YEAST STRAIN WITH XYLOSE UTILIZING CAPACITY

20200102549 ยท 2020-04-02

Assignee

Inventors

Cpc classification

International classification

Abstract

Disclosed herein are a yeast strain capable of utilizing xylose as a carbon source and a method for producing lipids using the same. The yeast strain is obtained by adaptively evolving a wild-type yeast strain which cannot utilize xylose as a carbon source so that it can produce high density lipids and then transforming the adaptively evolved strain to obtain the ability to metabolize xylose. Since the strain does not have the xylose metabolic pathway based on oxidoreductase, it can produce biodiesel and biomaterials based on lipid and lignocellulosic biomass at a high yield without a problem of cofactor imbalance and can greatly improve the economic feasibility and sustainability of the production processes of biodiesel and biomaterials.

Claims

1. A transformed and adaptively evolved yeast strain, comprising the following mutations in at least one gene selected from the group consisting of YALI0_A15642g, YALI0_A15796g, YALI0_C11165g, YALI0_C16247g, YALI0_D24849g, YALI0_D27016g, YALI0_E14388g1, YALI0_E23969g, YALIO_F04906g, and YALI0_F17468g, comprising at least one gene selected from the group consisting of a gene encoding an enzyme that interconverts D-xylose and D-xylulose and a gene encoding an enzyme that produces D-xylulose-5-phosphate from D-xylulose and capable of utilizing xylose as the sole carbon source: 147G>A mutation in the YALI0_A15642g gene; 567_568insACA and 576T>G mutations in the YALI0_A15796g gene; 1523T>C mutation in the YALI0_C11165g gene; T1412A, G1441A, A1513G, A1534G, G1535T, T1544A, and C1847T mutations in the YALI0_C16247g gene; 103G>A mutation in the YALI0_D24849g gene; 446T>C mutation in the YALI0_D27016g gene; 2525C>G, 2531T>G, 2534A>G, and 2558T>C mutations in the YALI0_E14388g1 gene; 480_481insTCCTCTACCCCCGAG, 526_527insCCTCCACCACCGAGC, and 497A>C mutations in the YALI0_E23969g gene; 2702T>A mutation in the YALIO_F04906g gene; or 482_482insGCACCA mutation in the YALI0_F17468g gene.

2. The transformed and adaptively evolved yeast strain according to claim 1, wherein the strain further comprises the following mutations in at least one gene selected from the group consisting of YALI0_A00891g, YALI0_A00935g, YALI0_A02002g, YALI0_A02497g, YALI0_A07997g, YALI0_A13849g, YALI0_A16863g, YALI0_A17578g, YALI0_A17776g, YALI0_A17853g, YALI0_A19646g, YALI0_B00748g, YALI0_B08800g, YALI0_C06424g, YALI0_C07172g, YALI0_C08437g, YALI0_C09031g, YALI0_C09614g, YALI0_C13728g, YALI0_C14476g, YALI0_C15532g, YALI0_C16148g, YALI0_D15752g, YALI0_D17820g, YALI0_D18381g, YALI0_D19822g, YALI0_D20064g, YALI0_D20526g, YALI0_D20790g, YALI0_D24563g, YALI0_D25014g, YALI0_D25058g, YALI0_D26257g, YALI0_D26510g, YALI0_D26620g, YALI0_E07832g, YALI0_E08008g, YALI0_E11363g, YALI0_E13596g, YALI0_E16731g, YALI0_E18073g, YALI0_E18216g, YALI0_E20449g, YALIO_E21109g, YALI0_F12221g, YALI0_F12793g, YALI0_F16577g, YALI0_F19030g, and YALI0_F23287g: 11_16delACGGCC mutation in the YALI0_A00891g gene; 202_203insGCTC mutation in the YALI0_A00935g gene; 1255_1256insGAGGTCAAGGTC mutation in the YALI0_A02002g gene; 132_137dupCAACTC and 331_332insCCCACT mutations in the YALI0_A02497g gene; 2846_2847insGGAGCAGGA and 2869_2870insAGGAGGAGG mutations in the YALI0_A07997g gene; 165_166insCAAA mutation in the YALI0_A13849g gene; 888_889insGAGCTGAGATGAC mutation in the YALI0_A16863g gene; 432_433insGCGGAGCCG mutation in the YALI0_A17578g gene; 959_960insACAGCAGAT mutation in the YALI0_A17776g gene; 1940_1942delAGG, 1990_1991insAGGAGGAGGCTAAGAAGA and 2817_2818insTCTGAG mutations in the YALI0_A17853g gene; 1462_1463insGGG mutation in the YALI0_A19646g gene; 525_526insCCCGAC mutation in the YALI0_B00748g gene; 152_153delGT mutation in the YALI0_B08800g gene; 1370_1373delACTT mutation in the YALI0_C06424g gene; 308_309insGCAGCGACA mutation in the YALI0_C07172g gene; 1592_1593insGACAGTCAGCAC mutation in the YALI0_C08437g gene; 1789_1790insCTCCCGAGTCCTCTGCTGAGCCTACCAGCGAAGAGACTTCT TCCG mutation in the YALI0_C09031g gene; 1620_1623delACA mutation in the YALI0_C09614g gene; 99_100insAAAAAGTGGTCGAAAAAGTGGCCA and 129_130insTGGCCGAAAAAGTGGCCAAAA mutations in the YALI0_C13728g gene; 778_779insTGC mutation in the YALI0_C14476g gene; 1611_1616delCAGCTT mutation in the YALI0_C15532g gene; 961_969delAGCAGCAGT mutation in the YALI0_C16148g gene; 1038_1039insCAG mutation in the YALI0_D15752g gene; 619_620insCCCACCCGCAAACCC mutation in the YALI0_D17820g gene; 114_115insCCTCTCACCAACTCA mutation in the YALI0_D18381g gene; 310_315delAAAGAG mutation in the YALI0_D19822g gene; 67_68insGGGGGGGG mutation in the YALI0_D20064g gene; 354_355insTCCACCGGA mutation in the YALI0_D20526g gene; 37_38insCACGTGAAAGTAGCCGAA mutation in the YALI0_D20790g gene; 84_85insGCT mutation in the YALI0_D24563g gene; 484_485insCCGCTAGCGCCAACTCTGGCTCGGAGC mutation in the YALI0_D25014g gene; 592_594dupAAG mutation in the YALI0_D25058g gene; 1478_1480delAGA mutation in the YALI0_D26257g gene; 1287_1288insAAG mutation in the YALI0_D26510g gene; 926_927insCGATGAGGACGA mutation in the YALI0_D26620g gene; 499_500insCCAAGCCCCCCGCTTCCAAGCCCACCGCTT mutation in the YALI0_E07832g gene; 794_795insCTCTTCCTCTTCCTCTTCCTCTTCCTCTTC mutation in the YALI0_E08008g gene; 74_77delCACA mutation in the YALI0_E11363g gene; 1053_1054insCAACAACAACAGCAACAA mutation in the YALI0_E13596g gene; 1622_1623insTGAGGAGGAAGAGTAGGATGAGGAGTA mutation in the YALI0_E16731g gene; 266_267insCCCCACGCAGCAGTCTTG mutation in the YALI0_E18073g gene; 930_938delACAACAGCA mutation in the YALI0_E18216g gene; 899_900insAAACGC mutation in the YALI0_E20449g gene; 228_229insGCCCCGCCT mutation in the YALI0_E21109g gene; 1825_1827delAAG mutation in the YALI0_F12221g gene; 1855_1860delTCTTCT mutation in the YALI0_F12793g gene; 807_808insCCTCCT mutation in the YALI0_F16577g gene; 1344_1345insCCTACTACCGCCGATGTT, 2065T>A, 2098A>G, and 2099C>A mutations in the YALI0_F19030g gene; or 1919_1920insCTC mutation in the YALI0_F23287g gene

3. The transformed and adaptively evolved yeast strain according to claim 1, wherein the yeast strain is a Yarrowia lipolytica strain.

4. The transformed and adaptively evolved yeast strain according to claim 1, wherein the enzyme that interconverts D-xylose and D-xylulose is xylose isomerase.

5. The transformed and adaptively evolved yeast strain according to claim 1, wherein the enzyme that produces D-xylulose-5-phosphate from D-xylulose is xylulokinase.

6. The transformed and adaptively evolved yeast strain according to claim 1, wherein the gene encoding an enzyme that interconverts D-xylose and D-xylulose is the xylA (xylose isomerase) gene.

7. The transformed and adaptively evolved yeast strain according to claim 1, wherein the gene encoding an enzyme that interconverts D-xylose and D-xylulose consists of a sequence of SEQ ID NO: 1.

8. The transformed and adaptively evolved yeast strain according to claim 1, wherein the gene encoding an enzyme that produces D-xylulose-5-phosphate from D-xylulose is the XK (xylulokinase) gene.

9. The transformed and adaptively evolved yeast strain according to claim 1, wherein the gene encoding an enzyme that produces D-xylulose-5-phosphate from D-xylulose consists of a sequence of SEQ ID NO: 2.

10. The transformed and adaptively evolved yeast strain according to claim 1, wherein the strain is transformed with at least one vector selected from the group consisting of a first vector and a second vector, wherein the first vector comprises a gene encoding an enzyme that interconverts D-xylose and D-xylulose, and wherein the second vector comprises a gene encoding an enzyme that produces D-xylulose-5-phosphate from D-xylulose.

11. The transformed and adaptively evolved yeast strain according to claim 10, wherein the first vector comprises a UAS1B enhancer, a translational elongation factor (TEF) promoter, and a gene encoding an enzyme that interconverts D-xylose and D-xylulose.

12. The transformed and adaptively evolved yeast strain according to claim 11, wherein the first vector consists of a sequence of SEQ ID NO: 3.

13. The transformed and adaptively evolved yeast strain according to claim 10, wherein the second vector comprises a UAS1B enhancer, a translational elongation factor (TEF) promoter, and a gene encoding an enzyme that produces D-xylulose-5-phosphate from D-xylulose.

14. The transformed and adaptively evolved yeast strain according to claim 13, wherein the second vector consists of a sequence of SEQ ID NO: 4.

15. The transformed and adaptively evolved yeast strain according to claim 1, wherein the strain is subcultured three times or more in a medium containing xylose as the sole carbon source.

16. The transformed and adaptively evolved yeast strain according to claim 1, wherein the yeast strain comprising mutant genes has the accession number KCTC13615BP.

17. The transformed and adaptively evolved yeast strain according to claim 1, wherein the transformed and adaptively evolved yeast strain has the accession number KCTC13616BP.

18. A method for producing the transformed and adaptively evolved yeast strain according to claim 1, comprising the steps of: subculturing a wild-type yeast strain three times or more in a medium containing xylose as the sole carbon source; and transforming the subcultured strain to comprise at least one gene selected from the group consisting of a gene encoding an enzyme that interconverts D-xylose and D-xylulose and a gene encoding an enzyme that produces D-xylulose-5-phosphate from D-xylulose.

19. A method for producing lipids, comprising the step of culturing the transformed and adaptively evolved yeast strain according to claim 1.

20. A method for producing biodiesel, comprising the steps of: culturing the transformed and adaptively evolved yeast strain according to claim 1 in a medium containing xylose as a carbon source to produce lipids; and transesterifying the produced lipids to obtain biodiesel.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0088] FIG. 1 shows the growth curves of a strain (XYLA(O), XK(X)) obtained by introducing only the xylose isomerase gene into a wild-type Yarrowia lipolytica strain (XYLA(X), XK(X)), a strain (XYLA(X), XK(O)) obtained by introducing only the xylulokinase gene, and a strain (XYLA(O), XK(O)) obtained by introducing both the xylose isomerase gene and the xylulokinase gene, in a medium containing xylose as a carbon source;

[0089] FIG. 2 shows the growth curves of a wild-type Yarrowia lipolytica strain (Wild type) and an adaptively evolved Yarrowia lipolytica strain (YSX) with xylose utilizing capacity obtained by subculturing the strain in xylose minimal medium, in a medium containing xylose as the sole carbon source;

[0090] FIG. 3 shows the growth curves of an adaptively evolved Yarrowia lipolytica strain (YSX), a strain (YSX_xylA) obtained by introducing only the xylose isomerase gene into the strain, a strain (YSX_XK) obtained by introducing only the xylulokinase, and a strain (YSX_xylA_XK) obtained by introducing both the xylose isomerase gene and the xylulokinase gene, in a minimal medium containing xylose as a carbon source;

[0091] FIG. 4 is a graph showing the xylose conversion ability of a wild-type Yarrowia lipolytica strain (WT) which was not subjected to adaptive evolution and a transformed and adaptively evolved Yarrowia lipolytica strain (YSX_xylA_XK), obtained by batch reactor operation; and

[0092] FIG. 5 is a graph comparing the concentration of the lipids produced by a transformed and adaptively evolved Yarrowia lipolytica strain (YSX_xylA_XK), obtained by batch reactor operation, compared with that of a wild-type Yarrowia lipolytica strain (WT) which was not subjected to an adaptive evolution process.

DETAILED DESCRIPTION

[0093] Hereinafter, the present invention will be described in detail.

[0094] The present invention relates to a new technology for biodiesel production capable of overcoming the limitations of conventional biodiesel production methods based on vegetable oil or microalgae in order to cope with the increasing demand for biodiesel. It relates to a technology for improving the economic feasibility and sustainability of biodiesel by producing high density lipids, which are raw materials of biodiesel, from biomass using a yeast strain that produce or contain lipids, specifically a Yarrowia lipolytica strain.

[0095] Yarrowia lipolytica strain as used herein is a representative lipid-producing strain. The lipids produced by the strain can be used as biodiesel after going through a simple chemical reaction, and biomaterials (raw materials for cosmetics, etc.). However, it is known that the wild-type Yarrowia lipolytica strain cannot utilize xylose as a carbon source. In order to increase economic feasibility and sustainability in the production of biodiesel and biomaterials, lignocellulosic biomass may be used as a raw material to produce lipids, instead of refined sugar. The lignocellulosic biomass is a raw material that provides a carbon source necessary for a lipid-producing strain to produce lipids and encompasses herbaceous biomass and cellulosic biomass. It is the most abundant carbon source which accounts for at least 90% of the total biomass produced on earth and is an environmentally friendly, renewable resource. Also, biofuels produced from lignocellulosic biomass have a better carbon reduction effect than fossil fuels and first-generation biofuels. The lignocellulosic biomass includes waste wood, agricultural and forestry by-products, and energy crops. Among the available carbon sources in lignocellulosic biomass, the carbon source that yeast strains such as yeast can utilize is glucose, which accounts for about 50% of the total lignocellulosic biomass. If a yeast strain that can also utilize xylose, which accounts for up to about 30% of lignocellulosic biomass, is developed, it will be possible to utilize up to about 80% of the available resources in lignocellulosic biomass, which will greatly improve the yield of lipid per unit biomass and thus the economical feasibility and sustainability of the production of biodiesel and biomaterials using lignocellulosic biomass. Accordingly, the present inventors have developed a yeast strain, specifically a Yarrowia lipolytica strain, capable of utilizing xylose as a carbon source.

[0096] In one aspect, the present invention provides a transformed and adaptively evolved yeast strain, comprising the following mutations in at least one gene selected from the group consisting of YALI0_A15642g, YALI0_A15796g, YALI0_C11165g, YALI0_C16247g, YALI0_D24849g, YALI0_D27016g, YALI0_E14388g1, YALI0_E23969g, YALIO_F04906g, and YALI0_F17468g, comprising at least one gene selected from the group consisting of a gene encoding an enzyme that interconverts D-xylose and D-xylulose and a gene encoding an enzyme that produces D-xylulose-5-phosphate from D-xylulose, and capable of utilizing xylose as the sole carbon source: [0097] 147G>A mutation in the YALI0_A15642g gene; [0098] 567_568insACA and 576T>G mutations in the YALI0_A15796g gene; [0099] 1523T>C mutation in the YALI0_C11165g gene; [0100] T1412A, G1441A, A1513G, A1534G, G1535T, T1544A, and C1847T mutations in the YALI0_C16247g gene; [0101] 103G>A mutation in the YALI0_D24849g gene; [0102] 446T>C mutation in the YALI0_D27016g gene; [0103] 2525C>G, 2531T>G, 2534A>G, and 2558T>C mutations in the YALI0_E14388g1 gene; [0104] 480_481insTCCTCTACCCCCGAG, 526_527insCCTCCACCACCGAGC and 497A>C mutations in the YALI0_E23969g gene; [0105] 2702T>A mutation in the YALIO_F04906g gene; or [0106] 482_482insGCACCA mutation in the YALI0_F17468g gene.

[0107] In another aspect, the present invention provides a transformed and adaptively evolved yeast strain, comprising the following mutations in at least one gene selected from the group consisting of YALI0_A15642g, YALI0_A15796g, YALI0_C11165g, YALI0_C16247g, YALI0_D24849g, YALI0_D27016g, YALI0_E14388g1, YALI0_E23969g, YALI0_F04906g, YALI0_F17468g, YALI0_A00891g, YALI0_A00935g, YALI0_A02002g, YALI0_A02497g, YALI0_A07997g, YALI0_A13849g, YALI0_A16863g, YALI0_A17578g, YALI0_A17776g, YALI0_A17853g, YALI0_A19646g, YALI0_B00748g, YALI0_B08800g, YALI0_C06424g, YALI0_C07172g, YALI0_C08437g, YALI0_C09031g, YALI0_C09614g, YALI0_C13728g, YALI0_C14476g, YALI0_C15532g, YALI0_C16148g, YALI0_D15752g, YALI0_D17820g, YALI0_D18381g, YALI0_D19822g, YALI0_D20064g, YALI0_D20526g, YALI0_D20790g, YALI0_D24563g, YALI0_D25014g, YALI0_D25058g, YALI0_D26257g, YALI0_D26510g, YALI0_D26620g, YALI0_E07832g, YALI0_E08008g, YALI0_E11363g, YALI0_E13596g, YALI0_E16731g, YALI0_E18073g, YALI0_E18216g, YALI0_E20449g, YALIO_E21109g, YALI0_F12221g, YALI0_F12793g, YALI0_F16577g, YALI0_F19030g, and YALI0_F23287g, comprising at least one gene selected from the group consisting of a gene encoding an enzyme that interconverts D-xylose and D-xylulose and a gene encoding an enzyme that produces D-xylulose-5-phosphate from D-xylulose and capable of utilizing xylose as the sole carbon source: [0108] 147G>A mutation in the YALI0_A15642g gene; [0109] 567_568insACA and 576T>G mutations in the YALI0_A15796g gene; [0110] 1523T>C mutation in the YALI0_C11165g gene; [0111] T1412A, G1441A, A1513G, A1534G, G1535T, T1544A, and C1847T mutations in the YALI0_C16247g gene; [0112] 103G>A mutation in the YALI0_D24849g gene; [0113] 446T>C mutation in the YALI0_D27016g gene; [0114] 2525C>G, 2531T>G, 2534A>G, and 2558T>C mutations in the YALI0_E14388g1 gene; [0115] 480_481insTCCTCTACCCCCGAG, 526_527insCCTCCACCACCGAGC and 497A>C mutations in the YALI0_E23969g gene; [0116] 2702T>A mutation in the YALIO_F04906g gene; [0117] 482_482insGCACCA mutation in the YALI0_F17468g gene; [0118] 11_16delACGGCC mutation in the YALI0_A00891g gene; [0119] 202_203insGCTC mutation in the YALI0_A00935g gene; [0120] 1255_1256insGAGGTCAAGGTC mutation in the YALI0_A02002g gene; [0121] 132_137dupCAACTC and 331_332insCCCACT mutations in the YALI0_A02497g gene; [0122] 2846_2847insGGAGCAGGA and 2869_2870insAGGAGGAGG mutations in the YALI0_A07997g gene; [0123] 165_166insCAAA mutation in the YALI0_A13849g gene; [0124] 888_889insGAGCTGAGATGAC mutation in the YALI0_A16863g gene; [0125] 432_433insGCGGAGCCG mutation in the YALI0_A17578g gene; [0126] 959_960insACAGCAGAT mutation in the YALI0_A17776g gene; [0127] 1940_1942delAGG, 1990_1991insAGGAGGAGGCTAAGAAGA, and 2817_2818insTCTGAG mutations in the YALI0_A17853g gene; [0128] 1462_1463insGGG mutation in the YALI0_A19646g gene; [0129] 525_526insCCCGAC mutation in the YALI0_B00748g gene; [0130] 152_153delGT mutation in the YALI0_B08800g gene; [0131] 1370_1373delACTT mutation in the YALI0_C06424g gene; [0132] 308_309insGCAGCGACA mutation in the YALI0_C07172g gene; [0133] 1592_1593insGACAGTCAGCAC mutation in the YALI0_C08437g gene; [0134] 1789_1790insCTCCCGAGTCCTCTGCTGAGCCTACCAGCGAAGAGACTTCT TCCG mutation in the YALI0_C09031g gene; [0135] 1620_1623delACA mutation in the YALI0_C09614g gene; [0136] 99_100insAAAAAGTGGTCGAAAAAGTGGCCA and 129_130insTGGCCGAAAAAGTGGCCAAAA mutations in the YALI0_C13728g gene; [0137] 778_779insTGC mutation in the YALI0_C14476g gene; [0138] 1611_1616delCAGCTT mutation in the YALI0_C15532g gene; [0139] 961_969delAGCAGCAGT mutation in the YALI0_C16148g gene; [0140] 1038_1039insCAG mutation in the YALI0_D15752g gene; [0141] 619_620insCCCACCCGCAAACCC mutation in the YALI0_D17820g gene; [0142] 114_115insCCTCTCACCAACTCA mutation in the YALI0_D18381g gene; [0143] 310_315delAAAGAG mutation in the YALI0_D19822g gene; [0144] 67_68insGGGGGGGG mutation in the YALI0_D20064g gene; [0145] 354_355insTCCACCGGA mutation in the YALI0_D20526g gene; [0146] 37_38insCACGTGAAAGTAGCCGAA mutation in the YALI0_D20790g gene; [0147] 84_85insGCT mutation in the YALI0_D24563g gene; [0148] 484_485insCCGCTAGCGCCAACTCTGGCTCGGAGC mutation in the YALI0_D25014g gene; [0149] 592_594dupAAG mutation in the YALI0_D25058g gene; [0150] 1478_1480delAGA mutation in the YALI0_D26257g gene; [0151] 1287_1288insAAG mutation in the YALI0_D26510g gene; [0152] 926 927insCGATGAGGACGA mutation in the YALI0_D26620g gene; [0153] 499_500insCCAAGCCCCCCGCTTCCAAGCCCACCGCTT mutation in the YALI0_E07832g gene; [0154] 794_795insCTCTTCCTCTTCCTCTTCCTCTTCCTCTTC mutation in the YALI0_E08008g gene; [0155] 74_77delCACA mutation in the YALI0_E11363g gene; [0156] 1053_1054insCAACAACAACAGCAACAA mutation in the YALI0_E13596g gene; [0157] 1622_1623insTGAGGAGGAAGAGTAGGATGAGGAGTA mutation in the YALI0_E16731g gene; [0158] 266_267insCCCCACGCAGCAGTCTTG mutation in the YALI0_E18073g gene; [0159] 930_938delACAACAGCA mutation in the YALI0_E18216g gene; [0160] 899_900insAAACGC mutation in the YALI0_E20449g gene; [0161] 228_229insGCCCCGCCT mutation in the YALI0_E21109g gene; [0162] 1825_1827delAAG mutation in the YALI0_F12221g gene; [0163] 1855_1860delTCTTCT mutation in the YALI0_F12793g gene; [0164] 807_808insCCTCCT mutation in the YALI0_F16577g gene; [0165] 1344_1345insCCTACTACCGCCGATGTT, 2065T>A, 2098A>G and 2099C>A mutations in the YALI0_F19030g gene; or [0166] 1919_1920insCTC mutation in the YALI0_F23287g gene.

[0167] The type of the yeast strain or wild-type yeast strain of the present invention is not limited as long as they are capable of producing an intracellular product or lipid. Specifically, it may be a Yarrowia lipolytica strain or a wild-type Yarrowia lipolytica strain. The wild-type Yarrowia lipolytica strain may be a commercially available one or the one deposited in a reliable depository authority and for which the fact that it can be freely purchased through a catalog, etc. issued by the depository authority has been verified.

[0168] Descriptions of the mutations as used herein, including deletion (del), insertion (ins), frame shift (fs), duplication (duplication) and stop (*), are as follows. For example, an expression of a mutation of a specific gene, A; B such as 11_16delACGGCC; p.Asn4_Gln6delinsLys, means that the amino acid sequence has been mutated into B due to the gene mutation of A. In addition, for example, an expression of a mutation of a specific gene, 11_16delACGGCC, means that bases 11 to 16, ACGGCC, have been deleted. Also, for example, an expression of a mutation of a specific gene, 202_203insGCTC, means that GCTC has been inserted between base 202 and base 203 of the gene. In addition, for example, an expression of a mutation of a specific gene, 132_137dupCAACTC, means that bases 132 to 137 of the gene, CAACTC, have been duplicated. Also, for example, an expression of a mutation of a specific gene, 147G>A, means that base 147 of the gene, G, has been substituted with A. Also, for example, an expression of an amino acid sequence modification (mutation) due to a mutation of a specific gene, p.Trp49*, means that the amino acid Trp has changed to stop (*). Also, for example, an expression of a mutation of a specific gene such as T1412A means that base 1412 of the gene, T, has been substituted with A.

[0169] As used herein, the term adaptively evolved yeast strain may refer to a strain comprising the following mutations in at least one gene selected from the group consisting of YALI0_A15642g, YALI0_A15796g, YALI0_C11165g, YALI0_C16247g, YALI0_D24849g, YALI0_D27016g, YALI0_E14388g1, YALI0_E23969g, YALIO_F04906g, and YALI0_F17468g: [0170] 147G>A mutation in the YALI0_A15642g gene; [0171] 567_568insACA and 576T>G mutations in the YALI0_A15796g gene; [0172] 1523T>C mutation in the YALI0_C11165g gene; [0173] T1412A, G1441A, A1513G, A1534G, G1535T, T1544A, and C1847T mutations in the YALI0_C16247g gene; [0174] 103G>A mutation in the YALI0_D24849g gene; [0175] 446T>C mutation in the YALI0_D27016g gene; [0176] 2525C>G, 2531T>G, 2534A>G, and 2558T>C mutations in the YALI0_E14388g1 gene; [0177] 480_481insTCCTCTACCCCCGAG, 526_527insCCTCCACCACCGAGC, and 497A>C mutations in the YALI0_E23969g gene; [0178] 2702T>A mutation in the YALIO_F04906g gene; or [0179] 482_482insGCACCA mutation in the YALI0_F17468g gene.

[0180] Also, the term adaptively evolved yeast strain as used herein may refer to a strain comprising the following mutations in at least one gene selected from the group consisting of YALI0_A15642g, YALI0_A15796g, YALI0_C11165g, YALI0_C16247g, YALI0_D24849g, YALI0_D27016g, YALI0_E14388g1, YALI0_E23969g, YALI0_F04906g, YALI0_F17468g, YALI0_A00891g, YALI0_A00935g, YALI0_A02002g, YALI0_A02497g, YALI0_A07997g, YALI0_A13849g, YALI0_A16863g, YALI0_A17578g, YALI0_A17776g, YALI0_A17853g, YALI0_A19646g, YALI0_B00748g, YALI0_B08800g, YALI0_C06424g, YALI0_C07172g, YALI0_C08437g, YALI0_C09031g, YALI0_C09614g, YALI0_C13728g, YALI0_C14476g, YALI0_C15532g, YALI0_C16148g, YALI0_D15752g, YALI0_D17820g, YALI0_D18381g, YALI0_D19822g, YALI0_D20064g, YALI0_D20526g, YALI0_D20790g, YALI0_D24563g, YALI0_D25014g, YALI0_D25058g, YALI0_D26257g, YALI0_D26510g, YALI0_D26620g, YALI0_E07832g, YALI0_E08008g, YALI0_E11363g, YALI0_E13596g, YALI0_E16731g, YALI0_E18073g, YALI0_E18216g, YALI0_E20449g, YALIO_E21109g, YALI0_F12221g, YALI0_F12793g, YALI0_F16577g, YALI0_F19030g, and YALI0_F23287g: [0181] 147G>A mutation in the YALI0_A15642g gene; [0182] 567_568insACA and 576T>G mutations in the YALI0_A15796g gene; [0183] 1523T>C mutation in the YALI0_C11165g gene; [0184] T1412A, G1441A, A1513G, A1534G, G1535T, T1544A, and C1847T mutations in the YALI0_C16247g gene; [0185] 103G>A mutation in the YALI0_D24849g gene; [0186] 446T>C mutation in the YALI0_D27016g gene; [0187] 2525C>G, 2531T>G, 2534A>G, and 2558T>C mutations in the YALI0_E14388g1 gene; [0188] 480_481insTCCTCTACCCCCGAG, 526_527insCCTCCACCACCGAGC, and 497A>C mutations in the YALI0_E23969g gene; [0189] 2702T>A mutation in the YALIO_F04906g gene; [0190] 482_482insGCACCA mutation in the YALI0_F17468g gene; [0191] 11_16delACGGCC mutation in the YALI0_A00891g gene; [0192] 202_203insGCTC mutation in the YALI0_A00935g gene; [0193] 1255_1256insGAGGTCAAGGTC mutation in the YALI0_A02002g gene; [0194] 132_137dupCAACTC and 331_332insCCCACT mutations in the YALI0_A02497g gene; [0195] 2846_2847insGGAGCAGGA and 2869_2870insAGGAGGAGG mutations in the YALI0_A07997g gene; [0196] 165_166insCAAA mutation in the YALI0_A13849g gene; [0197] 888_889insGAGCTGAGATGAC mutation in the YALI0_A16863g gene; [0198] 432_433insGCGGAGCCG mutation in the YALI0_A17578g gene; [0199] 959_960insACAGCAGAT mutation in the YALI0_A17776g gene; [0200] 1940_1942delAGG, 1990_1991insAGGAGGAGGCTAAGAAGA and 2817_2818insTCTGAG mutations in the YALI0_A17853g gene; [0201] 1462_1463insGGG mutation in the YALI0_A19646g gene; [0202] 525_526insCCCGAC mutation in the YALI0_B00748g gene; [0203] 152_153delGT mutation in the YALI0_B08800g gene; [0204] 1370_1373delACTT mutation in the YALI0_C06424g gene; [0205] 308_309insGCAGCGACA mutation in the YALI0_C07172g gene; [0206] 1592_1593insGACAGTCAGCAC mutation in the YALI0_C08437g gene; [0207] 1789_1790insCTCCCGAGTCCTCTGCTGAGCCTACCAGCGAAGAGACTTCT TCCG mutation in the YALI0_C09031g gene; [0208] 1620_1623delACA mutation in the YALI0_C09614g gene; [0209] 99_100insAAAAAGTGGTCGAAAAAGTGGCCA and 129_130insTGGCCGAAAAAGTGGCCAAAA mutations in the YALI0_C13728g gene; [0210] 778_779insTGC mutation in the YALI0_C14476g gene; [0211] 1611_1616delCAGCTT mutation in the YALI0_C15532g gene; [0212] 961_969delAGCAGCAGT mutation in the YALI0_C16148g gene; [0213] 1038_1039insCAG mutation in the YALI0_D15752g gene; [0214] 619_620insCCCACCCGCAAACCC mutation in the YALI0_D17820g gene; [0215] 114_115insCCTCTCACCAACTCA mutation in the YALI0_D18381g gene; [0216] 310_315delAAAGAG mutation in the YALI0_D19822g gene; [0217] 67_68insGGGGGGGG mutation in the YALI0_D20064g gene; [0218] 354_355insTCCACCGGA mutation in the YALI0_D20526g gene; [0219] 37_38insCACGTGAAAGTAGCCGAA mutation in the YALI0_D20790g gene; [0220] 84_85insGCT mutation in the YALI0_D24563g gene; [0221] 484_485insCCGCTAGCGCCAACTCTGGCTCGGAGC mutation in the YALI0_D25014g gene; [0222] 592_594dupAAG mutation in the YALI0_D25058g gene; [0223] 1478_1480delAGA mutation in the YALI0_D26257g gene; [0224] 1287_1288insAAG mutation in the YALI0_D26510g gene; [0225] 926_927insCGATGAGGACGA mutation in the YALI0_D26620g gene; [0226] 499_500insCCAAGCCCCCCGCTTCCAAGCCCACCGCTT mutation in the YALI0_E07832g gene; [0227] 794_795insCTCTTCCTCTTCCTCTTCCTCTTCCTCTTC mutation in the YALI0_E08008g gene; [0228] 74_77delCACA mutation in the YALI0_E11363g gene; [0229] 1053_1054insCAACAACAACAGCAACAA mutation in the YALI0_E13596g gene; [0230] 1622_1623insTGAGGAGGAAGAGTAGGATGAGGAGTA mutation in the YALI0_E16731g gene; [0231] 266_267insCCCCACGCAGCAGTCTTG mutation in the YALI0_E18073g gene; [0232] 930_938delACAACAGCA mutation in the YALI0_E18216g gene; [0233] 899_900insAAACGC mutation in the YALI0_E20449g gene; [0234] 228_229insGCCCCGCCT mutation in the YALI0_E21109g gene; [0235] 1825_1827delAAG mutation in the YALI0_F12221g gene; [0236] 1855_1860delTCTTCT mutation in the YALI0_F12793g gene; [0237] 807_808insCCTCCT mutation in the YALI0_F16577g gene; [0238] 1344_1345insCCTACTACCGCCGATGTT, 2065T>A, 2098A>G, and 2099C>A mutations in the YALI0_F19030g gene; or [0239] 1919_1920insCTC mutation in the YALI0_F23287g gene.

[0240] The mutation may be introduced by treating a microorganism with any chemical means and/or physical means known in the art to be capable of causing a mutation. Examples of the chemical means include chemical substances such as nitrosoguanidine (NTG), which is a guanidine derivative effective as a mutagenic substance (mutagen), methyl methanesulfonate (MMS), ethyl methanesulfonate (EMS), and benzopyrene. Examples of the physical means include radiations such as UV rays, X-rays, and -rays, although not limited thereto. In addition, the mutant genes may be introduced using a molecular biological method, specifically, genetic scissors such as CRISPR-Cas, although not limited thereto. The adaptively evolved yeast strain may be a mutant strain adaptively evolved to obtain xylose utilizing capacity by subculturing three times or more, specifically three times or more, four times or more, or five times or more in a medium containing xylose as the sole carbon source, although not limited thereto. Alternatively, the adaptively evolved yeast strain may be an adaptively evolved Yarrowia lipolytica strain. Also, it may be a strain having the accession number KCTC13615BP.

[0241] The transformed and adaptively evolved yeast strain of the present invention may be a strain obtained by transforming the adaptively evolved yeast strain. Also, it may be a transformed and adaptively evolved Yarrowia lipolytica strain. Specifically, it may be a strain transformed to comprise at least one gene selected from the group consisting of a gene encoding an enzyme that interconverts D-xylose and D-xylulose and a gene encoding an enzyme that produces D-xylulose-5-phosphate from D-xylulose.

[0242] According to one embodiment of the present invention, the adaptively evolved strain (YSK), which is obtained by subculturing a wild-type Yarrowia lipolytica strain five times in a medium containing xylose as the sole carbon source and in which at least one gene selected from the group consisting of the genes shown in Table 1 below has been mutated as shown in Table 1 below, exhibited greatly improved xylose utilizing capacity as compared to wild-type Yarrowia lipolytica strains which express xylose isomerase, and thus was found to be able to grow utilizing xylose as the sole carbon source (Example 2). The sequence of each SEQ ID NO. listed in Table 1 below represents a sequence in which the respective gene has been mutated as shown in Table 1 below.

TABLE-US-00001 TABLE1 NCBI SEQ Gene Reference ID No. GeneName Sequenceno. MutationsinGene NO. 1 YALI0_A00891g NC_006067.1 11_16delACGGCC; 5 (112988..114379, p.Asn4_Gln6delinsLys complement) 2 YALI0_A00935g NC_006067.1 202_203insGCTC;p.Tyr68fs 6 (121112..121432, complement) 3 YALI0_A02002g NC_006067.1 1255_1256insGAGGTCAAGGTC; 7 (252726..254057, p.Gly418_Gln419insArgGlyGlnGly complement) 4 YALI0_A02497g NC_006067.1 132_137dupCAACTC; 8 (316093..317005, p.Ser46Gly47insAsnSer, complement) 331_332insCCCACT; p.Asn110_Tyr111insSerHis 5 YALI0_A07997g NC_006067.1 2846_2847insGGAGCAGGA; 9 (762324..766571, p.Gly949Glu950insGluGlnGlu, complement) 2869_2870insAGGAGGAGG; p.Lys957_Glu958insGluGluGlu 6 YALI0_A13849g NC_006067.1 165_166insCAAA;p.Lys56fs 10 (1420547..1420819, complement) 7 YALI0_A15642g NC_006067.1 147G> A;p.Trp49* 11 (1605399..1605629, complement) 8 YALI0_A15796g NC_006067.1 567_568insACA;p.Thr189dup, 12 (1616617..1619565, 576T> G;p.Asp192Glu complement) 9 YALI0_A16863g NC_006067.1 888_889insGAGCTGAGATGAC;p.Val298fs 13 (1743518..1744417, complement) 10 YALI0_A17578g NC_006067.1 432_433insGCGGAGCCG; 14 (1813242..1816943, p.Pro144_Ser145insAlaGluPro complement) 11 YALI0_A17776g NC_006067.1 959_960insACAGCAGAT; 15 (1825648..1829883, p.Pro320_Gln321insGlnGlnIle complement) 12 YALI0_A17853g NC_006067.1 1940_1942delAGG;p.Glu648del, 16 (1845367..1849173, 1990_1991insAGGAGGAGGCTAAGAAGA; complement) p.Glu664_Glu665insGluGluAlaLysLysLys 2817_2818insTCTGAG; p.Asp939_Ser940insSerGlu 13 YALI0_A19646g NC_006067.1 1462_1463insGGG; 17 (2112864..2114768, p.Glu487_Glu488insGly complement) 14 YALI0_B00748g NC_006068.1 525_526insCCCGAC; 18 (102187..103176, p.Asp175_Ser176insProAsp complement) 15 YALI0_B08800g NC_006068.1 152_153delGT;p.Cys51fs 19 (1210467..1212137, complement) 16 YALI0_C06424g NC_006069.1 1370_1373delACTT;p.Tyr457fs 20 (852842..854389, complement) 17 YALI0_C07172g NC_0060697.1_ 308_309insGCAGCGACA; 21 (955882..958353, p.Gln103_Gln104insGlnArgGln complement) 18 YALI0_C08437g NC_006069.1 1592_1593insGACAGTCAGCAC; 22 (1146546..1148330, p.Lys531_Thr532insThrValSerThr complement) 19 YALI0_C09031g NC_006069.1 1789_1790insCTCCCGAGTCCTCTGCTGAGCCTA 23 (1232749..1236846, CCAGCGAAGAGACTTCTTCCG; complement) p.Ser596_Val597insAlaProGluSerSerAla GluProThrSerGluGluThrSerSer 20 YALI0_C09614g NC_006069.1 1620_1622delACA;p.Gln541del 24 (1309626..1312265, complement) 21 YALI0_C11165g NC_006069.1 1523T> C;p.Val508Ala 25 (1536684..1540028, complement) 22 YALI0_C13728g NC_006069.1 99_100insAAAAAGTGGTCGAAAAAGTGGCCA; 26 (1885929..1886756, p.Pro33_Lys34insLysLysTrpSerLysLysTr complement) pPro, 129_130insTGGCCGAAAAAGTGGCCAAAA; p.Lys43_Lys44insTrpProLysLysTrpProLys 23 YALI0_C14476g NC_006069.1 778_779insTGC;p.Lys260delinsMetGln 27 (1992000..1994063, complement) 24 YALI0_C15532g NC_006069.1 1611_1616delCAGCTT; 28 (2170451..2173659, p.Ser538_Phe539del complement) 25 YALI0_C16148g NC_006069.1 961_969delAGCAGCAGT; 29 (2285288..2286607, p.Ser321_Ser323del complement) 26 YALI0_C16247g NC_006069.1 T1412A;Val471Asp,G1441A; 30 (2295675..2299085, Asp481Asn,A1513G; complement) Asn505Asp,A1534G;Ser512Gly, G1535T; Ser512Ile,T1544A;Val515Glu, C1847T;Ala616Val 27 YALI0_D15752g NC_006070.1 1038_1039insCAG; 31 (1928726..1930150, Pro346_Gln347insGln complement) 28 YALI0_D17820g NC_006070.1 619_620insCCCACCCGCAAACCC; 32 (2203609..2206944, Thr206_His207insProHisProGlnThr complement) 29 YALI0_D18381g NC_006070.1 114_115insCCTCTCACCAACTCA; 33 (2301563..2304454, Ser38_Thr39insProLeuThrAsnSer complement) 30 YALI0_D19822g NC_006070.1 310_315delAAAGAG;Lys104_Glu105del 34 (2505960..2508386, complement) 31 YALI0_D20064g NC_006070.1 67_68insGGGGGGGG;p.Tyr23fs 35 (2529127..2530611, complement) 32 YALI0_D20526g NC_006070.1 354_355insTCCACCGGA; 36 (2604298..2604907, p.Gly118_Ser119insSerThrGly complement) 33 YALI0_D20790g NC_006070.1 37_38insCACGTGAAAGTAGCCGAA; 37 (Pre-mRNA- (2636519..2639383, p.Ser13Arg14insArgGluSerSerArgThr splicing complement) factorCWC22) 34 YALI0_D24563g NC_006070.1 84_85insGCT;p.Glu28_Lys29insAla 38 (3267394..3268023, complement) 35 YALI0_D24849g NC_006070.1 103G> A;p.Ala35Thr 39 (3309927..3310196, complement) 36 YALI0_D25014g NC_006070.1 484_485insCCGCTAGCGCCAACTCTGGCTCGGAG 40 (3333236..3334741, C; complement) p.Ala162_Ala163insAlaSerAlaAsnSerGly SerGluPro 37 YALI0_D25058g NC_006070.1 592_594dupAAG;p.Lys198dup 41 (FACTcomplex (3340885..3342519, subunitPOB3) complement) 38 YALI0_D26257g NC_006070.1 1478_1480delAGA; 42 (3490069..3492042, p.Glu493_Thr494delinsAla; complement) 39 YALI0_D26510g NC_006070.1 1287_1288insAAG; 43 (3533723..3535557, p.Gln429_Gln430insLys complement) 40 YALI0_D26620g NC_006070.1 926_927insCGATGAGGACGA; 44 (3542396..3546277, p.Asp308_Glu309insAspAspGluAsp complement) 41 YALI0_D27016g NC_006070.1 446T> C;p.Leu149Pro 45 (3595010..3597181, complement) 42 YALI0_E07832g NC_006071.1 499_500insCCAAGCCCCCCGCTTCCAAGCCCACC 46 (908935..909591, GCTT; complement) p.Pro167_Lys168insLysProProAlaSerLys ProThrAlaSer 43 YALI0_E08008g NC_006071.1 794_795insCTCTTCCTCTTCCTCTTCCTCTTCCT 47 (934849..936210, CTTC; complement) p.Gly265_Ser266insSerSerSerSerSerSer SerSerSerSer 44 YALI0_E11363g NC_006071.1 74_77delCACA;p.Thr25fs 48 (1388910..1390034, complement) 45 YALI0_E13596g NC_006071.1 1053_1054insCAACAACAACAGCAACAA; 49 (1643634..1645772, p.Gln346_Gln351dup complement) 46 YALI0_E14388g1 NC_006071.1 2531T> G;p.Leu844Arg,2534A> G; 50 (1723970..1728435, p.Gln845Arg,2558T> C;p.Val853Ala, complement) 2525C> G;p.Ser842* 47 YALI0_E16731g NC_006071.1 1622_1623insTGAGGAGGAAGAGTAGGATGAGGA 51 (1979332..1982976, GTA; complement) p.Glu541delinsAspGluGluGluGluTerAspGlu GluTer 48 YALI0_E18073g NC_006071.1 266_267insCCCCACGCAGCAGTCTTG; 52 (2132735..2133649, p.Cys89_Pro90insProThrGlnGlnSerCys complement) 49 YALI0_E18216g NC_006071.1_ 930_938delACAACAGCA; 53 (2171557..2172525, p.Gln311_Gln313del complement) 50 YALI0_E20449g NC_006071.1_ 899_900insAAACGC; 54 (2423925..2425388, p.Ala300_Asn30linsAsnAla complement) 51 YALI0_E21109g NC_006071.1 228_229insGCCCCGCCT; 55 (2510568..2511743, p.Gln76_Ala77insAlaProPro complement) 52 YALI0_E23969g NC_0060717.1 480_481insTCCTCTACCCCCGAG; 56 (2842397..2843512, p.Ser160_Ser161insSerSerThrProGlu, complement) 526_527insCCTCCACCACCGAGC; p.Ser176_Ser177insSerThrThrGluPro, 497A> C;p.Tyr166Ser 53 YALI0_F04906g NC_006072.1 2702T> A;p.Val901Glu 57 (750999..754226, complement) 54 YALI0_F12221g NC_006072.1 1825_1827delAAG;p.Lys609del 58 (1609086..1611512, complement) 55 YALI0_F12793g NC_0060727.1 1855_1860delTCTTCT; 59 (1713697..1718010, p.Ser619_Ser620del complement) 56 YALI0_F16577g NC_006072.1 807_808insCCTCCT; 60 (2216900..2218064, p.Leu269_Thr270insProPro complement) 57 YALI0_F17468g NC_006072.1 482_483insGCACCA; 61 (2332587..2335994, p.Gln160_His161insGlnHis complement) 58 YALI0_F19030g NC_006072.1 1344_1345insCCTACTACCGCCGATGTT; 62 (2541990..2544461, p.Val448_Pro449insProThrThrAlaAspVal complement) 2065T> A;p.Ser689Thr,2098A> G; p.Thr700Ala,2099C> A;p.Thr700Asn 59 YAL10_F23287g NC_006072.1 1919_1920insCTC;p.Ser640dup 63 (3052893..3056228, complement) del: deletion, ns: insertion, fs: frame shift, dup: duplication, *: stop

[0243] The transformed and adaptively evolved yeast strain of the present invention may comprise a gene encoding an enzyme that interconverts D-xylose and D-xylulose. Alternatively, the transformed and adaptively evolved yeast strain of the present invention may comprise the following mutations in at least one gene selected from the group consisting of YALI0_A15642g, YALI0_A15796g, YALI0_C11165g, YALI0_C16247g, YALI0_D24849g, YALI0_D27016g, YALI0_E14388g1, YALI0_E23969g, YALIO_F04906g, and YALI0_F17468g: [0244] 147G>A mutation in the YALI0_A15642g gene; [0245] 567_568insACA and 576T>G mutations in the YALI0_A15796g gene; [0246] 1523T>C mutation in the YALI0_C11165g gene; [0247] T1412A, G1441A, A1513G, A1534G, G1535T, T1544A, and C1847T mutations in the YALI0_C16247g gene; [0248] 103G>A mutation in the YALI0_D24849g gene; [0249] 446T>C mutation in the YALI0_D27016g gene; [0250] 2525C>G, 2531T>G, 2534A>G, and 2558T>C mutations in the YALI0_E14388g1 gene; [0251] 480_481insTCCTCTACCCCCGAG, 526_527insCCTCCACCACCGAGC and 497A>C mutations in the YALI0_E23969g gene; [0252] 2702T>A mutation in the YALIO_F04906g gene; or [0253] 482_482insGCACCA mutation in the YALI0_F17468g gene, or comprise the following mutations in at least one gene selected from the group consisting of YALI0_A15642g, YALI0_A15796g, YALI0_C11165g, YALI0_C16247g, YALI0_D24849g, YALI0_D27016g, YALI0_E14388g1, YALI0_E23969g, YALI0_F04906g, YALI0_F17468g, YALI0_A00891g, YALI0_A00935g, YALI0_A02002g, YALI0_A02497g, YALI0_A07997g, YALI0_A13849g, YALI0_A16863g, YALI0_A17578g, YALI0_A17776g, YALI0_A17853g, YALI0_A19646g, YALI0_B00748g, YALI0_B08800g, YALI0_C06424g, YALI0_C07172g, YALI0_C08437g, YALI0_C09031g, YALI0_C09614g, YALI0_C13728g, YALI0_C14476g, YALI0_C15532g, YALI0_C16148g, YALI0_D15752g, YALI0_D17820g, YALI0_D18381g, YALI0_D19822g, YALI0_D20064g, YALI0_D20526g, YALI0_D20790g, YALI0_D24563g, YALI0_D25014g, YALI0_D25058g, YALI0_D26257g, YALI0_D26510g, YALI0_D26620g, YALI0_E07832g, YALI0_E08008g, YALI0_E11363g, YALI0_E13596g, YALI0_E16731g, YALI0_E18073g, YALI0_E18216g, YALI0_E20449g, YALIO_E21109g, YALI0_F12221g, YALI0_F12793g, YALI0_F16577g, YALI0_F19030g, and YALI0_F23287g: [0254] 147G>A mutation in the YALI0_A15642g gene; [0255] 567_568insACA and 576T>G mutations in the YALI0_A15796g gene; [0256] 1523T>C mutation in the YALI0_C11165g gene; [0257] T1412A, G1441A, A1513G, A1534G, G1535T, T1544A, and C1847T mutations in the YALI0_C16247g gene; [0258] 103G>A mutation in the YALI0_D24849g gene; [0259] 446T>C mutation in the YALI0_D27016g gene; [0260] 2525C>G, 2531T>G, 2534A>G, and 2558T>C mutations in the YALI0_E14388g1 gene; [0261] 480_481insTCCTCTACCCCCGAG, 526_527insCCTCCACCACCGAGC, and 497A>C mutations in the YALI0_E23969g gene; [0262] 2702T>A mutation in the YALIO_F04906g gene; [0263] 482_482insGCACCA mutation in the YALI0_F17468g gene; [0264] 11_16delACGGCC mutation in the YALI0_A00891g gene; [0265] 202_203insGCTC mutation in the YALI0_A00935g gene; [0266] 1255_1256insGAGGTCAAGGTC mutation in the YALI0_A02002g gene; [0267] 132_137dupCAACTC and 331_332insCCCACT mutations in the YALI0_A02497g gene; [0268] 2846_2847insGGAGCAGGA and 2869_2870insAGGAGGAGG mutations in the YALI0_A07997g gene; [0269] 165_166insCAAA mutation in the YALI0_A13849g gene; [0270] 888_889insGAGCTGAGATGAC mutation in the YALI0_A16863g gene; [0271] 432_433insGCGGAGCCG mutation in the YALI0_A17578g gene; [0272] 959_960insACAGCAGAT mutation in the YALI0_A17776g gene; [0273] 1940_1942delAGG, 1990_1991insAGGAGGAGGCTAAGAAGA, and 2817_2818insTCTGAG mutations in the YALI0_A17853g gene; [0274] 1462_1463insGGG mutation in the YALI0_A19646g gene; [0275] 525_526insCCCGAC mutation in the YALI0_B00748g gene; [0276] 152_153delGT mutation in the YALI0_B08800g gene; [0277] 1370_1373delACTT mutation in the YALI0_C06424g gene; [0278] 308_309insGCAGCGACA mutation in the YALI0_C07172g gene; [0279] 1592_1593insGACAGTCAGCAC mutation in the YALI0_C08437g gene; [0280] 1789_1790insCTCCCGAGTCCTCTGCTGAGCCTACCAGCGAAGAGACTTCT TCCG mutation in the YALI0_C09031g gene; [0281] 1620_1623delACA mutation in the YALI0_C09614g gene; [0282] 99_100insAAAAAGTGGTCGAAAAAGTGGCCA and 129_130insTGGCCGAAAAAGTGGCCAAAA mutations in the YALI0_C13728g gene; [0283] 778_779insTGC mutation in the YALI0_C14476g gene; [0284] 1611_1616delCAGCTT mutation in the YALI0_C15532g gene; [0285] 961_969delAGCAGCAGT mutation in the YALI0_C16148g gene; [0286] 1038_1039insCAG mutation in the YALI0_D15752g gene; [0287] 619_620insCCCACCCGCAAACCC mutation in the YALI0_D17820g gene; [0288] 114_115insCCTCTCACCAACTCA mutation in the YALI0_D18381g gene; [0289] 310_315delAAAGAG mutation in the YALI0_D19822g gene; [0290] 67_68insGGGGGGGG mutation in the YALI0_D20064g gene; [0291] 354_355insTCCACCGGA mutation in the YALI0_D20526g gene; [0292] 37_38insCACGTGAAAGTAGCCGAA mutation in the YALI0_D20790g gene; [0293] 84_85insGCT mutation in the YALI0_D24563g gene; [0294] 484_485insCCGCTAGCGCCAACTCTGGCTCGGAGC mutation in the YALI0_D25014g gene; [0295] 592_594dupAAG mutation in the YALI0_D25058g gene; [0296] 1478_1480delAGA mutation in the YALI0_D26257g gene; [0297] 1287_1288insAAG mutation in the YALI0_D26510g gene; [0298] 926_927insCGATGAGGACGA mutation in the YALI0_D26620g gene; [0299] 499_500insCCAAGCCCCCCGCTTCCAAGCCCACCGCTT mutation in the YALI0_E07832g gene; [0300] 794_795insCTCTTCCTCTTCCTCTTCCTCTTCCTCTTC mutation in the YALI0_E08008g gene; [0301] 74_77delCACA mutation in the YALI0_E11363g gene; [0302] 1053_1054insCAACAACAACAGCAACAA mutation in the YALI0_E13596g gene; [0303] 1622_1623insTGAGGAGGAAGAGTAGGATGAGGAGTA mutation in the YALI0_E16731g gene; [0304] 266_267insCCCCACGCAGCAGTCTTG mutation in the YALI0_E18073g gene; [0305] 930_938delACAACAGCA mutation in the YALI0_E18216g gene; [0306] 899_900insAAACGC mutation in the YALI0_E20449g gene; [0307] 228_229insGCCCCGCCT mutation in the YALI0_E21109g gene; [0308] 1825_1827delAAG mutation in the YALI0_F12221g gene; [0309] 1855_1860delTCTTCT mutation in the YALI0_F12793g gene; [0310] 807_808insCCTCCT mutation in the YALI0_F16577g gene; [0311] 1344_1345insCCTACTACCGCCGATGTT, 2065T>A, 2098A>G, and 2099C>A mutations in the YALI0_F19030g gene; or [0312] 1919_1920insCTC mutation in the YALI0_F23287g gene,
and comprise a gene encoding an enzyme that interconverts D-xylose and D-xylulose. The gene encoding an enzyme that interconverts D-xylose and D-xylulose may be a gene encoding xylose isomerase. The gene encoding an enzyme that interconverts D-xylose and D-xylulose may be derived from Piromyces sp., specifically, a xylA (xylose isomerase) gene. More specifically, it may be a gene (xylA3*) obtained by mutating a xylA (xylose isomerase) gene derived from Piromyces sp. to obtain improved performance. More specifically, it may be a gene consisting of the sequence of SEQ ID NO: 1.

[0313] The transformed and adaptively evolved yeast strain of the present invention may comprise a gene encoding an enzyme that produces D-xylulose-5-phosphate from D-xylulose. Alternatively, the transformed and adaptively evolved yeast strain of the present invention may comprise the following mutations in at least one gene selected from the group consisting of YALI0_A15642g, YALI0_A15796g, YALI0_C11165g, YALI0_C16247g, YALI0_D24849g, YALI0_D27016g, YALI0_E14388g1, YALI0_E23969g, YALIO_F04906g, and YALI0_F17468g: [0314] 147G>A mutation in the YALI0_A15642g gene; [0315] 567_568insACA and 576T>G mutations in the YALI0_A15796g gene; [0316] 1523T>C mutation in the YALI0_C11165g gene; [0317] T1412A, G1441A, A1513G, A1534G, G1535T, T1544A, and C1847T mutations in the YALI0_C16247g gene; [0318] 103G>A mutation in the YALI0_D24849g gene; [0319] 446T>C mutation in the YALI0_D27016g gene; [0320] 2525C>G, 2531T>G, 2534A>G, and 2558T>C mutations in the YALI0_E14388g1 gene; [0321] 480_481insTCCTCTACCCCCGAG, 526_527insCCTCCACCACCGAGC, and 497A>C mutations in the YALI0_E23969g gene; [0322] 2702T>A mutation in the YALIO_F04906g gene; or [0323] 482_482insGCACCA mutation in the YALI0_F17468g gene, or comprise the following mutations in at least one gene selected from the group consisting of YALI0_A15642g, YALI0_A15796g, YALI0_C11165g, YALI0_C16247g, YALI0_D24849g, YALI0_D27016g, YALI0_E14388g1, YALI0_E23969g, YALI0_F04906g, YALI0_F17468g, YALI0_A00891g, YALI0_A00935g, YALI0_A02002g, YALI0_A02497g, YALI0_A07997g, YALI0_A13849g, YALI0_A16863g, YALI0_A17578g, YALI0_A17776g, YALI0_A17853g, YALI0_A19646g, YALI0_B00748g, YALI0_B08800g, YALI0_C06424g, YALI0_C07172g, YALI0_C08437g, YALI0_C09031g, YALI0_C09614g, YALI0_C13728g, YALI0_C14476g, YALI0_C15532g, YALI0_C16148g, YALI0_D15752g, YALI0_D17820g, YALI0_D18381g, YALI0_D19822g, YALI0_D20064g, YALI0_D20526g, YALI0_D20790g, YALI0_D24563g, YALI0_D25014g, YALI0_D25058g, YALI0_D26257g, YALI0_D26510g, YALI0_D26620g, YALI0_E07832g, YALI0_E08008g, YALI0_E11363g, YALI0_E13596g, YALI0_E16731g, YALI0_E18073g, YALI0_E18216g, YALI0_E20449g, YALIO_E21109g, YALI0_F12221g, YALI0_F12793g, YALI0_F16577g, YALI0_F19030g, and YALI0_F23287g: [0324] 147G>A mutation in the YALI0_A15642g gene; [0325] 567_568insACA and 576T>G mutations in the YALI0_A15796g gene; [0326] 1523T>C mutation in the YALI0_C11165g gene; [0327] T1412A, G1441A, A1513G, A1534G, G1535T, T1544A, and C1847T mutations in the YALI0_C16247g gene; [0328] 103G>A mutation in the YALI0_D24849g gene; [0329] 446T>C mutation in the YALI0_D27016g gene; [0330] 2525C>G, 2531T>G, 2534A>G, and 2558T>C mutations in the YALI0_E14388g1 gene; [0331] 480_481insTCCTCTACCCCCGAG, 526_527insCCTCCACCACCGAGC, and 497A>C mutations in the YALI0_E23969g gene; [0332] 2702T>A mutation in the YALIO_F04906g gene; [0333] 482_482insGCACCA mutation in the YALI0_F17468g gene; [0334] 11_16delACGGCC mutation in the YALI0_A00891g gene; [0335] 202_203insGCTC mutation in the YALI0_A00935g gene; [0336] 1255_1256insGAGGTCAAGGTC mutation in the YALI0_A02002g gene; [0337] 132_137dupCAACTC and 331_332insCCCACT mutations in the YALI0_A02497g gene; [0338] 2846_2847insGGAGCAGGA and 2869_2870insAGGAGGAGG mutations in the YALI0_A07997g gene; [0339] 165_166insCAAA mutation in the YALI0_A13849g gene; [0340] 888_889insGAGCTGAGATGAC mutation in the YALI0_A16863g gene; [0341] 432_433insGCGGAGCCG mutation in the YALI0_A17578g gene; [0342] 959_960insACAGCAGAT mutation in the YALI0_A17776g gene; [0343] 1940_1942delAGG, 1990_1991insAGGAGGAGGCTAAGAAGA, and 2817_2818insTCTGAG mutations in the YALI0_A17853g gene; [0344] 1462_1463insGGG mutation in the YALI0_A19646g gene; [0345] 525_526insCCCGAC mutation in the YALI0_B00748g gene; [0346] 152_153delGT mutation in the YALI0_B08800g gene; [0347] 1370_1373delACTT mutation in the YALI0_C06424g gene; [0348] 308_309insGCAGCGACA mutation in the YALI0_C07172g gene; [0349] 1592_1593insGACAGTCAGCAC mutation in the YALI0_C08437g gene; [0350] 1789_1790insCTCCCGAGTCCTCTGCTGAGCCTACCAGCGAAGAGACTTCT TCCG mutation in the YALI0_C09031g gene; [0351] 1620_1623delACA mutation in the YALI0_C09614g gene; [0352] 99_100insAAAAAGTGGTCGAAAAAGTGGCCA and 129_130insTGGCCGAAAAAGTGGCCAAAA mutations in the YALI0_C13728g gene; [0353] 778_779insTGC mutation in the YALI0_C14476g gene; [0354] 1611_1616delCAGCTT mutation in the YALI0_C15532g gene; [0355] 961_969delAGCAGCAGT mutation in the YALI0_C16148g gene; [0356] 1038_1039insCAG mutation in the YALI0_D15752g gene; [0357] 619_620insCCCACCCGCAAACCC mutation in the YALI0_D17820g gene; [0358] 114_115insCCTCTCACCAACTCA mutation in the YALI0_D18381g gene; [0359] 310_315delAAAGAG mutation in the YALI0_D19822g gene; [0360] 67_68insGGGGGGGG mutation in the YALI0_D20064g gene; [0361] 354_355insTCCACCGGA mutation in the YALI0_D20526g gene; [0362] 37_38insCACGTGAAAGTAGCCGAA mutation in the YALI0_D20790g gene; [0363] 84_85insGCT mutation in the YALI0_D24563g gene; [0364] 484_485insCCGCTAGCGCCAACTCTGGCTCGGAGC mutation in the YALI0_D25014g gene; [0365] 592_594dupAAG mutation in the YALI0_D25058g gene; [0366] 1478_1480delAGA mutation in the YALI0_D26257g gene; [0367] 1287_1288insAAG mutation in the YALI0_D26510g gene; [0368] 926_927insCGATGAGGACGA mutation in the YALI0_D26620g gene; [0369] 499_500insCCAAGCCCCCCGCTTCCAAGCCCACCGCTT mutation in the YALI0_E07832g gene; [0370] 794_795insCTCTTCCTCTTCCTCTTCCTCTTCCTCTTC mutation in the YALI0_E08008g gene; [0371] 74_77delCACA mutation in the YALI0_E11363g gene; [0372] 1053_1054insCAACAACAACAGCAACAA mutation in the YALI0_E13596g gene; [0373] 1622_1623insTGAGGAGGAAGAGTAGGATGAGGAGTA mutation in the YALI0_E16731g gene; [0374] 266_267insCCCCACGCAGCAGTCTTG mutation in the YALI0_E18073g gene; [0375] 930_938delACAACAGCA mutation in the YALI0_E18216g gene; [0376] 899_900insAAACGC mutation in the YALI0_E20449g gene; [0377] 228_229insGCCCCGCCT mutation in the YALI0_E21109g gene; [0378] 1825_1827delAAG mutation in the YALI0_F12221g gene; [0379] 1855_1860delTCTTCT mutation in the YALI0_F12793g gene; [0380] 807_808insCCTCCT mutation in the YALI0_F16577g gene; [0381] 1344_1345insCCTACTACCGCCGATGTT, 2065T>A, 2098A>G and 2099C>A mutations in the YALI0_F19030g gene; or [0382] 1919_1920insCTC mutation in the YALI0_F23287g gene,
and comprise a gene encoding an enzyme that produces D-xylulose-5-phosphate from D-xylulose. Alternatively, the transformed and adaptively evolved yeast strain of the present invention may comprise a gene encoding an enzyme that interconverts D-xylose and D-xylulose and a gene encoding an enzyme that produces D-xylulose-5-phosphate from D-xylulose. The gene encoding an enzyme that produces D-xylulose-5-phosphate from D-xylulose may be a xylulokinase. The gene encoding an enzyme that produces D-xylulose-5-phosphate from D-xylulose may be derived from Yarrowia lipolytica , specifically, a XK (xylulokinase) gene. More specifically, it may be a gene consisting of the sequence of SEQ ID NO: 2.

[0383] The adaptively evolved yeast strain or transformed and adaptively evolved yeast strain of the present invention is capable of utilizing xylose as the sole carbon source. Alternatively, the transformed and adaptively evolved yeast strain of the present invention is obtained by transforming the adaptively evolved yeast strain to comprise at least one gene selected from the group consisting of a gene encoding an enzyme that interconverts D-xylose and D-xylulose and a gene encoding an enzyme that produces D-xylulose-5-phosphate from D-xylulose, and is capable of utilizing xylose as the sole carbon source.

[0384] In one example of the present invention, a strain (YSX_xylA) transformed by introducing only the xylose isomerase gene into a strain, which is adaptively evolved by subculturing five times in a medium containing xylose as the sole carbon source, exhibited a growth rate of about 1.02 times greater than that of the control (wild-type yeast strain not subjected to adaptive evolution, OD.sub.600 of about 0.88, strain growth rate () of about 0.0158 h.sup.1). A strain (YSX_XK) transformed by introducing only the xylulokinase gene exhibited an about 1.49 times greater growth rate. A strain (YSX_xylA_XK) transformed by introducing both the xylose isomerase gene and the xylulokinase gene exhibited an about 12 times greater growth rate, indicating that it can utilize xylose as the sole carbon source (see Example 3).

[0385] The transformed and adaptively evolved yeast strain of the present invention may be transformed with at least one vector selected from the group consisting of a first vector and a second vector. Here, the terms first and second are only for distinguishing between the types of vectors, and do not limit the order or method of transformation.

[0386] The first vector may comprise a gene encoding an enzyme that interconverts D-xylose and D-xylulose. Specifically, it may comprise a UAS1B enhancer, a translational elongation factor (TEF) promoter, and a gene encoding an enzyme that interconverts D-xylose and D-xylulose. More specifically, it may consist of the sequence of SEQ ID NO: 3.

[0387] The second vector may comprise a gene encoding an enzyme that produces D-xylulose-5-phosphate from D-xylulose. Specifically, it may comprise a UAS1B enhancer, a translational elongation factor (TEF) promoter, and a gene encoding an enzyme that produces D-xylulose-5-phosphate from D-xylulose. More specifically, it may consist of the sequence of SEQ ID NO: 4.

[0388] The transformed and adaptively evolved yeast strain of the present invention may be a strain having the accession number KCTC13616BP. The strain having the accession number KCTC13616BP may be a strain obtained by transforming a strain adaptively evolved by subculturing five times in a medium containing xylose as the sole carbon source and which is adaptively evolved compared with, for example, wild-type yeast strains, with a first vector comprising a gene encoding an enzyme that interconverts D-xylose and D-xylulose. Alternatively, it may be a strain obtained by transforming the adaptively evolved strain with a second vector comprising a gene encoding an enzyme that produces D-xylulose-5-phosphate from D-xylulose. Alternatively, it may be a strain obtained by transforming the adaptively evolved strain with the first vector and the second vector.

[0389] In another aspect, the present invention may relate to a method for producing the transformed and adaptively evolved yeast strain, comprising the steps of: subculturing a wild-type yeast strain three times or more in a medium containing xylose as the sole carbon source; and transforming the subcultured strain to comprise at least one gene selected from the group consisting of a gene encoding an enzyme that interconverts D-xylose and D-xylulose and a gene encoding an enzyme that produces D-xylulose-5-phosphate from D-xylulose. Alternatively, the present invention may relate to a method for producing the transformed and adaptively evolved yeast strain, comprising the steps of: subculturing a wild-type yeast strain three times or more in a medium containing xylose as the sole carbon source; and transforming the subcultured strain to comprise at least one gene selected from the group consisting of a gene encoding an enzyme that interconverts D-xylose and D-xylulose and a gene encoding an enzyme that produces D-xylulose-5-phosphate from D-xylulose.

[0390] The step of subculturing may be subculturing a wild-type yeast strain three times or more, specifically, three times or more, four times or more, or five times or more in a medium containing xylose as the sole carbon source. The subcultured strain may be an adaptively evolved strain which comprises a mutation as shown in Table 2 below in at least one gene selected from the group consisting of the genes of Table 2 below or which comprises a mutation as shown in Table 2 below in at least one gene selected from the group consisting of the genes of Table 2 below and a mutation as shown in Table 3 below in at least one gene selected from the group consisting of the genes of Table 3 below, as compared with wild-type yeast strains. Also, the subcultured strain may be an adaptively evolved strain having the accession number KCTC13615BP.

TABLE-US-00002 TABLE2 Gene No. GeneName MutationsinGene 7 YALI0_A15642g 147G> A;p.Trp49* 8 YALI0_A15796g 567_568insACA;p.Thr189dup,576T> G;p.Asp192Glu 21 YALI0_C11165g 1523T> C;p.Val508Ala 26 YALI0_C16247g T1412A;Val471Asp,G1441A;Asp481Asn,A1513G; Asn505Asp, A1534G;Ser512Gly,G1535T;Ser512Ile,T1544A; Val515Glu, C1847T;Ala616Val 35 YALI0_D24849g 103G> A;p.Ala35Thr 41 YALI0_D27016g 446T> C;p.Leu149Pro 46 YALI0_E14388g1 2531T> G;p.Leu844Arg,2534A> G;p.Gln845Arg, 2558T> C;p.Val853Ala 52 YALI0_E23969g 480_481insTCCTCTACCCCCGAG; p.Ser160_Ser161insSerSerThrProGlu, 526_527insCCTCCACCACCGAGC; p.Ser176_Ser177insSerThrThrGluPro, 497A> C;p.Tyr166Ser 53 YALI0_F04906g 2702T> A;p.Val901Glu 57 YALI0_F17468g 482_483insGCACCA;p.Gln160_His161insGlnHis del: deletion, ins: insertion, fs: frame shift, dup: duplication, *: stop

TABLE-US-00003 TABLE3 Gene No. GeneName MutationsinGene 1 YALI0_A00891g 11_16delACGGCC;p.Asn4_Gln6delinsLys 2 YALI0_A00935g 202_203insGCTC;p.Tyr68fs 3 YALI0_A02002g 1255_1256insGAGGTCAAGGTC;p.Gly418_Gln419insArgGlyGlnGly 4 YALI0_A02497g 132_137dupCAACTC;p.Ser46_Gly47insAsnSer, 331_332insCCCACT;p.Asn110_Tyr111insSerHis 5 YALI0_A07997g 2846_2847insGGAGCAGGA;p.Gly949Glu950insGluGlnGlu, 2869_2870insAGGAGGAGG;p.Lys957Glu958insGluGluGlu 6 YALI0_A13849g 165_166insCAAA;p.Lys56fs 9 YALI0_A16863g 888_889insGAGCTGAGATGAC;p.Val298fs 10 YALI0_A17578g 432_433insGCGGAGCCG;p.Pro144_Ser145insAlaGluPro 11 YALI0_A17776g 959_960insACAGCAGAT;p.Pro320_Gln321insGlnGlnIle 12 YALI0_A17853g 1940_1942delAGG;p.Glu648del, 1990_1991insAGGAGGAGGCTAAGAAGA; p.Glu664_Glu665insGluGluAlaLysLysLys, 2817_2818insTCTGAG;p.Asp939Ser940insSerGlu 13 YALI0_A19646g 1462_1463insGGG;p.Glu487_Glu488insGly 14 YALI0_B00748g 525_526insCCCGAC;p.Asp175_Ser176insProAsp 15 YALI0_B08800g 152_153delGT;p.Cys51fs 16 YALI0_C06424g 1370_1373delACTT;p.Tyr457fs 17 YALI0_C07172g 308_309insGCAGCGACA;p.Gln103_Gln104insGlnArgGln 18 YALI0_C08437g 1592_1593insGACAGTCAGCAC;p.Lys531_Thr532insThrValSerThr 19 YALI0_C09031g 1789_1790insCTCCCGAGTCCTCTGCTGAGCCTACCAGCGAAGAGACTTCTTCCG; p.Ser596_Val597insAlaProGluSerSerAlaGluProThrSerGluGluThrSerSer 20 YALI0_C09614g 1620_1622delACA;p.Gln541del 22 YALI0_C13728g 99_100insAAAAAGTGGTCGAAAAAGTGGCCA; p.Pro33_Lys34insLysLysTrpSerLysLysTrpPro, 129_130insTGGCCGAAAAAGTGGCCAAAA; p.Lys43_Lys44insTrpProLysLysTrpProLys 23 YALI0_C14476g 778_779insTGC;p.Lys260delinsMetGln 24 YALI0_C15532g 1611_1616delCAGCTT;p.Ser538_Phe539del 25 YALI0_C16148g 961_969delAGCAGCAGT;p.Ser321_Ser323del 27 YALI0_D15752g 1038_1039insCAG;Pro346_Gln347insGln 28 YALI0_D17820g 619_620insCCCACCCGCAAACCC;Thr206_His207insProHisProGlnThr 29 YALI0_D18381g 114_115insCCTCTCACCAACTCA;Ser38_Thr39insProLeuThrAsnSer 30 YALI0_D19822g 310_315delAAAGAG;Lys104_Glu105del 31 YALI0_D20064g 67_68insGGGGGGGG;p.Tyr23fs 32 YALI0_D20526g 354_355insTCCACCGGA;p.Gly118_Ser119insSerThrGly 33 YALI0_D20790g 37_38insCACGTGAAAGTAGCCGAA;p.Ser13_Arg14insArgGluSerSerArgThr 34 YALI0_D24563g 84_85insGCT;p.Glu28_Lys29insAla 36 YALI0_D25014g 484_485insCCGCTAGCGCCAACTCTGGCTCGGAGC; p.Ala162_Ala163insAlaSerAlaAsnSerGlySerGluPro 37 YALI0_D25058g 592_594dupAAG;p.Lys198dup 38 YALI0_D26257g 1478_1480delAGA;p.Glu493_Thr494delinsAla;1480/1974; 1478/1974; 493/657; 39 YALI0_D26510g 1287_1288insAAG;p.Gln429_Gln430insLys 40 YALI0_D26620g 926_927insCGATGAGGACGA;p.Asp308_Glu309insAspAspGluAsp 42 YALI0_E07832g 499_500insCCAAGCCCCCCGCTTCCAAGCCCACCGCTT; p.Pro167_Lys168insLysProProAlaSerLysProThrAlaSer 43 YALI0_E08008g 794_795insCTCTTCCTCTTCCTCTTCCTCTTCCTCTTC; p.Gly265_Ser266insSerSerSerSerSerSerSerSerSerSer 44 YALI0_E11363g 74_77delCACA;p.Thr25fs 45 YALI0_E13596g 1053_1054insCAACAACAACAGCAACAA;p.Gln346_Gln351dup 47 YALI0E16731g 1622_1623insTGAGGAGGAAGAGTAGGATGAGGAGTA; p.Glu541delinsAspGluGluGluGluTerAspGluGluTer 48 YALI0_E18073g 266_267insCCCCACGCAGCAGTCTTG; p.Cys89_Pro90insProThrGlnGlnSerCys 49 YALI0_E18216g 930_938delACAACAGCA;p.Gln311_Gln313del 50 YALI0_E20449g 899_900insAAACGC;p.Ala300_Asn301insAsnAla 51 YALI0_E21109g 228_229insGCCCCGCCT;p.Gln76_Ala77insAlaProPro 54 YALI0_F12221g 1825_1827delAAG;p.Lys609del 55 YALI0_F12793g 1855_1860delTCTTCT;p.Ser619_Ser620del 56 YALI0_F16577g 807_808insCCTCCT;p.Leu269_Thr270insProPro 57 YALI0_F19030g 1344_1345insCCTACTACCGCCGATGTT; p.Val448_Pro449insProThrThrAlaAspVal,2065T> A;p.Ser689Thr, 2098A> G;p.Thr700Ala,2099C> A;p.Thr700Asn 58 YALI0_F23287g 1919_1920insCTC;p.Ser640dup del: deletion, ins: insertion, fs: frame shift, dup: duplication, *: stop

[0391] The step of transformation may be transforming the subcultured strain to comprise at least one gene selected from the group consisting of a gene encoding an enzyme that interconverts D-xylose and D-xylulose and a gene encoding an enzyme that produces D-xylulose-5-phosphate from D-xylulose. Specifically, it may be the step of transformation with at least one vector selected from the group consisting of the first vector and the second vector. The descriptions of the gene encoding an enzyme that interconverts D-xylose and D-xylulose, the gene encoding an enzyme that produces D-xylulose-5-phosphate from D-xylulose, the first vector, and the second vector are as described above.

[0392] In yet another aspect, the present invention provides a method for producing lipids, comprising the step of culturing the transformed and adaptively evolved yeast strain. Also, the present invention provides a method for producing lipids comprising the step of culturing the transformed and adaptively evolved yeast strain in a medium containing xylose as a carbon source.

[0393] The transformed and adaptively evolved yeast strain may be a strain obtained by subculturing three times or more, specifically, three times or more, four times or more, or five times or more in a medium containing xylose as the sole carbon source. Also, the subcultured yeast strain may be an adaptively evolved strain which comprises a mutation as shown in Table 2 below in at least one gene selected from the group consisting of the genes of Table 2 below or which comprises a mutation as shown in Table 2 below in at least one gene selected from the group consisting of the genes of Table 2 below and a mutation as shown in Table 3 below in at least one gene selected from the group consisting of the genes of Table 3 below, as compared with wild-type yeast strains. Also, it may be an adaptively evolved strain having the accession number KCTC13615BP. The descriptions of the adaptively evolved strain, the subculture, the mutant strain, the transformed and adaptively evolved yeast strain, etc. are as described above.

[0394] The lipid is an organic matter or organic compound consisting essentially of a fatty acid and glycerol, and may comprise at least one selected from the group consisting of acylglycerol, glyceride, and free fatty acid. The acylglycerol may be at least one selected from the group consisting of triacylglycerol (TAG), diacylglycerol (DAG), and monoacylglycerol (MAG). The glyceride may be at least one selected from the group consisting of monoglyceride, diglyceride, and triglyceride. Alternatively, the lipid may be at least one selected from the group consisting of butyric acid (butanoic acid, C4:0), caproic acid (hexanoic acid, C6:0), caprylic acid (octanoic acid, C8:0), capric acid (decanoic acid, C10:0), lauric acid (dodecanoic acid, C12:0), myristic acid (tetradecanoic acid, C14:0), myristoleic acid (-5, C14:1), pentadecylic acid (C15:0), palmitic acid (hexadecanoic acid, C16:0), palmitoleic acid (-7, C16:1), hexadecadienoic acid (C16:2), hexadecatrienoic acid (C16:3), margaric acid (C17:0), heptadenoic acid (C17:1), stearic acid (octadecanoic acid, C18:0), oleic acid (-9, C18:1), linoleic acid (LA, -6, C18:2), alpha-linolenic acid (ALA, -3, C18:3), octadecatetraenoic acid (C18:4), nonadecylic acid (C19:0), nonadecylic acid (C19:1), arachidic acid (eicosanoic acid, C20:0), arachidonic acid (AA, -6, C20:4), eicosapentaenoic acid (-3, C20:5), behenic acid (docosanoic acid, C22:0), erucic acid (-9, C22:1), docosapentaenoic acid (DPA, -3, 22:5), and docosahexaenoic acid (DHA, -3, C22:6). Specifically, it may be at least one fatty acid selected from the group consisting of C16:0, C16:1, C16:2, C16:3, C18:0, C18:1, C18:2, C18:3, and C18:4.

[0395] The medium used for the culture may be appropriately selected according to the characteristics of the microorganism to be cultured. If the microorganism to be cultured is a yeast strain, specifically, a Yarrowia lipolytica strain, a Yeast Synthetic Complete (YSC) medium may be used. Also, the culture medium used for the culture may be a common medium containing at least one selected from the group consisting of a suitable carbon source, nitrogen source, amino acid, vitamin, etc., and which satisfies the culture conditions of yeast strains according to an appropriate method with adjustment of the temperature, pH, etc. Examples of carbon sources that may be used include sugars and carbohydrates such as glucose, xylose, sucrose, lactose, fructose, maltose, starch, and cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil, fatty acids such as palmitic acid, stearic acid and linoleic acid, alcohols such as glycerol and ethanol, organic acids such as acetic acid, and volatile fatty acids (VFA) such as acetic acid, butyric acid, isobutyric acid, propionic acid, valeric acid, isovaleric acid, and caproic acid. These materials may be used alone or as a mixture. Examples of nitrogen sources that may be used include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, and ammonium nitrate; and organic nitrogen sources, such as amino acids and peptones such as glutamic acid, methionine and glutamine, NZ-amines, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or its decomposition products, and defatted soybean cake or its decomposition products. These nitrogen sources may be used alone or as a mixture. The medium may contain, as phosphorus sources, potassium phosphate monobasic, potassium phosphate dibasic and corresponding sodium-containing salts. Examples of phosphorus sources that may be used include potassium phosphate monobasic, potassium phosphate dibasic and corresponding sodium-containing salts. Examples of inorganic compounds that may be used include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate and calcium carbonate. Finally, in addition to the above materials, materials such as amino acids and vitamins may be used.

[0396] In addition, the culture of the transformed and adaptively evolved yeast strain may utilize xylose as a carbon source.

[0397] In addition, suitable precursors may be used in the culture medium. The above-mentioned raw materials may be added to the culture during culturing in a batch, a fed-batch, or a continuous manner by an appropriate method, although not particularly limited thereto. The pH of the culture may be adjusted by using an appropriate concentration of basic compounds, such as sodium hydroxide, potassium hydroxide, and ammonia or acidic compounds such as phosphoric acid or sulfuric acid in an appropriate amount and an appropriate manner.

[0398] Also, the culture of the transformed and adaptively evolved yeast strain may be any one selected from the group consisting of shaking culture, stationary culture, batch culture, fed-batch culture, and continuous culture. The shaking culture refers to a method of culturing a culture inoculated with a microorganism while shaking the culture. The stationary culture refers to a culture method in which a liquid culture inoculated with a microorganism is allowed to stand for culturing, without shaking. The batch culture refers to a culture method in which culture is performed with the volume of the culture fixed, without addition of a new culture from the outside. An apparatus capable of realizing this culture method is referred to as a batch reactor. The fed-batch culture is an opposite term of batch culture, in which all of the raw materials are added into a culture tank from the beginning and cultured, and it refers to a culture method in which a small amount of elements are first added, followed by repeated addition of a small amount of raw materials during culturing. An apparatus capable of realizing this culture method is referred to as a fed-batch reactor. The continuous culture refers to a culture method in which a new nutrient medium is continuously supplied and at the same time a culture containing cells and products is continuously removed. An apparatus capable of realizing this culture method is referred to as a continuous reactor. Specifically, the culture may be carried out in a batch reactor, a continuous reactor, or a fed-batch reactor. According to one embodiment of the present invention, when a yeast strain, specifically a transformed and adaptively evolved yeast strain is cultured by operating a batch reactor, a high concentration of yeast strains can be cultured and high-density lipids can be produced using the culture.

[0399] Also, the culture of the transformed and adaptively evolved yeast strain may achieve an OD.sub.600 of 1.0 or more, 1.5 or more, or more, 2.0 or more, 2.2 or more, 2.4 or more, 2.6 or more, 2.8 or more, 3.0 or more, 3.2 or more, 3.4 or more, 3.6 or more, 3.8 or more, 4.0 or more, 4.2 or more, 4.4 or more, 4.6 or more, 4.8 or more, 5.0 or more, 5.2 or more, 5.4 or more, 5.6 or more, 5.8 or more, 6.0 or more, 6.2 or more, 6.4 or more, 6.6 or more, 6.8 or more, 7.0 or more, 7.2 or more, 7.4 or more, 7.6 or more, 7.8 or more, 8.0 or more, 8.2 or more, 8.4 or more, 8.6 or more, 8.8 or more, 9.0 or more, 9.2 or more, 9.4 or more, 9.6 or more, 9.8 or more, 10.0 or more, 10.2 or more, 10.4 or more, 10.6 or more, 10.8 or more, 11.0 or more, 11.2 or more, 11.4 or more, 11.6 or more, 11.8 or more, 12.0 or more, 12.2 or more, 12.4 or more, 12.6 or more, 12.8 or more, 13.0 or more, 13.2 or more, 13.4 or more, 13.5 or more, 13.6 or more, 13.8 or more, 14.0 or more, 20 or more, 30 or more, 40 or more, 42 or more, 44 or more and 120 or less, 115 or less, 110 or less, 105 or less, 100 or less, 95 or less, 90 or less, 85 or less, 80 or less, 70 or less, 60 or less, 50 or less, 48 or less, 46 or less, 45 or less, 44 or less, 42 or less, 40 or less, 30 or less, 20 or less, 18 or less, 16 or less, 15 or less, 14 or less, 13.8 or less, 13.6 or less, 13.5 or less, 13.4 or less, 13.2 or less, 13.0 or less, 12 or less, 10 or less, 5 or less, 2 or less or 1 or less.

[0400] In another aspect, the present invention provides a method for producing biodiesel, comprising the steps of: culturing the transformed and adaptively evolved yeast strain in a medium containing xylose as a carbon source to produce lipids; and transesterifying the produced lipids to obtain biodiesel. The descriptions of the adaptively evolved strain, the transformed and adaptively evolved yeast strain, the culture of the strain, and the production of lipids are as described above.

[0401] The biodiesel, which is a type of biofuel, generally refers to fatty acid methyl ester (FAME) obtained by transesterification in which glycerol is separated from triglyceride, in which glycerol is bonded to three fatty acids, using methanol to form a fatty acid ester. The transesterification of the produced lipids to obtain biodiesel is not limited as long as it is a method for obtaining biodiesel from lipids.

[0402] Hereinafter, the present invention will be described in more detail through examples. However, the following examples are provided for illustrative purposes only to facilitate understanding of the present invention, and the scope of the present invention is not limited thereto.

EXAMPLE 1

Construction of a Strain Expressing the Xylose Isomerase Gene and the Xylulokinase Gene

[0403] In order to develop a Yarrowia lipolytica strain having xylose utilizing capacity, a Yarrowia lipolytica strain comprising a gene encoding xylose isomerase or a gene encoding xylulokinase was constructed and the xylose utilizing capacity was compared based on the curves of growth of Yarrowia lipolytica strains using xylose.

[0404] Specifically, the xylA3* gene (a mutant gene obtained by modifying the xylA (xylose isomerase) gene derived from Piromyces sp. to obtain improved performance; hereinafter referred to as xylA) was selected as the gene encoding xylose isomerase and the XK (xylulokinase) gene derived from Yarrowia lipolytica was selected as the gene encoding xylulokinase. Then, the xylA gene or the XK gene was introduced into a wild-type Yarrowia lipolytica strain that does not have xylose isomerase and xylulokinase according to the following method: Firstly, in order to overexpress the two genes, pMCS-UAS1B16-TEF-XylA-CYCt (SEQ ID NO: 3) as a first vector was constructed by inserting the xylA gene consisting of the sequence of SEQ ID NO: 1 into a translational elongation factor (TEF) promoter upstream of which an enhancer (UAS1B) has been added, and pMCS-UAS1B12-TEF-XK-CYCt (SEQ ID NO: 4) as a second vector was constructed by inserting the XK gene consisting of the sequence of SEQ ID NO: 2 into a translational elongation factor (TEF) promoter upstream of which an enhancer (UAS1B) has been added, according to a vector production method known in the art. Then, the following three types of strains were constructed: a transformed strain (the XYLA(O), XK(X) strain of FIG. 1) obtained by inserting only the first vector into a wild-type Yarrowia lipolytica strain, a transformed strain (the XYLA(X), XK(O) strain of FIG. 1) obtained by inserting only the second vector into a wild-type Yarrowia lipolytica strain and a transformed strain (the XYLA(O), XK(O) strain of FIG. 1) obtained by inserting both the first and second vectors into a wild-type Yarrowia lipolytica strain. An empty vector (pMCS-UAS1B16-TEF-CYCt and pMCS-UAS1B12-TEF-CYCt) in which neither the xylA gene nor the XK gene have been inserted was introduced into a wild-type Yarrowia lipolytica strain to obtain a control strain (the XYLA(X), XK(X) strain of FIG. 1).

[0405] Then, the above four strains were inoculated into a minimal medium (YSC medium (Yeast Synthetic Complete medium)) containing xylose as a carbon source and cultured at 28 C. with stirring at 200 rpm to investigate the growth of strains using xylose. Based on the results, the xylose utilizing capacity of the recombinant strains was evaluated, and the results are shown in FIG. 1. As used herein, the term OD.sub.600 refers to the absorbance or optical density at a wavelength of 600 nm. It can be measured using a device such as a spectrophotometer. It is possible to measure the density or concentration of microorganisms or cells in a sample by using the measured OD.sub.600.

[0406] As shown in FIG. 1, the four strains reached a stationary phase of strain growth within 28 to 60 hours, and the strain (the XYLA (O), XK (X) strain in FIG. 1) expressing only the xylose isomerase gene exhibited an OD.sub.600 value of 0.4961 at the stationary phase of growth at 60 hours after culture, indicating that it was a strain exhibiting the highest xylose-based growth, that is, having the highest xylose utilizing capacity. Meanwhile, the strain (the XYLA (O), XK (O) strain of FIG. 1) expressing both xylose isomerase and xylulokinase exhibited an OD.sub.600 value of 0.4210 at 60 hours after culture, showing a slightly increased growth compared to the control (the XYLA(X), XK(X) strain of FIG. 1) (OD.sub.600=0.3957). However, there was no significant difference between the strain and the control in the growth of cells in a xylose medium. In other words, none of the experimental groups expressing xylose isomerase or xylulokinase showed a significant improvement in cell growth as compared with the control group, and it was found that the introduction alone of the xylose isomerase and xylulokinase genes into wild-type did not lead to a significant effect on xylose utilizing capacity.

EXAMPLE 2

Construction of an Adaptively Evolved Yarrowia lipolytica Strain With Xylose Utilizing Capacity Through an Evolutionary Engineering Method

[0407] The object of this example was to obtain a Yarrowia lipolytica strain adaptively evolved for xylose utilization by subculturing the wild-type strain in xylose minimal medium (YSC medium (Yeast Synthetic Complete medium)) to improve the xylose metabolism of the wild-type Yarrowia lipolytica strain. To this end, a wild-type Yarrowia lipolytica strain expressing xylose isomerase was cultured in a minimal medium (Complete Supplement Mixture (CSM)-Leu-Ura medium (6.7 g/L yeast nitrogen base, 20 g/L xylose, CSM-Leu-Ura (MP biomedicals, Solon, USA)) containing 20 g/L of xylose as the sole carbon source. As a result, an adaptively evolved strain (the YSX strain of FIG. 2) with improved xylose utilizing capacity was separated after 5 passages of subculture. It was found that the adaptively evolved strain (YSX strain) had the mutations in the genes as shown in Table 1 above.

[0408] When the xylose utilizing capacity of the adaptively evolved strain (YSX strain) was compared with that of the wild-type strain, as shown in FIG. 2, the maximum strain concentration at the stationary phase of strain growth, expressed as OD.sub.600, was 0.50 for the wild-type strain and 1.57 for the adaptively evolved strain (YSX strain), and the adaptively evolved strain exhibited a 215% increased cell growth rate compared to the wild-type strain. In terms of growth rate (unit: ), the adaptively evolved strain (YSK strain) exhibited a growth rate of 0.006 h.sup.1, indicating that it had about 3 times higher xylose utilizing capacity than the wild-type strain, which showed a growth rate of of 0.002 h.sup.1.

[0409] From the results, it can be understood that the adaptively evolved strain has significantly improved xylose utilizing capacity as compared with the wild-type Yarrowia lipolytica strain which expresses xylose isomerase, and thus can grow utilizing xylose as the sole carbon source

EXAMPLE 3

Expression of the Xylose Isomerase Gene and the Xylulokinase Gene in Adaptively Evolved Strain

[0410] In order to produce a Yarrowia lipolytica strain having increased xylose utilizing capacity, the adaptively evolved Yarrowia lipolytica strain (YSX strain) produced in Example 2 was transformed to overexpress genes related to the xylose metabolic pathway.

Specifically, a xylose isomerase gene (xylA gene) or a xylulokinase gene (XK gene) was inserted into the adaptively evolved Yarrowia lipolytica strain (YSX strain) prepared in Example 2 according to the same method as that of Example 1 to produce transformed strains. The following three types of transformed strains were produced: a strain (the YSX_xylA strain of FIG. 3) obtained by introducing only the xylose isomerase gene (xylA gene) of Example 1 into the adaptively evolved Yarrowia lipolytica strain (YSX strain) produced in Example 2, a strain (the YSX_XK strain of FIG. 3) obtained by introducing only the xylulokinase gene (XK gene) into the adaptively evolved Yarrowia lipolytica strain (YSX strain) of Example 2, and a strain (the YSX_xylA_XK strain of FIG. 3) obtained by introducing both the xylose isomerase gene (xylA gene) and xylulokinase gene (XK gene) into the adaptively evolved Yarrowia lipolytica strain (YSX strain) produced in Example 2. The adaptively evolved Yarrowia lipolytica strain (YSK strain) of Example 2 was used as the control. Then, each of the three transformed strains and the control strain was cultured in a minimal medium (Complete Supplement Mixture (CSM) medium (6.7 g/L yeast nitrogen base, 20 g/L xylose, CSM-Leu-Ura (MP biomedicals, Solon, USA)) containing 20 g/L of xylose as a carbon source, and the xylose utilizing capacity of each strain was evaluated by comparing the indexes (OD.sub.600 and growth rate ()) of growth of the strains using xylose, according to the same method as Example 2. The results are shown in FIG. 3.

[0411] As shown in FIG. 3, the adaptively evolved control strain (YSX strain) exhibited an OD.sub.600 of about 0.88 at the stationery phase of strain growth and a strain growth rate () of about 0.0158 h.sup.1. In contrast, the strain (YSX_xylA) in which the xylose isomerase gene (xylA) has been introduced exhibited an increased OD.sub.600 of 0.99 and an increased strain growth rate of 0.0162 h.sup.1. The strain (YSX_XK) in which the xylulokinase gene (XK) has been introduced exhibited a further improved xylose utilizing capacity with an OD.sub.600 of 8.82 and a strain growth rate of 0.0235 h.sup.1. The strain (YSX_xylA_XK) in which both the xylose isomerase gene (xylA) and the xylulokinase gene (XK) has been introduced exhibited an increased OD.sub.600 of 13.51 and an increased strain growth rate of 0.0250 h.sup.1. Among the strain growth indexes of the YSX_xylA_XK strain, the maximum strain concentration (OD.sub.600) was about 38 times higher than that of the wild-type control of Example 1 (OD.sub.600=0.3596, strain growth rate 0.0027 h.sup.1) and the growth rate was about 9 times higher than the control.

[0412] Thus, it was confirmed that the transformed and adaptively evolved Yarrowia lipolytica strain, obtained by transforming the adaptively evolved Yarrowia lipolytica strain according to the present invention to express the xylose isomerase or xylulokinase gene, has a significantly increased xylose utilizing capacity compared to the wild-type strain.

EXAMPLE 4

Evaluation of the Xylose Utilizing Capacity and Lipid-Producing Ability of Transformed and Adaptively Evolved Yarrowia lipolytica Strain

[0413] In order to evaluate the ability of the transformed and adaptively evolved Yarrowia lipolytica strains to produce lipids using xylose, the transformed and adaptively evolved Yarrowia lipolytica strain (YSX_xylA_XK) produced in Example 3 was cultured in a batch reactor while investigating the strain growth using xylose and the xylose consumption trend to evaluate the actual xylose utilizing capacity thereof. Culture of yeast strains using a batch reactor allows to culture yeast strains at a high concentration and thus enables to produce high density lipids.

[0414] Specifically, the transformed and adaptively evolved Yarrowia lipolytica strain (YSX_xylA_XK) produced in Example 3 was cultured in a batch reactor. The stirring speed was adjusted to 250 to 800 rpm to maintain the dissolved oxygen concentration at 50% or more, and if necessary, a 2.5M NaOH solution was added to maintain the pH in the reactor at 3.5. At this time, 160 g/L of xylose was added to the reactor to produce high density lipids. The reactor was stopped after about 256 hours, which was the point at which xylose cannot be consumed any more. The strain growth and xylose concentration over time were measured, and the results are shown in FIG. 4. A wild-type Yarrowia lipolytica strain (control strain of Example 1), which did not have xylose isomerase and xylulokinase and did not undergo adaptive evolution as in Example 2, was used as the control.

[0415] As shown in FIG. 4, unlike the wild-type strain, which consumes almost no xylose, the transformed and adaptively evolved Yarrowia lipolytica strain (YSX_xylA_XK) produced in Example 3 showed an increase in the maximum strain concentration in a medium containing a high concentration (160 g/L) of xylose, with an OD.sub.600 of 44.79.

[0416] Also, as illustrated in FIG. 5, the measurement results of lipid production showed that the transformed and adaptively evolved Yarrowia lipolytica strain (YSX_xylA_XK) produced in Example 3 accumulated about 4 g/L of lipids from 60 g/L of xylose. The lipid production was about at least 11 times higher than that of the control.

[0417] Thus, it was confirmed that the transformed and adaptively evolved Yarrowia lipolytica strain, obtained by transforming the adaptively evolved Yarrowia lipolytica strain according to the present invention to express the xylose isomerase or xylulokinase gene, has a significantly superior xylose utilizing capacity and lipid-producing ability compared to the wild-type strain.

[0418] The present invention allows to impart to a wild-type yeast strain, which cannot utilize xylose as a carbon source, the ability to metabolize xylose based on xylose isomerase by adaptively evolving the wild-type yeast strain so as to activate the xylose metabolic pathway and then transforming the adaptively evolved strain. Thus, the present invention does not introduce the xylose metabolic pathway based on oxidoreductase, and thus allows to produce biodiesel and biomaterials (such as cosmetics) based on lipid and lignocellulosic biomass at a high yield without a problem of cofactor imbalance, and to greatly improve the economic feasibility and sustainability of the production processes of biodiesel and biomaterials.

[0419] While the present invention has been described with respect to the specific embodiments, it will be apparent to those skilled in the art that various changes and modifications may be made without departing from the spirit and scope of the invention as defined in the following claims.

[Accession Number]

[0420] Depository authority: Korean Collection for Type Cultures [0421] Accession number: KCTC13615BP [0422] Deposit date: 2018 Aug. 7

[Accession Number]

[0423] Depository authority: Korean Collection for Type Cultures [0424] Accession number: KCTC13616BP [0425] Deposit date: 2018 Aug. 7