USE OF LACTIC ACID BACTERIA FOR PREPARING FERMENTED FOOD PRODUCTS WITH INCREASED NATURAL SWEETNESS
20200093149 ยท 2020-03-26
Assignee
Inventors
- Eric Johansen (Hoersholm, DK)
- Kim Ib Soerensen (Farum, DK)
- Mirjana Curic-Bawden (Brookfield, WI)
- Mette Pia Junge (Hilleroed, DK)
Cpc classification
C12N9/1205
CHEMISTRY; METALLURGY
C12N15/01
CHEMISTRY; METALLURGY
A23C19/0323
HUMAN NECESSITIES
C12N15/1034
CHEMISTRY; METALLURGY
C12N15/746
CHEMISTRY; METALLURGY
A23C9/1238
HUMAN NECESSITIES
International classification
A23C9/123
HUMAN NECESSITIES
C12N15/10
CHEMISTRY; METALLURGY
C12N9/12
CHEMISTRY; METALLURGY
A23C19/032
HUMAN NECESSITIES
C12N15/74
CHEMISTRY; METALLURGY
Abstract
The dairy industry today faces a problem of providing an alternative to adding sweeteners to fermented milk products in order to achieve the desired sweet taste without the added calories. Furthermore, it would be highly advantageous to establish a method for reducing lactose in fermented milk products to a level which is acceptable for lactose-intolerant consumers. The above problems have been solved by providing mutant Streptococcus thermophilus strains and mutant Lactobacillus delbrueckii subsp. bulgaricus strains that excrete glucose to the milk when the milk is inoculated and fermented with such Streptococcus thermophilus strains and Lactobacillus delbrueckii subsp, bulgaricus strains. Thus, the present invention relates to strains of Streptococcus thermophilus and Lactobacillus delbrueckii subsp, bulgaricus which secrete glucose to the milk substrate during fermentation, as well as to mixed cultures comprising the Streptococcus thermophilus strains and the Lactobacillus delbrueckii subsp, bulgaricus strains, starter cultures comprising the strains and dairy products manufactured with the cultures. The present method also relates to use of the strains for decreasing the lactose content of a fermented food product and for boosting growth of the probiotic BB-12.
Claims
1-25. (canceled)
26. A method for obtaining a non-genetically modified Streptococcus thermophilus strain that carries a mutation in the DNA sequence of the glcK gene encoding a glucokinasc protein, wherein the mutation inactivates the glucokinase protein or has a negative effect on expression of the gene, comprising: (a) selecting and isolating from a pool of Streptococcus thermophilus strains derived from a galactose-fermenting Streptococcus thermophilus mother strain a pool of Streptococcus thermophilus strains which are resistant to 2-deoxyglucose; and (b) selecting and isolating from the pool of Streptococcus thermophilus strains which are resistant to 2-deoxyglucose a Streptococcus thermophilus strain and which exhibit a growth rate in M17 medium+2% galactose higher than a growth rate in M17 medium+2% glucose.
27. A method according to claim 26 further comprising: (c) selecting and isolating from a pool of 2-deoxyglucose resistant Streptococcus thermophilus strains derived from the Streptococcus thermophilus strain selected in step (b) a Streptococcus thermophilus strain exhibiting a growth rate that is high in M17 medium+2% sucrose but acto or at least 0-50% reduced compared to the growth rate of the mother strain in M17 medium+2% glucose.
28. The method according to claim 26, wherein the galactose-fermenting mother strain is selected from the group consisting of the Streptococcus thermophilus CHCC14994 strain that was deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen under accession no. DSM 25838, the Streptococcus thermophilus CHCC11976 strain that was deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen under accession no. DSM 22934, and strains derived therefrom.
29. A method for obtaining a strain of Lactobacillus delbrueckii subsp. bulgaricus strain, comprising: (a) selecting and isolating from a pool of mutant Lactobacillus delbrueckii subsp. bulgaricus strains derived from a Lactobacillus delbrueckii subsp. bulgaricus mother strain a pool of Lactobacillus delbrueckii subsp. bulgaricus strains which are resistant to 2-deoxyglucose; and (b) selecting and isolating from the pool of Lactobacillus delbrueckii subsp. bulgaricus strains which are resistant to 2-deoxyglucose a Lactobacillus delbrueckii subsp. bulgaricus and exhibit a growth rate in MRS-IM medium+2% lactose higher than a growth rate in MRS-IM medium+2% glucose.
30. A method according to claim 29, wherein the mother strain is selected from the group consisting of the Lactobacillus delbrueckii subsp. bulgaricus CHCC759 strain that was deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen under accession No. DSM 26419, the Lactobacillus delbrueckii subsp. bulgaricus CHCC10C19 strain that was deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen under accession No. DSM 19252, and strains derived therefrom.
31. A method according to claim 26, wherein the obtained Streptococcus thermophilus strain increases the amount of glucose in 9.5% B-milk to at least 5 mg/ml when inoculated into the 9.5% B-milk at a concentration of 10.sup.6-10.sup.7 CFU/ml and grown at 40 C. for 20 hours.
32. A method according to claim 26, wherein the obtained Streptococcus thermophilus strain increases the amount of glucose in 9.5% B-milk with 0.05% sucrose to at least 5 mg/ml when inoculated into the 9.5% B-milk with 0.05% sucrose at a concentration of 10.sup.6-10.sup.7 CFU/ml and grown at 40 C. for 20 hours.
33. A method according to claim 29, wherein the obtained Lactobacillus delbrueckii subsp. bulgaricus strain is resistant to 2-deoxyglucose and increases the amount of glucose in 9.5% B-milk to at least 5 mg/ml when inoculated into the 9.5% B-milk at a concentration of 10.sup.6-10.sup.7 CFU/ml and grown at 40 C. for at least 20 hours.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0037]
[0038]
[0039]
[0040]
DETAILED DISCLOSURE OF THE INVENTION
[0041] As used herein, the term lactic acid bacterium designates a gram-positive, microaerophilic or anaerobic bacterium, which ferments sugars with the production of acids including lactic acid as the predominantly produced acid, acetic acid and propionic acid. The industrially most useful lactic acid bacteria are found within the order lactobacillales which includes Lactococcus spp., Streptococcus spp., Lactobacillus spp., Leuconostoc spp., Pediococcus spp., Brevibacterium spp., Enterococcus spp. and Propionibacterium spp. Lactic acid bacteria, including bacteria of the species Lactobacillus sp. and Streptococcus thermophilus, are normally supplied to the dairy industry either as frozen or freeze-dried cultures for bulk starter propagation or as so-called Direct Vat Set (DVS) cultures, Intended for direct inoculation into a fermentation vessel or vat for the production of a dairy product, such as a fermented milk product. Such cultures are in general referred to as starter cultures or starters.
[0042] The use of the terms a and an and the and similar referents in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms comprising, having, including and containing are to be construed as open-ended terms (i.e., meaning including, but not limited to,) unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring Individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., such as) provided herein, is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention unless otherwise claimed. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.
[0043] In some countries, the legal definition of yoghurt requires the presence of both Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus. Both species generate desirable amounts of acetaldehyde, an important flavor component in yoghurt.
[0044] Cheese, such as Mozzarella and Pizza cheese as well as Feta, can also be prepared by fermentation using both Streptococcus thermophilus and Lactobacillus delbrueckii sub sp. bulgaricus (Hier et al. (2010) in The Technology of Cheesemaking, 2.sup.nd Ed. Blackwell Publishing, Oxford; 166-192).
[0045] In order to meet the requirements of tie food industry, it has become desirable to develop new strains, in particular Lactobacillus delbruckii subsp. bulgaricus strains and Streptococcus thermophilus strains, which produce more natural sweetness directly in the fermented product (inner sweetness) without contributing extra calories.
[0046] Streptococcus thermophilus is one of the most widely used lactic acid bacteria for commercial milk fermentation where the organism is normally used as part of a mixed starter culture, the other component being a Lactobacillus sp., e.g. Lactobacillus delbrueckii subsp. bulgaricus for yoghurt and Lactobacillus helveticus for Swiss-type cheese.
[0047] Lactose and sucrose are fermented more readily by Streptococcus thermophilus than their component monosaccharides. Only the glucose portion of the lactose molecule is fermented by Streptococcus thermophilus and galactose accumulates in fermented milk products when Streptococcus thermophilus is used. In yoghurt, wherein high acid concentrations limit the fermentation, free galactose remains while the free galactose produced in the early stages of Swiss cheese manufacture is later fermented by Lactobacillus helveticus. Lactococcus lactis found in many starter cultures used for cheese manufacture is also capable of consuming the galactose produced by Streptococcus thermophilus.
[0048] In order to ensure Streptococcus thermophilus strains with a growth performance as optimal as possible, the present inventors have exposed galactose-fermenting strains of Streptococcus thermophilus to the selective agent 2-deoxyglucose. Typically 2-deoxyglucose resistant mutants have mutations in the gene encoding glucokinase and in genes coding for glucose transport. The isolated mutants, CHCC15757, CHCC15887 and CHCC16404, which are resistant to 2-deoxyglucose have mutations in their glucokinase (glcK) gene. In addition to a mutation in the glucokinase gene, the present inventors found that CHCC16404 has a stop codon mutation in a glucose/mannose transporter gene which could explain why exported glucose is not transported back into the cells again.
[0049] Surprisingly, such mutants alone are still fully capable of acidifying milk although acidification time to pH 5 is delayed by 2-5 hours. They are therefore as such useful in fermented milk applications and they have preserved the ability of the mother strains to clot the milk which is characteristic of yoghurt. Additionally, it was found that the mutants excreted more than 5 mg/ml glucose, when 9.5% B-milk was inoculated with 10.sup.6-10.sup.7 CFU/ml of Streptococcus thermophilus strain CHCC15757 or CHCC15887 and fermented at 40 C. for at least 20 hours without the need for isolation of glucose transport mutants, or when 9.5% B-milk with 0.05% sucrose was inoculated with 10.sup.6-10.sup.7 CFU/ml of Streptococcus thermophilus strain CHCC16404 and fermented at 40 C. for at least 20 hours. At the same time, as little as approximately 10 mg/ml lactose and less than 1.5 mg/ml lactose (detection limit), respectively, remain in the fermented milk. Therefore, the use of such strains for producing fermented milk products may have an importance for people with lactose intolerance.
[0050] Consequently, the final fermented milk has a higher inner sweetness index of at least 2.0 calculated as described by Godshall (1988. Food Technology 42(11):71-78).
[0051] The first aspect of the present invention, thus, relates to a galactose-fermenting mutant strain of Streptococcus thermophilus, wherein the mutant strain carries a mutation in the DNA sequence of the glcK gene encoding a glucokinase protein, wherein the mutation inactivates the encoded glucokinase protein or has a negative effect on expression of the gene. Methods for measuring the level of glucokinase activity or the level of expression of the glucokinase gene are readily known (Porter etal. (1982) Biochim. Biophys. Acta, 709; 178-186) and include enzyme assays with commercially available kits and transcriptomics or quantitative PCR using materials which are readily available.
[0052] A bacterial strain as used herein refers to a bacterium which remains genetically unchanged when grown or multiplied. A multiplicity of identical bacteria are included. The term galactose-fermenting Streptococcus thermophilus strains as used herein refers to Streptococcus thermophilus strains which are capable of growth on/in M17 medium+2% galactose. The galactose-fermenting Streptococcus thermophilus strains are defined herein as Streptococcus thermophilus strains which lower the pH of M17 broth containing 2% galactose as sole carbohydrate to 5.5 or lower when inoculated from an overnight culture at 1% and incubated for 24 hours at 37 C.
[0053] Galactose-fermenting strains may be obtained by the method described in WO 2011/026863.
[0054] The term the mutation inactivates the glucokinase protein as used herein refers to a mutation which results in an inactivated glucokinase protein, a glucokinase protein which, if present in a cell, is not able to exert its normal function as well as mutations which prevent the formation of the glucokinase protein or result in degradation of the glucokinase protein.
[0055] In particular, an inactivated glucokinase protein is a protein which compared to a functional glucokinase protein is not able to facilitate phosphorylation of glucose to glucose-6-phosphate or facilitates phosphorylation of glucose to glucose-6-phosphate at a significantly reduced rate. The gene encoding such an inactivated glucokinase protein compared to the gene encoding a functional glucokinase protein comprises a mutation in the open reading frame (ORF) of the gene, wherein said mutation may include, but is not limited to, a deletion, a frameshift mutation, introduction of a stop codon or a mutation which results in an amino acid substitution, which changes the functional properties of the protein, or a promoter mutation that reduces or abolishes transcription or translation of the gene.
[0056] In preferred embodiments the mutation reduces the activity (the rate of phosphorylation of glucose to glucose-6-phosphate) of the glucokinase protein with at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%.
[0057] The glucokinase activity can be determined by the glucokinase enzymatic assays as described by Pool et al. (2006. Metabolic Engineering 8; 456-464).
[0058] The term functional glucokinase protein as used herein refers to a glucokinase protein which, if present in a cell, facilitates phosphorylation of glucose to glucose-6-phosphate. In particular, a functional glucokinase protein may be encoded by a gene comprising an ORF which has a sequence corresponding to position 1-966 in SEQ ID NO. 1 or a sequence which has at least 85% identity, such as at least 90% identity, such as at least 95% identity, such as at least 98% identity, such as at least 99% identity, to the sequence corresponding to position 1-966 of SEQ ID NO. 1.
[0059] The percent identity of two sequences can be determined by using mathematical algorithms, such as the algorithm of Karlin and Altschul (1990. Proc. Natl. Acad. Sci. USA 87; 2264), the modified algorithm described in Karlin and Altschul (1993. Proc. Natl. Acad. Sci. USA 90; 5873-5877); the algorithm of Myers and Miller (1988. CABIOS 4; 11-17); the algorithm of Needleman and Wunsch (1970. J. Mol. Biol. 48;443-453); and algorithm of Pearson and Lipman (1988. Proc. Natl. Acad. Sci. USA 85; 2444-2448). Computer software for the determination of nucleic acid or amino acid sequence identity based on these mathematical algorithms is also available. For example, the comparison of nucleotide sequences can be performed with the BLASTN program, score=100, wordlength=12. The comparison of amino acid sequences can be performed with the BLASTX program, score=50, word-length=3. For the remaining parameters of the BLAST programs, the default parameters can be used.
[0060] In many countries the use of genetically modified organisms (GMOs) for fermented milk products is not accepted. The present invention instead provides for a method of obtaining naturally occurring or induced mutant strains which can provide a desirable accumulation of glucose in the fermented milk product.
[0061] Thus, in a much preferred embodiment of the present invention the mutant strain is a naturally occurring mutant or an induced mutant.
[0062] A mutant bacterium or a mutant strain as used herein refers to a natural (spontaneous, naturally occurring) mutant bacterium or an induced mutant bacterium comprising one or more mutations in its genome (DNA) which are absent in the wild type DNA. An induced mutant is a bacterium where the mutation was induced by human treatment, such as treatment with chemical mutagens, UV- or gamma radiation etc. In contrast, a spontaneous mutant or naturally occurring mutant has not been mutagenized by man. Mutant bacteria are herein, non-GMO (non-genetically modified organism), i.e. not modified by recombinant DNA technology.
[0063] Wild type strain refers to the non-mutated form of a bacterium, as found in nature.
[0064] Terms such as strains with a sweetening property, strains which can provide a desirable accumulation of glucose in the fermented milk product and strains with enhanced properties for natural sweetening of food products are used interchangeably herein to characterize an advantageous aspect of using the strains of the present invention in fermentation of milk products.
[0065] In a preferred embodiment, the mutant strain of Streptococcus thermophilus according to the invention increases the amount of glucose in 9.5% B-milk to at least 5 mg/mL when inoculated into the 9.5% B-milk at a concentration of 10.sup.6-10.sup.7 CFU/ml and grown at 40 C. for at least 20 hours.
[0066] In another preferred embodiment, the mutant strain of Streptococcus thermophilus according to the invention increases the amount of glucose in 9.5% B-milk with 0.05% sucrose to at least 5 mg/mL when inoculated into the 9.5% B-milk with 0.05% sucrose at a concentration of 10.sup.6-10.sup.7 CFU/ml and grown at 40 C. for at least 20 hours.
[0067] In the present context, 9.5% B-milk is boiled milk made with reconstituted low fat skim milk powder to a level of dry matter of 9.5% and pasteurized at 99 C. for 30 min. followed by cooling to 40 C.
[0068] In more preferred embodiments of the invention the mutant strain leads to an increase in the amount of glucose to at least 6 mg/mL, such as at least 7 mg/mL, such as at least 8 mg/mL, such as at least 9 mg/ml, such as at least 10 mg/ml, such as at least 11 mg/ml, such as at least 12 mg/ml, such as at least 13 mg/ml, such as at least 14 mg/ml, such as at least 15 mg/ml, such as at least 20 mg/ml, such as at least 25 mg/ml.
[0069] In another embodiment of the invention the mutant strain of Streptococcus thermophilus is resistant to 2-deoxyglucose.
[0070] The term resistant to 2-deoxyglucose herein is defined by that a particular mutated bacterial strain has the ability to grow to a colony when streaked on a plate of M17 medium containing 20 mM 2-deoxyglucose after incubation at 40 C. for 20 hours. The presence of 2-deoxygluxcose in the culture medium will prevent the growth of non-mutated strains while the growth of the mutated strains is not affected or not affected significantly. Non-mutated strains which can be used as sensitive reference strains in the assessment of resistance preferably include the strains CHCC14994 and CHCC11976.
[0071] Examples 1 and 2 herein exemplify the isolation of mutant strains of Streptococcus thermophilus which are resistant to 2-deoxyglucose.
[0072] In yet another embodiment, the mutant strain according to the invention can be characterized by its growth pattern. This is illustrated by the finding that the growth rate of the mutant strain is higher in M17 medium+2% galactose than in M17 medium+2% glucose. The growth rate is measured as the development in optical density of the exponentially growing culture at 600 nanometers (OD.sub.600) with time as described in Example 2 herein.
[0073] In a preferred embodiment the growth rate is at least 5% higher, such as at least 10% higher, such as at least 15% higher, such as at least 20% higher, in M17 medium+2% galactose than in M17 medium+2% glucose.
[0074] In a preferred embodiment the mutation results in the replacement of the codon coding for serine with the codon codinc for proline in position 72 in SEQ ID NO. 2. Preferably the mutation in the glcK gere results in the replacement of a T with a C on position 214 in SEQ ID NO. 1.
[0075] In another preferred embodiment the mutation results in the replacement of the codon coding for threonine with the codon coding for isoleucine in position 141 in SEQ ID NO. 2.
[0076] Preferably, the mutation in the glcK gene results in the replacement of a C with a T on position 422 in SEQ ID NO. 1.
[0077] It should be emphasized that the glcK gene of a Streptococcus thermophilus may be inactivated by other types of mutations in other sites of the glcK gene.
[0078] In a preferred embodiment the Streptococcus thermophilus strain carries a mutation that reduces the transport of glucose into the cell.
[0079] The term a mutation that reduces the transport of glucose into the cell as used herein refers to a mutation in a gene encoding a protein involved in transport of glucose which results in an accumulation of glucose in the environment of the cell. The level of glucose in the culture medium of a Streptococcus thermophilus strain can readily be measured by methods known to the skilled person and as described in Example 4 herein also when the culture medium is a milk substrate.
[0080] In preferred embodiments the mutation reduces the transport of glucose into the cell with at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%.
[0081] The transport of glucose into the cell can be determined by the glucose uptake assay as described by Cochu et al. (2003. Appl Environ Microbiol 69(9); 5423-5432).
[0082] Preferably, the Streptococcus thermophilus strain carries a mutation in a gene encoding a component of a glucose transporter, wherein the mutation inactivates the glucose transporter protein or has a negative effect on expression of the gene.
[0083] The component may be any component of a glucose transporter protein which is critical for the transport of glucose. E.g., it is contemplated that inactivation of any component of the glucose/mannose PTS in Streptococcus thermophilus depicted in
[0084] The term the mutation inactivates the glucose transporter as used herein refers to a mutation which results in an inactivated glucose transporter, a glucose transporter protein which, if present in a cell, is not able to exert its normal function as well as mutations which prevent the formation of the glucose transporter protein or result in degradation of the glucose transporter protein.
[0085] In particular, an Inactivated glucose transporter protein is a protein which compared to a functional glucose transporter protein is not able to facilitate transport of glucose over a plasma membrane or facilitates transport of glucose over a plasma membrane at a significantly reduced rate. The gene encoding such an inactivated glucose transporter protein compared to the gene encoding a functional glucose transporter protein comprises a mutation in the open reading frame (ORF) of the gene, wherein said mutation may include, but is not limited to, a deletion, a frameshift mutation, introduction of a stop codon or a mutation which results in an amino acid substitution, which changes the functional properties of the protein, or a promoter mutation that reduces or abolishes transcription or translation of the gene.
[0086] In preferred embodiments the mutation reduces the activity (the rate of transport of glucose) of the glucose transporter protein by at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%.
[0087] The glucose transporter activity can be determined by the glucose uptake assay as described by Cochu et al. (2003. Appl Environ Microbiol 69(9); 5423-5432).
[0088] The term functional glucose transporter protein as used herein refers to a glucose transporter protein which, if present in a cell, facilitates transport of glucose over a plasma membrane.
[0089] More preferred the Streptococcus thermophilus strain carries a mutation in the DNA sequence of the manM gene encoding the IIC.sup.Man protein of the glucose/mannose phosphotransferase system, wherein the mutation inactivates the IIC.sup.Man protein or has a negative effect on expression of the gene.
[0090] In an even more preferred embodiment the mutation results in the replacement of the codon coding for glutamic acid with a stop codon in position 209 of SEQ ID NO. 6 of the IIC.sup.Man protein of the glucose/mannose phosphotransferase system. Preferably, the mutation results in the replacement of a G with a T in position 625 of SEQ ID NO. 5.
[0091] A second aspect of the invention relates to a Streptococcus thermophilus strain selected from the group consisting of the Streptococcus thermophilus CHCC15757 strain that was deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen under accession No. DSM 25850, a Streptococcus thermophilus CHCC15887 strain that was deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen under accession No. DSM 25851, the Streptococcus thermophilus CHCC16404 strain that was deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen under accession No. DSM 26722 and strains derived therefrom.
[0092] In the present context, the term strains derived therefrom should be understood as strains derived, or strains which can be derived from a strain (or their mother strain) of the invention by means of e.g. genetic engineering, radiation and/or chemical treatment. The strains derived therefrom can also be spontaneously occurring mutants. It is preferred that the strains derived therefrom are functionally equivalent mutants, e.g. mutants that have substantially the same, or improved, properties (e.g. regarding excretion of glucose) as their mother strain. Such strains derived therefrom are part of the present invention. Especially, the term strains derived therefrom refers to strains obtained by subjecting a strain of the invention to any conventionally used mutagenization treatment including treatment with a chemical mutagen such as ethane methane sulphonate (EMS) or N-methyl-N-nitro-N-nitroguanidine (NTG), UV light, or to a spontaneously occurring mutant. A mutant may have been subjected to several mutagenization treatments (a single treatment should be understood as one mutagenization step followed by a screening/selection step), but it is presently preferred that no more than 20, or no more than 10, or no more than 5, treatments (or screening/selection steps) are carried out. In a presently preferred mutant less than 1%, less than 0.1%, less than 0.01%, less than 0.001% or even less than 0.0001% of the nucleotides in the bacterial genome have been replaced with another nucleotide, or deleted, compared to the mother strain.
[0093] Accordingly, In a preferred embodiment the Streptococcus thermophilus strain is selected from the group consisting of the Streptococcus thermophilus CHCC15757 strain that was deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen under accession No. DSM 25850, a Streptococcus thermophilus CHCC15887 strain that was deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen under accession No. DSM 25851, the Streptococcus thermophilus CHCC16404 strain that was deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen under accession No. DSM 26722 and a mutant strain derived therefrom, wherein the mutant strain is obtained by using one of the deposited strains as starting material, and wherein the mutant has retained or further improved the lactose fermenting property and/or the glucose secreting property of said deposited strain.
[0094] Lactobacillus delbrueckii subsp. bulgaricus is a lactic acid bacterium which is frequently employed for commercial milk fermentation where the organism is normally used as part of a mixed starter culture.
[0095] Lactose is fermented more readily than the monosaccharides glucose, fructose, and mannose by Lactobacillus delbrueckii subsp. bulgaricus and strains of this species normally do not grow on galactose (Buchanan R. E., Gibbons N. E., eds (1974): Bergey's manual of determinative bacteriology (The Williams & Wilkins Co. Baltimore, Md.), 8th ed.). During fermentation of lactose by Lactobacillus delbrueckii subsp. bulgaricus, only the glucose portion of the lactose molecule is fermented and thus galactose accumulates in fermented milk products.
[0096] In order to obtain Lactobacillus delbrueckii subsp. bulgaricus strains which are unable to grow on glucose as carbon source, the present inventors have exposed strains of Lactobacillus delbrueckii subsp. bulgaricus to 2-deoxyglucose. The isolated mutants were resistant to 2-deoxyglucose and capable of growing in a milk substrate without using glucose as a carbon source. The mutants were found to increase the glucose content of milk. Accordingly, fermented milk products produced by use of these strains are characterized by a higher amount of glucose which renders the products sweeter in taste.
[0097] Surprisingly, the Lactobacillus delbrueckii subsp. bulgaricus strains of the invention alone are still fully capable of acidifying milk although acidification time to pH 5 is delayed by 2-5 hours. Additionally, as demonstrated in the Examples, it was found that the strains excreted approximately 5 mg/ml or more glucose while less than approximately 10 mg/ml lactose remained in the fermented milk when 9.5% B-milk was inoculated with 10.sup.6-10.sup.7 CFU/ml of a Lactobacillus delbrueckii subsp. bulgaricus strain according to the invention and fermented with the Lactobacillus delbrueckii subsp. bulgaricus strain according to the invention at 40 C. for at least 20 hours. Therefore, the use of such strains for producing fermented milk products may have an importance for people with lactose intolerance.
[0098] Consequently, the final fermented milk has a higher inner sweetness index of approximately 2 or higher calculated as described by Godshall (1988. Food Technology 42(11):71-78), such as 2.5 or higher or such as 3 or higher.
[0099] The third aspect of the present invention relates to a Lactobacillus delbrueckii subsp. bulgaricus strain, wherein said strain is resistant to 2-deoxyglucose.
[0100] The term resistant to 2-deoxyglucose in relation to a Lactobacillus delbrueckii subsp. bulgaricus strain is defined by that a particular bacterial strain has the ability to grow to a colony after incubation at 40 C. for 20 hours when streaked on a plate of MRS-IM medium containing 2% lactose and 20 mM 2-deoxyglucose. The presence of 2-deoxyglucose in the culture medium will prevent the growth of non-resistant strains while the growth of resistant strains is not affected or not affected significantly. Non-resistant Lactobacillus delbrueckii subsp. bulgaricus strains which can be used as sensitive reference strains in the assessment of resistance include the Lactobacillus delbrueckii subsp. bulgaricus strains CHCC759, that was deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) under the accession no. DSM 26419 and CHCC10019, that was deposited Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) under the accession no. DSM 19252.
[0101] In the event the MRS-IM agar plates containing 2% lactose and furthermore containing 20 mM 2-deoxyglucose plate is overgrown with colonies, it is appropriate to increase the concentration of 2-deoxyglucose in the plates, for example to 30 mM or even 40 mM or higher. In the event no colonies are obtained, it is appropriate to decrease the concentration of 2-deoxyglucose in the plates, for example to 15 mM or 10 mM or even lower. If considered necessary, the mutation rate can be enhanced by using appropriate physical or chemical mutagenesis protocols.
[0102] Preferably, the Lactobacillus delbrueckii subsp. bulgaricus strain of the invention increases the amount of glucose in 9.5% B-milk to at least 5 mg/ml when inoculated into the 9.5% B-milk at a concentration of 10.sup.6 to 10.sup.7 CFU/ml and grown at 40 C. for at least 20 hours, such as for between 20 to 30 hours, such as for 20 hours.
[0103] In more preferred embodiments of the invention the mutant strain leads to an increase in the amount of glucose to at least 6 mg/mL, such as at least 7 mg/mL, such as at least 8 mg/mL, such as at least 9 mg/ml, such as at least 10 mg/ml, such as at least 11 mg/ml, such as at least 12 mg/ml, such as at least 13 mg/ml, such as at least 14 mg/ml, such as at least 15 mg/ml.
[0104] A fourth aspect of the Invention relates to a Lactobacillus delbrueckii subsp. bulgaricus strain which is selected from the group consisting of the Lactobacillus delbrueckii subsp. bulgaricus strain CHCC16159, that was deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) under accession no. DSM26420, the Lactobacillus delbrueckii subsp. bulgaricus strain CHCC16160, that was deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) under accession no. DSM26421, and strains derived therefrom.
[0105] The term strains derived therefrom should be understood as defined above.
[0106] Accordingly, in a preferred embodiment the Lactobacillus delbrueckii subsp. bulgaricus strain is selected from the group consisting of the Lactobacillus delbrueckii subsp. bulgaricus strain CHCC16159, that was deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) under accession no. DSM26420, the Lactobacillus delbrueckii subsp. bulgaricus strain CHCC16160, that was deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) under accession no. DSM26421 and a mutant strain derived therefrom, wherein the mutant strain is obtained by using one of the deposited strains as starting material, and wherein the mutant has retained or further improved the lactose fermenting property and/or the glucose secreting property of said deposited strain.
[0107] A fifth aspect of the present invention relates to a composition comprising from 10.sup.4 to 10.sup.12 CFU (colony forming units)/g of a Streptococcus thermophilus strain according to the first or second aspect of the invention, such as from 10.sup.5 to 10.sup.11 CFU/g, such as from 10.sup.6 to 10.sup.10 CFU/g, or such as from 10.sup.7 to 109 CFU/g of the Streptococcus thermophilus strain.
[0108] In a preferred embodiment the Streptococcus thermophilus strain is unable to acidify 9.5% B-milk, defined as resulting in a pH decrease of less than 1.0 when 9.5% B-milk is inoculated with 10.sup.6-10.sup.7 CFU/ml of the Streptococcus thermophilus strain and incubated for 14 hours at 40 C., and the composition further comprises an amount of a compound, which can trigger acidification of the 9.5% B-milk by the Streptococcus thermophilus strain CHCC16404 that was deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen under accession No. DSM 26722, defined as resulting in a pH decrease of 1.0 or more when 9.5% B-milk is inoculated with 10.sup.6-10.sup.7 CFU/ml of the Streptococcus thermophilus strain and incubated for 14 hours at 40 C.
[0109] Preferably, the compound is sucrose.
[0110] Preferably, the amount of sucrose is from 0.000001% to 2%, such as from 0.00001% to 0.2%, such as from 0.0001% to 0.1%, such as from 0.001% to 0.05%.
[0111] In an especially preferred embodiment the composition further comprises from 10.sup.4 to 10.sup.12 CFU/g of a Lactobacillus delbrueckii subsp. bulgaricus strain according to the invention, such as from 10.sup.5 to 10.sup.11 CFU/g, such as from 10.sup.6 to 10.sup.10 to CFU/g, or such as from 10.sup.7 to 10.sup.9 CFU/g of the Lactobacillus delbrueckii subsp. bulgaricus strain.
[0112] A preferred composition of the present invention comprises, for example, Lactobacillus delbrueckii subsp. bulgaricus strain CHCC16159 and/or Lactobacillus delbrueckii subsp. bulgaricus strain CHCC16160 in combination with Streptococcus thermophilus strain CHCC15757. A further preferred composition comprises Lactobacillus delbrueckii subsp. bulgaricus strain CHCC16159 and/or Lactobacillus delbrueckii subsp. bulgaricus CHCC16150 in combination with Streptococcus thermophilus strain CHCC15887. An even further preferred composition comprises Lactobacillus delbrueckii subsp. bulgaricus strain CHCC16159 and/or Lactobacillus delbrueckii subsp. bulgaricus CHCC16150 in combination with Streptococcus thermophilus strain CHCC16404.
[0113] Lactobacillus delbrueckii subsp. bulgaricus, Streptococcus thermophilus and other lactic acid bacteria are commonly used as starter cultures serving a technological purpose in the production of various foods, such as in the dairy industry, such as for fermented milk products. Thus, in another preferred embodiment the composition is suitable as a starter culture.
[0114] Starter cultures may be provided as frozen or dried starter cultures in addition to liquid starter cultures. Thus, in yet another preferred embodiment the composition is in frozen, freeze-dried or liquid form.
[0115] As disclosed in WO 2005/003327, it is beneficial to add certain cryoprotective agents to a starter culture. Thus, a starter culture composition according to the present invention may comprise one or more cryoprotective agent(s) selected from the group consisting of inosine-5-monophosphate (IMP), adenosine-5-monophosphate (AMP), guanosine-5-nonophosphate (GMP), uranosine-5-monophosphate (UMP), cytidine-5-monophosphate (CMP), adenine, guanine, uracil, cytosine, adenosine, guanosine, uridine, cytidine, hypoxanthine, xanthine, hypoxanthine, orotidine, thymidine, inosine and a derivative of any such compounds.
[0116] A sixth aspect of the invention is directed to a method for producing a fermented milk product comprising inoculating and fermenting a milk substrate with at least one Streptococcus thermophilus strain according to the first or second aspect of the present invention.
[0117] The term milk is to be understood as the lacteal secretion obtained by milking any mammal, such as a cow, a sheep, a goat, a buffalo or a camel. In a preferred embodiment, the milk is cow's milk.
[0118] The term milk substrate may be any raw and/or processed milk material that can be subjected to fermentation according to the method of the invention. Thus, useful milk substrates include, but are not limited to, solutions/suspensions of any milk or milk like products comprising protein, such as whole or low fat milk, skim milk, buttermilk, reconstituted milk powder, condensed milk, dried milk, whey, whey permeate, lactose, mother liquid from crystallization of lactose, whey protein concentrate, or cream. Obviously, the milk substrate may originate from any mammal, e.g. being substantially pure mammalian milk, or reconstituted milk powder.
[0119] Preferably, at least part of the protein in the milk substrate is proteins naturally occurring in milk, such as casein or whey protein. However, part of the protein may be proteins which are not naturally occurring in milk.
[0120] Prior to fermentation, the milk substrate may be homogenized and pasteurized according to methods known in the art.
[0121] Homogenizing as used herein means intensive mixing to obtain a soluble suspension or emulsion. If homogenization is performed prior to fermentation, it may be performed so as to break up the milk fat into smaller sizes so that it no longer separates from the milk. This may be accomplished by forcing the milk at high pressure through small orifices.
[0122] Pasteurizing as used herein means treatment of the milk substrate to reduce or eliminate the presence of live organisms, such as microorganisms. Preferably, pasteurization is attained by maintaining a specified temperature for a specified period of time. The specified temperature is usually attained by heating. The temperature and duration may be selected in order to kill or inactivate certain bacteria, such as harmful bacteria. A rapid cooling step may follow.
[0123] Fermentation in the methods of the present invention means the conversion of carbohydrates into alcohols or acids through the action of a microorganism. Preferably, fermentation in the methods of the invention comprises conversion of lactose to lactic acid.
[0124] Fermentation processes to be used in production of fermented milk products are well known and the person of skill in the art will know how to select suitable process conditions, such as temperature, oxygen, amount and characteristics of microorganism(s) and process time. Obviously, fermentation conditions are selected so as to support the achievement of the present invention, i.e. to obtain a dairy product in solid or liquid form (fermented milk product).
[0125] The term fermented milk product as used herein refers to a food or feed product wherein the preparation of the food or feed product involves fermentation of a milk substrate with a lactic acid bacteria. Fermented milk product as used herein includes but is not limited to products such as yoghurt, cheese, sour cream and buttermilk as well as fermented whey.
[0126] In a preferred embodiment the concentration of Streptococcus thermophilus cells inoculated is from 10.sup.4 to 10.sup.9 CFU Streptococcus thermophilus cells per ml of milk substrate, such as from 10.sup.4 CFU to 10.sup.8 CFU Streptococcus thermophilus cells per ml of milk substrate.
[0127] In another preferred embodiment the Streptococcus thermophilus strain is unable to acidify the 9.5% B-milk, defined as resulting in a pH decrease of less than 1.0 when 9.5% B-milk is inoculated with 10.sup.6-10.sup.7 CFU/ml of the Streptococcus thermophilus strain and incubated for 14 hours at 40 C., and the milk substrate is added an amount of a compound, effective to trigger acidification of 9.5% B-milk by the Streptococcus thermophilus strain CHCC16404 that was deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen under accession No. DSM 26722, defined as resulting in a pH decrease of 1.0 or more when 9.5% B-milk is inoculated with 10.sup.6-10.sup.7 CFU/ml of the Streptococcus thermophilus strain and incubated for 14 hours at 40 C.
[0128] Preferably, the compound is sucrose.
[0129] Preferably, the amount of sucrose is from 0.000001% to 2%, such as from 0.00001% to 0.2%, such as from 0.0001% to 0.1%, such as from 0.001% to 0.05%.
[0130] A seventh aspect of the invention is directed to a method for producing a fermented milk product comprising inoculating and fermenting a milk substrate with at least one Lactobacillus delbrueckii subsp. bulgaricus strain according to the third or fourth aspect of the present invention.
[0131] In a preferred embodiment the concentration of Lactobacillus delbrueckii subsp. bulgaricus cells inoculated is from 10.sup.4 to 10.sup.9 CFU Lactobacillus delbrueckii subsp. bulgaricus cells per ml of milk substrate, such as from 10.sup.4 CFU to 10.sup.8 CFU Lactobacillus delbrueckii subsp. bulgaricus cells per ml of milk substrate.
[0132] In a preferred embodiment the method for producing the fermented milk product comprises inoculating and fermenting a milk substrate with at least one Streptococcus thermophilus strain according to the present invention and at least one Lactobacillus delbrueckii subsp. bulgaricus strain according to the present invention.
[0133] In another preferred embodiment the fermented milk product is a yoghurt or a cheese.
[0134] Examples of cheeses which are prepared by fermentation with Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus include Mozzarella and pizza cheese (Hier et al. (2010) in The Technology of Cheesemaking, 2.sup.nd Ed. Blackwell Publishing, Oxford; 166-192).
[0135] Preferably the fermented milk product is a yoghurt.
[0136] In the present context, a yoghurt starter culture is a bacterial culture which comprises at least one Lactobacillus delbrueckii subsp bulgaricus strain and at least one Streptococcus thermophilus strain. In accordance herewith, the term yoghurt refers to a fermented milk product obtainable by inoculating and fermenting milk with a composition comprising a Lactobacillus delbrueckii subsp bulgaricus strain and a Streptococcus thermophilus strain.
[0137] In an eighth aspect the present invention relates to a fermented milk product obtainable by the method according the sixth or seventh aspect of the invention.
[0138] In a ninth aspect the present invention relates to a fermented milk product comprising at least one Streptococcus thermophilus strain according to the first or second aspect of the invention.
[0139] In a tenth aspect the present invention relates to a fermented milk product comprising at least one Lactobacillus delbrueckii subsp. bulgaricus strain according to the third or fourth aspect of the invention.
[0140] In a preferred embodiment the fermented milk product comprises at least one Streptococcus thermophilus strain according to the invention and at least one Lactobacillus delbrueckii subsp. bulgaricus strain according to the invention.
[0141] In another preferred embodiment the fermented milk product is a yoghurt or a cheese. Preferably, the fermented milk product is a yoghurt.
[0142] In an eleventh aspect the present invention relates to the use of a Streptococcus thermophilus strain according to the first or second aspect of the invention for the preparation of a fermented milk product.
[0143] In a twelfth aspect the present invention relates to the use of a Lactobacillus delbrueckii subsp. bulgaricus according to the third or fourth aspect of the invention for the preparation of a fermented milk product.
[0144] A thirteenth aspect of the present invention relates to the use of a Streptococcus thermophilus strain according to the invention and a Lactobacillus delbrueckii subsp. bulgaricus according to the invention for the preparation of a fermented milk product.
[0145] A fourteenth aspect relates to the use of a Streptococcus thermophilus strain according to the first or second aspect of the invention for increasing the sweetness of a fermented milk product.
[0146] In a fifteenth aspect the present invention is directed to the use of a Lactobacillus delbrueckii subsp. bulgaricus strain according to the third and fourth aspect of the invention for increasing the sweetness of a fermented milk product.
[0147] In a sixteenth aspect the present invention is directed to the use of a Streptococcus thermophilus strain according to the first or second aspect of the invention and a Lactobacillus delbrueckii subsp. bulgaricus strain according to the third and fourth aspect of the invention for increasing the sweetness of a fermented milk product.
[0148] Especially, children as a consumer group have a preference for sweet-tasting food products and it is contemplated that the Streptococcus thermophilus strain of the invention and the Lactobacillus delbrueckii subsp. bulgaricus strain of the invention may be particularly useful in increasing the sweetness of a fermented milk product intended for children.
[0149] A seventeenth aspect of the present invention relates to a fermented milk product according to the invention for use in reducing the calorie intake.
[0150] The fermented milk product according to the invention is thought to be especially useful in the diet of persons suffering from overweight or obesity.
[0151] Thus, in a preferred embodiment the fermented milk product according to the invention is for use in reducing the calorie intake of a person suffering from overweight or obesity.
[0152] Overweight and obesity are medical conditions defined by the World Health Organization (WHO) as abnormal or excessive fat accumulation that presents a risk to health. The Body Mass Index (BMI) can be used as a rough guide to classify overweight and obesity in adults and is calculated as a person's weight in kilograms divided by the square of his/her height in meters (kg/m.sup.2). The WHO definition states that a BMI greater than or equal to 25 is overweight and that a BMI greater than or equal to 30 is obesity.
[0153] An eighteenth aspect of the present invention relates to the use of a Streptococcus thermophilus strain according to the first or second aspect of the invention for decreasing the lactose content in a fermented milk product.
[0154] In a nineteenth aspect the present invention is directed to the use of a Lactobacillus delbrueckii subsp. bulgaricus strain according to the third or fourth aspect of the invention for decreasing the lactose content in a fermented milk product.
[0155] A twentieth aspect of the present invention is related to the use of a Streptococcus thermophilus strain according to the first or second aspect of the invention and a Lactobacillus delbrueckii subsp. bulgaricus strain according to the third or fourth aspect of the invention for decreasing the lactose content in a fermented milk product.
[0156] A twenty-first aspect of the present invention is directed to a fermented milk product according to the invention for use in avoiding symptoms of lactose intolerance.
[0157] A twenty-second aspect relates to a composition of the invention for use as a medicament.
[0158] In a twenty-third aspect the invention is directed to the use of a Streptococcus thermophilus strain according to the invention for improving the growth of a Bifidobacterium strain.
[0159] In a preferred embodiment the Bifidobacterium strain belongs to a species selected from the group consisting of Bifidobacterium longum, Bifidobacterium bifidum, Bifidobacterium lactis, Bifidobacterium brevis, Bifidobacterium animalis, Bifidobacterium adolescentis and Bifidobacterium infantis, such as a strain selected from the group consisting of Bifidobacterium animalis subsp. lactis BB-12strain deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) under accession No. DSM 15954, Bifidobacterium animalis strain deposited at DSMZ under accession No. DSM 15954, Bifidobacterium longum subsp. infantis strain deposited at DSMZ under accession No. DSM 15953 and Bifidobacterium longum subsp. longum strain deposited at DSMZ under accession No. DSM 15955. Most preferred the Bifidobacterium strain is Bifidobacterium animalis subsp. lactis BB-12deposited at DSMZ under accession No. DSM 15954.
[0160] In a twenty-fourth aspect the invention relates to the use of a Lactobacillus delbrueckii subsp. bulgaricus strain according to the invention for improving the growth of a Bifidobacterium strain.
[0161] In a preferred embodiment the Bifidobacterium strain belongs to a species selected from the group consisting of Bifidobacterium longum, Bifidobacterium bifidum, Bifidobacterium lactis, Bifidobacterium brevis, Bifidobacterium animalis, Bifidobacterium adolescentis and Bifidobacterium infantis, such as a strain selected from the group consisting of Bifidobacterium animalis subsp. lactis BB-12strain deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) under accession No. DSM 15954, Bifidobacterium animalis strain deposited at DSMZ under accession No. DSM 15954. Bifidobacterium longum subsp. infantis strain deposited at DSMZ under access on No. DSM 15953 and Bifidobacterium longum subsp. longum strain deposited at DSMZ under accession No. DSM 15955. Most preferred the Bifidobacterium strain is Bifidobacterium animalis subsp. lactis BB-12deposited at DSMZ under accession No. DSM 15954.
[0162] A twenty-fifth aspect relates to the use of a Streptococcus thermophilus strain according to the invention and a Lactobacillus delbrueckii subsp. bulgaricus strain according to the invention for for improving the growth of Bifidobacterium animalis subsp. lactis strain BB-12that was deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen under accession No. DSM 15954.
[0163] 2-deoxyglucose and a determination of the growth pattern of the bacteria in M17 medium+2% galactose compared to in M17 medium+2% glucose is used for the selection of bacteria having a mutation in the glucokinase (glcK) gene.
[0164] In a twenty-sixth aspect of the present invention a method for screening and isolating a strain of Streptococcus thermophilus with a mutated glcK gene is provided. The method comprises the following steps:
[0165] a) providing a galactose-fermenting Streptococcus thermophilus mother strain;
[0166] b) selecting and isolating from a pool of mutant Streptococcus thermophilus strains derived from the mother strain a pool of mutant Streptococcus thermophilus strains which are resistant to 2-deoxyglucose; and
[0167] c) selecting and isolating from the pool of mutant Streptococcus thermophilus strains which are resistant to 2-deoxyglucose a mutant Streptococcus thermophilus strain if the growth rate of the mutant Streptococcus thermophilus strain is higher in M17 medium+2% galactose than in M17 medium+2% glucose.
[0168] The term resistant to 2-deoxyglucose herein is defined by that a particular mutated bacterial strain has the ability to grow to a colony when streaked on a plate of M17 medium containing 2% lactose or 2% galactose and containing 20 mM 2-deoxyglucose after incubation at 40 C. or 20 hours. The presence of 2-deoxygluxcose in the culture medium will prevent the growth of non-mutated strains while the growth of the mutated strains is not affected or not affected significantly. Non-mutated strains which can be used as sensitive reference strains in the assessment of resistance include the strains CHCC14994 and CHCC11976.
[0169] Examples 1 and 2 herein exemplify the isolation of mutant strains of Streptococcus thermophilus which are resistant to 2-deoxyglucose.
[0170] In a preferred embodiment the method further comprises the step a1) subjecting the mother strain to mutagenization, such as subjecting the mother strain to a chemical and/or a physical mutagen.
[0171] In another preferred embodiment the method further comprises a step d) selecting and isolating from a pool of 2-deoxyglucose resistant Streptococcus thermophilus strains derived from the Streptococcus thermophilus strain selected in step c) a Streptococcus thermophilus strain if the growth rate of the Streptococcus thermophilus strain is high in M17 medium+2% sucrose but zero or at least 0-50% reduced compared to the growth rate cf the mother strain in M17 medium+2% glucose.
[0172] The galactose-fermenting Streptococcus thermophilus mother strains are capable of growth on/in M17 medium+2% galactose and are defined herein by that they have the ability to lower the pH in M17 broth containing 2% galactose as sole carbohydrate to 5.5 or lower when inoculated from an overnight culture at 1% and incubated for 24 hours at 37 C. Such galactose-positive strains have been described in the prior art and WO2011/026863 (Chr. Hansen A/S) describes a method for obtaining such strains.
[0173] In a much preferred embodiment the mother strain is selected from the group consisting of the Streptococcus thermophilus CHCC14994 strain that was deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen under accession No. DSM 25838, the Streptococcus thermophilus CHCC11976 strain that was deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen under accession No. DSM 22934, and strains derived therefrom.
[0174] In the present context, the term strains derived therefrom should be understood as strains derived, or strains which can be derived from galactose-fermenting Streptococcus thermophilus mother strains by means of e.g. genetic engineering, radiation and/or chemical treatment. The strains derived therefrom can also be spontaneously occurring mutants. It is preferred that the strains derived therefrom are functionally equivalent mutants, e.g. mutants that have substantially the same, or improved, properties (e.g regarding fermentation of galactose) as their mother strain. Such strains derived therefrom are part of the present invention. Especially, the term strains derived therefrom refers to strains obtained by subjecting a strain of the invention to any conventionally used mutagenization treatment including treatment with a chemical mutagen such as ethane methane sulphonate (EMS) or N-methyl-N-nitro-N-nitroguanidine (NTG), UV light, or to a spontaneously occurring mutant. A mutant may have been subjected to several mutagenization treatments (a single treatment should be understood one mutagenization step followed by a screening/selection step), but it is presently preferred that no more than 20, or no more than 10, or no more than 5, treatments (or screening/selection steps) are carried out. In a presently preferred mutant less than 1%, less than 0.1%, less than 0.01%, less than 0.001% or even less than 0.0001% of the nucleotides in the bacterial genome have been replaced with another nucleotide, or deleted, compared to the mother strain.
[0175] In a twenty-seventh aspect a mutant Streptococcus thermophilus strain obtainable by the method according to the twentyseventh aspect is comprised herein.
[0176] In a twenty-eighth aspect of the present invention a method for screening and isolating a strain of Lactobacillus delbrueckii subsp. bulgaricus with an impaired glucose metabolism is provided. The method comprises the following steps:
[0177] a) providing a Lactobacillus delbrueckii subsp. bulgaricus mother strain;
[0178] b) selecting and isolating from a pool of mutant Lactobacillus delbrueckii subsp. bulgaricus strains derived from the mother strain a pool of Lactobacillus delbrueckii subsp. bulgaricus strains which are resistant to 2-deoxyglucose; and
[0179] c) selecting and isolating from the pool of Lactobacillus delbrueckii subsp. bulgaricus strains which are resistant to 2-deoxyglucose a Lactobacillus delbrueckii subsp. bulgaricus strain if the growth rate of the Lactobacillus delbrueckii subsp. bulgaricus strain is higher in MRS-IM medium+2% lactose than in MRS-IM medium+2% glucose.
[0180] The isolation of mutant strains of Lactobacillus delbrueckii subsp. bulgaricus strains which are resistant to 2-deoxyglucose is described in detail in the Examples. Based on the 2-deoxyglucose resistance selection assay of Example 5, the skilled person can routinely test for a specific strain of interest (e.g. one from a relevant commercial product) if this specific strain of interest has the herein relevant resistance to 2-deoxyglucose. Based on the 2-deoxyglucose resistance mutant growth pattern of Example 6 the skilled person can routinely test for a specific strain of interest (e.g. one from a relevant commercial product) if this specific strain of interest has the relevant growth pattern which is a property of the selected mutants.
[0181] In a preferred embodiment the method further comprises the step a1) subjecting the mother strain to mutagenization, such as subjecting the mother strain to a chemical and/or a physical mutagen.
[0182] The Lactobacillus delbrueckii subsp. bulgaricus mother strains are capable of growing on/in MRS-IM medium+2% lactose and are defined herein by that they have the ability to lower the pH in MRS-IM broth containing 2% lactose as sole carbohydrate to 5.5 or lower when inoculated from an overnight culture at 1% and incubated for 24 hours at 37 C.
[0183] In a much preferred embodiment the mother strain is selected from the group consisting of the Lactobacillus delbrueckii subsp. bulgaricus CHCC759 strain that was deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen under accession No. DSM 26419, the Lactobacillus delbrueckii subsp. bulgaricus CHCC10019 strain that was deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen under accession No. DSM 19252, and strains derived therefrom.
[0184] In a twenty-ninth aspect a Lactobacillus delbrueckii subsp. bulgaricus strain obtainable by the method according to the twenty-eighth aspect is comprised herein.
[0185] Embodiments of the present invention are described below, by way of non-limiting examples.
EXAMPLES
[0186] Materials and Methods
[0187] Medium:
[0188] For Streptococcus thermophilus, the medium used is the M17 medium known to persons skilled in the art.
[0189] The M17 agar medium has the following composition per litre H.sub.2O:
[0190] agar, 12.75 g
[0191] ascorbic acid, 0.5 g
[0192] casein peptone (tryptic), 2.5 g
[0193] disodium -glycerophosphate pentahydrate, 19 g
[0194] magnesium sulfate hydrate, 0.25 g
[0195] meat extract, 5 g
[0196] meat peptone (peptic), 2.5 g
[0197] soyapeptone (papainic), 5 g
[0198] yeast extract, 2.5 g
[0199] final pH 7.10.2 (25 C.)
[0200] and M17 broth has the following composition per litre H.sub.2O:
[0201] ascorbic acid, 0.5 g
[0202] magnesium sulfate, 0.25 g
[0203] meat extract, 5 g
[0204] meat peptone (peptic), 2.5 g
[0205] sodium glycerophosphate, 19 g
[0206] soya peptone (papainic), 5 g
[0207] tryptone, 2.5 g
[0208] yeast extract, 2.5 g
[0209] final pH 7.00.2 (25 C.)
[0210] Carbon sources added are sterile lactose 20 g/l, glucose 20 g/l or galactose 20 g/l.
[0211] As known to the skilled person, the M17 medium is a medium that is considered to be suitable for growth of Streptococcus thermophilus. Further, as understood by the skilled person, in the present context, a M17 concentrate may be supplied from different suppliers and independently of the specific supplier one will (within standard measurement uncertainty) get the same herein relevant result of 2-deoxyglucose resistance for a herein relevant cell of interest.
[0212] The medium used for culturing Lactobacillus delbrueckii subsp. bulgaricus was MRS-IM medium. MRS-IM was used either in the form of agar plates or broth.
[0213] The MRS-IM agar medium had the following composition per litre H.sub.2O:
TABLE-US-00001 Tryptone Oxoid L 42 10.0 g Yeast extract Oxoid L 21 5.0 g Tween 80 Merck nr 8.22187 1.0 g K.sub.2HPO.sub.4 Merck nr 105104 2.6 g Na-acetate Merck nr 106267 5.0 g Diammonium-hydrogen-citrate Merck nr 101154 2.0 g MgSO.sub.4, 7 H2O Merck nr 105882 0.2 g MnSO.sub.4, H2O Merck nr 105941 0.05 g Agar SO-BI-GEL 13.0 g
[0214] The pH was adjusted after autoclaving to 6.90.1 at 25 C.
[0215] The MRS-IM broth used in the below examples for liquid cultures had the following composition per litre H.sub.2O:
TABLE-US-00002 Tryptone Oxoid L 42 10.0 g Yeast extract Oxoid L 21 5.0 g Tween 80 Merck nr 8.22187 1.0 g K.sub.2HPO.sub.4 Merck nr 105104 2.6 g Na-acetate Merck nr 106267 5.0 g Diammonium-hydrogen-citrate Merck nr 101154 2.0 g MgSO.sub.4, 7 H2O Merck nr 105882 0.2 g MnSO.sub.4, H2O Merck nr 105941 0.05 g
[0216] The pH is adjusted after autoclaving to 6.90.1 at 25 C. The carbon sources, lactose 20 g/l or glucose 20 g/l, were first filtered sterile and then added to the autoclaved broth.
[0217] The above MRS-IM media can be varied to some extent without affecting the capability of the media to support growth of Lactobacillus delbrueckii subsp. bulgaricus. Further, as will be understood by the skilled person, a MRS-IM concentrate or the various components described above may be obtained from different suppliers and used for the preparation of a MRS-IM medium. These media will likewise be used in the below examples, in particular in the 2-deoxyglucose resistance selection assay.
[0218] Mother Strains
[0219] Streptococcus thermophilus CHCC11976 (galactose-fermenting strain with a mutation in the GalK gene and producing exopolysaccharides as described in WO 2011/026863).
[0220] Streptococcus thermophilus CHCC14994 (galactose-fermenting strain).
[0221] Lactobacillus delbrueckii subsp. bulgaricus CHCC759.
[0222] Lactobacillus delbrueckii subsp. bulgaricus CHCC10019.
[0223] 2-deoxy-glucose resistant strains
[0224] Streptococcus thermophilus CHCC15757 (2-deoxyglucose resistant mutant of CHCC14994).
[0225] Streptococcus thermophilus CHCC15887 (2-deoxyglucose resistant mutant of CHCC11976).
[0226] Streptococcus thermophilus CHCC16404 (hyper-lactose fermenting and glucose secreting mutant of CHCC15757 ).
[0227] Lactobacillus delbrueckii subsp. bulgaricus CHCC16159 (2-deoxyglucose resistant mutant of CHCC759).
[0228] Lactobacillus delbrueckii subsp. bulgaricus CHCC16160 (2-deoxyglucose resistant mutant of CHCC10019).
Example 1
Use of 2-Deoxyglucose to Isolate Glucose Kinase Mutants of Streptococcus thermophilus with Enhanced Excretion of Glucose
[0229] In order to isolate mutants of Streptococcus thermophilus strain CHCC11976 and of Streptococcus thermophilus strain CHCC14994, cells derived from the growth of a single colony were inoculated into 10 ml of M17 broth containing 2% lactose and grown overnight at 40 C.
[0230] Next day, the strains were plated in serial dilutions on M17 agar plates containing 2% galactose and a concentration of 2-deoxyglucose of either 20 mM (CHCC14994) or 30 mM (CHCC11976) and incubated for 20 hours at 40 C. Resistant colonies were at first re-streaked on the same type of agar plates as they were selected. Survivors were used to inoculate fresh M17 broth containing either 2% lactose, 2% galactose or 2% glucose and growth was measured.
[0231] From this, a number of mutants that ware able to grow faster on galactose than on glucose were identified as outlined in Example 2. Two such mutants were CHCC15757 and CHCC15887, which are derived from CHCC14994 and CHCC11976 respectively.
Example 2
2-Deoxyglucose Resistance Mutant Growth Pattern
[0232] To ensure the selection of 2-deoxyglucose resistant mutants that can grow on galactose, two strains that were selected from a galactose-fermenting strain collection were used. While these galactose-fermenting strains still grow at least 10% faster in exponential phase in M17 broth+2% glucose than in M17 broth+2% galactose, the 2-deoxyglucosc resistant mutant derivates of CHCC11976 and CHCC14994, such as CHCC15757 and CHCC15887, on the other hand, are characterized by growing faster in exponential phase In M17 broth+2% galactose than in M17 broth+2% glucose.
[0233] Growth in exponential phase is herein measured as the development in optical density of the exponentially growing culture at 600 nanometers (OD.sub.600) with time at 40 C.
[0234] As known by the skilled person, it may vary from species to species when the culture is in exponential growth. The skilled person will know how to determine the growth in exponential phase, e.g. between OD.sub.600 0.1-1.0.
[0235] The optical density (OD) of the culture is measured in a spectrophotometer.
[0236] Conclusion:
[0237] Based on the 2-deoxyglucose resistance mutant growth pattern of this Example 2for a specific strain of interest (e.g. one from a relevant commercial product)the skilled person can routinely test if this specific strain of interest has the herein relevant growth pattern which is a property of the selected mutants.
Example 3
Mutation Analysis Assay of the Gene Encoding Glucose Kinase
[0238] Total DNA was isolated from the mutants identified in Example 1 to perform mutation analysis assay of the gene encoding glucose kinase. Sequencing of the glucose kinase gene revealed that the gene in CHCC15757 contains a non-conserved mutation in codon 141 generating an isoleucine instead of a threonine codon. Sequencing of the gene from mutant CHCC15887 revealed a mutation in codon 72 resulting in a non-conserved amino acid change from serine to proline (
[0239] The 2-deoxyglucose resistant strains complying to the conditions specified in Examples 1 and 2 and isolated as described in Example 1 are characterized by having a mutation in the gene encoding glucose kinase (glcK). The mutation can result in an amino acid change of the encoded enzyme or result in generation of a stop codon which will truncate the encoded enzyme.
[0240] To reveal the mutation in the glcK gene, the specific strain of interest is grown in the liquid broth (M17) to which is added 2% lactose at 40 C. over night. After isolation of the chromosomal DNA, the DNA was subjected to PCR analysis using two primers complementary to a conserved region just upstream and just downstream of the gene encoding glucose kinase. The sequences of the primers are:
TABLE-US-00003 GK1F: (SEQIDNO.3) 5CTTGGGTAAAAGGCTCTATG3 GKI.R: (SEQIDNO.4) 5CGTTTTTCAACAAAAAAGTGCTACC3
[0241] The conditions for the PCR reactions were as specified by the manufacturer of the PCR amplification kit (ROCHE) e.g.
[0242] 2 l Chromosomal DNA
[0243] 1 l Primer GK1F
[0244] 1 l Primer GK1R
[0245] 25 l Master mix
[0246] 21 l H2O
[0247] PCR-program: (94 C.1.5 min., 50 C.1 min., 72 C.1.5 min)30
[0248] PCR amplification generates a 1168 bp fragment. After purification using a PCR purification kit from Biorad, the PCR fragment was submitted for DNA sequencing at Macrogen using the same two primers that were used for the amplification. After sequencing, the DNA sequence was compared to that of the mother strain.
Example 4
Carbohydrate Analysis of Fermented Milk
[0249] In another experiment, the sugar concentrations of relevant sugar were determined in milk fermented with CHCC14994, CHCC11976, CHCC15757 and CHCC15887, respectively. 9.5% B-milk was inoculated with 1% (10.sup.6-10.sup.7 CFU/ml) of a culture grown over night in M17 broth to which is added 2% galactose. The acidification was followed w th an INTAB PC logger and Easyview software. After 30 hours of acidification at 40 C. milk samples were taken for HPLC analysis to obtain the content of relevant sugars and acids. The acidification curves showed that the mutants had a slightly delayed initiation of acidification but ended at a similar end pH. The HPLC data is presented in Table 1.
[0250] From Table 1 it is apparent that the two glcK mutant strains, CHCC15757 and CHCC15887, consume at least 71% of the lactose, while the mother strains consume approximately 28% of the lactose. For the most lactose fermenting mutant, CHCC15887, as little as 11.9 mg/ml remains in the fermented milk indicating a role for this product even for people with lactose intolerance. Very significantly, the two glcK mutants have excreted between 8.3 and 11.3 mg/ml of glucose while the glucose secretion of the mother strains is below detection level. At the same time both mutant strains also secrete more galactose than the mother strains: between 34 and 52%. Taking into account that sucrose is a 100 reference, and the sweetness of lactose is 16, the sweetness of galactose is 32 and the sweetness of glucose is 74.3, a calculation of the relative sweetness of the final fermented product suggests a sweetness 2.0 times sweeter when fermented with the best mutant CHCC15757 than with the corresponding mother strain CHCC14994.
TABLE-US-00004 TABLE 1 HPLC data of milk samples. Amount Amount Amount mg/ml mg/ml mg/ml Amount Amount Amount Amount Sample Citric Lactic Acetic mg/ml mg/ml mg/ml mg/ml No. acid acid acid Galactose Glucose Lactose Fructose Sweetness Detection <1.25 <1.25 <1.25 <1.5 <1.5 <1.5 <1.5 limit Milk 1.8 1.7 <1.25 <1.5 <1.5 47.6 <1.5 761.6 CHCC11976 2.0 8.2 <1.25 7.2 <1.5 34.4 <1.5 781 CHCC15887 1.8 7.8 <1.25 10.9 8.3 11.9 <1.5 1156 CHCC14994 1.8 7.2 <1.25 4.9 <1.5 34.3 <1.5 705.6 CHCC15757 1.7 7.1 <1.25 10.3 11.3 13.8 <1.5 1390 Sweetness calculated: mg/ml glucose *74 + mg/ml lactose *16 + mg/ml galactose * 32.
[0251] As the two glcK mutant strains, CHCC15757 and CHCC15887, excrete high levels of glucose, it is contemplated that the mutations In the glcK gene inactivates the the encoded glucokinase protein.
Example 5
Selection of 2-Deoxyglucose Resistant Lactobacillus delbrueckii subsp. bulgaricus Strains
[0252] Selection of 2-deoxyglucose resistant mutants
[0253] Two Lactobacillus delbrueckii subsp. bulgaricus strains of interest, CHCC759 and CHCC10019, were independently from one another inoculated into 10 ml of the above-described MRS-IM broth containing 2% lactose and incubated anaerobically at 40 C. overnight. In the next step, samples of these cultures containing about 310.sup.8 cells were plated on MRS-IM agar plates containing 2% lactose and furthermore containing 20 mM 2-deoxyglucose. Colonies arising on the plates were purified by single colony streaking on MRS-IM agar plates containing 2% lactose and furthermore containing 20 mM 2-deoxyglucose and further characterized as described below.
[0254] 2-deoxyglucose resistance assay:
[0255] The following method is suitable for determining whether or not a strain of interest is resistant to 2-deoxyglucose. Strains of interest are inoculated into 10 ml of the above-described MRS-IM broth containing 2% lactose and incubated anaerobically at 40 C. over night. In the next step, diluted samples of these cultures containing about 10.sup.4-10.sup.5 cells are plated on MRS-IM agar plates containing 2% lactose and furthermore containing the same 2-deoxyglucose concentration that was used for selection of the resistant mutant (typically 20 mM but other concentrations might be used). The agar plates are incubated under anaerobic conditions for 20 hours at 40 C. and inspected. Lactobacillus delbrueckii subsp. bulgaricus strains which are not resistant to 2-deoxyglucose will produce few if any colonies whereas strains which are resistant to 2-deoxyglucose will produce a multitude of colonies. Appropriate controls include the Lactobacillus delbrueckii subsp. bulgaricus strains, CHCC759 and CHCC10019, which are sensitive to 2-deoxyglucose at a concentration of 20 mM and CHCC16159 and CHCC16160 which are resistant to 20 mM 2-deoxyglucose.
[0256] Result: Several clones that were capable of growing under the selective conditions in the presence of 2-dexyglucose were isolated by this approach. Mutant strains that showed a rapid growth on plates with 2-dexyglucose were designated CHCC16159 (derived from mother strain CHCC759) and CHCC16160 (derived from mother strain CHCC10019). These mutant strains were deposited at the Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) GmbH.
Example 6
Growth Pattern of 2-Deoxyglucose Resistant Mutants of Lactobacillus delbrueckii subsp. bulgaricus
[0257] To ensure that the 2-deoxyglucose resistant mutants of Lactobacillus delbrueckii subsp. bulgaricus have either lost the ability to grow on glucose or have an impaired ability to grow on glucose as carbon source, the growth pattern of the mutants was compared to that of the mother strains by growing both the mother strains, CHCC759 and CHCC10019, and the mutants, CHCC16159 and CHCC16160, in MRS-IM broth containing 2% glucose.
[0258] While the 2 mother strains, CHCC759 and CHCC10019, grew exponentially in MRS-IM broth added 2% glucose with a doubling time less than 10 hours, the two 2-deoxyglucose resistant mutants CHCC16159 and CHCC16160 did not grow or grew only very slowly in this medium. Growth in the exponential phase was monitored by measuring the optical density of the exponentially growing culture at 600 nanometers (OD.sub.600) at 40 C. in a spectrophotometer. The exponential phase of growth was reached between OD.sub.600 0.1-1.0.
Example 7
Carbohydrate Analysis of Milk Fermented with Strains of Lactobacillus delbrueckii subsp. bulgaricus
[0259] In another experiment, the sugar concentrations of different sugars were determined in milk fermented with the Lactobacillus delbrueckii subsp. bulgaricus strains CHCC759, CHCC10019, CHCC16159, and CHCC16160, respectively. 9.5% B-milk was inoculated with 1% (10.sup.6-10.sup.7 CFU/ml) of a liquid culture grown over night anaerobically in MRS-IM broth containing 2% lactose. The acidification was followed with an INTAB PC logger and the Easyview software. After 30 hours of acidification at 40 C., milk samples were taken for HPLC analysis to measure the amounts of various sugars and organic acids. The acidification curves showed that the mutants had a somewhat delayed initiation of acidification and ended at a slightly higher end pH. The HPLC data are presented in Table 2.
[0260] As can be seen from Table 2, the two 2-deoxyglucose resistant mutant strains, CHCC16159 and CHCC16160, consumed at least about 94% of the lactose, while the mother strains consumed at least about 37% of the lactose. For the mutant showing the highest production of lactic acid, CHCC16160, as little as 2.9 mg/ml lactose remained in the fermented milk. Fermented milk products with such low levels of lactose could be suitable for consumption by people with lactose intolerance.
[0261] Significantly, the two mutant strains, CHCC16159 and CHCC16160, excreted between 15.2 and 15.8 mg/ml of glucose while the glucose secretion of the mother strains is below detection level for CHCC10019 and 4.2 mg/ml for CHCC759, respectively. At the same time both mutant strains also secreted more galactose than the mother strains. If the reference value for sweetness of sucrose is 100, and the sweetness of lactose is 16, the sweetness of galactose is 32 and the sweetness of glucose is 74, a calculation of the relative sweetness of the final fermented product suggests that the mutant CHCC16160 produces a fermented milk product that is 2.5 times sweeter than with the corresponding mother strain CHCC10019.
TABLE-US-00005 TABLE 2 HPLC data of milk samples. Amount Amount Amount mg/ml mg/ml mg/ml Amount Amount Amount Amount Sample Citric Lactic Acetic mg/ml mg/ml mg/ml mg/ml No. acid acid acid Galactose Glucose Lactose Fructose Sweetness Detection <1.25 <1.25 <1.25 <1.5 <1.5 <1.5 <1.5 limit Milk 1.9 <1.25 <1.25 <1.5 <1.5 55.5 <1.5 888 CHCC759 1.8 9.6 <1.25 13.1 4.2 18.1 <1.5 1021 CHCC16159 2.0 7.9 <1.25 21.4 15.2 1.7 <1.5 1841 CHCC10019 1.8 11.1 <1.25 12.4 >1.5 20.8 <1.5 730 CHCC16160 1.9 5.4 <1.25 19.4 15.8 2.9 <1.5 1841 Sweetness calculated: mg/ml glucose *74 + mg/ml lactose *16 + mg/ml galactose * 32.
Example 8
Selection of a Hyper-Lactose Fermenting and Glucose Secreting Mutant of Streptococcus thermophius
[0262] In order to isolate a hyper-lactose fermenting and glucose secreting mutant of Streptococcus thermophilus strain CHCC15757, cells derived from the growth of a single colony were inoculated into 10 ml of M17 broth containing 2% galactose and grown overnight at 40 C.
[0263] Next day, the strain was plated in serial dilutions on M17 agar plates containing 2% galactose and a concentration of 2-deoxyglucose of 30 mM and incubated for 20 hours at 40 C. Resistant colonies were at first re-streaked on the same type of agar plates as they were selected. Survivors were used to inoculate fresh M17 broth containing either 2% lactose, 2% galactose, 2% sucrose or 2% glucose.
[0264] From this, we were able to solate a mutant, CHCC16404, derived from CHCC15757, that was unable to grow h B-milk but able to grow in M17 added 2% sucrose at 40 C. Furthermore, CHCC16404 was unable to grow in M17 added 2% glucose.
[0265] Growth in exponential phase is herein measured as the development in optical density of the exponentially growing culture at 600 nanometers (OD.sub.600) with time at 40 C.
Example 9
Growth Pattern of Hyper-Lactose Fermenting and Glucose Secreting Streptococcus thermophilus Mutant CHCC16404
[0266] To ensure maintenance and proper growth of mutant CHCC16404, the strain was grown at 40 C. in M17 added 2% sucrose. To our surprise, we observed that mutant strain CHCC16404 was able to acidify 9.5% B-milk only when the strain was inoculated with 1% (10.sup.6-10.sup.7 CFU/ml) of a culture grown over night in M17 broth added 2% sucrose or when the milk was added sucrose. We observed that addition of as little as 0.01 % sucrose to the milk enabled CHCC16404 to acidify 9.5% B-milk. Furthermore, CHCC16404 was unable to grow in M17 added 2% glucose at 40 C. as opposed to the mother strain CHCC15757 that can grow in M17 added glucose under the same conditions. Together these results indicated that the 2-deoxyglucose treatment of CHCC15757, that generated CHCC16404, has selected a mutation that inactivates the glucose uptake system disabling uptake of secreted glucose from the medium
Example 10
Carbohydrate Analysis of Milk Fermented with Hyper-Lactose Fermenting and Glucose Secreting Streptococcus thermophilus Mutant CHCC16404
[0267] In another experiment, the sugar concentrations of relevant sugars were determined in milk fermented with CHCC16404. Bottles containing 9.5% B-milk added 0.01%, 0.02%, 0.03% and 0.05% sucrose respectively were inoculated with 1% (10.sup.6-10.sup.7 CFU/ml) of a culture grown over night in M17 broth to which is added 2% sucrose. The acidification was followed with an INTAB PC logger and Easyview software. After 30 hours of acidification at 40 C., milk samples were taken for HPLC analysis to obtain the content of relevant sugars and acids.
[0268] From Table 3 it is apparent that the hyper-lactose fermenting and glucose secreting mutant CHCC16404, surprisingly, consumes all of the lactose at all concentrations of added sucrose tested in this experiment. We have also observed that when a higher sucrose concentration was added (e.g. >0.1 mg/ml), the lactose fermentation is not completed before the Final pH is reached. Furthermore Table 3 also shows that all the lactose is converted into glucose and galactose and that only part of the galactose is used for fermentation at all concentrations of added sucrose. Interestingly, the secreted glucose is not taken up again thereby leaving more than 23.9 mg/ml glucose in the milk. Since about 25% of the galactose is fermented more than 16 mg/ml of galactose remains in the milk after fermentation. These data indicate that CHCC16404, in addition to the glcK mutation inherited from the mother strain CHCC15757, also harbours a mutation that inactivates the glucose uptake system disabling uptake of secreted glucose from the medium. Comparison of the data in Table 3 with those In Table land taking into account that sucrose is a 100 reference, and the sweetness of lactose is 16, the sweetness of galactose is 32 and the sweetness of glucose is 74.3, a calculation of the relative sweetness of the final fermented product generates a sweetness about 3.5 times sweeter when fermented with CHCC16404 than with the strain CHCC14994.
TABLE-US-00006 TABLE 3 HPLC data of milk samples. Amount Amount Amount mg/ml mg/ml mg/ml Amount Amount Amount Sample Citric Lactic Acetic mg/ml mg/ml mg/ml No. acid acid acid Galactose Glucose Lactose Sweetness Detection <1.25 <1.25 <1.25 <1.5 <1.5 <1.5 limit Milk 1.8 1.7 <1.25 <1.5 <1.5 47.6 762 CHCC16404 + 1.9 5.4 <1.25 16.1 23.9 <1.5 2291 0.01% sucrose CHCC16404 + 2.0 5.6 <1.25 17.0 25.3 <1.5 2424 0.02% sucrose CHCC16404 + 2.0 5.6 <1.25 16.4 24.1 <1.5 2315 0.03% sucrose CHCC16404 + 2.1 6.0 <1.25 17.3 25.4 <1.5 2441 0.05% sucrose Sweetness caculated: mg/ml glucose *74 + mg/ml lactose *16 + mg/ml galactose * 32.
Example 11
Carbohydrate Analysis of Milk Fermented with a Combination of Strains of Streptococcus thermophilus and Strains of Lactobacillus delbrueckii subsp. bulgaricus
[0269] In this experiment, the concentrations of sugars and organic acids were determined in milk fermented with combinations of a Lactobacillus delbrueckii subsp. bulgaricus strain (selected from CHCC759, CHCC10019, CHCC16159 and CHCC16160) and a Streptococcus thermophilus strain which was either CHCC14994, CHCC15757 or CHCC16404.
[0270] The production of yoghurt normally involves the use of a mixed starter culture containing both Lactobacillus delbrueckii subsp. bulgaricus and Streptococcus thermophilus strains. Typically, the milk substrate used in the production of yoghurt is inoculated with 1 part Lactobacillus delbrueckii subsp. bulgaricus and 9 parts Streptococcus thermophilus. In order to analyse glucose secretion capabilities in a standard setup for yoghurt production, 9.5% B-milk was inoculated with 0.1% of a Lactobacillus delbrueckii subsp. bulgaricus culture grown over night anaerobically in MRS-IM broth containing 2% lactose and 0.9% of a Streptococcus thermophilus culture grown over night in M17 broth containing 2% galactose (CHCC15757 ) or 2% sucrose (CHCC16404). The acidification was followed with an INTAB PC logger and Easyview software. After 30 hours of acidification, milk samples were taken for HPLC analysis to measure the amount of different sugars and acids. The HPLC data are presented in Table 4.
[0271] It can be taken from Table 4 that the use of the 2-deoxyglucose-resistant mutant strain CHCC15757 and CHCC16404 of Streptococcus thermophilus results in secretion of glucose into the milk irrespective of whether it is combined with a Lactobacillus delbrueckii subsp. bulgaricus mother strain or with a 2-deoxyglucose-resistant mutant thereof. However, glucose concentrations are higher when a combination of 2-deoxyglucose-resistant mutant strains of both species are used, e.g. a combination of CHCC15757 and CHCC16159, or a combination of CHCC15757 and CHCC16150. When using these mixed cultures, at least 82% of the lactose was found to be consumed, and between 11.8 mg/ml and 14.1 mg/ml of glucose was found to be excreted. Similar results are obtained when the Streptococcus thermophilus strain is CHCC15887 which is also a 2-deoxyglucose resistant mutant with a mutation in the glcK gene.
[0272] At the same time, the presence of a 2-deoxyglucose-resistant mutant strain in the starter culture also resulted in excretion of more galactose. When a combination of mutant strains, e.g. CHCC15757 and CHCC16159 is used, galactose excretion is about 3 times higher (17.1 mg/ml) compared to a starter culture comprising the corresponding mother strains CHCC14994 and CHCC10019.
[0273] Glucose secretion is even more efficient when a combination of the hyper-lactose fermenting and glucose secreting Streptococcus thermophilus mutant CHCC16404 and the 2-deoxyglucose-resistant mutant strains of Lactobacillus delbrueckii subsp. bulgaricus are used, e.g. a combination of CHCC16404 and CHCC16159, or a combination of CHCC16404 and CHCC16160.
[0274] Taking into account that the; sweetness of sucrose is a 100 (reference value), and the sweetness of lactose is 16, the sweetness of galactose is 32 and the sweetness of glucose is 74, a calculation of the relative sweetness of the final fermented product, presented in last row of Table 4, suggests that the different combination of strains enables the definition of the final concentration of residual lactose, glucose and galactose in the final fermented product. If a yoghurt with maximum inner sweetness due to high concentrations of secreted glucose and galactose and no residual lactose is desired then the most efficient combination of strains is CHCC16404 and CHCC16160. This combination provided a yoghurt that is 3.6 times more sweet that the corresponding combination of 2-DG sensitive strains of Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus, CHCC14994 and CHCC10019 and has no detectable lactose left in the fermented milk.
TABLE-US-00007 TABLE 4 HPLC data of milk samples fermented with mixed cultures Amount Amount Amount mg/ml mg/ml mg/ml Amount Amount Amount Citric Lactic Acetic mg/ml mg/ml mg/ml Strains acid acid acid Galactose Glucose Lactose Sweetness Detection limit <1.25 <1.25 <1.25 <1.5 <1.5 <1.5 Milk 1.7 <1.25 <1.25 <1.5 <1.5 51.6 CHCC14994 + CHCC10019 1.8 7.6 <1.25 5.7 <1.5 33.6 722 CHCC14994 + CHCC16159 1.9 7.7 <1.25 5.6 <1.5 36.4 762 CHCC15757 + CHCC10019 1.7 9.7 <1.25 12.9 6.5 13.2 1108 CHCC15757 + CHCC16159 2.0 10.4 <1.25 17.1 14.1 9.5 1743 CHCC14994 + CHCC759 1.7 7.4 <1.25 5.6 <1.5 31.6 686 CHCC14994 + CHCC16160 1.8 7.3 <1.25 5.5 <1.5 32.4 693 CHCC15757 + CHCC759 2.1 13.8 <1.25 16.6 6.5 12.2 1209 CHCC15757 + CHCC16160 2.0 8.7 <1.25 13.2 11.8 8.5 1432 CHCC16404 + CHCC10019 2.2 8.1 <1.25 11.5 1.8 24.9 900.1 CHCC16404 + CHCC16159 2.2 7.8 1.3 20.9 14.9 3.9 1838.3 CHCC16404 + CHCC16160 2.3 7.7 <1.25 23.1 22.3 <1.5 2396.1 CHCC16404* + CHCC10019 2.1 10.7 <1.25 17.7 11.9 3.2 1501.8 CHCC16404* + CHCC16159 2.0 11.0 <1.25 22.2 20.2 <1.5 2211.3 CHCC16404* + CHCC16160 2.1 6.6 <1.25 18.3 25.8 <1.5 2502.5 *addition of 0.05% sucrose Sweetness calculated: mg/ml glucose *74 + mg/ml lactose *16 + mg/ml galactose * 32.
Example 12
Improving the Growth of Bifidobacteria by use of Glucose Secreting Mutants of Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus
[0275] Some of the most acknowledged probiotic bacteria like Bifidobacterium, animalis subsp. lactis BB-12(commercially available from Chr. Hansen A/S, Hoersholm, Denmark) do not grow well when present alone in lactose based medium like milk. In this experiment, we have therefore investigated the effect of combining Bifidobacterium animalis subsp. lactis BB-12with a glucose secreting strain of Streptococcus thermophilus or Lactobacillus delbrueckii subsp. bulgaricus.
[0276] Experiment 1:
[0277] CHCC 5445 (BB-12) was grown up at anaerobic conditions overnight at 40 C. in MRS+0.05% cysteine chloride.
[0278] CHCC14994 was grown overnight at 40 C. in M17 with 2% galactose.
[0279] CHCC 15757 was grown overnight at 40 C. in M17 with 2% galactose.
[0280] Experiment 2:
[0281] CHCC 5445 (BB-12) was grown up at anaerobic conditions overnight at 40 C. in MRS+0.05% cysteine chloride.
[0282] CHCC10019 was grown overnight anaerobic at 40 C. in MRS with 2% lactose
[0283] CHCC16159 was grown overnight anaerobic at 40 C. in MRS with 2% lactose
[0284] Six bottles with 200 ml B-milk are inoculated at 40 C. overnight with a total of 1% of the outgrown cultures having similar optical densities: [0285] 1. 1% CHCC 5445 (BB-12). [0286] 2. 0.5% CHCC 5445 (BB-12)+0.5% CHCC14994 [0287] 3. 0.5% CHCC 5445 (BB-12)+0.5% CHCC15757 [0288] 4. 1% CHCC5445 (BB-12). [0289] 5. 0.5% CHCC 5445 (BB-12)+0.5% CHCC10019 [0290] 6. 0.5% CHCC 5445 (BB-12)+0.5% CHCC16159
[0291] Only bottles 2-3 and 5-6 acidified due to the poor performance of BB-12 in milk. After fermentation, 100 l of each culture was plated out in different dilutions (10.sup.5, 10.sup.6, 10.sup.7, 10.sup.8) on agar plates selecting for growth of BB-12specifically i.e. MRS+0.05% cystein chloride+tetracycline added 10 ug/ml of tetracycline and then incubated anaerobic overnight at 40 C. The number of colonies was subsequently determined by counting and an average of the results is given in Table 5 as CFU/ml (colony forming units per milliliter).
TABLE-US-00008 TABLE 5 CFU/ml of BB-12 in fermented milk cultures Experi- ment Cultures Cfu/ml 1 1% CHCC 5445 (BB-12) 4.50E+07 1 0.5% CHCC 5445 (BB-12) + 0.5% CHCC14994 4.00E+07 1 0.5% CHCC 5445 (BB-12) + 0.5% CHCC15757 4.00E+08 2 1% CHCC 5445 (BB-12) 6.00E+07 2 0.5% CHCC 5445 (BB-12) + 0.5% CHCC10019 2.00E+07 2 0.5% CHCC 5445 (BB-12) + 0.5% CHCC16159 1.40E+08
[0292] Only when the glucose secreting mutants of Streptococcus thermophilus, CHCC15757 and Lactobacillus delbrueckii subsp. bulgaricus, CHCC16159 is present together with BB-12, the growth of BB-12is boosted and the total cell count presented as CFU/ml is approximately 10(1 log) higher in these cultures. This result suggests that glucose secreting strains can be used to boost the content of probiotic strains like BB-12when mixed together in cultures.
Example 13
Genome comparison of CHCC15757 and CHCC16404 and identification of a mutation in the manM gene encoding the IIC.SUP.Man .protein of the glucose/mannose phosphotransferase system (PTS).
[0293] Genomic DNA preparations of CHCC15757 and CHCC16404 were sequenced at Beijing Genomics Institute (BGI, Beijing, China) and assembled and finished using CLC genomic workbench software (CLCBio, rhus, Denmark). The genome sequences of CHCC15757 and CHCC16404 were aligned using the annotated genome sequence of CHRZ1066 as a reference using Mauve 2.3.1 software. After alignment, a single-nucleotide polymorphism (SNP) analysis was performed using the free Mauve 2.3.1 software on both CHCC15757 and CHCC16404. This allowed the identification of a G to T mutation in the GAA codon (glutamic acid) at amino acid position 209 in the manM gene encoding the IIC.sup.Man protein of the glucose/mannose PTS. This change introduced a TAA stop codon at position 209 of the protein (
[0294] Deposits and Expert Solutions
[0295] The applicant requests that a sample of the deposited micro-organisms stated below may only be made available to an expert, until the date on which the patent is granted.
[0296] The strain Streptococcus thermophilus CHCC15757 has been deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) GmbH, Inhoffenstr. 7B, D-38124 Braunschweig, Germany, on 3 Apr. 2012 under the accession No. DSM 25850
[0297] The strain Streptococcus thermophilus CHCC15887 has been deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) GmbH, Inhoffenstr. 7B, D-38124 Braunschweig, Germany, on 3 Apr. 2012 under the accession No. DSM 25851
[0298] The strain Streptococcus thermophilus CHCC16404 has been deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) GmbH, Inhoffenstr. 7B, D-38124 Braunschweig, Germany, on 12 Dec. 2012 under the accession No. DSM 26722.
[0299] The strain Streptococcus thermophilus CHCC14994 has been deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) GmbH, Inhoffenstr. 7B, D-38124 Braunschweig, Germany, on 3 Apr. 2012 under the accession No. DSM 25838.
[0300] The strain Streptococcus thermophilus CHCC11976 has been deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) GmbH, Inhoffenstr. 7B, D-38124 Braunschweig, Germany, on 8 Sep. 2009 under the accession No. DSM 22934.
[0301] The strain Lactobacillus delbrueckii subsp. bulgaricus CHCC759 has been deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) GmbH, Inhoffenstr. 7B, D-38124 Braunschweig, Germany, on 6 Sep. 2012 under the accession No. DSM 26419.
[0302] The strain Lactobacillus delbrueckii subsp. bulgaricus CHCC10019 has been deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) GmbH, Inhoffenstr. 7B, D-38124 Braurschweig, Germany, on 3 Apr. 2007 under the accession No. DSM 19252.
[0303] The strain Lactobacillus delbrueckii subsp. bulgaricus CHCC16159 has been deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) GmbH, Inhoffenstr. 7B, D-38124 Braurschweig, Germany, on 6 Sep. 2012 under the accession No. DSM 26420.
[0304] The strain Lactobacillus delbrueckii subsp. bulgaricus CHCC16160 has been deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) GmbH, Inhoffenstr. 7B, D-38124 Braurschweig, Germany, on 6 Sep. 2012 under the accession No. DSM 26421.
[0305] The strain Bifidobacterium animalis subsp. lactis CHCC5445 (BB-12) has been deposited at Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) GmbH, Inhoffenstr. 7B, D-38124 Braurschweig, Germany, on 30 Sep. 2003 under the accession No. DSM 15954
[0306] The deposits were made according to the Budapest treaty on the international recognition of the deposit of microorganisms for the purposes of patent procedure.
REFERENCES
[0307] WO 2011/026863
[0308] Pool et al. (2006) Metabolic Engineering 8(5); 456-464
[0309] Thompson et al. (1985) J. Bacteriol. 162(1); 217-223
[0310] Chervaux et al. (2000). Appl and Environ Microbiol, 66, 5306-5311
[0311] Cochu et al. (2003). Appl and Environ Microbiol, 69(9), 5423-5432
[0312] Hier et al. (2010) in The Technology of Cheesemaking, 2nd Ed. Blackwell Publishing, Oxford; 166-192.