HIGH-THROUGHPUT HYBRIDIZATION AND READING METHOD FOR BIOCHIPS AND SYSTEM THEREOF
20200105369 ยท 2020-04-02
Inventors
Cpc classification
G16B40/10
PHYSICS
C12Q2565/625
CHEMISTRY; METALLURGY
C12Q2537/143
CHEMISTRY; METALLURGY
B01J2219/00587
PERFORMING OPERATIONS; TRANSPORTING
G16B20/20
PHYSICS
B01J19/0046
PERFORMING OPERATIONS; TRANSPORTING
C12Q2537/143
CHEMISTRY; METALLURGY
G16B25/20
PHYSICS
C12Q2565/625
CHEMISTRY; METALLURGY
International classification
B01J19/00
PERFORMING OPERATIONS; TRANSPORTING
Abstract
A high-throughput hybridization and reading method for biochips uses probes with different marks to specifically connect single nucleotide loci by conducting connection between the probes and target genes at different temperatures, and performing hybridization at the same temperature after the probes are connected, thereby achieving hybridization detection for various loci in a single chip. The method enables fast detection for multiple loci as required by personalized medicine. The detection is high-throughput and systematized and provides highly visualized and highly accurate results. The method allows detection for different loci at different hybridization temperatures to be done simultaneously. The method features highly uniform and repeatable detection, making biochips more efficient and utility in terms of detection. Besides, the chip is easy to prepare and use, thus having a good promotional value.
Claims
1. A high-throughput hybridization and reading method for biochips, which simultaneously detects plural SNP loci in a single chip, for detection of each SNP locus the method comprising the following steps: a) performing PCR amplification on a double-stranded DNA to be detected, and marking one of its strands with a marker; b) separating the amplified double-stranded DNA, keeping the DNA strand labeled with the marker, and naming it as a to-be-detected DNA strand; c) introducing the to-be-detected DNA strand, a first probe, a second probe, and a third probe into one reaction system for polymerase chain reaction, wherein, the 3-end through 5-end of the first probe are a first hybridization region and a first complementary region, respectively, and the 5-end is an A base or a G base; the 3-end through 5-end of the second probe are a second hybridization region and a second complementary region, respectively, and the 5-end is a C base or a T base; and the 5-end of the third probe is attached to fluorescent groups or chromophoric groups; and: neither of the first and the second hybridization regions is complementary to the to-be-detected DNA, both of the first and the second complementary regions are complementary to the to-be-detected DNA strand, the 5-end of the second probe or the first probe is complementary to an SNP locus of the to-be-detected DNA, the first probe and the second probe have at least 10 same bases from their 5-ends to the 3-ends and have different intervals, which comprise at least 50% of all bases of each probe; d) when the polymerase chain reaction ends, transferring the reaction liquid to the biochip, which has been fixed with fragments complementary to the first hybridization region of the first probe and the second hybridization region of the second probe, respectively, thereby accomplishing hybridization of the single SNP locus; for detection of multiple SNP loci, depending on SNP loci of the be-detected DNA, designing a first, a second, and a third probe sequences, and repeating Step a) through Step d), so as to obtain a chip or chips having the plural SNP loci; and performing specific reaction with the resulting chip(s) to obtain precipitation or fluorescence, and determining types of the SNP loci according to results of the specific reaction.
2. The method of claim 1, wherein the marker in Step a) includes but is not limited to: a biotin, an avidin or a streptavidin.
3. The method of claim 1, wherein the fluorescent group of the third probe in Step c) includes but is not limited to: FAM, HEX, TET, JOE, TAMRA, Texas Red, ROX, CY3 and /or CY5.
4. The method of claim 1, wherein the chromophoric group of the third probe in Step c) includes but is not limited to: ECL, NBT/BCIP or DAB.
5. The method of claim 1, wherein the number of the bases in each of the first and second hybridization regions is 15 to 25.
6. The method of claim 1, wherein the number of the bases in each of the first and second complementary regions is 15 to 25.
7. The method of claim 1, wherein detection channels for the fluorescent groups are: FAM: 465 to 510 nm; CY3: 533 to 580 nm; HEX: 533 to 580 nm; TET:533 to 580 nm; JOE: 533 to 580 nm; Texas Red: 533 to 610 nm; ROX: 533 to 610 nm; CY5: 618 to 660 nm; and TAMRA:533 to 580 nm.
8. The method of claim 1, wherein Tm values corresponding to the probes are independently greater than 25 C.
9. The method of claim 1, wherein the PCR amplification system is a 25 L reaction system, which comprises: 10PCR buffer solution 2 L, 25 mM MgCl 1.5 L, 0.2 mMdNTPs 0.5 L, 5 U/LTaq DNA polymerase 0.25 L, 100 M forward primer 0.1 L, 100 M reverse primer 0.1 L, ddH20 making up to 25 L.
10. The method of claim 1, wherein the reaction condition for the PCR polymerase chain reaction is: 95 C. initial denaturation 5min; 95 C. 2 s; 58 C. 10 s; 60 C. 1 min, 40 cycles in total.
11. A high-throughput hybridization and reading system for biochips, which simultaneously detects plural SNP loci in a single chip, the system at least comprising: an amplification unit, for a) performing PCR amplification on a double-stranded DNA, and marking one of its strands with a marker; a separation unit, for b) separating the amplified double-stranded DNA, keeping the DNA strand labeled with the marker, and naming it as a to-be-detected DNA strand; a polymerase chain reaction unit, for c) introducing the to-be-detected DNA strand, a first probe, a second probe, and a third probe into one reaction system for polymerase chain reaction, wherein, the 3-end through 5-end of the first probe are a first hybridization region and a first complementary region, respectively, and the 5-end is an A base or a G base; the 3-end through 5-end of the second probe are a second hybridization region and a second complementary region, respectively, and the 5-end is a C base or a T base; and the 5-end of the third probe is attached to fluorescent groups or chromophoric groups; and: neither of the first and the second hybridization regions is complementary to the to-be-detected DNA, both of the first and the second complementary regions are complementary to the to-be-detected DNA strand, the 5-end of the second or the first probe is complementary to an SNP locus of the to-be-detected DNA, the first probe and the second probe have at least 10 same bases from their 5-ends to the 3-ends and have different intervals, which comprise at least 50% of all bases of each probe; and a chip hybridization detection unit, for d) when the polymerase chain reaction ends, transferring the reaction liquid to the biochip, which has been fixed with fragments complementary to the first hybridization region of the first probe and the second hybridization region of the second probe, respectively, thereby accomplishing hybridization of the single SNP locus; for detection of multiple SNP loci, depending on SNP loci of the be-detected DNA, designing a first, a second, and a third probe sequences, and repeating Operation a) through Operation d), so as to obtain a chip or chips having the plural SNP loci; performing specific reaction with the resulting chip(s) to obtain precipitation or fluorescence, and determining types of the SNP loci according to results of the specific reaction.
12. The system of claim 11, wherein the marker in Operation a) includes but is not limited to: a biotin, an avidin, and a streptavidin.
13. The system of claim 11, wherein the fluorescent group of the third probe in Step c) includes but is not limited to: FAM, HEX, TET, JOE, TAMRA, Texas Red, ROX, CY3 and CY5.
14. The system of claim 11, wherein the surface of the biochip is fixed with a large number of label-complementary probes corresponding to different single-nucleotide polymorphism loci.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0036]
[0037]
DETAILED DESCRIPTION
[0038] The invention as well as a preferred mode of use, further objectives and advantages thereof will be best understood by reference to the following detailed description of illustrative embodiments when read in conjunction with the accompanying drawings.
[0039] Unless stated otherwise, the experiment methods used in the following embodiments are all those conventional. Unless stated otherwise, the experiment materials used in the following embodiments are all commercially available.
Embodiment 1
I. Probe Design
[0040] In the present invention, different probes correspond to different single-nucleotide loci. The present invention places no particular limitations on the location of different single-nucleotide loci in a genomic DNA. The different probes are designed according to to-be-detected single-nucleotide loci. The present invention places no particular limitations on how the probe is designed, and the design can be done using any probe design principles and software known to people skilled of the art. For example, multiple sequence alignment software such as Clustal may be used to do multiple sequence alignment, and LSPD software may be used to design probes and primers.
[0041] In the present embodiment, the to-be-detected SNP loci are two SNP loci in an APOE gene, located in Locus 112 and Locus 158. The sequence is as described in SEQ ID NO: 1 and is shown below, wherein the to-be-detected SNP loci are bold and underlined:
TABLE-US-00001 ggcacggctgtccaaggagctgcaggcggcgcaggcccggctgggcgcg gacatggaggacgtgtgcggccgcctggtgcagtaccgcggcgaggtgc aggccatgctcggccagagcaccgaggagctgcgggtgcgcctcgcctc ccacctgcgcaagctgcgtaagcggctcctccgcgatgccgatgacctg cagaagcgcctggcagtgtaccaggccggggcccgcgagggcgccgagc gcggcctcagcgccatccgcga
[0042] As shown in
[0043] According to the foregoing probe design rules, the probes of the present embodiment are as shown in Table 1 below:
TABLE-US-00002 TABLE1 Locus Probe SEQIDNO. DNASequence(3-5) APOE FirstProbe1 4 gcggtagtaccatacggtacctcctgcaca Locus112 SecondProbe2 5 acttggtctagccgacctacctcctgcacc SpottingProbe1 6 cgccatcatggtatgcc SpottingProbe2 7 tgccacagatcggctgg Chromogenic 8 cgccggcggaccacgtcatgg Probe5 APOE FirstProbe3 9 cgtcatgtgcaatccgactggacgtcttcg Locus158 SecondProbe4 10 atggagcattccgaacgctggacgtcttct SpottingProbe3 11 gcagtacacgttaggct SpottingProbe4 12 tacctcgcggattcgac Chromogenic 13 cggaccgtcacatggtccggc Probe6
[0044] In the present embodiment, the probes match the to-be-detected fragment from its 5-end. In other words, the first probe has from its 3-end the first hybridization region and the first complementary region successively, and the 5-end is an A base or G base. The 3-end through 5-end of the second probe are the second hybridization region and the second complementary region, respectively, and the 5-end is a base C or T. The 5-end of the third probe is connected with fluorescent groups or chromophoric groups. In a different design scheme, the probes match the to-be-detected fragment from its 3-end instead. In other words, the first probe has from its 5-end the first hybridization region and the first complementary region successively, and the 3-end is an A base or a G base. The second probe has from its 5-end the second hybridization region and the second complementarity region successively, and the 3-end is a base C or T. The third probe has is 5-end phosphorylated, and has its 3-end connected with fluorescent groups or chromophoric groups. This forms a design directionally opposite to the present embodiment, yet similarly achieving match and hybridization.
II. Double-Stranded PCR Amplification
[0045] PCR double-stranded amplification is performed on the to-be-detected fragment, and one strand of the amplified product is connected with biotin microspheres to facilitate strand separation.
[0046] Primers are designed as below according to the to-be-amplified fragment:
TABLE-US-00003 ApoE-primer-1(asdescribedinSEQIDNO:2): tcgcggatggcgctga ApoE-primer-2(asdescribedinSEQIDNO:3): biotin-ggcacggctgtccaagga
Therein, one end of Primer 2 is connected with biotin microspheres.
[0047] The PCR amplification system is a 250 L reaction system, which comprises: 10PCR buffer solution 2 L, 25 mM MgCl 1.5 L, 0.2 mMdNTPs 0.5 L, 5 U/L Taq DNA polymerase 0.25 L, 100 M forward primer 0.1 L, 100 L, 100 M reverse primer 0.1 L, and ddH20 making up to 25 L. Therein, the 5-end of the forward primer is connected with biotin label.
[0048] The PCR polymerase chain reaction is performed with the following conditions: 95 C. initial denaturation 5 min; 95 C. 2 s; 58 C. 10 s; 60 C. 1 min, 40 cycles in total.
[0049] In the present invention, the forward primer and reverse primer are primers designed according to the to-be-detected SNP locus. The present invention places no particular limitations on how the primers are designed, and the design may be done using any primer design method known to people skilled of the art. The present invention places no particular limitations on the conditions of the polymerase chain reaction, and conventional PCR reaction conditions known to people skilled of the art may be used.
III. DNA Strand Separation
[0050] DNA strand separation may be realized by filtration separation using a DNA strand separation device, or using other known methods. The DNA strand separation device uses polyethylene microspheres as its membrane filter material, with gaps between the microspheres preferably being 10 m, smaller than the diameter of the biotin, so that by direct physical filtration, single strands with affinity linker can be kept on the membrane, the strands without the affinity linker are filtered off. The device provides good adsorption and elution, and has a high DNA recovery rate. Besides, the material is inexpensive and environmentally friendly.
[0051] The separation process involves: adding 0.4M NaOH and 1M NaCl to unwind the double stranded helix, gently blowing and agitating for homogenization, centrifuging at 12000 rmp for 1 min; washing off residual NaOH, neutralizing to neutrality in pH, centrifuging at 12000 rmp for 1 min; with the to-be-detected fragment retained by the membrane filter, adding a collecting liquid such as ultrapure water, then gently blowing and agitating until the DNA strand fully suspend, collecting the strand, sealing up and storing at 4 C. for later use.
IV. Integrated Reaction for Hybridization and Reading
[0052] Hybridization of the first probes 1, 3 and the second probes 2, 4 and the third probes 5, 6 with the single-stranded DNA is performed using a DNA ligase. The hybridization system works with the following conditions: 95 C. 30 s, 60 C. 30 s, 72 C. 30 s, 35 cycles in total. For hybridization, the DNA ligase may be T4 DNA ligase or a thermostable DNA ligase. For better ligation, a thermostable DNA ligase is preferred. The buffer solution used in the hybridization system may be formulated similarly as to that for amplification.
[0053] The chromogenic probes are diluted to 5 pmol/l. The first probe or the second probe has a concentration of 0.25 to 1 pmol/l. For preparing the hybridization solution, 1 l of the first probe or the second probe, and 1 l of the chromogenic probe are added into 250 l hybridization buffer. The resulting hybridization solution and the amplified products go through hybridization reaction together.
[0054] After hybridization, a hybrid amplified productfirst probe 1third probe 5 and a hybrid amplified productfirst probe 3third probe 6 are formed. The hybrids are eluted and neutralized to pH7-8 using the eluate for chip hybridization detection.
[0055] A spotting probe 1 matching the first probe 1 and a spotting probe 2 matching the second probe 2 are fixed to the chip. The spotting probes are diluted to 10 pmol/ul, and spot on the chip in order.
[0056] The sequence of the spotting probe 1 is complementary to the first hybridization region of the first probe 1, and the sequence of the spotting probe 2 is complementary to the second hybridization region of the second probe 2. The first probe 1 and the second probe 2 are hybridized with the sequences fixed to the chip, respectively. After hybridization, the identification fragment at the end of the first probe or the second probe is used to perform SNP locus variant identification. The chip is generally made of a nylon membrane, while a glass sheet or a silicone sheet is also usable
[0057] After the reaction, the reactant is washed, and a digoxin antibody is added for further reaction. After the further reaction, the reactant is washed again. Then a chromogenic solution is added for chromogenic reaction. Hybridization, antibody reaction, and chromogenic reaction each take 10 minutes.
[0058] Since the signal probe exclusively has perfect match with a single genotype of the SNP locus, the type of the bases of the to-be-detected SNP locus can be identified according to chromogenic result of the chip.
[0059] After hybridization of the probes and the amplified products, centrifuging is performed to remove unbound parts, and a digoxin antibody is added to react with the digoxin at the end of the hybridized third probe. After the reaction, the antibody is washed off, and catalysis is performed using BCIP/NBT to form blue-violet precipitation on the surface of the chip.
[0060] Where the chromogenic probe is terminated with fluorescent groups, the foregoing antibody reaction can be eliminated and fluorescence at different sites in the chip can be directly observed.
[0061] In the present embodiment, at Locus 112, the first probe 1 and the chromogenic probe 3 perfectly match the amplified products. At Locus 158, the first probe 3 and the chromogenic probe 6 perfectly match the amplified products. As shown in
[0062] In the present embodiment, each of the first and second probes is made with three different concentrations (0.25 pmol/L, 0.5 pmol/L, and 1 pmol/L). Each concentration corresponds to two sets of parallel tests, amounting to 6 sets. The results of the parallel tests are shown in
[0063] The disclosed hybridization and reading system can accomplish simultaneous parallel analysis of 24 samples in merely 60 minutes. The detection results are consistent and the operation is convenient yet effective. The precipitation results are captured using external cameras and the images are automatically processed so that the signal points showing after hybridization chromogenic reaction are marked. After hybridization, the chromogenic location of reaction sites in the chip or the chromogenic intensity can be analyzed using a chip scanner and related software, and the imaging signals can be converted into data to provide the related biological information, thereby rapidly completing the entire operation from the raw samples to the desired analysis results in a closed system in a short period of time.
[0064] More conditions and parameters for the disclosed hybridization and reading process claimed herein can be seen from the existing methods and systems for SNP detection using biochips. The present embodiment is focused on the characteristics of the disclosed method and the difference between the present invention and prior art, and omits unnecessary details that are known to people skilled in the art.
Embodiment 2
[0065] The present embodiment is similar to Embodiment 1 with the only difference that fluorescence is used for chip reading. The results are consistent with Embodiment 1.
[0066] The present invention has been described with reference to the preferred embodiments and it is understood that the embodiments are not intended to limit the scope of the present invention. Moreover, as the contents disclosed herein should be readily understood and can be implemented by a person skilled in the art, all equivalent changes or modifications which do not depart from the concept of the present invention should be encompassed by the appended claims.