of sequences which are homologous to the plant cell's genome other than any guide sequences in sgRNA sequences so as to avoid integration to the plant genome.
[0383] In certain embodiments, the nucleic acid construct is a non-integrating construct, preferably where the nucleic acid sequence encoding the fluorescent reporter is also non-integrating. As used herein, non-integrating refers to a construct or sequence that is not affirmatively designed to facilitate integration of the construct or sequence into the genome of the plant of interest. For example, a functional T-DNA vector system for Agrobacterium-mediated genetic transformation is not a non-integrating vector system as the system is affirmatively designed to integrate into the plant genome. Similarly, a fluorescent reporter gene sequence or selectable marker sequence that has flanking sequences that are homologous to the genome of the plant of interest to facilitate homologous recombination of the fluorescent reporter gene sequence or selectable marker sequence into the genome of the plant of interest would not be a non-integrating fluorescent reporter gene sequence or selectable marker sequence.
[0384] Various cloning kits can be used according to the teachings of some embodiments of the invention.
[0385] According to a specific embodiment the nucleic acid construct is a binary vector. Examples for binary vectors are pBIN19, pBI101, pBinAR, pGPTV, pCAMBIA, pBIB-HYG, pBecks, pGreen or pPZP (Hajukiewicz, P. et al., Plant Mol. Biol. 25, 989 (1994), and Hellens et al, Trends in Plant Science 5, 446 (2000)).
[0386] Examples of other vectors to be used in other methods of DNA delivery (e.g. transfection, electroporation, bombardment, viral inoculation) are: pGE-sgRNA (Zhang et al. Nat. Comms. 2016 7:12697), pJIT163-Ubi-Cas9 (Wang et al. Nat. Biotechnol 2004 32, 947-951), pICH47742::2x355-5UTR-hCas9(STOP)-NOST (Belhan et al. Plant Methods 2013 11; 9(1):39).
[0387] Embodiments described herein also relate to a method of selecting cells comprising a genome editing event, the method comprising:
[0388] (a) transforming cells of a banana plant with a nucleic acid construct comprising the genome editing agent (as described above) and a fluorescent reporter;
[0389] (b) selecting transformed cells exhibiting fluorescence emitted by the fluorescent reporter using flow cytometry or imaging;
[0390] (c) culturing the transformed cells comprising the genome editing event by the DNA editing agent for a time sufficient to lose expression of the DNA editing agent so as to obtain cells which comprise a genome editing event generated by the DNA editing agent but lack DNA encoding the DNA editing agent; and
[0391] According to some embodiments, the method further comprises validating in the transformed cells, loss of expression of the fluorescent reporter following step (c).
[0392] According to some embodiments, the method further comprises validating in the transformed cells loss, of expression of the DNA editing agent following step (c).
[0393] A non-limiting embodiment of the method is described in the Flowchart of
[0394] According to a specific embodiment, the plant is a plant cell e.g., plant cell in an embryonic cell suspension.
[0395] According to a specific embodiment, the plant cell is a protoplast.
[0396] The protoplasts are derived from any plant tissue e.g., roots, leaves, embryonic cell suspension, calli or seedling tissue.
[0397] There are a number of methods of introducing DNA into plant cells e.g., using protoplasts and the skilled artisan will know which to select.
[0398] The delivery of nucleic acids may be introduced into a plant cell in embodiments of the invention by any method known to those of skill in the art, including, for example and without limitation: by transformation of protoplasts (See, e.g., U.S. Pat. No. 5,508,184); by desiccation/inhibition-mediated DNA uptake (See, e.g., Potrykus et al. (1985) Mol. Gen. Genet. 199:183-8); by electroporation (See, e.g., U.S. Pat. No. 5,384,253); by agitation with silicon carbide fibers (See, e.g., U.S. Pat. Nos. 5,302,523 and 5,464,765); by Agrobacterium-mediated transformation (See, e.g., U.S. Pat. Nos. 5,563,055, 5,591,616, 5,693,512, 5,824,877, 5,981,840, and 6,384,301); by acceleration of DNA-coated particles (See, e.g., U.S. Pat. Nos. 5,015,580, 5,550,318, 5,538,880, 6,160,208, 6,399,861, and 6,403,865) and by Nanoparticles, nanocarriers and cell penetrating peptides (WO201126644A2; WO2009046384A1; WO2008148223A1) in the methods to deliver DNA, RNA, Peptides and/or proteins or combinations of nucleic acids and peptides into plant cells.
[0399] Other methods of transfection include the use of transfection reagents (e.g. Lipofectin, ThermoFisher), dendrimers (Kukowska-Latallo, J. F. et al., 1996, Proc. Natl. Acad. Sci. USA93, 4897-902), cell penetrating peptides (Me et al., 2005, Internalisation of cell-penetrating peptides into tobacco protoplasts, Biochimica et Biophysica Acta 1669(2):101-7) or polyamines (Zhang and Vinogradov, 2010, Short biodegradable polyamines for gene delivery and transfection of brain capillary endothelial cells, J Control Release, 143(3):359-366).
[0400] According to a specific embodiment, the introduction of DNA into plant cells (e.g., protoplasts) is effected by electroporation.
[0401] According to a specific embodiment, the introduction of DNA into plant cells (e.g., protoplasts) is effected by bombardment/biolistics.
[0402] According to a specific embodiment, for introducing DNA into protoplasts the method comprises polyethylene glycol (PEG)-mediated DNA uptake. For further details see Karesch et al. (1991) Plant Cell Rep. 9:575-578; Mathur et al. (1995) Plant Cell Rep. 14:221-226; Negrutiu et al. (1987) Plant Cell Mol. Biol. 8:363-373. Protoplasts are then cultured under conditions that allowed them to grow cell walls, start dividing to form a callus, develop shoots and roots, and regenerate whole plants.
[0403] Transient transformation can also be effected by viral infection using modified plant viruses.
[0404] Viruses that have been shown to be useful for the transformation of plant hosts include CaMV, TMV, TRV and BV. Transformation of plants using plant viruses is described in U.S. Pat. No. 4,855,237 (BGV), EP-A 67,553 (TMV), Japanese Published Application No. 63-14693 (TMV), EPA 194,809 (BV), EPA 278,667 (BV); and Gluzman, Y. et al., Communications in Molecular Biology: Viral Vectors, Cold Spring Harbor Laboratory, New York, pp. 172-189 (1988). Pseudovirus particles for use in expressing foreign DNA in many hosts, including plants, is described in WO 87/06261.
[0405] Construction of plant RNA viruses for the introduction and expression of non-viral exogenous nucleic acid sequences in plants is demonstrated by the above references as well as by Dawson, W. O. et al., Virology (1989) 172:285-292; Takamatsu et al. EMBO J. (1987) 6:307-311; French et al. Science (1986) 231:1294-1297; and Takamatsu et al. FEBS Letters (1990) 269:73-76.
[0406] When the virus is a DNA virus, suitable modifications can be made to the virus itself. Alternatively, the virus DNA can first be cloned into a bacterial plasmid for ease of constructing the desired viral vector with the foreign DNA. The virus DNA can then be excised from the plasmid. If the virus is a DNA virus, a bacterial origin of replication can be attached to the viral DNA, which is then replicated by the bacteria. Transcription and translation of this DNA will produce the coat protein which will encapsidate the viral DNA. If the virus is an RNA virus, the virus is generally cloned as a cDNA and inserted into a plasmid. The plasmid is then used to make all of the constructions. The RNA virus is then produced by transcribing the viral sequence of the plasmid and translation of the viral genes to produce the coat protein(s) which encapsidate the viral RNA.
[0407] Construction of plant RNA viruses for the introduction and expression in plants of non-viral exogenous nucleic acid sequences such as those included in the construct of some embodiments of the invention is demonstrated by the above references as well as in U.S. Pat. No. 5,316,931.
[0408] In one embodiment, a plant viral nucleic acid is provided in which the native coat protein coding sequence has been deleted from a viral nucleic acid, a non-native plant viral coat protein coding sequence and a non-native promoter, preferably the subgenomic promoter of the non-native coat protein coding sequence, capable of expression in the plant host, packaging of the recombinant plant viral nucleic acid, and ensuring a systemic infection of the host by the recombinant plant viral nucleic acid, has been inserted. Alternatively, the coat protein gene may be inactivated by insertion of the non-native nucleic acid sequence within it, such that a protein is produced. The recombinant plant viral nucleic acid may contain one or more additional non-native subgenomic promoters. Each non-native subgenomic promoter is capable of transcribing or expressing adjacent genes or nucleic acid sequences in the plant host and incapable of recombination with each other and with native subgenomic promoters. Non-native (foreign) nucleic acid sequences may be inserted adjacent the native plant viral subgenomic promoter or the native and a non-native plant viral subgenomic promoters if more than one nucleic acid sequence is included. The non-native nucleic acid sequences are transcribed or expressed in the host plant under control of the subgenomic promoter to produce the desired products.
[0409] In a second embodiment, a recombinant plant viral nucleic acid is provided as in the first embodiment except that the native coat protein coding sequence is placed adjacent one of the non-native coat protein subgenomic promoters instead of a non-native coat protein coding sequence.
[0410] In a third embodiment, a recombinant plant viral nucleic acid is provided in which the native coat protein gene is adjacent its subgenomic promoter and one or more non-native subgenomic promoters have been inserted into the viral nucleic acid. The inserted non-native subgenomic promoters are capable of transcribing or expressing adjacent genes in a plant host and are incapable of recombination with each other and with native subgenomic promoters. Non-native nucleic acid sequences may be inserted adjacent the non-native subgenomic plant viral promoters such that said sequences are transcribed or expressed in the host plant under control of the subgenomic promoters to produce the desired product.
[0411] In a fourth embodiment, a recombinant plant viral nucleic acid is provided as in the third embodiment except that the native coat protein coding sequence is replaced by a non-native coat protein coding sequence.
[0412] The viral vectors are encapsidated by the coat proteins encoded by the recombinant plant viral nucleic acid to produce a recombinant plant virus. The recombinant plant viral nucleic acid or recombinant plant virus is used to infect appropriate host plants. The recombinant plant viral nucleic acid is capable of replication in the host, systemic spread in the host, and transcription or expression of foreign gene(s) (isolated nucleic acid) in the host to produce the desired protein.
[0413] Regardless of the transformation/infection method employed, the present teachings further relate to any cell e.g., a plant cell (e.g., protoplast) or a bacterial cell comprising the nucleic acid construct(s) as described herein.
[0414] Following transformation, cells are subjected to flow cytometry to select transformed cells exhibiting fluorescence emitted by the fluorescent reporter (i.e., fluorescent protein).
[0415] As used herein, a fluorescent protein refers to a polypeptide that emits fluorescence and is typically detectable by flow cytometry or imaging, therefore can be used as a basis for selection of cells expressing such a protein.
[0416] Examples of fluorescent proteins that can be used as reporters are the Green Fluorescent Protein (GFP), the Blue Fluorescent Protein (BFP) and the red fluorescent protein dsRed. A non-limiting list of fluorescent or other reporters includes proteins detectable by luminescence (e.g. luciferase) or colorimetric assay (e.g. GUS). According to a specific embodiment, the fluorescent reporter is DsRed or GFP.
[0417] This analysis is typically effected within 24-72 hours e.g., 48-72, 24-28 hours, following transformation. To ensure transient expression, no antibiotic selection is employed e.g., antibiotics for a selection marker. The culture may still comprise antibiotics but not to a selection marker.
[0418] Flow cytometry of plant cells is typically performed by Fluorescence Activated Cell Sorting (FACS). Fluorescence activated cell sorting (FACS) is a well-known method for separating particles, including cells, based on the fluorescent properties of the particles (see, e.g., Kamarch, 1987, Methods Enzymol, 151:150-165).
[0419] For instance, FACS of GFP-positive cells makes use of the visualization of the green versus the red emission spectra of protoplasts excited by a 488 nm laser. GFP-positive protoplasts can be distinguished by their increased ratio of green to red emission.
[0420] Following is a non-binding protocol adapted from Bastiaan et al. J Vis Exp. 2010; (36): 1673, which is hereby incorporated by reference. FACS apparati are commercially available e.g., FACSMelody (BD), FACSAria (BD).
[0421] A flow stream is set up with a 100 m nozzle and a 20 psi sheath pressure. The cell density and sample injection speed can be adjusted to the particular experiment based on whether a best possible yield or fastest achievable speed is desired, e.g., up to 10,000,000 cells/ml. The sample is agitated on the FACS to prevent sedimentation of the protoplasts. If clogging of the FACS is an issue, there are three possible troubleshooting steps: 1. Perform a sample-line backflush. 2. Dilute protoplast suspension to reduce the density. 3. Clean up the protoplast solution by repeating the filtration step after centrifugation and resuspension. The apparatus is prepared to measure forward scatter (FSC), side scatter (SSC) and emission at 530/30 nm for GFP and 610/20 nm for red spectrum auto-fluorescence (RSA) after excitation by a 488 nm laser. These are in essence the only parameters used to isolate GFP-positive protoplasts. The voltage settings can be used: FSC60V, SSC 250V, GFP 350V and RSA 335V. Note that the optimal voltage settings will be different for every FACS and will even need to be adjusted throughout the lifetime of the cell sorter.
[0422] The process is started by setting up a dotplot for forward scatter versus side scatter. The voltage settings are applied so that the measured events are centered in the plot. Next, a dot plot is created of green versus red fluorescence signals. The voltage settings are applied so that the measured events yield a centered diagonal population in the plot when looking at a wild-type (non-GFP) protoplast suspension. A protoplast suspension derived from a GFP marker line will produce a clear population of green fluorescent events never seen in wild-type samples. Compensation constraints are set to adjust for spectral overlap between GFP and RSA. Proper compensation constraint settings will allow for better separation of the GFP-positive protoplasts from the non-GFP protoplasts and debris. The constraints used here are as follows: RSA, minus 17.91% GFP. A gate is set to identify GFP-positive events, a negative control of non-GFP protoplasts should be used to aid in defining the gate boundaries. A forward scatter cutoff is implemented in order to leave small debris out of the analysis. The GFP-positive events are visualized in the FSC vs. SSC plot to help determine the placement of the cutoff. E.g., cutoff is set at 5,000. Note that the FACS will count debris as sort events and a sample with high levels of debris may have a different percent GFP positive events than expected. This is not necessarily a problem. However, the more debris in the sample, the longer the sort will take. Depending on the experiment and the abundance of the cell type to be analyzed, the FACS precision mode is set either for optimal yield or optimal purity of the sorted cells.
[0423] Following FACS sorting, positively selected pools of transformed plant cells, (e.g., protoplasts) displaying the fluorescent marker are collected and an aliquot can be used for testing the DNA editing event (optional step, see
[0424] Thus, clones are validated for the presence of a DNA editing event also referred to herein as mutation or edit, dependent on the type of editing sought e.g., insertion, deletion, insertion-deletion (Indel), inversion, substitution and combinations thereof.
[0425] According to a specific embodiment, the genome editing event comprises a deletion, a single base pair substitution, or an insertion of genetic material from a second plant that could otherwise be introduced into the plant of interest by traditional breeding.
[0426] According to a specific embodiment, the genome editing event does not comprise an introduction of foreign DNA into a genome of the plant of interest that could not be introduced through traditional breeding.
[0427] Methods for detecting sequence alteration are well known in the art and include, but not limited to, DNA sequencing (e.g., next generation sequencing), electrophoresis, an enzyme-based mismatch detection assay and a hybridization assay such as PCR, RT-PCR, RNase protection, in-situ hybridization, primer extension, Southern blot, Northern Blot and dot blot analysis. Various methods used for detection of single nucleotide polymorphisms (SNPs) can also be used, such as PCR based T7 endonuclease, Heteroduplex and Sanger sequencing.
[0428] Another method of validating the presence of a DNA editing event e.g., Indels comprises a mismatch cleavage assay that makes use of a structure selective enzyme (e.g. endonuclease) that recognizes and cleaves mismatched DNA.
[0429] The mismatch cleavage assay is a simple and cost-effective method for the detection of indels and is therefore the typical procedure to detect mutations induced by genome editing. The assay uses enzymes that cleave heteroduplex DNA at mismatches and extrahelical loops formed by multiple nucleotides, yielding two or more smaller fragments. A PCR product of 300-1000 bp is generated with the predicted nuclease cleavage site off-center so that the resulting fragments are dissimilar in size and can easily be resolved by conventional gel electrophoresis or high-performance liquid chromatography (HPLC). End-labeled digestion products can also be analyzed by automated gel or capillary electrophoresis. The frequency of indels at the locus can be estimated by measuring the integrated intensities of the PCR amplicon and cleaved DNA bands. The digestion step takes 15-60 min, and when the DNA preparation and PCR steps are added the entire assays can be completed in <3 h.
[0430] Two alternative enzymes are typically used in this assay. T7 endonuclease 1 (T7E1) is a resolvase that recognizes and cleaves imperfectly matched DNA at the first, second or third phosphodiester bond upstream of the mismatch. The sensitivity of a T7E1-based assay is 0.5-5% . In contrast, SurveyorTM nuclease (Transgenomic Inc., Omaha, Nebr., USA) is a member of the CEL family of mismatch-specific nucleases derived from celery. It recognizes and cleaves mismatches due to the presence of single nucleotide polymorphisms (SNPs) or small indels, cleaving both DNA strands downstream of the mismatch. It can detect indels of up to 12 nt and is sensitive to mutations present at frequencies as low as 3%, i.e. 1 in 32 copies.
[0431] Yet another method of validating the presence of an editing even comprises the high-resolution melting analysis.
[0432] High-resolution melting analysis (HRMA) involves the amplification of a DNA sequence spanning the genomic target (90-200 bp) by real-time PCR with the incorporation of a fluorescent dye, followed by melt curve analysis of the amplicons. HRMA is based on the loss of fluorescence when intercalating dyes are released from double-stranded DNA during thermal denaturation. It records the temperature-dependent denaturation profile of amplicons and detects whether the melting process involves one or more molecular species.
[0433] Yet another method is the heteroduplex mobility assay. Mutations can also be detected by analyzing re-hybridized PCR fragments directly by native polyacrylamide gel electrophoresis (PAGE). This method takes advantage of the differential migration of heteroduplex and homoduplex DNA in polyacrylamide gels. The angle between matched and mismatched DNA strands caused by an indel means that heteroduplex DNA migrates at a significantly slower rate than homoduplex DNA under native conditions, and they can easily be distinguished based on their mobility. Fragments of 140-170 bp can be separated in a 15% polyacrylamide gel. The sensitivity of such assays can approach 0.5% under optimal conditions, which is similar to T7E1 (. After reannealing the PCR products, the electrophoresis component of the assay takes 2 h.
[0434] Other methods of validating the presence of editing events are described in length in Zischewski 2017 Biotechnol. Advances 1(1):95-104.
[0435] It will be appreciated that positive clones can be homozygous or heterozygous for the DNA editing event. The skilled artisan will select the clone for further culturing/regeneration according to the intended use.
[0436] Clones exhibiting the presence of a DNA editing event as desired are further analyzed for the presence of the DNA editing agent. Namely, loss of DNA sequences encoding for the DNA editing agent, pointing to the transient nature of the method.
[0437] This can be done by analyzing the expression of the DNA editing agent (e.g., at the mRNA, protein) e.g., by fluorescent detection of GFP or q-PCR.
[0438] Alternatively, or additionally, the cells are analyzed for the presence of the nucleic acid construct as described herein or portions thereof e.g., nucleic acid sequence encoding the reporter polypeptide or the DNA editing agent.
[0439] Clones showing no DNA encoding the fluorescent reporter or DNA editing agent (e.g., as affirmed by fluorescent microscopy, q-PCR and or any other method such as Southern blot, PCR, sequencing) yet comprising the DNA editing event(s) [mutation(s)] as desired are isolated for further processing.
[0440] These clones can therefore be stored (e.g., cryopreserved).
[0441] Alternatively, cells (e.g., protoplasts) may be regenerated into whole plants first by growing into a group of plant cells that develops into a callus and then by regeneration of shoots (caulogenesis) from the callus using plant tissue culture methods. Growth of protoplasts into callus and regeneration of shoots requires the proper balance of plant growth regulators in the tissue culture medium that must be customized for each species of plant
[0442] Protoplasts may also be used for plant breeding, using a technique called protoplast fusion. Protoplasts from different species are induced to fuse by using an electric field or a solution of polyethylene glycol. This technique may be used to generate somatic hybrids in tissue culture.
[0443] Methods of protoplast regeneration are well known in the art. Several factors affect the isolation, culture, and regeneration of protoplasts, namely the genotype, the donor tissue and its pre-treatment, the enzyme treatment for protoplast isolation, the method of protoplast culture, the culture, the culture medium, and the physical environment. For a thorough review see Maheshwari et al. 1986 Differentiation of Protoplasts and of Transformed Plant Cells: 3-36. Springer-Verlag, Berlin.
[0444] The regenerated plants can be subjected to further breeding and selection as the skilled artisan sees fit.
[0445] The plant or cells thereof are devoid of a transgene encoding a DNA editing agent.
[0446] The phenotype of the final lines, plants or intermediate breeding products can be analyzed such as by determining the sequence of gene encoding the component of the ethylene biosynthesis pathway, expression thereof in the mRNA or protein level, activity of the protein and/or analyzing the properties of the fruit (shelf-life).
Ethylene production: Ethylene biosynthesis can be measured in small plantlets via gas chromatography (GC) or laser-based assays (Cristescu S M, Mandon J, Arslanov D, De Pessemier J, Hermans C, Harren F J M. Current methods for detecting ethylene in plants. Ann Bot-London. 2013; 111(3):347-60).
[0447] As is illustrated herein and in the Examples section which follows. The present inventors were able to transform banana with a genome editing agent(s), while avoiding stable transgenesis.
[0448] Hence the present methodology allows genome editing without integration of a selectable or screenable reporter.
[0449] Thus, embodiments of the invention further relate to plants, plant cells and processed product of plants comprising the gene editing event(s) generated according to the present teachings,
[0450] Thus, the present teachings also relate to parts of the plants as described herein or processed products thereof.
[0451] Banana fruit, and banana fruit based products as well as their methods of producing are contemplated using the plants described herein.
[0452] Also contemplated are banana-by-products and methods of producing same such as peels, leaves, pseudostem, stalk and inflorescence in various food and non-food applications serving as thickening agent, coloring and flavor, alternative source for macro and micronutrients, nutraceuticals, livestock feed, natural fibers, and sources of natural bioactive compounds and bio-fertilizers.
[0453] According to a specific-embodiment, processed products comprise DNA.
[0454] It is expected that during the life of a patent maturing from this application many relevant DNA editing agents will be developed and the scope of the term DNA editing agent is intended to include all such new technologies a priori.
[0455] As used herein the term about refers to 10%.
[0456] The terms comprises, comprising, includes, including, having and their conjugates mean including but not limited to.
[0457] The term consisting of means including and limited to.
[0458] The term consisting essentially of means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
[0459] As used herein, the singular form a, an and the include plural references unless the context clearly dictates otherwise. For example, the term a compound or at least one compound may include a plurality of compounds, including mixtures thereof.
[0460] Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
[0461] Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases ranging/ranges between a first indicate number and a second indicate number and ranging/ranges from a first indicate number to a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.
[0462] As used herein the term method refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
[0463] When reference is made to particular sequence listings, such reference is to be understood to also encompass sequences that substantially correspond to its complementary sequence as including minor sequence variations, resulting from, e.g., sequencing errors, cloning errors, or other alterations resulting in base substitution, base deletion or base addition, provided that the frequency of such variations is less than 1 in 50 nucleotides, alternatively, less than 1 in 100 nucleotides, alternatively, less than 1 in 200 nucleotides, alternatively, less than 1 in 500 nucleotides, alternatively, less than 1 in 1000 nucleotides, alternatively, less than 1 in 5,000 nucleotides, alternatively, less than 1 in 10,000 nucleotides.
[0464] It is understood that any Sequence Identification Number (SEQ ID NO) disclosed in the instant application can refer to either a DNA sequence or a RNA sequence, depending on the context where that SEQ ID NO is mentioned, even if that SEQ ID NO is expressed only in a DNA sequence format or a RNA sequence format. For example, a given SEQ ID NO: is expressed in a DNA sequence format (e.g., reciting T for thymine), but it can refer to either a DNA sequence that corresponds to a given nucleic acid sequence, or the RNA sequence of an RNA molecule nucleic acid sequence. Similarly, though some sequences are expressed in a RNA sequence format (e.g., reciting U for uracil), depending on the actual type of molecule being described, it can refer to either the sequence of a RNA molecule comprising a dsRNA, or the sequence of a DNA molecule that corresponds to the RNA sequence shown. In any event, both DNA and RNA molecules having the sequences disclosed with any substitutes are envisioned.
[0465] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.
[0466] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.
[0467] As used herein the term about refers to 10%.
[0468] The terms comprises, comprising, includes, including, having and their conjugates mean including but not limited to.
[0469] The term consisting of means including and limited to.
[0470] The term consisting essentially of means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
[0471] As used herein, the singular form a, an and the include plural references unless the context clearly dictates otherwise. For example, the term a compound or at least one compound may include a plurality of compounds, including mixtures thereof.
[0472] Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
[0473] Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases ranging/ranges between a first indicate number and a second indicate number and ranging/ranges from a first indicate number to a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.
[0474] As used herein the term method refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
[0475] As used herein, the term treating includes abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating clinical or aesthetical symptoms of a condition or substantially preventing the appearance of clinical or aesthetical symptoms of a condition.
[0476] When reference is made to particular sequence listings, such reference is to be understood to also encompass sequences that substantially correspond to its complementary sequence as including minor sequence variations, resulting from, e.g., sequencing errors, cloning errors, or other alterations resulting in base substitution, base deletion or base addition, provided that the frequency of such variations is less than 1 in 50 nucleotides, alternatively, less than 1 in 100 nucleotides, alternatively, less than 1 in 200 nucleotides, alternatively, less than 1 in 500 nucleotides, alternatively, less than 1 in 1000 nucleotides, alternatively, less than 1 in 5,000 nucleotides, alternatively, less than 1 in 10,000 nucleotides.
[0477] It is understood that any Sequence Identification Number (SEQ ID NO) disclosed in the instant application can refer to either a DNA sequence or a RNA sequence, depending on the context where that SEQ ID NO is mentioned, even if that SEQ ID NO is expressed only in a DNA sequence format or a RNA sequence format. For example, a SEQ ID NO: is expressed in a DNA sequence format (e.g., reciting T for thymine), but it can refer to either a DNA sequence that corresponds to a nucleic acid sequence, or the RNA sequence of an RNA molecule nucleic acid sequence. Similarly, though some sequences are expressed in a RNA sequence format (e.g., reciting U for uracil), depending on the actual type of molecule being described, it can refer to either the sequence of a RNA molecule comprising a dsRNA, or the sequence of a DNA molecule that corresponds to the RNA sequence shown. In any event, both DNA and RNA molecules having the sequences disclosed with any substitutes are envisioned.
[0478] It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.
[0479] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.
EXAMPLES
[0480] Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non-limiting fashion.
[0481] Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, Molecular Cloning: A laboratory Manual Sambrook et al., (1989); Current Protocols in Molecular Biology Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Maryland (1989); Perbal, A Practical Guide to Molecular Cloning, John Wiley & Sons, New York (1988); Watson et al., Recombinant DNA, Scientific American Books, New York; Birren et al. (eds) Genome Analysis: A Laboratory Manual Series, Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; Cell Biology: A Laboratory Handbook, Volumes I-III Cellis, J. E., ed. (1994); Culture of Animal Cells - A Manual of Basic Technique by Freshney, Wiley-Liss, N. Y. (1994), Third Edition; Current Protocols in Immunology Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), Basic and Clinical Immunology (8th Edition), Appleton & Lange, Norwalk, Conn. (1994); Mishell and Shiigi (eds), Selected Methods in Cellular Immunology, W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; Oligonucleotide Synthesis Gait, M. J., ed. (1984); Nucleic Acid Hybridization Hames, B. D., and Higgins S. J., eds. (1985); Transcription and Translation Hames, B. D., and Higgins S. J., eds. (1984); Animal Cell Culture Freshney, R. I., ed. (1986); Immobilized Cells and Enzymes IRL Press, (1986); A Practical Guide to Molecular Cloning Perbal, B., (1984) and Methods in Enzymology Vol. 1-317, Academic Press; PCR Protocols: A Guide To Methods And Applications, Academic Press, San Diego, Calif. (1990); Marshak et al., Strategies for Protein Purification and CharacterizationA Laboratory Course Manual CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.
Materials and Methods
Embryogenic Callus and Cell Suspension Generation and Maintenance
[0482] An embryogenic callus is developed from an initial explant such as immature male flowers or shoot tip as described by Ma, 1988 (Ma S.S. 1991 Somatic embryogenesis and plant regeneration from cell suspension culture of banana. In Proceedings of Symposium on Tissue culture of horticultural crops, Taipei, Taiwan, 8-9 Mar. 1988, pp. 181-188) and Schoofs, 1997 (Schoofs H. 1997. The origin of embryogenic cells in Musa. PhD thesis, KULeuven, Belgium). Embryogenic cell suspensions are initiated from freshly developed highly embryogenic calli in liquid medium. 80% of the medium is refreshed every 12-14 days until the initiated cell suspension is fully established (6-9 months).
sgRNA Cloning
[0483] The transfection plasmid utilized was composed of 4 modules comprising of 1, eGFP driven by the CaMV35s promoter terminated by a G7 temination sequence; 2, Cas9 (human codon optimised) driven by the CaMV35s promoter terminated by Mas termination sequence ; 3, AtU6 promoter driving sgRNA for guide 1; 4 AtU6 promoter driving sgRNA for guide 2. A binary vector can be used such as pCAMBIA or pRI-201-AN DNA.
Gene Editing System Validation by Targeting Exogenous Reporter Gene GFP
[0484] The non-transgenic GE system proposed here was validated and optimized through targeting the DNA of exogenous gene (GFP). To analyze the strength of different RNA polymerase III (pol-III) promoters sgRNA were designed for targeting eGFP in the CRISPR Cas9 complex and then the effect of different promoters in knocking out eGFP expression in transformed cells was tested.
[0485] Specifically, plasmids (e.g. pBluescript, pUC19) contained four transcriptional units containing Cas9, eGFP, dsRED, and sgRNA-GFP driven by different pol-II and pol-III promoters (e.g. CAMV 35S, U6). These plasmids were transfected into protoplast cultures and analyzed by FACS after a 24-72 hour incubation period. High frequency in dsRED (or mCherry, RFP) expression indicated high transfection efficiency, while low frequency in eGFP expression indicated successful gene editing through CRISPR-Cas9. Therefore the line that showed the lowest eGFP:dsRED expression ratio was the chosen pol-III promoter as it caused the highest proportion of eGFP inactivation through CRISPR Cas9 complexes.
Final Plasmid Design
[0486] For transient expression, a plasmid containing four transcriptional units was used. The first transcriptional unit contained the CaMV-35S promoter-driving expression of Cas9 and the tobacco mosaic virus (TMV) terminator. The next transcriptional unit consisted of another CaMV-35S promoter driving expression of eGFP and the nos terminator. The third and fourth transcriptional units each contained the Arabidopsis U6 promoter expressing sgRNA to target genes (as mentioned each vector comprises two sgRNAs).
Protoplasts Isolation
[0487] Protoplasts were isolated by incubating plant material (e.g. leaves, calli, cell suspensions) in a digestion solution (1% cellulase, 0.5% macerozyme, 0.5% driselase, 0.4M mannitol, 154 mM NaCl, 20 mM KCl, 20 mM MES pH 5.6, 10 mM CaC12) for 4-24 h at room temperature and gentle shaking. After digestion, remaining plant material was washed with W5 solution (154 mM NaCl, 125 mM CaCl2, 5 mM KCl, 2 mM MES pH5.6) and protoplasts suspension was filtered through a 40 um strainer. After centrifugation at 80 g for 3 min at room temperature, protoplasts were resuspended in 2 ml W5 buffer and precipitated by gravity in ice. The final protoplast pellet was resuspended in 2 ml of MMg (0.4M mannitol, 15 mM MagCl2, 4 mM MES pH 5.6) and protoplast concentration was determined using a hemocytometer. Protoplasts viability was estimated using Trypan Blue staining.
[0488] Polyethylene glycol (PEG)-mediated plasmid transfection. PEG-transfection of banana protoplasts was effected using a modified version of the strategy reported by Wang et al,. (2015) [Wang, H., et al., An efficient PEG-mediated transient gene expression system in grape protoplasts and its application in subcellular localization studies of flavonoids biosynthesis enzymes. Scientia Horticulturae, 2015. 191: p. 82-89]. Protoplasts were resuspended to a density of 2-510.sup.6 protoplasts/ml in MMg solution. 100-200 l A of protoplast suspension was added to a tube containing the plasmid. The plasmid: protoplast ratio greatly affects transformation efficiency therefore a range of plasmid concentrations in protoplast suspension, 5-300 g/l, were assayed. PEG solution (100-200 l) was added to the mixture and incubated at 23 C. for various lengths of time ranging from 10-60 minutes. PEG4000 concentration was optimized, a range of 20-80% PEG4000 in 200-400 mM mannitol, 100-500 mM CaCl.sub.2 solution was assayed. The protoplasts were then washed in W5 and centrifugated at 80 g for 3 min, prior resuspension in lml W5 and incubated in the dark at 23 C. After incubation for 24-72 h fluorescence was detected by microscopy.
Electroporation
[0489] A plasmid containing Pol2-driven GFP/RFP, Pol2-driven-NLS-Cas9 and Pol3-driven sgRNA targeting the relevant genes (see list of Table 2 above) was introduced to the cells using electroporation (BIORAD-GenePulserII; Miao and Jian 2007 Nature Protocols 2(10): 2348-2353. 500 l of protoplasts were transferred into electroporation cuvettes and mixed with 100 l of plasmid (10-40 g DNA). Protoplasts were electroporated at 130 V and 1,000 F and incubated at room temperature for 30 minutes. 1 ml of protoplast culture medium was added to each cuvette and the protoplast suspension was poured into a small petri dish. After incubation for 24-48 h fluorescence was detected by microscopy.
FACS Sorting of Fluorescent Protein-Expressing Cells
[0490] 48 hrs after plasmid/RNA delivery, cells were collected and sorted for fluorescent protein expression using a flow cytometer in order to enrich for GFP/Editing agent expressing cells [Chiang, T. W., et al., CRISPR-Cas9(D10A) nickase-based genotypic and phenotypic screening to enhance genome editing. Sci Rep, 2016. 6: p. 24356]. This enrichment step allows bypassing antibiotic selection and collecting only cells transiently expressing the fluorescent protein, Cas9 and the sgRNA. These cells can be further tested for editing of the target gene by non-homologues end joining (NHEJ) and loss of the corresponding gene expression.
Colony Formation
[0491] The fluorescent protein positive cells were partly sampled and used for DNA extraction and genome editing (GE) testing and partly plated at high dilution in liquid medium to allow colony formation for 28-35 days. Colonies were picked, grown and split into two aliquots. One aliquot was used for DNA extraction and genome editing (GE) testing and CRISPR DNA-free testing (see below), while the others were kept in culture until their status was verified. Only the ones clearly showing to be GE and CRISPR DNA-free were selected forward.
[0492] After 20 days in the dark (from splitting for GE analysis, i.e., 60 days, hence 80 days in total), the colonies were transferred to the same medium but with reduced glucose (0.46 M) and 0.4% agarose and incubated at a low light intensity. After six weeks agarose was cut into slices and placed on protoplast culture medium with 0.31 M glucose and 0.2% gelrite. After one month, protocolonies (or calli) were subcultured into regeneration media (half strength MS +B5 vitamins, 20 g/l sucrose). Regenerated plantlets were placed on solidified media (0.8% agar) at a low light intensity at 28 C. After 2 months' plantlets were transferred to soil and placed in a glasshouse at 80-100% humidity.
Screen for Gene Modification and Absence of CRISPR System DNA
[0493] From each colony DNA was extracted from an aliquot of GFP-sorted protoplasts (optional step) and from protoplasts-derived colonies and a PCR reaction was performed with primers flanking the targeted gene. Measures are taken to sample the colony as positive colonies will be used to regenerate the plant. A control reaction from protoplasts subjected to the same method but without Cas9-sgRNA is included and considered as wild type (WT). The PCR products were then separated on an agarose gel to detect any changes in the product size compared to the WT. The PCR reaction products that vary from the WT products were cloned into pBLUNT or PCR-TOPO (Invitrogen). Alternatively, sequencing was used to verify the editing event. The resulting colonies were picked, plasmids were isolated and sequenced to determine the nature of the mutations. Clones (colonies or calli) harboring mutations that were predicted to result in domain-alteration or complete loss of the corresponding protein were chosen for whole genome sequencing in order to validate that they were free from the CRISPR system DNA/RNA and to detect the mutations at the genomic DNA level.
[0494] Positive clones exhibiting the desired GE were first tested for GFP expression via microscopy analysis (compared to WT). Next, GFP-negative plants were tested for the presence of the Cas9 cassette by PCR using primers specific (or next generation sequencing, NGS) for the Cas9 sequence or any other sequence of the expression cassette. Other regions of the construct can also be tested to ensure that nothing of the original construct is in the genome.
Plant Regeneration
[0495] Ethylene production: Ethylene biosynthesis can be measure in small plantlets via gas chromatography (GC) or laser-based assays (Cristescu et al., 2013, Supra).
Example 2
Genome Editing in ACS and ACO Genes of Banana and Plant Regeneration
[0496]
TABLE-US-00002 TABLE1 Listofprimers ID Sequence/SEQIDNO: 42 Atgaggatctacggcgaggagcac/55 44 Atggggctccacgttgatgaacac/56 46 Atggggattcccggtgacgag/57 50 Atggcgtgctccttcccgg/58 236 Gtggcactgaatagggaggagttg/59 237 Cgatcggctcatcctcaaacag/60 239 Gagtttcgagccttcctgtaagca/61 240 Cctgaagtctcgatcgaatctgg/62 242 Gtggcagcgaatagggaggagctg/63 243 Gaacggggaagttgacgacgcaattac/64 245 Gaggcgatcgacatcctgttgcc/65 246 Ctctatctgatctccgaggttgacc/66 249 Ggtgcaccacgctcttgtac/67 250 Atggattcctttccggttatcgacatg/68 251 Ctcgagctggtcgccgag/69 277 Accgaagcccctcttaaccc/70 278 Gtatggctgacaccatcacc/71 321 Ggggtcatccaaatgggacttg/72 322 Ggctatatataagtagcaacg/73 323 Acactccagatagaaagcac/74
[0497] sgRNAs and target sequences are described in
[0498] A robust protocol for the efficient isolation of protoplasts from Musa acuminata cells suspensions was followed according to Example 1 above, to subsequently transfect them with plasmids carrying the CRISPR/Cas9 machinery to target the genes of interest (endogenous ACS and ACO genes) and enrich for cells expressing a reporter using FACS sorting. To achieve this aim, the present inventors (i) generated and maintained embryogenic material; (ii) isolated protoplasts from that material; (iii) transfected with specific plasmids targeting ACS and/or ACO genes; (iv) enriched for cells expressing a fluorescent marker as a proxy for cells (e.g., mCherry) that carry the CRISPR/Cas9 complex and sgRNAs that target the gene of interest; and (v) advanced sorted protoplasts through a protoplast-regeneration pipeline to regenerate plantlets.
[0499] To test whether viable protoplasts from Musa acuminata plant material could be recovered, banana plant material (cell suspensions) was incubated in a digestion solution for 4-24 h at room temperature with gentle shaking. After digestion, the plant material was washed, filtered and re-suspended in 2 ml of MMG buffer (0.4M mannitol, 15 mM MagCl2, 4 mM MES pH 5.6)). Protoplast concentration was determined and adjusted to 110.sup.6. Next, DNA plasmid pAC2010 (carrying mCherry as fluorescent marker) was incubated with the protoplasts derived from banana in the presence of polyethylene glycol (PEG). The expression of mCherry in the protoplasts was detected by fluorescence microscopy 3 days post transfection (
[0500] The next step in recovering gene-edited plants was to deliver the CRISPR/Cas9 complex and sgRNAs that target genes of interest in banana protoplasts and enrich for cells that carry such complex by fluorescence-activated cell sorting (FACS), thereby separating successfully transfected banana cells that transiently express the fluorescent protein, Cas9 and the sgRNA. Using FACS, positive mCherry expressing protoplasts were enriched and collected (
[0501] It was confirmed that the sorted protoplasts were still intact and indeed expressing the fluorescent marker by fluorescence microscopy (
[0502] The transient nature of the transfection of the CRISPR/Cas9 complex and sgRNAs that target genes of interest in Musa acuminata protoplasts was next examined. Since all our plasmids consist of a fluorescent marker (e.g. dsRed, mCherry), Cas9, and sgRNAs (under a U6 promoter and targeting an endogenous gene of interest), the expression of the fluorescent marker in transfected banana protoplasts was followed over time and the number of mCherry-positive protoplasts was used as a proxy to get an indication of how long the CRISPR/Cas9 complex and sgRNAs might be expressed (
[0503] To reduce ethylene levels in banana plants, which may result in extended shelf-life of banana fruits, knockout of genes involved in the biosynthesis of ethylene, including the highlighted ACS and ACO (
[0504] In order to identify the genes within the banana genome, which encode functional ACS and ACO, homologous sequences from characterized pathways in model or crop species were identified. The process involves a series of sequential steps for comparative analysis of DNA and protein sequences that aim at reconstructing the evolutionary history of genes through phylogenetic analysis, filtering candidates by validating their expression in general and target tissue, and sequencing of candidate genes to ensure appropriate sgRNA design (to avoid mismatches). This procedure allowed the selection of genes, the identification of optimized target regions for knockout (conserved and potentially catalytic domains), and the design of appropriate sgRNAs.
[0505] This pipeline is based on the assumption that homologous proteins with a common ancestor may have a similar function and by doing a phylogenetic reconstruction, gene families are established and assessed for functional diversity in the evolutionary context. This is particularly important for plant species that have undergone large-scale genome duplications and for expanded gene families. Nevertheless, paralogs within a gene family do not necessarily have the same function and part of the process is to target a selection of genes within a family either individually or as a group to also account for redundancy.
[0506] Briefly, synthesis of ethylene involves a three-step reaction: the enzyme S-adenosyl-methionine synthase (S-AdoMet) catalyzes adenosylation of methionine. Then S-AdoMet is metabolized to the first compound committed to ethylene biosynthesis 1-aminocyclopropane-1-carboxylic acid (ACC) by the enzyme ACC synthase (ACS). Finally, ACC is converted to ethylene by the enzyme ACC oxidase (ACO) (
[0507] Whole-genome sequence analysis of Musa acuminata revealed specific ancestral whole-genome duplications (WGD) in the Musa lineage and their impact on gene fractionation (D'Hont et al., 2012. Nature. Vol 488; Martin et al., 2016. BMC Genomics. 17:243). Moreover, it has been reported that some banana gene families involved in ethylene biosynthesis and signaling evolved through WGD and were preferentially retained (Jourda et al., 2014. New Phytologist. Vol. 202. Pp 986-1000). Interestingly, major genes in the ethylene pathway are expanded and gene expression profiles suggested functional redundancy for several of those genes derived from WGD (Jourda et al., 2014. New Phytologist. Vol. 202. Pp 986-1000). Therefore, selection of candidate genes requires careful assessment.
[0508] The ethylene biosynthesis pathway has been well-studied in tomato and ACS and ACO genes involved in steps along system 1 and 2 have been characterized. These characterized genes were used as query sequences and are highlighted in
[0509] ACS genes (Ma09_g19150; Ma04_g35640; Ma04_g31490) were targeted with two pairs of sgRNAs as indicated in
[0510] Next, the CRISPR/Cas9 complex and sgRNAs that target ACS and ACO candidates gene were transfected into banana protoplasts and enriched for cells that carry such complex by fluorescence-activated cell sorting (FACS). Using the mCherry marker, transfected banana cells that transiently express the fluorescent protein, Cas9 and the sgRNA were separated, sorted and collected mCherry-positive banana protoplasts at 3 days post transfection (dpt). DNA was extracted from 5000 sorted protoplasts (Qiagen Plant Dneasy extraction kit) at 6 dpt. Nested PCR was performed for increased sensitivity using primers shown in
[0511] To assess whether the sgRNAs and the CRISPR/Cas9 complex was active and induced genome-editing events in all other ACS and ACO genes, a T7E1 assay was performed. It was found that all sgRNA combinations induced genome-editing events in all ACS and ACO genes (ACS: Ma09_g19150; Ma04_g35640; Ma04_g31490. ACO: Ma01_g11540; Ma07_g19730)
[0512] In parallel, additional sorted mCherry-positive protoplasts were advanced in the protoplasts regeneration. Briefly, sorted protoplasts were plated at high dilution in liquid medium to allow colony formation for 28-35 days. Colonies were picked, grown and split into two aliquots. One aliquot was used for DNA extraction and genome editing (GE) testing and CRISPR DNA-free testing while the others were kept in culture until their status was verified. Only the ones clearly showing to be GE and CRISPR DNA-free were selected forward.
[0513] After 20 days in the dark (from splitting for GE analysis, i.e., 60 days, hence 80 days in total), the colonies were transferred to the same medium but with reduced glucose (0.46 M) and 0.4% agarose and incubated at a low light intensity. After six weeks agarose was cut into slices and placed on protoplast culture medium with 0.31 M glucose and 0.2% gelrite. After one month, protocolonies (or calli) were subcultured into regeneration media (half strength MS+B5 vitamins, 20 g/l sucrose). (
[0514] In addition, banana embryogenic cell suspensions (ECS) were bombarded with the same plasmids used for transfection (pAC2007, pAC2008, pAC2010, pAC2011, and pAC2012) to extend shelf life. 3 days old ECS after bombardment the cells were moved to proliferation medium and as embryos develop from bombarded ECS, embryos were passed to embryo development medium (EDM) and maturation medium (
[0515] Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.
[0516] All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting.