METHODS FOR MULTIPLEXING RECOMBINASE POLYMERASE AMPLIFICATION
20200095584 ยท 2020-03-26
Inventors
Cpc classification
C12Q2525/125
CHEMISTRY; METALLURGY
C12Q2565/625
CHEMISTRY; METALLURGY
C12Q2563/131
CHEMISTRY; METALLURGY
C12Q2563/131
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12Q2525/125
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
This disclosure provides for methods and reagents for rapid multiplex RPA reactions and improved methods for detection of multiplex RPA reaction products. In addition, the disclosure provides new methods for eliminating carryover contamination between RPA processes.
Claims
1. A RPA process of DNA amplification of a target nucleic acid molecule comprising a first and a second strand of DNA, comprising the steps of: (a) contacting a recombinase agent with a first and a second nucleic acid primer and a third extension blocked primer which comprises one or more noncomplementary or modified internal residue to form a first, second and third nucleoprotein primer; (b) contacting the first and second nucleoprotein primers to said double stranded target nucleic acid thereby forming a first double stranded structure between said first nucleoprotein primer and said first strand of DNA at a first portion of said first strand and a second double stranded structure between said second nucleoprotein primer and said second strand of DNA at a second portion of said second strand such that the 3 ends of said first nucleoprotein primer and said first nucleoprotein primer are oriented toward each other on the same target nucleic acid molecule with a third portion of target nucleic acid between said 3 ends; (c) extending the 3 end of said first nucleoprotein primer and second nucleoprotein primer with one or more polymerases and dNTPs to generate a first amplified target nucleic acid with an internal region comprising the third portion of nucleic acid; (d) contacting said amplified target nucleic acid to said third nucleoprotein primer to form a third double stranded structure at the third portion of said amplified target nucleic acid in the presences of a nuclease; wherein said nuclease specifically cleaves said noncomplementary internal residue only after the formation of said third double stranded structure to form a third 5 primer and a third 3 extension blocked primer; (e) extending the 3 end of said third 5 primer with one or more polymerase and dNTP to generate a second double stranded amplified nucleic acid which comprises said first nucleic acid primer and said third 5 primer; (f) continuing the reaction through repetition of (b) and (e) until a desired degree of the second double stranded amplified nucleic acid is reached.
2. The process of claim 1 wherein the first double stranded structure is part of a first D-loop and wherein said second double stranded structure is part of a second D-loop.
3. The process of claim 1 wherein said nuclease is a DNA glycosylase or AP endonuclease.
4. The process of claim 1 wherein said modified internal residue is a uracil or inosine residue.
5. The process of claim 4 wherein the nuclease recognizes the uracil or inosine residue cleaves said third extension blocked primer at the uracil or inosine residue.
6. The process of claim 1 wherein the nuclease recognizes a base mismatch between the noncomplementary base of said third extension blocked primer and said target nucleic acid and cleaves said third extension blocked primer at said noncomplementary base.
7. The process of claim 1 wherein said nuclease is selected from the group consisting of fpg, Nth, MutY, MutS, MutM, E. coli MUG, human MUG, human Ogg1, vertebrate Nei-like (Neil) glycosylases, uracil glycosylase, hypoxanthine-DNA glycosylase, and functional analogs thereof.
8. The process of claim 1 wherein said nuclease is E. coli Nfo or E. coli exonuclease III and wherein the modified residue is a tetrahydrofuran residue or carbon linker.
9. The process of claim 1 wherein the modified internal base is selected from the group consisting of 8-oxoguanine, thymine glycol, an abasic site mimic.
10. The process of claim 9 wherein the abasic site mimic is a tetrahydrofuran residue or D-spacer.
11. The process of claim 1 wherein said third extension blocked primer comprises a blocked 3 residue which is resistant to extension by DNA polymerase.
12. The process of claim 11 wherein the blocked 3 residue comprises a blocking moiety which prevents the extension of the primer by polymerase.
13. The process of claim 12 wherein the blocking moiety is attached to the 3 or 2 site of the 3 residue sugar.
14. The process of claim 12 wherein the blocking moiety is a detectable label.
15. The process of claim 14 wherein said detectable label is selected from the group consisting of a fluorophore, an enzyme, a quencher, an enzyme inhibitor, a radioactive label, a member of a binding pair, and a combination thereof.
16. The process of claim 11 wherein the blocked 3 residue is a dideoxy nucleotide.
17. The process of claim 1 wherein said first nucleic acid primer comprises a first detectable label and said third extension blocked primer comprises a second detectable label.
18. The process of claim 17 wherein said first and second detectable label are different and the production of said second double stranded amplified nucleic acid is monitored by detecting the presence of the first and second detectable label on a single double stranded DNA molecule.
19. The process of claim 18 wherein the production of said second double stranded amplified nucleic acid is detected by a sandwich assay wherein a first antibody binds said first detectable label and a second antibody binds said second detectable label.
20. The process of claim 1 wherein the third extension blocked primer further comprises one or more detectable labels.
21. The process of claim 20 wherein said process further comprises the step of monitoring the progress of the RPA reaction by detecting said detectable label on the third extension blocked primer.
22. The process of claim 20 wherein said detectable label is selected from the group consisting of a fluorophore, an enzyme, a quencher, an enzyme inhibitor, a radioactive label, one member of a binding pair and a combination thereof.
23. The process of claim 22 in which the fluorophore is attached to the third extension blocked primer by a fluorophore-dT amidite residue.
24. The process of claim 22 in which the quencher is attached to the third extension blocked primer by a quencher-dT amidite residue.
25. The process of claim 22 wherein said third extension blocked primer comprises a fluorophore and a quencher.
26. The process of claim 25 wherein said fluorophore and quencher are separated by between 0 to 2 bases.
27. The process of claim 25 wherein said fluorophore and quencher are separated by between 0 to 5 bases.
28. The process of claim 25 wherein said fluorophore and quencher are separated by between 0 to 8 bases.
29. The process of claim 25 wherein said fluorophore and quencher are separated by between 0 to 10 bases.
30. The process of claim 25 wherein said fluorophore and quencher are separated by a greater distance when the extension blocked primer is unhybridized than when the extension blocked primer is hybridized to the target nucleic acid.
31. The process of claim 25 wherein the fluorophore or the quencher is attached to the noncomplementary or modified internal residue and wherein the fluorophore and quencher are separated following cleavage of the modified internal base by the nuclease.
32. The process of claim 25 in which the fluorophore is selected from the group of fluorescein, FAM, TAMRA.
33. The process of claim 25 in which the quencher is a dark quencher.
34. The process of claim 33 wherein said dark quencher is selected from the group consisting of Dark Quencher 1, Dark Quencher 2, Black Hole Quencher 1 and Black Hole Quencher 2.
35. The process of claim 1 wherein the first primer, second primer or third extention blocked primer is 12 to 30 residues in length.
36. The process of claim 1 wherein the first primer, second primer or third extention blocked primer 12 to 40 residues in length.
37. The process of claim 1 wherein the first primer, second primer or third extention blocked primer 12 to 60 residues in length.
38. The process of claim 1 wherein said process is performed at a temperature of between 14 C. and 21 C.
39. The process of claim 1 wherein said process is performed at a temperature of between 21 C. and 25 C.
40. The process of claim 1 wherein said process is performed at a temperature of between 25 C. and 30 C.
41. The process of claim 1 wherein said process is performed at a temperature of between 30 C. and 37 C.
42. The process of claim 1 wherein said process is performed at a temperature of between 40 C. and 43 C.
43. The process of claim 1 wherein said process amplifies at least the third portion of said target nucleic acid at least 10.sup.7 folds.
44. The process of claim 1 wherein said process is performed in the presence of 1% to 12% PEG.
45. The process of claim 1 wherein said process is performed in the presence of 6% to 8% PEG.
46. The process of claim 1, wherein said dNTP comprises dUTP and wherein said RPA process is performed in the presence of uracil glycosylase for a first period of less than 20 minutes and wherein said process is performed in the presence of uracil glycosylase inhibitor after said first period.
47. The process of claim 46 wherein said process is performed without temperature based inactivation of said uracil glycosylase.
48. The process of claim 46 wherein said uracil glycosylase inhibitor is Bacillus subtilis phages PBS1 uracil glycosylase inhibitor or Bacillus subtilis phages PBS2 uracil glycosylase inhibitor.
49. The process of claim 46 wherein said dNTP consists of dATP, dUTP, dCTP and dGTP.
50. The process of claim 46 wherein said dNTP does not contain dTTP.
51. A multiplex process of RPA comprising the steps of performing more than one RPA process on one or more double stranded target nucleic acid in one reaction wherein each process comprise the following steps: (a) contacting a recombinase agent with a first and a second nucleic acid primer and a third extension blocked primer which comprises one or more noncomplementary or modified internal residue to form a first, second and third nucleoprotein primer; (b) contacting the first and second nucleoprotein primers to said double stranded target nucleic acid thereby forming a first double stranded structure between said first nucleoprotein primer and said first strand of DNA at a first portion of said first strand and a second double stranded structure between said second nucleoprotein primer and said second strand of DNA at a second portion of said second strand such that the 3 ends of said first nucleoprotein primer and said first nucleoprotein primer are oriented toward each other on the same target nucleic acid molecule with a third portion of target nucleic acid between said 3 ends; (c) extending the 3 end of said first nucleoprotein primer and second nucleoprotein primer with one or more polymerases and dNTPs to generate a first amplified target nucleic acid with an internal region comprising the third portion of nucleic acid; (d) contacting said amplified target nucleic acid to said third nucleoprotein primer to form a third double stranded structure at the third portion of said amplified target nucleic acid in the presences of a nuclease; wherein said nuclease specifically cleaves said noncomplementary internal residue only after the formation of said third double stranded structure to form a third 5 primer and a third 3 extension blocked primer; (e) extending the 3 end of said third 5 primer with one or more polymerase and dNTP to generate a second double stranded amplified nucleic acid which comprises said first nucleic acid primer and said third 5 primer; (f) continuing the reaction through repetition of (b) and (e) until a desired degree of the second double stranded amplified nucleic acid is reached; wherein each RPA process is performed with a different combination of said first and second nucleic acid primer and wherein each process is performed with the same third extension blocked primer.
52. The method of claim 51 wherein said more than one RPA processes comprises at least 2 separate RPA processes.
53. The method of claim 51 wherein said more than one RPA processes comprises at least 4 separate RPA processes.
54. The method of claim 51 wherein said more than one RPA processes comprises at least 5 separate RPA processes.
55. The method of claim 51 wherein said more than one RPA processes comprises at least 7 separate RPA processes.
56. The method of claim 51 wherein said more than one RPA processes comprises at least 10 separate RPA processes.
57. The process of claim 51 wherein said modified internal residue is a uracil or inosine residue.
58. The process of claim 51 further comprising the step of detecting the formation of said second double stranded amplified nucleic acid to determine the cumulative amplification of any of said more than one RPA process.
59. The process of claim 51 wherein the first nucleic acid primer of each RPA process is labeled with the same first detectable label, wherein said third extension blocked primer is labeled with a second detectable label, and wherein said detecting step comprises detecting a double stranded nucleic acid comprising both said first detectable label and said second detectable label.
60. The process of claim 59 wherein the production of said second double stranded amplified nucleic acid is detected by a sandwich assay wherein a first antibody binds said first detectable label and a second antibody binds said second detectable label.
61. The process of claim 51 wherein said nuclease is a DNA glycosylase or AP endonuclease.
62. The process of claim 51 wherein the nuclease recognizes a base mismatch between the noncomplementary base of said third extension blocked primer and said target nucleic acid and cleaves said third extension blocked primer at said noncomplementary base.
63. The process of claim 51 wherein said nuclease is selected from the group consisting of fpg, Nth, MutY, MutS, MutM, E. coli MUG, human MUG, human Ogg1, vertebrate Nei-like (Neil) glycosylases, uracil glycosylase, hypoxanthine-DNA glycosylase, and functional analogs thereof.
64. The process of claim 51 wherein said nuclease is E. coli Nfo or E. coli exonuclease III and wherein the modified residue is a tetrahydrofuran residue or carbon linker.
65. The process of claim 51 wherein the modified internal base is selected from the group consisting of 8-oxoguanine, thymine glycol, or an abasic site mimic.
66. or The process of claim 65 wherein the abasic site mimic is a tetrahydrofuran residue or D-spacer.
67. The process of claim 66 wherein the abasic site mimic is a tetrahydrofuran residue or D-spacer.
68. The process of claim 51 wherein said third extension blocked primer comprises a blocked 3 residue which is resistant to extension by DNA polymerase.
69. The process of claim 68 wherein the blocked 3 residue comprises a blocking moiety which prevents the extension of the primer by polymerase.
70. The process of claim 69 wherein the blocking moiety is attached to the 3 or 2 site of the 3 residue sugar.
71. The process of claim 70 wherein the blocked 3 residue is a dideoxy nucleotide.
72. A RPA process of DNA amplification of a double stranded target nucleic acid molecule comprising a first and a second strand of DNA, comprising the steps of: (a) contacting a recombinase agent with a first and a second nucleic acid primer to form a first and a second nucleoprotein primer; (b) contacting the first and second nucleoprotein primers to said double stranded target nucleic acid thereby forming a first double stranded structure between said first nucleoprotein primer and said first strand of DNA at a first portion of said first strand and a second double stranded structure between said second nucleoprotein primer and said second strand of DNA at a second portion of said second strand such that the 3 ends of said first nucleoprotein primer and said first nucleoprotein primer are oriented toward each other on the same double stranded target nucleic acid molecule; (c) extending the 3 end of said first nucleoprotein primer and second nucleoprotein primer with one or more polymerases and dNTPs and dUTP to generate an amplified target nucleic acid molecule; (d) continuing the reaction through repetition of (b) and (c) for a first period of no more than 20 minutes in the presence of uracil glycosylase; (e) continuing the reaction through repetition of (b) and (c) in the presence of an uracil glycosylase inhibitor until a desired degree of amplification is reached.
73. The process of claim 72 wherein said first period is less than or equal to 10 minutes.
74. The process of claim 72 wherein said first period is less than or equal to 5 minutes.
75. The process of claim 72 wherein said first period is less than or equal to 2 minutes.
76. The process of claim 72 wherein said uracil glycosylase inhibitor is Bacillus subtilis phages PBS1 uracil glycosylase inhibitor or Bacillus subtilis phages PBS2 uracil glycosylase inhibitor.
77. The process of claim 72 wherein said dNTP consists of dATP, dUTP, dCTP and dGTP.
78. The process of claim 72 wherein said dNTP does not contain dTTP.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
DETAILED DESCRIPTION OF THE INVENTION
[0063] In RPA the isothermal amplification of specific DNA fragments is achieved by the binding of opposing oligonucleotide primers to template DNA and their extension by a polymerase (
[0064] In this disclosure, we showed a number of improvements over the basic RPA process. First, we found that with modifications to standard conditions, RPA may be performed efficiently at 25 C. or 30 C. These reaction temperatures allows for equipment-free RPA tests with results in under an hour.
[0065] Second, we improved the sensitivity and specificity of RPA reactions by using DNA repair enzymes in the RPA reaction. In this study, we employed a wide spectrum of previously identified repair enzymes directly in RPA reactions to see if these enzymes would have an effect on RPA efficiency and fidelity. We hypothesize that primer artifacts arise in RPA principally by errant extension of short-lived hairpin structures formed by the primers, or possibly by forming primer dimers (PCT Application PCT/IB2005/001560 filed Apr. 11, 2005). Although such events are presumably rare, the high concentration of oligonucleotide in a reaction, typically of the order 10.sup.12-10.sup.13 molecules would tend to promote a significant degree of such events when the concentration of target template nucleic acid (i.e., the nucleic acid to be amplified) is low. It should be noted that these side reactions are distinct in nature from those often reported in PCR in which poorly-related sequences are amplified from complex DNA samples due to low fidelity of extension from hybridization products in which only a limited number of 3 residues are homologous to parts of the sample DNA. In RPA we believe that the primary recombinase-mediated pairing requires significant homology over significant regions, and rather that single-stranded DNA's are the species mainly sensitive to artifacts through snapback events occurring at the relatively low temperatures employed. Because of this distinction, methods for reducing primer artifacts in PCR do not necessarily work in RPA reaction. This distinction is important to comprehending the approach and mechanism described below for decreasing the background noise generated in the system even in the absence of any target nucleic acids, and the way in which this increases sensitivity by decreasing the competitive primer noise.
[0066] We disclose herein the use of primers deliberately modified with a 3-blocking group (with a biotin, ddC residue, or otherwise), and additionally containing a roughly centrally positioned modified (or absent) base. The internally positioned modification became a nuclease target for a repair endonuclease enzyme, which could split the primer to generate two separate primers only if first paired to a target to generate a stable duplex, and then secondarily processed by the enzyme. If one of the new daughter primers (i.e. the most relatively 5 positioned) possesses, or can subsequently be processed to possess, a free extendable 3 hydroxyl group, then it could subsequently function as a polymerase substrate. In contrast the daughter oligonucleotide positioned relatively 3 would retain the original blocking modification and be unable to function as a polymerase substrate. A dependence on splitting the oligonucleotide to form two duplex hybrids separated by a nick or single-nucleotide gap adds noise reduction to the RPA system as there is little or no opportunity for the un-split primer to be erroneously extended in transient fold-back structures due to the presence of the 3 blocking group. We demonstrate the utility of this approach to reduce primer noise here by showing that trace DNA samples can be detected and discriminated from water merely by assessing whether two labeled DNA primers become physically linked. The possibility of such simple assays presents RPA as a powerful tool in the development of cheap, disposable, equipment-free DNA tests.
[0067] Finally we have adapted the above duplex-specific nuclease system to the development of proprietary real-time fluorescent probes. We anticipated that the design of effective fluorescent probes would be quite distinct in the RPA system in comparison to other described systems, such as in the PCR method. Why is this? We identified two key areas of difference. First, the organization of the functional groups on the probe would likely be necessarily different due to the extreme difference between RPA reaction environments and those of other amplification systems. Earlier work demonstrated that the RPA reaction environment was fundamentally and critically distinct from that encountered in other nucleic acid amplification reactions. Saturating quantities of single-stranded DNA binding protein and recombinase protein ensures that oligonucleotides with non-modified backbones do not adopt a random coil structure. DNA's are relatively stretched out and rigid as these proteins imbue the nucleoprotein filament with a filament length roughly 1.5 times that of B-form DNA (Yang et al., 2001; Scheerhagen et al., 1985; Kuil M E et al., 1990). Consequently the supposition that probes covalently linked to fluorophores and quenchers distant in the primary sequence will still quench due to frequent random approach does not hold true. The second key area in which RPA probes were anticipated to be quite distinct form those in other described systems relates to the enzymes employed in probes processing. We discovered experimentally that described approaches using the 5 exonuclease domain of Pol I class enzymes appeared incompatible with RPA (so-called Taqman method), likely due to FLAP endonuclease activity of these enzymes (Kaiser et al., 1999). We further anticipated that other systems such as molecular beacons or scorpion probes were similarly unlikely to be practical (due to the instability of short duplex anchors in RPA conditions). Instead, we here show that it is possible to configure excellent real-time RPA probes by placing fluorophore and quencher moieties close to one another separated by a modified base that leads to backbone splitting only in a duplex context. This approach promises to add tremendous value to the RPA process as it brings the real-time quantitative detection and multiplexing specifications into alignment with the current state-of-the-art using the other methods. Specifically it provides an approach to assess absolute numbers of target nucleic acid molecules in a sample, to increase specificity and sensitivity to allow single molecule detection, and also to permit multiplex analysis of several targets. All of these properties can be attained using this method without a need for gel electrophoresis, or other approaches requiring experimental intervention, but rather reactions can be monitored continuously and automatically by dedicated equipment. To illustrate the power of combining the RPA process with these highly fidelitous detection approaches we have developed an ultra-sensitive, internally-controlled, test for the hospital pathogen MRSA, a difficult target due to the complex and diverse nature of pathogenic strains, and a need for multiplexing.
[0068] Each aspect of the invention is described in more detail below:
Low Temperature RPA
[0069] RPA reactions operate optimally at about 37 C., reflecting the temperature optimum of the enzymes involved in an RPA reaction. While 37 C. is easily achieved in the laboratory, an RPA reaction that can function efficiently at 30 C. or 25 C. would increase the utility of RPA and allow real time amplification under field conditions where a 37 C. incubate in not available.
[0070] To determine if primer length has an effect on RPA efficiency, RPA reactions were performed at 37 C. with primer pairs of different lengths (
[0071] It is understood that the primers for any of the methods of the invention may be made from DNA, RNA, PNA, LNA, morpholino backbone nucleic acid, phosphorothiorate backbone nucleic acid and a combination thereof. Combinations thereof in this case refer to a single nucleic acid molecule which may contain one or more of one base connected to one of more of another base. Preferred concentration of these molecules may be in the range of between 25 nM to 1000 nM. In one preferred embodiment, the primers may contain a non-phosphate linkage between the two bases at its 3 end and is resistant to 3 to 5 nuclease activity.
[0072] Our results show that there was a gradual increase in kinetic rate as the primers were lengthened. In fact lengthening the primers from 30/31-mers to 45-mers cut the amplification time to threshold detection by about 10 minutes, from roughly 35 minutes to 25 minutes under the conditions used here (10 mM magnesium, 5% carbowax 20M). Based on the results of this experiment, we conclude that primers with slow kinetics may be enhanced by increasing primer length.
[0073] We also investigated whether primer length has an effect on RPA performed in lower temperatures. RPA may not work at a lower temperature for at least two reasons. First, there can be a sudden and dramatic cessation of RPA reaction function below a certain temperature if, for example, one of the components of the reaction cease to function below a certain temperature. For example, the carbowax may go through a phase transition at a lower temperature and cease to function in the desired fashion. Second, the reaction rate may simply slow progressively so that doubling times lengthen, a reflection of slower enzyme catalysis and diffusion. In the second case, the primer rate could be very important because the reaction would possibly be up-against-the-clock with regard to exhaustion of reaction components such as ATP.
[0074] To test our hypothesis, we attempted to amplify the same fragments as in
[0075] As seen in
[0076] The kinetic behavior of the 45-mer primers at 25 C., under different concentrations of PEG, is shown in
[0077] The lack of a signal in the 4% lane is possibly due to experimental error. The results show that higher PEG concentrations can accelerate kinetics up to a point, and then some inhibition in rate and overall reaction behavior/outcome is observed. In this case 7% or 8% PEG were optimal for maximizing the amount of amplified nucleic acids of the correct length. When the PEG concentrations are higher, there is progressive domination of the faster-migrating anomalous band. In the presence of 8% PEG detection was observed by about 37 minutes at 25 C., which corresponds to a doubling time of around 1 minute 25 seconds. At 5% PEG detection was made at about 54 minutes (corresponding to a 2 minutes doubling time). This reaction at 25 C. is about half as fastas the experiment shown in
[0078] The experiment of
[0079] Primers for the Human Apolipoprotein B locus show rapid kinetics without primer elongation. In this case kinetic studies using SYBR-green revealed that no rate increase was found with longer RPA primers. It appears that the ApoB4 and Apo300 primers used here, even when short, possess high rate behavior to the extent that they are not the rate limiting factor in the reaction. Presumably, in this reaction, polymerase rate is now the main rate-limiting part of the reaction and more active (longer) primers cannot achieve an overall speed benefit. Consistent with our hypothesis, we find that all of the Apolipoprotein B primers generate the expected product at 25 C. (
Contamination Control Using UNG Inhibitor from Bacteriophage PBS2
[0080] RPA reactions are compatible with the use of dUTP as a method to control carry-over contamination. One caveat with the earlier experimental data is that in order to initiate the reaction the uracil glycosylase enzyme had to be heat inactivated. This poses two incompatibility issues with RPA. First, heat inactivation would also inactivate complete RPA reactions because RPA reagents are not heat stable. Second, heat inactivation is inconsistent with one goal of RPAthe avoidance of thermal cycling.
[0081] Because of the reasons above, we set to investigate another technical route to implement contamination control. It is known that the Bacillus subtilis phages PBS1 (See, Savva and Pearl, 1995) and PBS2 (See, Wang, Z. and Mosbaugh, D. W. (1989)) possess a specific small peptide inhibitor of E. coli and B. subtilis uracil-DNA glycosylase (Wang and Mosbaugh, 1988). They require a highly effective system as their own DNA is synthesized using dUTP rather than dTTP. We cloned the PBS2 DNA sequencing encoding the inhibitor peptide and expressed it in E. coli with a C-terminal hexahistidine tag. We also cloned the E. coli uracil glycosylase gene and expressed it with a C-terminal hexahistidine. We used these protein preparations to test whether a carry-over contamination system could be employed with them.
Fluorescent Real-Time Probes for RPA Reactions
[0082] Many possible applications of the RPA process in detecting DNA (or RNA) sequences would benefit from being applied in a real-time format. RPA has already been shown to be effective when combined with minor groove binding dyes such as SYBR-green (PCT Application PCT/IB2005/001560 filed Apr. 11, 2005). However there may be potential limitations of using such general indicators of DNA accumulation to assess reaction behavior. First, there is no capacity for multiplexing amplification reactions as the dyes cannot discriminate between the various products formed. In many clinical tests, for example, there would be a need to include an internal amplification control to exclude false negatives. Second, RPA reactions are similar to most other DNA amplification processes insofar as even when no target is present in a sample, some DNA synthesis will eventually ensue. Consequently may be difficult or impossible to discriminate between the presences of a few copies of target nucleic acid or no copies of a nucleic acid based on current methods of florescent detection.
[0083] In response to these issues we have developed a proprietary fluorescence-based probe system to monitor RPA reactions. We investigated using the 5-3 nuclease associated with the polymerases of the E. coli Pol I class. This nuclease is used in a fluorescent probe methodology for PCR known as the 5nuclease, or Taqman, assay. We found that both Bacillus subtilis Pol I retaining the 5-3 nuclease domain and the E. coli Poll enzyme would not support RPA reactions. On reflection we believe this arises because these nucleases are structural/functional homologs of the FEN1 FLAP endonuclease family and most likely are structure-specific endonucleases (Kaiser et al.). We suppose these enzymes progressively digest the displaced strand during the strand-displacement synthesis thus inhibiting DNA amplification.
[0084] We focused our attentions particularly on the E. coli glycosylase enzymes and AP endonucleases involved in DNA repair known as fpg, Nth, Nfo, and more recently E. coli exonuclease III. Importantly these enzymes will only remove damaged bases and/or nick DNA backbones at positions in which base modifications have occurred and, critically, in the context of duplex DNA. All of these enzymes are able to cleave such appropriate duplex DNA molecules with high specificity in the RPA environment (see application). Test probes were utilized that contained a modified base within the body of the oligonucleotide (8-oxoguanine, thymine glycol, or abasic site mimic respectively) and an additional distinct elongation blocking group on the 3 end (provided by a 3-dR-biotin). Despite obvious promise for all of these enzymes, and potentially other repair/processing enzymes, we focused on the behavior of the E. coli Nfo and exonuclease III enzymes for the following reasons. First, we observed when testing fpg, Nth, and Nfo proteins that the degree of successful probe processing was highest for the probe containing a tetrahydrofuran residue (THFan abasic site mimic), and processed by Nfo. Second, because Nfo, and the functionally similar E. coli exonuclease III, split the oligonucleotide into two smaller oligonucleotides separated by a single nucleotide gap, in which the new 3 end that is formed can be elongated by a strand displacing polymerase that can initiate at nicks. This property endows the THF/Nfo or THF/exonuclease III processing system with a wealth of application opportunities that extend beyond application to fluorescent probe processing. (Note that other abasic site mimics, or true abasic sites might also be employed).
[0085] A previous report has also illustrated a potential use of employing an abasic, or other blocking residue, in the context of an amplification process, with the preferred intention to remove the residue in the context of PCR or LCR reactions using a thermostable nuclease (U.S. Pat. No. 5,792,607, referred to herein as the '607 patent). However the approach we used is distinct from that of the '607 patent. In the '607 patent, an abasic site is described as one member of a broader selection of modifying groups, to be positioned preferentially at the 3 end of the intended amplification oligonucleotide, and designed to serve as a reversible 3 sugar modifying group by effectively preventing substrate recognition or catalysis by the polymerase. The intention is to decrease the propensity of the amplification system to amplify unintended targets in sample DNA because of the tendency of PCR and LCR techniques to form, albeit at reduced frequency, hybrids with sequences sharing limited homology to the 3-region of oligonucleotide primers. Furthermore it is intended, critically, in the '607 patent that this modification preventing substrate recognition be specifically corrected in a target-dependent fashion. Such an activity might be performed by the activity of an agent such as endonuclease IV which can polish groups from a 3 sugar residue. However, quite distinctly, in the process described herein the THF residue does not serve as an elongation-blocking modification agent to the 3 sugar that prevents the initial oligonucleotide/template hybrid being recognized as a bona fide substrate. Indeed the THF residue, instead of being located at the very 3 end of an oligonucleotide, is positioned within the body of the oligonucleotide, away from the substrate target of the polymerase (i.e. the 3 end region of the hybridized primer on the template DNA). In this disclosure the principal motivation is to prevent noise arising from primer fold-back artifacts. Thus, instead, herein the processing of the THF residue by an endonuclease activity leads to incision of the oligonucleotide backbone in the context of a bona fide duplex in a distinct event from correction of the modification that prevents polymerase substrate recognition. We also describe herein 3 terminal elongation-blocking modifications, however these are not the corrected modification in this case, and are not necessarily removed from 3-terminal nucleotides as in the '607 patent. Instead, in the case described here we would employ two separable entitities, a non-corrected 3-blocking group, and a centrally located abasic-like residue which can be incised by an AP endonuclease to generate a nicked structure and two independent daughter annealed primers, only one of whom is a polymerase substrate.
[0086]
[0087] A THF residues was inserted at a nucleotide position between these modified bases. The probe was blocked by the presence of a 3-dR-biotin group.
TABLE-US-00002 (SEQIDNO:8) 5-catgattggatgaataagctgcagc(dTfluoro)g(THF)t (dT-DDQ1)aaaggaaactta-dRbiotin-3
[0088] The probe is homologous to part of the Bacillus subtilis SpoOB locus contained within an amplicon generated by primers J1 and K2. The fluorophore and quencher were designed to be on T residues in the sequence so that they could be incorporated directly on commercially available amidites.
[0089] The sensing probe was designed to possess a fluorophore and quencher separated by (a) less than 10 bases (to ensure efficient quenching) and (b) a cleavable site (THF residue). In this case the primary amplicon was generated using the primers J1 and K2 to amplify a fragment from the Bacillus subtilis SpoOB locus. RPA reactions were modified from our usual conditions in the following manner. First the probe was included, whose overall structure and sequence is shown in the lower part of the figure. Second the amplification primers were biased in concentration so that there was a relative excess of the amplification primer opposing the probe in order that there might be a steady-state excess of complementary sequences to the probe. Finally the Nfo enzyme was included in the reaction. Reactions were performed in 20 microliter volumes in a standard 384-well plate and fluorescence monitored using excitation/detection filters of 485/525 in a BIO-TEK Flx800 plate reader. We observed that there was a template-dependent increase in fluorescence. The time at which accumulation begins was dependent on the copy number, as was the level of total fluorescence at the end of the period of reaction monitoring at one hour.
[0090] In
[0091] In this case we have shown the result of normalizing the samples against the signal in the water control, and then the results of plotting the logarithm of the normalized fluorescence signal. We set a fluorescence signal of 2.5 or above as constituting a positive signal. Note that it is easy to distinguish the low copy samples from water in contrast to the situation usually observed when using SYBR-green. The slight fluorescence increase in the water sample is almost certainly due to slight carry-over contamination associated with this particular amplicon which has been handled widely in the laboratory.
[0092] With respect to the quenchers of this disclosure, it is understood that a quencher need not be a fluorophore. A non-fluorescent chromophore can be used that overlaps with the donor's emission (a dark quencher). In such a case, the transferred energy is dissipated as heat.
[0093] High efficiency dark quenchers, such as Dark Quencher 1, Dark Quencher 2 and Black Hole Quencher1 and Black Hole Quencher 2 are known and commercially available (Biosearch Technologies, Inc., Novato, Calif.). As is known in the art, the high quenching efficiency and lack of native fluorescence of the dark quencher allows attachment of a fluorophore and a quencher on one oligonucleotide and ensures that such an oligonucleotide does not fluoresce when it is in solution.
[0094] Suitable fluorophores and quenchers for use with the polynucleotides of the present invention can be readily determined by one skilled in the art (see also, Tgayi et al., Nature Biotechnol. 16:49-53 (1998); Marras et al., Genet. Anal.: Biomolec. Eng. 14:151-156 (1999)). Many fluorophores and quenchers are available commercially, for example from Molecular Probes (Eugene, Oreg.) or Biosearch Technologies, Inc. (Novato, Calif.). Examples of fluorophores that can be used in the present invention include, but are not limited to, fluorescein and fluorescein derivatives such as FAM, VIC, and JOE, 5-(2-aminoethyl)aminonaphthalene-1-sulphonic acid (EDANS), coumarin and coumarin derivatives, Lucifer yellow, NED, Texas red, tetramethylrhodamine, tetrachloro-6-carboxyfluoroscein, 5 carboxyrhodamine, cyanine dyes and the like. Quenchers include, but are not limited to, DABSYL, 4-(4-dimethylaminophenylazo)benzoic acid (DABCYL), 4-dimethylaminophenylazophenyl-4-maleimide (DABMI), tetramethylrhodamine, carboxytetramethylrhodamine (TAMRA), Black Hole Quencher, Dark Quencher 1, and Dark Quencher 2. Methods of coupling fluorophores and quenchers to nucleic acids are well-known in the art.
[0095] We have successfully implemented a fluorescent probe system in the RPA reaction environment and established the general structure of probes. With this knowledge it should be easy to develop probes to detect any amplicon, and by judicious selection of alternate fluorophores, to multiplex more than one amplification at once. To demonstrate this we have developed a multiplex test for the antibiotic-resistant S. aureus pathogen known in the United Kingdom as methicillin-resistant Staphylococcus aureus, or MRSA for short.
The Detection of Methicillin-Resistant Staphylococcus aureus
[0096] MRSA comprises a collection of Staphylococcus aureus strains which have developed antibiotic resistance by integration of a resistance cassette, the mecA cassette, at a specific location in the S. aureus genome. While the same general genomic integration site is always used, the precise integration site junctions and orientation of the cassettes can vary. Despite this variation, independent isolates can be segregated into a limited number of general groups with representative integration structures. In addition to this complexity, further difficulties arise due to the existence of base polymorphisms between strains which can compromise the effectiveness of amplification primers and probes. The MRSA pathogen thus represents a complex target because in order to capture over 90% of the strains commonly found in clinical specimens in a single test it is necessary to accommodate detection of three structurally distinct variations of the mecA resistance cassette integration locus, and account for some common polymorphisms. Additionally, it is necessary that the amplicon spans one arm of the integration cassette to ensure that any mecA sequences amplified are in the context of the S. aureus genome, and were not present in an unrelated bacterium.
[0097] In order to configure an RPA test for over 90% of common MRSA strains, we developed a primer design strategy which is illustrated in
Three probes were employed:
TABLE-US-00003 SATamral1 (SEQIDNO:9) 5-tgttaattgaacaagtgtacagagcatt(T)a(H)ga(q1) tatgcgtggag-Biotin-3 SATamra2 (SEQIDNO:10) 5-tgttaattgagcaagtgtatagagcatt(T)a(H)ga(q2) tatgcgtggag-Biotin-3 BSF1c (SEQIDNO:11) 5-catgattggatgaataagctgcagc(F)g(H)t(q3) aaaggaaactta-Biotin-3
[0098] Here (T) is dT-TAMRA, (F) is dT-Fluorescein, (H) is THF, (q1) is dT-BHQ1, (q2) is dT-BHQ2, (q3) is dT-DDQ1. Probes were employed at 60 nM SATamra1 (MRSAIII experiment) or at 45 nM SATamra1, 45 nM SATamra2, 60 nM BSFlc (multiplex experiment). Nfo was used at 200 ng/ul. Excitation/detection was at 485/525 nm (SybrGreenI, BSFlc) or 530/575 nm (SATamra1/2). Measurements were taken every 30 sec or 45 sec (multiplex experiment). Fluorescence probe data were normalized against water control and pre-amplification baseline adjusted. The logarithm of the read-out was plotted against reaction time.
[0099] Briefly, a single primer was designed to recognize the S. aureus genomic DNA outside of the integration cassette region, and is termed orfX. Two further primers specific to the mec cassette were designed, and one of these (scc I/II) can be used to amplify the locus from two of the strain variants, while the second (scc III) amplified the locus from the third variant. Two probes for the amplicons are used, differing in two residues to account for common single nucleotide polymorphisms. Both these MRSA probes use TAMRA as fluorophore. Finally a control amplicon is included in the reaction which comprises a unique segment of an unrelated B. subtilis genomic DNA fragment fused to the orfx and sccIII primers, and a third probe may be used to sense this amplicon (BSFlc, and this is the same probe used in the experiments in
[0100] Included in these experiments are control reactions containing relatively high concentrations of (10.sup.4 copies) of non-resistant S. aureus DNA. Satisfyingly, these samples do not score positive indicating a strict requirement for both S. aureus sequences as well as the mecA cassette. To ensure that this control DNA was functional and that the copy concentration was as indicated, the DNA was used in control reactions employing a combination of the orfx primer and a second S. aureus specific primer termed mssa. In this case the same probes may be employed as the probes recognize common sections of the S. aureus genome. In
Detection of Trace Nucleic Acids by Association of Primers Following Enzymatic Generation of an Extendable 3 End
[0101] RPA is ideally suited to the development of portable equipment-free, or equipment-light, DNA tests. However such tests would ideally employ cheap, easy-to-use, approaches to determine whether amplification has occurred. Traditionally gel electrophoresis is used to assess whether a product of a defined size has accumulated. Alternatively fluorescent probes may be employed. In either case significant hardware is required to perform the analysis and this prevents the test being used by end-users lacking appropriate equipment.
[0102] Other approaches may be used to determine whether or not DNA amplification has occurred. One convenient hardware-free approach is to perform a sandwich assay in which the presence of an amplicon is assessed by interrogating whether two labeled gene-specific primers have become associated in a common DNA duplex. This can be achieved by labeling one amplification primer with a label, such as biotin, and an opposing primer with a second label, such as FAM. A variety of approaches can be employed to determine whether the two labeled primers become associated. For example in a conventional lateral flow strip assay (see for example patent EP0810436A1), two antibodies (or other moiety such as streptavidin that binds with high affinity to one of the oligonucleotide labels) are employed. One antibody would be immobilized on a flow membrane in a line or spot. The other is coupled to visible particles such as colloidal gold, latex particles, or similar. When the sample, in this case a diluted or undiluted amplification reaction, is applied to a sample pad in which the antibody-coupled visible particles are pre-deposited, the visible particles become stably associated with one of the labeled oligonucleotides. The entire sample then moves by capillary action up the membrane and as it flows the other labeled primer becomes caught on the immobilized antibody. If the labeled primers are not co-associated in a duplex then the antibodies caught on the membrane are not associated with the visible particles associated with the other primer. If, however, they are associated as a consequence of amplification then the visible particles also become trapped on the line or spot, and a visible signal accumulates. Other approaches to assess for association of primers can be configured.
[0103] One problem with simple association assays, such as sandwich assays, is the requirement that the primers do not associate unless bona fide amplification of the desired target has occurred. Any undesired association will lead to a false positive signal. However such a clean-cut situation is rarely the case with most amplification methods, particularly when the target is not abundant. For example primer dimers, or other artifacts, tend to accumulate to some extent in the PCR method regardless of optimization. RPA also suffers from the accumulation of primer-related artifacts as detailed earlier, and these are likely to interfere with the direct combination of RPA with such simple read-outs. Indeed this general problem may underpin part of the reason that sandwich assays have not been broadly implemented in currently available high sensitivity/specificity DNA tests. Those commercially available lateral flow systems marketed to assess PCR product accumulation are inconvenient, requiring a final step of hybridizing an additional probe primer to the product after the reaction has been performed in order to avoid aberrant co-association of primers through DNA synthesis (e.g. The Genline Chlamydia Direct test strip from Milenia).
[0104] We have configured RPA reactions to permit easy assessment of bona fide target amplification by direct addition to lateral flow strips, or potentially by other similar methods. To attain a clean distinction between positive and negative samples we have employed a labeled primer which is split by the E. coli Nfo or exonuclease III enzymes to generate two primers, one of which may be elongated. This is attained by blocking the 3 end of the oligonucleotide, and separately incorporating a THF residue or product of employing a 5-O-Dimethoxytrityl-1,2-Dideoxyribose-3-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite during oligonucleotide synthesis, referred to herein as D-spacer available from Glen Research, Sterling, Va., USA) within the oligonucleotide to act as a splitting target for the enzyme. The dependence on formation of a stable duplex before the Nfo or exonuclease III enzymes will incise/split the primer ensures that aberrant association of this primer with the other labeled opposing primer does not occur, or is so infrequent as to fall below threshold of detection.
[0105]
[0106] In this case 2 of the primers act as the main amplification primer pair, and a third acts as a probe. The probe contains a 3 blocking group and a separate internal THF residue to act as a splitting target, as well as a FAM label at the 5 end. The probe opposes one of the main amplification primers which is labeled with a biotin residue. Only if a bona fide amplicon accumulates will the probe form stable hybrids that are nicked/split by Nfo, elongated, and thus associate the 2 labeled primers. The results of an experiment are shown in which RPA amplifications established in this way were performed on DNA from the resistant and non-resistant strains. A small quantity of the reaction (1 l) was then mixed with 5 l of lateral flow running buffer (Phosphate buffered saline with 3% Tween-20) and directly applied to a commercial lateral flow strip (Milenia-germany). After about 1-2 minutes the strips were assessed for signal, and a photograph was taken. The test clearly distinguishes positive from negative.
[0107] Other processing enzymes might be employed in such approaches. In particular the E. coli fpg, Nth, and exonuclease III enzymes, homologs from other phyla, base mismatch repair enzymes such as E. coli MutY, MutS and MutM, E. coli MUG, Human MUG, Ogg1, and the vertebrate Nei-like (Neil) glycosylases. Any combination of the above repair enzymes might also be employed. In particular note that E. coli Nfo (endonuclease IV), and E. coli exonuclease III, possess phosphodiesterase activities and are capable of processing the non-extendable 3 ends of nicked products of the other glycosylase/lyases to extendable 3-hydroxyl residues.
[0108] All patents, patent applications and references, cited anywhere in this disclosure, are incorporated by reference in their entirety.
[0109] The invention will now be described further by way of examples. The examples are illustrative of the invention and are not intended to limit it in any way.
EXAMPLE
Example 1 Nucleic Acid Sequences
Proteins and DNA
[0110] Coding sequences for uvsx, uvsy, gp32, Bsu and Nfo were amplified from genomic DNA (DSMZ, Germany), fused to hexahistidine-tags (N-terminal for uvsY, Bsu and Nfo, C-terminal for uvsX and gp32) and cloned into suitable expression vectors. Overexpression and purification was done by standard protocols using Nickel-NTA resin (Qiagen). S. aureus alleles were EMRSA-3 (SCCmec type I; MRSAI), EMRSA-16 (MRSAII), EMRSA-1 (MRSAIII) and wild-type MSSA. See additional sequence information provided below.
TABLE-US-00004 Primersequences HumanlocusApoB(productsizeexperimentSI): Apo700 tggtaaacggaagtctggcagggtgattctcg(SEQIDNO:12) Apo800 caattgtgtgtgagatgtggggaagctggaat(SEQIDNO:13) Apo900 gaggtggttccattccctatgtcagcatttgc(SEQIDNO:14) Apo1000 gggtttgagagttgtgcatttgcttgaaaatc(SEQIDNO:15) HumanlociforSTRmarkers(STRexperimentandprimersizeexperiment,SI): CSF1PO 5 gttgctaaccaccctgtgtctcagttttcctac(SEQIDNO:16) CSF1PO 3 agactcttccacacaccactggccatcttcagc(SEQIDNO:17) D7S820 5 gaacacttgtcatagtttagaacgaactaacg(SEQIDNO:18) D7S820 3 gaattataacgattccacatttatcctcattgac(SEQIDNO:19) D13S317 5 ttgctggacatggtatcacagaagtctgggatg(SEQIDNO:20) D13S317 3 ccataggcagcccaaaaagacagacagaaaga(SEQIDNO:21) D16S539 5 aaacaaaggcagatcccaagctcttcctcttcc(SEQIDNO:22) D16S539 5 ataccatttacgtttgtgtgtgcatctgtaagc(SEQIDNO:23) D18S51 5 ggtggacatgttggcttctctctgttcttaac(SEQIDNO:24) D18S51 3 ggtggcacgtgcctgtagtctcagctacttgc(SEQIDNO:25) THO1 5 tacacagggcttccggtgcaggtcacaggga(SEQIDNO:26) THO1 3 ccttcccaggctctagcagcagctcatggtgg(SEQIDNO:27) TPDX 5 actggcacagaacaggcacttagggaaccc(SEQIDNO:28) TPDX 3 ggaggaactgggaaccacacaggttaatta(SEQIDNO:29) HumanlociApoB,D18S51andSry(primersizeexperiment,SI): APOB500 atggtaaattctggtgtggaaaacctggatgg(SEQIDNO:30) APO500-28 taaattctggtgtggaaaacctggatgg(SEQIDNO:31) APO500-25 attctggtgtggaaaacctggatgg(SEQIDNO:32) APOB300REV ctatccaagattgggctaaacgtatgaaagca(SEQIDNO:33) APOB300REV-28 ccaagattgggctaaacgtatgaaagca(SEQIDNO:34) APOB300REV-25 agattgggctaaacgtatgaaagca(SEQIDNO:35) D18S515-28 gacatgttggcttctctctgttcttaac(SEQIDNO:36) D18S515-25 atgttggcttctctctgttcttaac(SEQIDNO:37) D18S513-28 gcacgtgcctgtagtctcagctacttgc(SEQIDNO:38) D18S513-25 cgtgcctgtagtctcagctacttgc(SEQIDNO:39) SRY3 aaagctgtaactctaagtatcagtgtgaaac(SEQIDNO:40) SRY3-28 gctgtaactctaagtatcagtgtgaaac(SEQIDNO:41) SRY3-25 gtaactctaagtatcagtgtgaaac(SEQIDNO:42) SRY4 gttgtccagttgcacttcgctgcagagtacc(SEQIDNO:43) SRY4-28 gtccagttgcacttcgctgcagagtacc(SEQIDNO:44) SRY4-25 cagttgcacttcgctgcagagtacc(SEQIDNO:45) DNAsusedinthisdisclosure BsA1 ttgggcacttggatatgatggaactggcac(SEQIDNO:46) BsA1-36 ttgggcacttggatatgatggaactggcacggttgt(SEQIDNO:47) BsA1-410 ttgggcacttggatatgatggaactggcacggttgttgcg(SEQIDNO:48) BsA1-45 ttgggcacttggatatgatggaactggcacggttgttgcgtccat(SEQIDNO:49) BsB3 ccatcttcagagaacgctttaacagcaatcc(SEQIDNO:50) BsB3-36 cgccatcttcagagaacgctttaacagcaatccatt(SEQIDNO:51) BsB3-40 cgccatcttcagagaacgctttaacagcaatccattttgc(SEQIDNO:52) BsB3-45 cgccatcttcagagaacgctttaacagcaatccattttgcgccag(SEQIDNO:53) ApoB4 cagtgtatctggaaagcctacaggacaccaaaa(SEQIDNO:54) ApoB4-40 cagtgtatctggaaagcctacaggacaccaaaataacctt(SEQIDNO:55) ApoB4-45 cagtgtatctggaaagcctacaggacaccaaaataaccttaatca(SEQIDNO:56) Apo300 tgctttcatacgtttagcccaatcttggatag(SEQIDNO:57) Apo300-40 tgctttcatacgtttagcccaatcttggatagaatattgc(SEQIDNO:58) Apo300-45 tgctttcatacgtttagcccaatcttggatagaatattgctctgc(SEQIDNO:59) SRY8 ccagctgtgcaagagaatattcccgctctccg(SEQIDNO:60) SRY9 cctgttgtccagttgcacttcgctgcagagt(SEQIDNO:61) J1 acggcattaacaaacgaactgattcatctgcttgg(SEQIDNO:62) K2 ccttaatttctccgagaacttcatattcaagcgtc(SEQIDNO:63) NfoIprobe 5-catgattggatgaataagctgcagc-[dTfluorescein]-g-[tetrahydrofuranyl]- t-[dT-DDQ1]-aaaggaaactta-dRbiotin-3 (SEQIDNO:64) ORFX45-b ccaagaattgaaccaacgcatgacccaagggcaaagcgactttgt(SEQIDNO:65) ORFXprobe2 5-(FAM)-CCACATCAAATGATGCGGGTTGTGTTAAT-[d-SPACER]-GAACAAGTGTACAGAG- 3ddC(block)(SEQIDNO:66) SATamira1 5-tgttaattgaacaagtgtacagagcatt-[dT-tamra] a(THF)ga(BHQ1)tatgcgtggag-Biotin-3 (SEQIDNO:67). SATamira2 5-tgttaattgagcaagtgtatagagcatt(dT tamra])a(THF)ga(BHQ2)tatgcgtggag-Biotin-3 (SEQIDNO:68) BSFlc 5-catgattggatgaataagctgcagc(F)g(H)t(q3) aaaggaaactta-Biotin-3 (SEQIDNO:69)
Sequence of MSSA and MRSA Alleles and Primers Used Here:
[0111] Primer target sites are bold/underlined, probe binding site is in bold/italic.
TABLE-US-00005 MRSA/MSSAprimers(S.aureusexperiment): (SEQIDNO:70) SCCI/II ctcaaagctagaactttgcttcactataagtattc (SEQIDNO:71) SCCIII ccaatatttcatatatgtaattcctccacatctca (SEQIDNO:72) ORFX cccaagggcaaagcgactttgtattcgtcattggcggatcaaacg (SEQIDNO:73) MSSA ccaatttgatagggcctaatttcaactgttagcta (SEQIDNO:74) sccII-35-2-bio 5-bio-ctatgtcaaaaatcatgaacctcattacttatgat MSSADNAsequence: (SEQIDNO:75) ttttagatataaaccaatttgatagggcctaatttcaactgttagctact acttaagttatatgcgcaattatcgtgatatatcttatatattgaatgaa cgtggatttaatgtccaccatttaacaccctccaaattattatctcctca tacagaattttttagttttacttatgatacgcct
caacccgcatcatttgatgtg ggaatgtcattttgctgaatgatagtgcgtagttactgcgttgtaagacg tccttgtgcaggccgtttgatccgccaatgacgaatacaaagtcgctttg cccttgggtcatgcg MRSAIDNAsequence: (SEQIDNO:76) tttagttgcagaaagaattttctcaaagctagaactttgcttcactataagtattcagt ataaagaatatttcgctattatttacttgaaatgaaagactgcggaggctaactatgtc aaaaatcatgaacctcattacttatgataagctt
caacccgcatcatttgatgtgggaatgtcattttgctga atgatagtgcgtagttactgcgttgtaagacgtccttgtgcaggccgtttgatccgcca atgacgaatacaaagtcgctttgcccttgggtcatgcg MRSAIIDNAsequence: (SEQIDNO:77) tttagttgcagaaagaattttctcaaagctagaactttgcttcactataagtattcagt ataaagaatatttcgctattatttacttgaaatgaaagactgcggaggctaactatgtc aaaaatcatgaacctcattacttatgataagcttcttaaaaacataacagcaattcaca taaacctcatatgttctgatacattcaaaatccctttatgaagcggctgaaaaaaccgc atcatttatgatatgctt
caacccgcatcatttgatgtgggaatgtcattttgctgaatgatagtgcgtagtt actgcgttgtaagacgtccttgtgcaggccgtttgatccgccaatgacgaatacaaagt cgctttgcccttgggtcatgcg MRSAIIIDNAsequence: (SEQIDNO:78) aaggtataatccaatatttcatatatgtaattcctccacatctcattaaatttttaaat tatacacaacctaatttttagttttatttatgatacgctt
caacccgcatcatttgatgtgggaatgtcattt tgctgaatgatagtgcgtagttactgcgttgtaagacgtccttgtgcaggccgtttgat ccgccaatgacgaatacaaagtcgctttgcccttgggtcatgcg
Example 2 Kinetics of an RPA Reaction
[0112] A schematic of the RPA process is shown in
[0113] The kinetics of recombinase/primer filament formation is shown in
[0114] The result of a typical RPA reaction is shown in
[0115] The ability to monitor RPA reaction in real time is shown in
Example 3 Detection of RPA Amplicons Using Lateral Flow Strips
[0116] We devised a method of using lateral-flow-strip technology for the detection of RPA amplicon. This method uses specific antibodies to immobilize and detect complexes containing two antigenic labels (
[0117] To detect the presences of the double labeled amplicons, samples suspected of containing the amplicons a pad soaked in visible (gold) particles coupled to an antibody recognizing one of the two labels (in this case, the label is an antigen) (
[0118] A number of research and clinical applications could benefit from employing RPA and the various detection methods disclosed herein. For example, RPA offers a significant breakthrough for the development of non-laboratory devices. When integrated with handheld instruments or entirely equipment free DNA detection systems, RPA will enable an easy-to-use testing system for a variety of pathogens as well as field kits for other applications.
Materials and Methods
[0119] Proteins and DNA
[0120] Coding sequences for uvsx, uvsy, gp32, Bsu and Nfo were amplified from genomic DNA (DSMZ, Germany), fused to hexahistidine-tags (N-terminal for uvsY, Bsu and Nfo, C-terminal for uvsX and gp32) and cloned into suitable expression vectors. Overexpression and purification was done by standard protocols using Nickel-NTA resin (Qiagen).
[0121] Human DNA was purified from blood (Wizard-Genomic-purification-kit, Promega), B. subtilis DNA was from ATCC (USA), S. aureus DNAs were a gift from Jodi Lindsay. S. aureus alleles were EMRSA-3 (SCCmec type I; MRSAI), EMRSA-16 (MRSAII), EMRSA-1 (MRSAIII) and wild-type MSSA (12). See supplementary information for sequences.
RPA Conditions
[0122] Reactions were performed at 37 C. for 60 min or as indicated. Standard conditions were 50 mM Tris (pH 8.4), 80 mM Potassium-acetate, 10 mM Magnesium-acetate, 2 mM DTT, 5% Carbowax20M, 200 M dNTPs, 3 mM ATP, 20 mM Phosphocreatine, 100 ng/l Creatine-kinase, 20 ng/l Bsu. In contrast, MRSA amplifications were done at 50 mM Tris (pH 7.9), 100 mM Potassium-acetate, 14 mM Magnesium-acetate; in the multiplex experiment Carbowax20M was at 5.5%. Concentrations of gp32/uxsX/uvsY (in ng/ul) were 600/200/60 (STR experiment), 600/120/30 (B. subtilis experiment) or 900/120/30 (MRSA experiments). Primers were employed at 300 nM each, except in MRSA amplification, where 500 nM sccIII, 100 nM orfX (MRSAIII experiment) or 265 nM sccI/II, 265 nM sccIII, 70 nM orfX (multiplex experiment) or 240 nM BiosccI/II, 240 nM Bio-sccIII, 120 nM orfX (lateral-flow-strip experiment) have been used. Reaction volumes were 20 l, except for the STR experiment (40 l) and the B. subtilis experiment (50 l).
Real-Time Monitoring
[0123] Real-time RPA was performed in a plate-reader (BioTek Flx-800) in the presence of SybrGreen1 (1:50000, Molecular Probes) or fluorophore/quencher probes (Eurogentec). Three probes were employed:
TABLE-US-00006 SATamra1 5-tgttaattgaacaagtgtacagagcatt(T)a(H)ga(q1)tatgcg tggag-Biotin-3 SATamra2 5-tgttaattgagcaagtgtatagagcatt(T)a(H)ga(q2)tatgcg tggag-Biotin-3 BSF1c 5-catgattggatgaataagctgcagc(F)g(H)t(q3)aaaggaaact ta-Biotin-3
[0124] Here (T) is dT-TAMRA, (F) is dT-Fluorescein, (H) is THF, (q1) is dT-BHQ1, (q2) is dT-BHQ2, (q3) is dT-DDQ1. Probes were employed at 60 nM SATamra1 (MRSAIII experiment) or at 45 nM SATamra1, 45 nM SATamra2, 60 nM BSFlc (multiplex experiment). Nfo was used at 200 ng/ul. Excitation/detection was at 485/525 nm (SybrGreen1, BSFlc) or 530/575 nm (SATamra1/2). Measurements were taken every 30 sec or 45 sec (multiplex experiment). Fluorescence probe data were normalised against water control and pre-amplification baseline adjusted. The logarithm of the read-out was plotted against reaction time.
Lateral-Flow-Strip Detection
[0125]
TABLE-US-00007 Forlateral-flow-stripexperimentstwoprobeswere usedat75nMeach: Lfs1 5FAM-ccacatcaaatgatgcgggttgtgttaat(H)gaacaagtgtac agag-ddC-3 Lfs2 5FAM-ccacatcaaatgatgcgggttgtgttaat(H)gagcaagtgtat agag-ddC-3
[0126] 5-biotinylated forms of sccI/II and sccIII were utilised as primers. For each reaction (20 ul) 1 ul was diluted with 5 ul running buffer (PBS/3% Tween) and applied directly to HybriDetect-strips (Milenia) according to manufacturer instructions.
[0127] The result of the lateral flow strip detection is shown in
Example 4 Analysis of Optimal Conditions for RPA
RPA Conditions
[0128] RPA relies on the establishment of a reaction environment that support the formation of recombinase-oligonucleotide complexes. Since the process is also ATPdependent (Formosa et al., 1986), it requires an energy regeneration system for sustained activity. In this experiment, we titrated key components of the RPA reaction mixture in order to determine their influence on amplification performance. The results are shown in
[0129] RPA proved to work robustly over a relatively wide range of reagent concentrations. We found, however, that optimal reaction conditions varied between different primer pairs and therefore had to be defined individually.
Primer Requirements
[0130] We used RPA to amplify of a wide range of targets. While the design of primers revealed no limitations on sequence composition itself, certain parameters have to be met for an oligonucleotide to be suitable for RPA. We investigated these parameters in the experiments shown in
[0131] Shown is polyacrylamide gel electrophoresis of RPA reactions using primers for the three independent loci in human genomic DNA (Apolipoprotein B, STR D18551, Sry). Primers were 25, 28, or >31 bases, as indicated. Reactions were performed at 37 C. for 120 min. Conditions used were 50 mM Tris/Cl pH 8.4, 80 mM Potassium acetate, 10 mM Magnesium-acetate, 2 mM DTT, 3 mM ATP, 200 M dNTPs, 20 mM Phosphocreatine, 100 ng/l Creatine kinase, 5% Carbowax20M, 600 ng/l gp32, 200 ng/l uvsX and 60 ng/l uvsY, and 20 ng/l Bsu polymerase. 3000 copies of target served as template in 30 ul reactions (per sample the equivalent of 10 ul reaction volume was loaded on the gel). The finding that a primer length of >28 bases is required to support RPA is in good agreement with reports that investigated the ATP hydrolysis activity of uvsX-oligonucleotide filaments at different oligonucleotide sizes (See, Huletsky et al., 2004).
[0132] The minimum length of a primer proved to be about 30 nucleotides (
Control DNA
[0133] The wild-type S. aureus DNA (MSSA) (See, Enright et al., 2002; Huletsky et al., 2004) serving as a negative control in the experiment shown in 2C does act as a template for RPA when combined with the primer pair orfX/mssa (
REFERENCES
[0134] Amasino R. M., Acceleration of nucleic acid hybridization rate by polyethylene glycol. Anal Biochem, Volume 152, Issue 2, 304-7, Feb. 1, 1986. [0135] Armes N. A. and Stemple D. L., Recombinase Polymerase Amplification, U.S. patent application Ser. No. 10/371,641. [0136] Benedict R. C. and Kowalczykowski S. C. Increase in the DNA strand assimilation activity of recA protein by removal of the C terminus and structure-function studies of the resulting protein fragment. J. Biol. Chem. 1988 Oct. 25; 263(30):15513-20. [0137] Chan E. W., Dale P. J., Greco I. L., Rose J. G., O'Connor T. E., Biochim Biophys Acta, Volume 606, Issue 2, 353-61, Feb. 29, 1980. [0138] Edwards, A., Hammond, H. A., Jin, L., Caskey, C. T. & Chakraborty, R. Genetic variation at five trimeric and tetrameric tandem repeat loci in four human population groups. Genomics 12, 241-53 (1992). [0139] Eggler A. L., Lusetti S. L., Cox M. M. The C terminus of the Escherichia coli RecA protein modulates the DNA binding competition with single-stranded DNA-binding protein. J. Biol. Chem. 2003 May 2; 278(18):16389-96. [0140] Ellouze C., Takahashi M., Wittung P., Mortensen K., Schnarr M., Norden B. Eur. J. Biochem. 1995 Oct. 15; 233(2):579-83. [0141] Enright, M. C. et al. The evolutionary history of methicillin-resistant Staphylococcus aureus (MRSA). Proc Natl Acad Sci USA 99, 7687-92 (2002). [0142] Formosa T. and Alberts B. M. Purification and characterization of the T4 bacteriophage uvsX protein. J. Biol. Chem. 1986 May 5; 261(13):6107-18. [0143] Giedroc D. P., Gin H. W., Khan R., King G. C., Chen K. Zn(II) coordination domain mutants of T4 gp32 protein. Biochemistry. 1992 Jan. 28; 31(3):765-74. [0144] Giedroc D. P., Keating K. M., Williams K. R., and Coleman J. E. The function of zinc in gene 32 protein from T4. Biochemistry 1987 Aug. 25; 26(17):5251-9. [0145] Hammond, H. A., Jin, L., Zhong, Y., Caskey, C. T. & Chakraborty, R. Evaluation of 13 short tandem repeat loci for use in personal identification applications. Am J Hum Genet 55, 175-89 (1994). [0146] Harris, L. D. & Griffith, J. D. Formation of D loops by the UvsX protein of T4 bacteriophage: a comparison of the reaction catalyzed in the presence or absence of gene 32 protein. Biochemistry 27, 6954-9 (1988). [0147] Harris, L. D. & Griffith, J. D. UvsY protein of bacteriophage T4 is an accessory protein for in vitro catalysis of strand exchange. J Mol Biol 206, 19-27 (1989). [0148] Huletsky, A. et al. New real-time PCR assay for rapid detection of methicillinresistant Staphylococcus aureus directly from specimens containing a mixture of staphylococci. J Clin Microbiol 42, 1875-84 (2004). [0149] Ischenko A A, Saparbaev M K. Alternative nucleotide incision repair pathway for oxidative DNA damage. Nature 2002 Jan. 10; 415(6868):183-7. [0150] Kaiser M W, Lyamicheva N, Ma W, Miller C, Neri B, Fors L, Lyamichev V I. A comparison of eubacterial and archaeal structure-specific 5-exonucleases. J Biol Chem. 1999 Jul. 23; 274(30):21387-94. [0151] Kuil M E, van der Oord C J, Vlaanderen C A, van Haeringen B, van Grondelle R. A refined calculation of the solution dimensions of the complex between gene 32 protein and single stranded DNA based on estimates of the bending persistence length. J Biomol Struct Dyn. 1990 February; 7(4):943-57. [0152] Lavery P. E. and Kowalczykowski S. C., J. Biol. Chem., Vol. 267, Issue 13, 9307-14, May 5, 1992. [0153] Lerman L. S., A transition to a Compact Form of DNA in Polymer Solutions. Proc Natl Acad Sci USA. 1971 April; 68(8):1886-1890. [0154] Levin, J. D., Johnson, A. W. & Demple, B. Homogeneous Escherichia coli endonuclease IV. Characterization of an enzyme that recognizes oxidative damage in DNA. J Biol Chem 263, 8066-71 (1988). [0155] Lusetti S. L., Shaw J. J., Cox M. M. Magnesium ion-dependent activation of the RecA protein involves the C terminus. J. Biol. Chem. 2003 May 2; 278(18):16389-96. [0156] Malkov V. A. and Camerini-Otero R. D. Photocross-links between single-stranded DNA and Escherichia coli RecA protein map to loops L1 (amino acid residues 157-164) and L2 (amino acid residues 195-209). J. Biol. Chem. 1995 Dec. 15, Volume 270, Issue 50, 30230-3. [0157] Minton A. P. The Influence of Macromolecular Crowding and Macromolecular Confinement on Biochemical Reactions in Physiological Media. J. Biol. Chem., Vol. 276, Issue 14, 10577-10580, Apr. 6, 2001. [0158] Morrison, T. B., Weis, J. J. & Wittwer, C. T. Quantification of low-copy transcripts by continuous SYBR Green I monitoring during amplification. Biotechniques 24, 954-8, 960, 962 (1998). [0159] Nadler S. G., Roberts W. J., Shamoo Y., Williams K. R. A novel function for Zinc(II) in a nucleic acid-binding protein. Contribution of Zinc(II) toward the cooperativity of bacteriophage T4 gp32 protein binding. J. Biol. Chem. 1990 Jun. 25; 265(18):10389-94. [0160] Naimushin A. N., Quach M., Fujimoto B. S., Schurr J. M. Effect of polyethylene glycol on the supercoiling free energy of DNA. Biopolymers. 2001, Volume 58, Issue 2, 204-17. [0161] Okazaki, T. & Kornberg, A. Enzymatic Synthesis of Deoxyribonucleic Acid. Xv. Purification and Properties of a Polymerase from Bacillus Subtilis. J Biol Chem 239, 259-68 (1964). [0162] Qiu H. and Giedroc D. P. Effects of substitution of proposed Zn(II) ligand His81 or His64 in phage gp32 protein:spectroscopic evidence for a novel zinc coordination complex. Biochemistry 1994 Jul. 5; 33(26):8139-48. [0163] Rivas G., Ferrone F., Herzfeld J. Life in a crowded worldWorkshop on the Biological Implications of Macromolecular Crowding. EMBO reports 5, 1, 23-27 (2004) doi:10.1038/sj.embor.7400056 Published online: 19 Dec. 2003. [0164] Savva, R. and Pearl, L. H. Cloning and expression of the uracil-DNA glycosylase inhibitor (UGI) from bacteriophage PBS-1 and crystallization of a uracil-DNA glycosylase-UGI complex, Proteins 22 (3), 287-289 (1995). [0165] Scheerhagen M A, Kuil M E, van Grondelle R, Blok J. Hydrodynamic studies of a DNA-protein complex. Dimensions of the complex of single-stranded 145 base DNA with gene 32 protein of phage T4 deduced from quasi-elastic light scattering. FEBS Lett. 1985 May 20; 184(2):221-5. [0166] Shibata, T., Cunningham, R. P., DasGupta, C. & Radding, C. M. Homologous pairing in genetic recombination: complexes of recA protein and DNA. Proc Natl Acad Sci USA 76, 5100-4 (1979). [0167] Story R. M., Bishop D. K., Kleckner N., Steitz, T. A. Structural relationship of bacterial RecA proteins to recombination proteins from bacteriophage T4 and yeast. Science. 1993 Mar. 26, 259(5103):1892-6. [0168] Takeshita, M., Chang, C. N., Johnson, F., Will, S. & Grollman, A. P. Oligodeoxynucleotides containing synthetic abasic sites. Model substrates for DNA polymerases and apurinic/apyrimidinic endonucleases. J Biol Chem 262, 10171-9 (1987). [0169] Voloshin O. N., Wang L., Camerini-Otero R. D. Homologous DNA pairing Promoted by a 20-Amino Acid Peptide Derived from RecA. Science 10 May 1996. Vol 272 Number 5263, pages 868-872. [0170] Voloshin O. N., Wang L., Camerini-Otero R. D. The homologous pairing domain of RecA also mediates the allosteric regulation of DNA binding and ATP hydrolysis: a remarkable concentration of functional residues. J. Mol. Biol. 2000 Nov. 10; 303(5):709-20. [0171] Walker J. E., Saraste M., Runswick M., and Gay N. J. 1982 EMBO J. Volume 1. Pages 945-51. [0172] Wang Z, Mosbaugh D W. Uracil-DNA glycosylase inhibitor of bacteriophage PBS2: cloning and effects of expression of the inhibitor gene in Escherichia coli. J Bacteriol. 1988 March; 170(3):1082-91. [0173] Yang S, VanLoock M S, Yu X, Egelman E H. Comparison of bacteriophage T4 UvsX and human Rad51 filaments suggests that recA-like polymerase may have evolved independently. J Mol Biol. 2001 Oct. 5; 312(5):999-1009. [0174] Yonesaki, T., Ryo, Y., Minagawa, T. & Takahashi, H. Purification and some of the functions of the products of bacteriophage T4 recombination genes, uvsX and uvsY. Eur J Biochem 148, 127-34 (1985). [0175] Zarling, D. A., Sena E. P., Green C. J., U.S. Pat. No. 5,223,414 filed May 7, 1990. [0176] Zimmerman S B and Harrison B. Macromolecular crowding increases binding of DNA polymerase to DNA: an adaptive effect. Proc Natl Acad Sci USA. 1987 April; 84(7):1871-5. [0177] Zinchenko A. A. and Yoshikawa, K. Biophysical Journal. June 2005.