EXPRESSION OF NITROGENASE POLYPEPTIDES IN PLANT CELLS
20200095598 ยท 2020-03-26
Inventors
- Craig Christopher WOOD (Dickson, Australian Capital Territory, AU)
- Robert Silas ALLEN (Downer, Australian Capital Territory, AU)
- Shoko OKADA (Coombs, Austrialian Capital Territory, AU)
- Andrew Charles WARDEN (Ngunnawal, Australian Capital Territory, AU)
- Kimberly Thelma TILBROOK (Coogee, New South Wales, AU)
- Matthew Craig TAYLOR (Chifley, Australian Capital Territory, AU)
Cpc classification
C12N15/8261
CHEMISTRY; METALLURGY
C07K2319/07
CHEMISTRY; METALLURGY
Y02A40/146
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12N9/0095
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to methods and means for producing nitrogenase polypeptides in the mitochondria of plant cells. The present disclosure provides plant cells that express one or more MTP-Nif fusions and/or translational NifD-NifK and NifE-NifN fusions. The present disclosure also provides nucleic acid constructs encoding these fusions as well as expression constructs for expression and targeting of the fusions to the mitochondria of plant cells. The present disclosure also provides transgenic plants comprising the plant cells of the invention and products obtained therefrom.
Claims
1. A plant cell comprising mitochondria and a fusion polypeptide comprising (i) a mitochondrial targeting peptide (MTP) which has a C-terminus, (ii) a NifD polypeptide (ND) which has a N-terminus and a C-terminus, (iii) an oligopeptide linker, and (iv) a NifK polypeptide (NK) which has a N-terminus, wherein the C-terminus of the MTP is translationally fused to the N-terminus of the ND, and wherein the linker is translationally fused to the C-terminus of the ND and the N-terminus of the NK.
2. The plant cell of claim 1, wherein the C-terminus of the fusion polypetide is the C-terminus of the NK, optionally wherein the C-terminus of the NK is a wild-type NifK C-terminus.
3. The plant cell of claim 2 or claim 3, wherein the oligopeptide linker is between 8 and 50 amino acids in length.
4. The plant cell according to any one of claims 1 to 3, wherein the NifD polypeptide and the NifK polypeptide in the fusion polypeptide have the same function as the NifD polypeptide and the NifK polypeptide when present as two separate polypeptides.
5. A plant cell comprising mitochondria and a fusion polypeptide comprising (i) a mitochondrial targeting peptide (MTP) which has a C-terminus, (ii) a NifE polypeptide (NE) which has a N-terminus and a C-terminus, (iii) an oligopeptide linker, and (iv) a NifN polypeptide (NN) which has a N-terminus, wherein the C-terminus of the MTP is translationally fused to the N-terminus of the NE, and wherein the linker is translationally fused to the C-terminus of the NE and the N-terminus of the NN.
6. The plant cell of claim 5, wherein the oligopeptide linker is at least about 20 amino acids, or at least about 30 amino acids, or at least about 40 amino acids, or about 20 amino acids to about 70 amino acids, or about 30 amino acids to about 70 amino acids, or about 30 amino acids to about 60 amino acids, or about 30 amino acids to about 50 amino acids, or about 25 amino acids, or about 30 amino acids, or about 35 amino acids, or about 40 amino acids, or about 45 amino acids, or about 46 amino acids, or about 50 amino acids, or about 55 amino acids, in length.
7. The plant cell of claim 5 or claim 6, wherein the NifE polypeptide and the NifN polypeptide in the fusion polypeptide have the same function as the NifE polypeptide and the NifN polypeptide when present as two separate polypeptides, preferably having the same function as a wild-type NifE polypeptide and a wild-type NifN polypeptide, respectively.
8. The plant cell according to any one of claims 1 to 7, wherein the MTP comprises a protease cleavage site for matrix processing protease (MPP) such that the fusion polypeptide is capable of being cleaved by MPP to produce a N-terminal cleavage peptide and a processed fusion polypeptide (CF) comprising (ii) to (iv).
9. The plant cell of claim 8, wherein CF comprises some, but not all, of the C-terminal amino acids of the MTP, preferably 5 to 45 amino acids of the C-terminal amino acids of the MTP.
10. The plant cell according to any one of claims 1 to 9, wherein the MTP comprises about 51 amino acids of a F1-ATPase -subunit MTP.
11. The plant cell according to any one of claims 1 to 10, further comprising one or more NF fusion polypeptides (NF), each NF comprising (i) a mitochondrial targeting peptide (MTP) which has a C-terminus and (ii) a Nif polypeptide (NP) which has a N-terminus, wherein the C-terminus of the MTP is translationally fused to the N-terminus of the NP, wherein each MTP is independently the same or different and each NP is independently the same or different, and wherein the mitochondria comprise the one or more NFs and/or a processed product thereof (CF), and wherein each CF, if present, is produced by cleavage of the corresponding NF within its MTP.
12. The plant cell of claim 11, wherein at least one of the NF polypeptides is NifH.
13. The plant cell according to any one of claims 1 to 12, wherein the mitochondria comprise one, at least two, at least three, at least four, or all Nif polypeptides selected from the group consisting of (i) NifD, NifH, NifK, NifB, NifE and NifN, or (ii) NifD, NifH, NifK and NifS.
14. The plant cell according to any one of claims 1 to 13, wherein the MTP comprises at least 10 amino acids, preferably between 10 and 80 amino acids.
15. The plant cell according to any one of claims 1 to 14, wherein at least one, or more, or all of the MTPs comprise an MTP of a mitochondrial protein precursor, or a variant thereof, preferably a plant MTP.
16. The plant cell according to any one of claims 1 to 15, wherein an exogenous polynucleotide(s) encoding the fusion polypetide(s) is integrated into the nuclear genome of the cell.
17. The plant cell of any one of claims 1 to 16, wherein the cell is a cell other than an Arabidopsis thaliana protoplast.
18. A transgenic plant comprising cells according to any one of claims 1 to 17, wherein the transgenic plant is transgenic for one or more exogenous polynucleotide(s) encoding the fusion polypetide(s).
19. The transgenic plant of claim 18, wherein one, or more, or all of the exogenous polynucleotides are expressed in roots of the plant, preferably expressed at a greater level in the roots of the plant than in leaves of the plant.
20. The transgenic plant of claim 18 or claim 19, which is a cereal plant such as wheat, rice, maize, triticale, oat, or barley, preferably wheat.
21. The transgenic plant according to any one of claims 18 to 20 which is homozygous or heterozygous for the exogenous polynucleotide(s).
22. The transgenic plant according to any one of claims 19 to 21 which is growing in a field.
23. A population of at least 100 plants according to any one of claims 18 to 22 growing in a field.
24. A fusion polypeptide comprising (i) a mitochondrial targeting peptide (MTP) which has a C-terminus, (ii) a NifD polypeptide (ND) which has a N-terminus and a C-terminus, (iii) an oligopeptide linker, and (ii) a NifK polypeptide (NK) which has a N-terminus, wherein the C-terminus of the MTP is translationally fused to the N-terminus of the ND, and wherein the linker is translationally fused to the C-terminus of the ND and the N-terminus of the NK.
25. The fusion polypeptide of claim 24, wherein the C-terminus of the fusion polypeptide is the C-terminus of the NK, optionally wherein the C terminus of the NK is a wild-type NifK C terminus.
26. A fusion polypeptide comprising (i) a mitochondrial targeting peptide (MTP) which has a C-terminus, (ii) a NifE polypeptide (NE) which has a N-terminus and a C-terminus, (iii) an oligopeptide linker, and (iv) a NifN polypeptide (NN) which has a N-terminus, wherein the C-terminus of the MTP is translationally fused to the N-terminus of the NE, and wherein the linker is translationally fused to the C-terminus of the NE and the N-terminus of the NN.
27. The fusion polypeptide of claim 26, wherein the oligopeptide linker is about 46 amino acids in length.
28. The fusion polypeptide(s) according to any one of claims 24 to 27, wherein the fusion polypeptide(s) is capable of being cleaved by matrix processing protease (MPP) to produce one or more processed Nif polypeptide products comprising (ii) to (iv).
29. The fusion polypeptide(s) according to any one of claims 24 to 28, which is present in a plant cell or a bacterial cell, preferably in a mitochondrion of a plant cell.
30. A processed Nif polypeptide which was produced from the fusion polypeptide(s) according to any one of claims 24 to 29 by cleavage within the MTP of the fusion polypeptide(s).
31. The processed Nif polypeptide of claim 30 which was produced by cleavage of the fusion polypeptide by MPP in the mitochondrial matrix of a plant cell.
32. The processed Nif polypeptide of claim 30 or claim 31 which is present in a plant cell or a bacterial cell, preferably in a plant mitochondrion, more preferably in the mitochondrial matrix (MM) of a plant cell mitochondrion.
33. The fusion polypeptide(s) according to any one of claims 24 to 29, or the processed Nif polypeptide according to any one of claims 30 to 32, which has the same biochemical activity as a corresponding wild-type Nif polypeptide, preferably having about the same level of biochemical activity as the corresponding wild-type Nif polypeptide, optionally as determined in a bacterial cell.
34. A polynucleotide encoding one, or more, of the fusion polypeptides according to any one of claims 24 to 29.
35. The polynucleotide of claim 34, wherein the polynucleotide has been codon-modified for expression in a plant cell, relative to a naturally-occurring polynucleotide which encodes the corresponding Nif protein in a bacterium.
36. The polynucleotide of claim 34 or claim 35 further comprising a promoter operably linked to the polynucleotide.
37. The polynucleotide according to any one of claims 34 to 36 which is present in a plant cell or a bacterial cell, preferably integrated into the nuclear genome of the plant cell.
38. A chimeric vector comprising or encoding the polynucleotide according to any one of claims 34 to 37.
39. A method of producing the transgenic plant according to any one of claims 18 to 22, the method comprising the steps of i) introducing the polynucleotide according to any one of claims 34 to 37, and/or the vector according to any one of claim 38, into a cell of a plant, ii) regenerating a transgenic plant from the cell, and iii) optionally harvesting seed from the plant, and/or iv) optionally producing one or more progeny plants from the transgenic plant, thereby producing the transgenic plant.
40. A plant part of the plant according to any one of claims 18 to 22.
41. The plant part of claim 40 which is a seed that comprises the polynucleotide according to any one of claims 34 to 37.
42. A method of producing flour, wholemeal, starch, oil, seedmeal or other product obtained from seed, the method comprising; a) obtaining seed of claim 41, and b) extracting the flour, wholemeal, starch, oil or other product, or producing the seedmeal.
43. A product produced from the plant according to any one of claims 18 to 22 and/or the plant part of claim 40 or claim 41.
44. A method of preparing a food product, the method comprising mixing seed of claim 41, or flour, wholemeal, or starch from the seed, with another food ingredient.
Description
BRIEF DESCRIPTION OF THE ACCOMPANYING DRAWINGS
[0180]
[0181]
[0182]
[0183]
[0184]
[0185]
[0186]
[0187]
[0188]
[0189]
[0190]
[0191]
[0192]
[0193]
[0194]
[0195]
[0196]
[0197]
[0198]
KEY TO THE SEQUENCE LISTING
[0199] SEQ ID NO:1Amino acid sequence of the native MTP of the cytochrome-c oxidase subunit IV (CoxIV MTP).
[0200] SEQ ID NO:2Amino acid sequence of the derivative MTP of the cytochrome-c oxidase subunit IV (dCoxIV).
[0201] SEQ ID NO:3Conserved arginine and serine residues in the motif xRxxxSSx of dCoxIV involved in import and processing of the MTP.
[0202] SEQ ID NO:4Nucleotide sequence of the T-DNA region of pCW440 with components T-DNA right border (nucleotides 1-164), 35S promoter (nucleotides 219-1564) flanked by a HindIII site and an XhoI site, CTCGAG (XhoI), T7 promoter (nucleotides 1571-1587), dCoxIV-encoding sequence (nucleotides 1650-1742) starting with an ATG, AscI site (nucleotides 1743 to 1750), T7 terminator (nucleotides 1810-1856), nos 3 terminator (nucleotides 1861-2084) and T-DNA left border (nucleotides 2186 to 2346).
[0203] SEQ ID NO:5Amino acid sequence of wild-type K. pneumoniae NifH.
[0204] SEQ ID NO:6Amino acid sequence of wild-type K. pneumoniae NifD.
[0205] SEQ ID NO:7Amino acid sequence of wild-type K. pneumoniae NifK.
[0206] SEQ ID NO:8Amino acid sequence of wild-type K. pneumoniae NifY.
[0207] SEQ ID NO:9Amino acid sequence of wild-type K. pneumoniae NifB.
[0208] SEQ ID NO:10Amino acid sequence of wild-type K. pneumoniae NifE.
[0209] SEQ ID NO:11Amino acid sequence of wild-type K. pneumoniae NifN.
[0210] SEQ ID NO:12Amino acid sequence of wild-type K. pneumoniae NifQ.
[0211] SEQ ID NO:13Amino acid sequence of wild-type K. pneumoniae NifS.
[0212] SEQ ID NO:13Amino acid sequence of wild-type K. pneumoniae NifS.
[0213] SEQ ID NO:14Amino acid sequence of wild-type K. pneumoniae NifU.
[0214] SEQ ID NO:15Amino acid sequence of wild-type K. pneumoniae NifX.
[0215] SEQ ID NO:16Amino acid sequence of wild-type K. pneumoniae NifF.
[0216] SEQ ID NO:17Amino acid sequence of wild-type K. pneumoniae NifZ.
[0217] SEQ ID NO:18Amino acid sequence of wild-type K. pneumoniae NifM.
[0218] SEQ ID NO:19Amino acid sequence of wild-type K. pneumoniae NifM.
[0219] SEQ ID NO:20Amino acid sequence of wild-type K. pneumoniae NifV.
[0220] SEQ ID NO:21Amino acid sequence of C-terminal extension (17aa) including the HA epitope (amino acids 7-15).
[0221] SEQ ID NO:22Amino acid sequence of C-terminal extension (12aa) including the FLAG epitope.
[0222] SEQ ID NO:23Amino acid sequence of the dCoxIV::NifH::HA fusion polypeptide encoded by pCW446. Amino acids 1-31 correspond to the dCoxIV MTP, amino acids 32-34 were the result of cloning at the AscI site, amino acids 35-326 were the K. pneumoniae NifH amino acids (with start codon Met removed), and amino acids 327-343 include the HA epitope.
[0223] SEQ ID NO:24Amino acid sequence of the dCoxIV::NifD::FLAG fusion polypeptide encoded by pCW447. Amino acids 1-31 correspond to the dCoxIV MTP, amino acids 32-34 were the result of cloning at the AscI site, amino acids 35-515 were the K. pneumoniae NifD amino acids (with two N-terminal Met residues removed), and amino acids 516-527 include the FLAG epitope.
[0224] SEQ ID NO:25Amino acid sequence of the dCoxIV::NifK::HA fusion polypeptide encoded by pCW448. Amino acids 1-31 correspond to the dCoxIV MTP, amino acids 32-34 were the result of cloning at the AscI site, amino acids 35-553 were the K. pneumoniae NifK amino acids, and amino acids 554-570 include the HA epitope.
[0225] SEQ ID NO:26Amino acid sequence of the dCoxIV::NifY::HA fusion polypeptide encoded by pCW449. Amino acids 1-31 correspond to the dCoxIV MTP, amino acids 32-34 were the result of cloning at the AscI site, amino acids 35-253 were the K. pneumoniae NifY amino acids (without start codon Met), and amino acids 254-270 include the HA epitope.
[0226] SEQ ID NO:27Nucleotide sequence of the AscI fragment encoding NifH::HA, AscI-NifH-HA-AscI.
[0227] SEQ ID NO:28Nucleotide sequence of the AscI fragment encoding NifD::FLAG, AscI-NifD-FLAG-AscI.
[0228] SEQ ID NO:29Nucleotide sequence of the AscI fragment encoding NifK::HA, AscI-NifK-HA-AscI.
[0229] SEQ ID NO:30Nucleotide sequence of the AscI fragment encoding NifY::HA, AscI-NifY-HA-AscI.
[0230] SEQ ID NO:31Amino acid sequence of the dCoxIV::NifB::HA fusion polypeptide encoded by pCW452. Amino acids 1-31 correspond to the dCoxIV MTP, amino acids 32-34 were the result of cloning at the AscI site, amino acids 35-501 were the K. pneumoniae NifB amino acids (without start codon Met), and amino acids 502-518 include the HA epitope.
[0231] SEQ ID NO:32Amino acid sequence of the dCoxIV::NifE::HA fusion polypeptide encoded by pCW454. Amino acids 1-31 correspond to the dCoxIV MTP, amino acids 32-34 were the result of cloning at the AscI site, amino acids 35-490 were the K. pneumoniae NifE amino acids (without start codon Met), and amino acids 491-507 include the HA epitope.
[0232] SEQ ID NO:33Amino acid sequence of the dCoxIV::NifN::FLAG fusion polypeptide encoded by pCW455. Amino acids 1-31 correspond to the dCoxIV MTP, amino acids 32-34 were the result of cloning at the AscI site, amino acids 35-493 were the K. pneumoniae NifN amino acids (without start codon Met), and amino acids 494-505 include the FLAG epitope.
[0233] SEQ ID NO:34Amino acid sequence of the dCoxIV::NifQ::HA fusion polypeptide encoded by pCW456. Amino acids 1-31 correspond to the dCoxIV MTP, amino acids 32-34 were the result of cloning at the AscI site, amino acids 35-200 were Klebsiella sp. NifQ amino acids (without start codon Met), and amino acids 201-217 include the HA epitope.
[0234] SEQ ID NO:35Amino acid sequence of the dCoxIV::NifS::HA fusion polypeptide encoded by pCW450. Amino acids 1-31 correspond to the dCoxIV MTP, amino acids 32-34 were the result of cloning at the AscI site, amino acids 35-433 were the K. pneumoniae NifS amino acids (without start codon Met), and amino acids 434-450 include the HA epitope.
[0235] SEQ ID NO:36Amino acid sequence of the dCoxIV::NifU::FLAG fusion polypeptide encoded by pCW451. Amino acids 1-31 correspond to the dCoxIV MTP, amino acids 32-34 were the result of cloning at the AscI site, amino acids 35-493 were the K. pneumoniae NifU amino acids (without start codon Met), and amino acids 494-505 include the FLAG epitope.
[0236] SEQ ID NO:37Amino acid sequence of the dCoxIV::NifX::FLAG fusion polypeptide encoded by pCW453. Amino acids 1-31 correspond to the dCoxIV MTP, amino acids 32-34 were the result of cloning at the AscI site, amino acids 35-189 were the K. pneumoniae NifX amino acids (without start codon Met), and amino acids 190-201 include the FLAG epitope.
[0237] SEQ ID NO:38Amino acid sequence of the N-terminal extension comprising the pFA MTP (amino acids 1-77) and the amino acid triplet GAP (78-80) added as a consequence of the cloning strategy into pRA00. Cleavage by MPP occurs between amino acid residues 42 and 43.
[0238] SEQ ID NO:39Amino acid sequence of the modified N-terminal extension, encoded in the vector pRA21, comprising the mFA sequence (amino acids 1-77) and the amino acid triplet GAP (78-80) added as a consequence of the cloning strategy into pRA21. The alanine amino acid substitutions at amino acids 12-18, 24-33 and 39-45 relative to SEQ ID NO:38 were designed to abolish cleavage by MPP.
[0239] SEQ ID NO:40Amino acid sequence of the pFA::NifF::HA fusion polypeptide encoded by pRA05. Amino acids 1-77 correspond to the pFA MTP, amino acids 78-80 (GAP) were the result of cloning K. pneumoniae NifX at the AscI site, amino acids 81-256 were the K. pneumoniae NifF amino acids (SEQ ID NO:16) and amino acids 257-267 include the HA epitope.
[0240] SEQ ID NO:41Amino acid sequence of the pFA::NifZ::FLAG fusion polypeptide encoded by pRA04. Amino acids 1-77 correspond to the pFA MTP, amino acids 78-80 (GAP) were the result of cloning at the AscI site, amino acids 81-228 were the K. pneumoniae NifZ amino acids (SEQ ID NO:17) and amino acids 229-238 include the FLAG epitope.
[0241] SEQ ID NO:42Amino acid sequence of the pFA::NifH::HA fusion polypeptide encoded by pRA10. Amino acids 1-77 correspond to the pFA MTP, amino acids 78-80 (GAP) were the result of cloning at the AscI site, amino acids 81-372 were the K. pneumoniae NifH amino acids (SEQ ID NO:5 without the initiator Met) and amino acids 373-389 include the HA epitope.
[0242] SEQ ID NO:43Amino acid sequence of a tryptic peptide from pFA, unprocessed.
[0243] SEQ ID NO:44Amino acid sequence of a tryptic peptide from pFA, after processing by MPP.
[0244] SEQ ID NO:45Amino acid sequence of a tryptic peptide from pFA, after processing by MPP.
[0245] SEQ ID NO:46Amino acid sequence of the pFA::NifB::HA fusion polypeptide encoded by pRA03. Amino acids 1-77 correspond to the pFA MTP, amino acids 78-80 (GAP) were the result of cloning at the AscI site, amino acids 81-547 were the K. pneumoniae NifB amino acids (SEQ ID NO:9 without the initiator Met) and amino acids 548-564 include the HA epitope.
[0246] SEQ ID NO:47Amino acid sequence of the pFA::NifD::FLAG fusion polypeptide encoded by pRA07. Amino acids 1-77 correspond to the pFA MTP, amino acids 78-80 (GAP) were the result of cloning at the AscI site, amino acids 81-561 were the K. pneumoniae NifD amino acids (SEQ ID NO:6 without the initiator Met and following Met) and amino acids 562-573 include the FLAG epitope.
[0247] SEQ ID NO:48Amino acid sequence of the pFA::NifE::HA fusion polypeptide encoded by pRA09. Amino acids 1-77 correspond to the pFA MTP, amino acids 78-80 (GAP) were the result of cloning at the AscI site, amino acids 81-536 were the K. pneumoniae NifE amino acids (SEQ ID NO:10 without the initiator Met) and amino acids 537-553 include the HA epitope.
[0248] SEQ ID NO:49Amino acid sequence of the pFA::NifJ::FLAG fusion polypeptide encoded by pRA06. Amino acids 1-77 correspond to the pFA MTP, amino acids 78-80 (GAP) were the result of cloning at the AscI site, amino acids 81-1251 were the K. pneumoniae NifJ amino acids (SEQ ID NO:18) and amino acids 1252-1261 include the FLAG epitope.
[0249] SEQ ID NO:50Amino acid sequence of the pFA::NifK::HA fusion polypeptide encoded by pRA11. Amino acids 1-77 correspond to the pFA MTP, amino acids 78-80 (GAP) were the result of cloning at the AscI site, amino acids 81-599 were the K. pneumoniae NifK amino acids (SEQ ID NO:7 without the initiator Met) and amino acids 600-616 include the HA epitope.
[0250] SEQ ID NO:51Amino acid sequence of the pFA::NifM::HA fusion polypeptide encoded by pRA18. Amino acids 1-77 correspond to the pFA MTP, amino acids 78-80 (GAP) were the result of cloning at the AscI site, amino acids 81-346 were the K. pneumoniae NifM amino acids (SEQ ID NO:19) and amino acids 347-357 include the HA epitope.
[0251] SEQ ID NO:52Amino acid sequence of the pFA::NifN::FLAG fusion polypeptide encoded by pRA13. Amino acids 1-77 correspond to the pFA MTP, amino acids 78-80 (GAP) were the result of cloning at the AscI site, amino acids 81-539 were the K. pneumoniae NifN amino acids (SEQ ID NO:11 without the initiator Met) and amino acids 540-551 include the FLAG epitope.
[0252] SEQ ID NO:53Amino acid sequence of the pFA::NifQ::HA fusion polypeptide encoded by pRA08. Amino acids 1-77 correspond to the pFA MTP, amino acids 78-80 (GAP) were the result of cloning at the AscI site, amino acids 81-246 were the K. pneumoniae NifQ amino acids (SEQ ID NO:12 without the initiator Met) and amino acids 247-263 include the HA epitope.
[0253] SEQ ID NO:54Amino acid sequence of the pFA::NifS::HA fusion polypeptide encoded by pRA16. Amino acids 1-77 correspond to the pFA MTP, amino acids 78-80 (GAP) were the result of cloning at the AscI site, amino acids 81-478 were the K. pneumoniae NifS amino acids (SEQ ID NO:13 without the initiator Met) and amino acids 479-496 include the HA epitope.
[0254] SEQ ID NO:55Amino acid sequence of the pFA::NifU::FLAG fusion polypeptide encoded by pRA15. Amino acids 1-77 correspond to the pFA MTP, amino acids 78-80 (GAP) were the result of cloning at the AscI site, amino acids 81-353 were the K. pneumoniae NifU amino acids (SEQ ID NO:14 without the initiator Met) and amino acids 354-365 include the FLAG epitope.
[0255] SEQ ID NO:56Amino acid sequence of the pFA::NifV::FLAG fusion polypeptide encoded by pRA17. Amino acids 1-77 correspond to the pFA MTP, amino acids 78-80 (GAP) were the result of cloning at the AscI site, amino acids 81-461 were the K. pneumoniae NifV amino acids (SEQ ID NO:20) and amino acids 462-471 include the FLAG epitope.
[0256] SEQ ID NO:57Amino acid sequence of the pFA::NifX::FLAG fusion polypeptide encoded by pRA14. Amino acids 1-77 correspond to the pFA MTP, amino acids 78-80 (GAP) were the result of cloning at the AscI site, amino acids 81-235 were the K. pneumoniae NifX amino acids (SEQ ID NO:15 without initiator Met) and amino acids 236-247 include the FLAG epitope.
[0257] SEQ ID NO:58Amino acid sequence of the pFA::NifY::HA fusion polypeptide encoded by pRA12. Amino acids 1-77 correspond to the pFA MTP, amino acids 78-80 (GAP) were the result of cloning at the AscI site, amino acids 81-299 were the K. pneumoniae NifY amino acids (SEQ ID NO:8 without the initiator Met) and amino acids 300-316 include the HA epitope.
[0258] SEQ ID NO:59Amino acid sequence of the pFA::NifD::HA fusion polypeptide encoded by pRA19. Amino acids 1-77 correspond to the pFA MTP, amino acids 78-80 (GAP) were the result of cloning at the AscI site, amino acids 81-561 were the K. pneumoniae NifD amino acids (SEQ ID NO:6 without the initiator Met and following Met) and amino acids 562-574 include the HA epitope.
[0259] SEQ ID NO:60Amino acid sequence of the pFA::NifK fusion polypeptide (pRA25), lacking any C-terminal extension. Amino acids 1-77 correspond to the pFA MTP, amino acids 78-80 (GAP) were the result of cloning at the AscI site, amino acids 81-599 were the K. pneumoniae NifK amino acids (SEQ ID NO:7 without the initiator Met).
[0260] SEQ ID NO:61Amino acid sequence of an 11-residue section from a known unstructured linker region from Hypocrea jecorina cellobiohydrolase II (Accession no. AAG39980.1).
[0261] SEQ ID NO:62Amino acid sequence of an 8-residue FLAG epitope.
[0262] SEQ ID NO:63Amino acid sequence of linker. The linker is 30 residues in length and consists of an 11-residue section from a known unstructured linker region from Hypocrea jecorina cellobiohydrolase II (Accession no. AAG39980.1, ATPPPGSTTTR; SEQ ID NO:61) with the final arginine replaced by an alanine, then an 8-residue FLAG epitope (DYKDDDDK; SEQ ID NO:62) followed finally by another copy of the 11-residue unstructured linker sequence with the arginine replaced by an alanine.
[0263] SEQ ID NO:64Amino acid sequence of the pFA::NifD-linker-NifK fusion polypeptide (pRA02), lacking any C-terminal extension for NifK. Amino acids 1-77 correspond to the pFA MTP, amino acids 78-80 (GAP) were the result of cloning at the AscI site, amino acids 81-561 were the K. pneumoniae NifD amino acids (SEQ ID NO:6 without the initiator Met and following Met), amino acids 562-592 were the 30 amino acid linker, and amino acids 593-1110 were the K. pneumoniae NifK amino acids (SEQ ID NO:7 without the initiator Met).
[0264] SEQ ID NO:65Amino acid sequence of the pFA::NifD-linker-NifK::HA fusion polypeptide (pRA20), lacking any C-terminal extension for NifK. Amino acids 1-77 correspond to the pFA MTP, amino acids 78-80 (GAP) were the result of cloning at the AscI site, amino acids 81-561 were the K. pneumoniae NifD amino acids (SEQ ID NO:6 without the initiator Met and following Met), amino acids 562-592 were the 30 amino acid linker, amino acids 593-1110 were the K. pneumoniae NifK amino acids (SEQ ID NO:7 without the initiator Met) and amino acids 1111-1119 include the HA epitope.
[0265] SEQ ID NO:66Amino acid sequence of C-terminal extension including the MYC epitope, corresponding to amino acids 347-356 of SEQ ID NO:67.
[0266] SEQ ID NO:67Amino acid sequence of the pFA::NifM::MYC fusion polypeptide.
[0267] SEQ ID NO:68Nucleotide sequence coding for the pFA::NifD::HA fusion polypeptide in pRA19, starting at the translation start codon.
[0268] SEQ ID NO:69Amino acid sequence of the last four amino acid residues at the C-terminus of the NifK polypeptide from K. pneumoniae.
[0269] SEQ ID NO:70. Nucleotide sequence of the DNA fragment encoding the pFA-C polypeptide.
[0270] SEQ ID NO:71. Amino acid sequence of the pFA-C polypeptide.
[0271] SEQ ID NO:72. Oligonucleotide primer NifD-F.
[0272] SEQ ID NO:73. Oligonucleotide primer NifD-R.
[0273] SEQ ID NO:74. Amino acid sequence of wild-type K. pneumoniae NifW.
[0274] SEQ ID NO:75. Amino acid sequence of the MTP-FA.sup.51 polypeptide.
[0275] SEQ ID NO:76. Amino acid sequence of the FA-scar.sup.9 polypeptide.
[0276] SEQ ID NO:77. Amino acid sequence of the CPN60 MTP.
[0277] SEQ ID NO:78. Amino acid sequence of the CPN60/No GGlinker MTP.
[0278] SEQ ID NO:79. Amino acid sequence of the Superoxide dismutase (SOD) MTP (At3G10920).
[0279] SEQ ID NO:80. Amino acid sequence of the Superoxide dismutase doubled(2SOD) MTP (At3G10920).
[0280] SEQ ID NO:81. Amino acid sequence of the Superoxide dismutase modified(SODmod) MTP (At3g10920).
[0281] SEQ ID NO:82. Amino acid sequence of the Superoxide dismutase modified (2SODmod) doubled MTP (At3g10920).
[0282] SEQ ID NO:83. Amino acid sequence of the L29 MTP (At1G07830).
[0283] SEQ ID NO:84. Amino acid sequence of the Neurospora crassa F0 ATPase subunit 9 (SU9) MTP.
[0284] SEQ ID NO:85. Amino acid sequence of the gATPase gamma subunit (FA51) MTP.
[0285] SEQ ID NO:86. Amino acid sequence of the CoxIV twin strep (ABM97483) MTP.
[0286] SEQ ID NO:87. Amino acid sequence of the CoxIV 10His (ABM97483) MTP.
[0287] SEQ ID NO:88. Amino acid sequence of the predicted scar for the Superoxide dismutase (SOD) MTP (SEQ ID NO:80).
[0288] SEQ ID NO:89. Amino acid sequence of the predicted scar for Superoxide dismutase doubled(2SOD) MTP (SEQ ID NO:81).
[0289] SEQ ID NO:90. Amino acid sequence of the predicted scar for the L29 MTP (SEQ ID NO:84).
[0290] SEQ ID NO:91. Amino acid sequence of the predicted scar for the Neurospora crassa F0 ATPase subunit 9 (SU9) MTP (SEQ ID NO:85).
[0291] SEQ ID NO:92. Amino acid sequence of the predicted scar for the gATPase gamma subunit (FA51) MTP (SEQ ID NO:86).
[0292] SEQ ID NO:93. Amino acid sequence of the predicted scar for the CoxIV twin strep MTP (SEQ ID NO:87).
[0293] SEQ ID NO:94. Amino acid sequence of the predicted scar for the CoxIV 10His MTP (SEQ ID NO:88).
[0294] SEQ ID NO:95. Amino acid sequence of variant NifD.
[0295] SEQ ID NO:96. Amino acid sequence of variant NifS.
[0296] SEQ ID NO:97. NifK 9 amino acid C-terminal extension.
[0297] SEQ ID NO:98. Oligonucleotide primer.
[0298] SEQ ID NO:99. Oligonucleotide primer.
[0299] SEQ ID NO:100. Oligonucleotide primer.
[0300] SEQ ID NO:101. Oligonucleotide primer.
[0301] SEQ ID NO:102. Oligonucleotide primer BO1.
[0302] SEQ ID NO: 103. Oligonucleotide primer BO2.
[0303] SEQ ID NO:104. Amino acid sequence of linker.
[0304] SEQ ID NO: 105. Oligonucleotide primer pRA31DK-FW.
[0305] SEQ ID NO: 106. Oligonucleotide primer pRA31DK-RV.
[0306] SEQ ID NO:107. Oligonucleotide primer D_start_RV.
[0307] SEQ ID NO:108. Oligonucleotide primer K_end_FW.
[0308] SEQ ID NO:109. Oligonucleotide primer.
[0309] SEQ ID NO:110. Oligonucleotide primer.
[0310] SEQ ID NO:111. NifD-linker-NifK polypeptide 9 amino acid sequence N-terminal extension SEQ ID NO:112. Amino acid sequence of HA epitope.
[0311] SEQ ID NO:113. Amino acid sequence of NifE-NifN HA polypeptide linker.
[0312] SEQ ID NO:114. Oligonucleotide primer pRAEN-FW. SEQ ID NO:115.
[0313] Oligonucleotide primer pRAEN-RV.
[0314] SEQ ID NO:116. Oligonucleotide primer E_start_RV.
[0315] SEQ ID NO:117. Oligonucleotide primer N_end_FW.
[0316] SEQ ID NO:118. Oligonucleotide primer.
[0317] SEQ ID NO:119. Oligonucleotide primer.
[0318] SEQ ID NO:120. Nucleotide sequence of the SCSV-S4 version 1 promoter.
[0319] SEQ ID NO:121. Nucleotide sequence of the SCSV-S4 version 2 promoter.
[0320] SEQ ID NO:122. Nucleotide sequence of the SCSV-S7 promoter.
[0321] SEQ ID NO:123. Nucleotide sequence of the CaMV-35S long version promoter.
[0322] SEQ ID NO: 124. Nucleotide sequence of the CaMV-225S promoter.
[0323] SEQ ID NO:125. Amino acid sequence of P19 viral suppressor protein.
[0324] SEQ ID NO:126. Amino acid sequence of P19 peptide.
[0325] SEQ ID NO:127. Amino acid sequence P19 peptide.
[0326] SEQ ID NO:128-143. Amino acid sequence of NifK peptides.
[0327] SEQ ID NO:144-154. Amino acid sequence of NifK peptides.
[0328] SEQ ID NO:155-160. Amino acid sequence of NifB peptides.
[0329] SEQ ID NO:161-165. Amino acid sequence of NifJ peptides.
[0330] SEQ ID NO:166-174. Amino acid sequence of NifS peptides.
[0331] SEQ ID NO:175-182. Amino acid sequence of NifX peptides.
[0332] SEQ ID NO:183-186. Amino acid sequence of NifF peptides.
DETAILED DESCRIPTION OF THE INVENTION
General Techniques and Definitions
[0333] Unless specifically defined otherwise, all technical and scientific terms used herein shall be taken to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in cell culture, molecular genetics, plant molecular biology, protein chemistry, and biochemistry).
[0334] Unless otherwise indicated, the recombinant protein, cell culture, and immunological techniques utilized in the present invention are standard procedures, well known to those skilled in the art. Such techniques are described and explained throughout the literature in sources such as, J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989), T. A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D. M. Glover and B. D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and F. M. Ausubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates until present), Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory, (1988), and J. E. Coligan et al. (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates until present).
[0335] The term and/or, e.g., X and/or Y shall be understood to mean either X and Y or X or Y and shall be taken to provide explicit support for both meanings or for either meaning.
[0336] Throughout this specification the word comprise, or variations such as comprises or comprising, will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.
[0337] Nitrogenase is the enzyme in eubacteria and archaeobacteria that catalyses the reduction of the strong, triple bond of nitrogen (N.sub.2) to produce ammonia (NH.sub.3). Nitrogenase is found naturally only in bacteria. It is a complex of two enzymes that can be purified separately, namely dinitrogenase and dinitrogenase reductase. Dinitrogenase, also referred to as component I or the molybdenum-iron (MoFe) protein, is a tetramer of two NifD and two NifK polypeptides (.sub.2.sub.2) that also contains two P-clusters and two FeMo-cofactors (FeMoCo). Each pair of NifD-NifK subunits contains one P-cluster and one FeMoCo. FeMoCo is a metallocluster composed of a MoFe.sub.3S.sub.3 cluster complexed with a homocitrate molecule, which is coordinated to the molybdenum atom, and bridged to a Fe.sub.4S.sub.3 cluster by three sulfur ligands. FeMoCo is assembled separately in cells and is then incorporated into apo-MoFe protein. The P-cluster is also a metallocluster and contains 8 Fe atoms and 7 sulfur atoms with a structure similar but different to FeMoCo. The P-clusters are located at the subunit interface of dinitrogenase and are coordinated by cysteinyl residues from both subunits. Dinitrogenase reductase, also referred to as component II or the Fe protein is a dimer of NifH polypeptides which also contains a single Fe.sub.4S.sub.4 cluster at the subunit interface and two Mg-ATP binding sites, one at each subunit. This enzyme is the obligatory electron donor to the dinitrogenase, where the electrons are transferred from the Fe.sub.4S.sub.4 cluster to the P-cluster and in turn to the FeMoCo, the site for N.sub.2 reduction.
[0338] Although the Mo-containing nitrogenase is the most commonly found nitrogenase in bacteria, there are two homologous nitrogenases that are genetically distinct but have similar cofactor and subunit compositions, namely the vanadium-containing nitrogenase and the Fe-only nitrogenase, encoded by the Vnf (vanadium nitrogen fixation) and Anf (alternative nitrogen fixation) genes, respectively. Some bacteria in nature possess all three types of nitrogenases, other bacteria contain only the Mo- and V-containing enzymes or only the Mo-containing enzyme, for example, Klebsiella pneumoniae.
[0339] A variety of nitrogen fixation (Nif) genes are required for the biosynthesis of FeMoCo and maturation of the nitrogenase components to their catalytically active forms. Roles for the NifB, NifE, NifH, NifN, NifQ, NifV and NifX polypeptides in FeMoCo synthesis have been described (Rubio and Ludden, 2005).
[0340] Biological N.sub.2 fixation, catalyzed by the prokaryotic enzyme nitrogenase, is an alternative to the use of synthetic N.sub.2 fertilizers. The sensitivity of nitrogenase to oxygen is a major barrier to engineering biological nitrogen fixation into plants, for example, into cereal crops, by direct Nif gene transfer.
[0341] The present inventors considered that targeting Nif polypeptides to the mitochondrial matrix (MM) of plant cells might overcome the oxygen sensitivity problem. The MM possesses oxygen consuming enzymes that allow other enzymes that contain an oxygen sensitive FeS cluster to function. The mitochondrial FeS cluster assembly machinery is similar to diazotrophic equivalents (Balk and Pilon, 2011; Lill and Miihlenhoff, 2008). Therefore some of the requisites for nitrogenase biosynthesis may already be in place in the MM, reducing the number of Nif genes required for reconstitution. The cofactor homocitrate is produced as part of the TCA cycle. There is also a high reducing potential and concentration of ATP (Geigenberger and Fernie, 2014; Mackenzie and McIntosh, 1999), both prerequisites for nitrogenase enzyme catalysis. Additionally the presence of glutamate synthase in mitochondria provides an entry point for any ammonium fixed by nitrogenase to enter plant metabolism. Given these characteristics, and the fact that mitochondria themselves are of -proteobacterial origin, the present inventors considered that this organelle was well suited as a location for attempting functional reconstitution of nitrogenase.
[0342] As a first step towards reconstitution of nitrogenase in plant cell mitochondria, evidence was needed that individual Nif proteins can be correctly targeted to the MM. For this purpose, the inventors chose the model plant Nicotiana benthamiana as an expression platform (Wood et al., 2009) to provide for expression of transgenes either singly or, more importantly, in combinations. As most MM-located proteins are nuclear-encoded, the present inventors relied upon recent advances in understanding the subcellular signalling and transport process (Huang et al., 2009; Murcha et al., 2014), using a previously characterised N-terminal peptide targeting signal (Lee et al., 2012).
[0343] The model bacterial diazotroph Klebsiella pneumoniae uses 16 unique proteins for the biosynthesis and catalytic function of nitrogenase. The present inventors re-engineered all 16 Nif proteins from the K. pneumoniae for targeting to the plant MM and assessed their expression and processing in N. benthamiana leaves. All 16 Nif polypeptides were transiently expressed and tested for sequence specific MM processing. The present inventors have established that all of the 16 Nif polypeptides can be individually expressed as MTP:Nif fusion polypeptides in plant leaf cells. Furthermore, the present inventors provide evidence that these proteins can be targeted to the mitochondrial matrix (MM), a subcellular location potentially accommodating for nitrogenase function and can be cleaved by mitochondrial processing protease (MPP). This is the first practical demonstration of the feasibility of such an approach, and represents important progress towards the aim of engineering endogenous nitrogen fixation in plants.
Mitochondrial Targeting Peptide (MTP)-Nif Fusion Polypeptides
[0344] The present invention relates to mitochondrial targeting peptide (MTP)-Nif fusion polypeptides and their cleaved polypeptide products. When an MTP-Nif fusion polypeptide of the invention is expressed in a plant cell, either the MTP-Nif fusion polypeptide and/or the cleaved polypeptide product is targeted to the mitochondrial matrix (MM). Preferably, the fusion polypeptides confer nitrogenase reductase and/or nitrogenase activity to the plant cell, or an activity which is the same as that conferred by a corresponding wild-type Nif polypeptide in bacteria.
[0345] As used herein, the term fusion polypeptide means a polypeptide which comprises two or more functional polypeptide domains which are covalently joined by a peptide bond. Typically, the fusion polypeptide is encoded as a single polypeptide chain by a chimeric polynucleotide of the invention. In an embodiment, fusion polypeptides of the invention comprise a mitochondrial targeting peptide (MTP) and a Nif polypeptide (NP). In this embodiment, the C-terminus of the MTP is translationally fused to the N-terminus of the NP. In an alternative embodiment, fusion polypeptides of the invention comprise a C-terminal part of an MTP and a NP, where the C-terminal part results from cleavage of the MTP by MPP. In this embodiment, the C-terminus of the C-terminal part of the MTP is translationally fused to the N-terminus of the NP.
[0346] As used herein, the term translationally fused to the N-terminus means that the C-terminus of the MTP polypeptide is covalently joined by a peptide bond to the N-terminal amino acid of a NP, thereby being a fusion polypeptide. In an embodiment, the NP does not comprise its native translation start methionine (Met) residue or its two N-terminal Met residues relative to a corresponding wild-type NP. In an alternative embodiment, the NP comprises the translation start Met or one or both of the two N-terminal Met residues of the wild-type NP polypeptide such as, for example, for NifD.
[0347] Such polypeptides are typically produced by expression of a chimeric protein coding region where the translational reading frame of the nucleotides encoding the MTP are joined in-frame with the reading frame of the nucelotides encoding the NP. The skilled person will appreciate that the C-terminus of the MTP can be translationally fused to the N-terminal amino acid of the NP without a linker or via a linker of one or more amino acid residues, for example of 1-5 amino acid residues. Such a linker can also be considered to be part of the MTP. Expression of the protein coding region may be followed by cleavage of the MTP in the MM of a plant cell, and such cleavage (if it occurs) is included in the concept of production of the fusion polypeptide of the invention.
[0348] The fusion polypeptide or the processed Nif polypeptide preferably has functional Nif activity which is comparable to that of the corresponding wild-type Nif polypeptide. The functional activity of the fusion polypeptide or the processed Nif polypeptide may be determined in bacterial and biochemical complementaton assays. In a preferred embodiment, the fusion polypeptide or the processed Nif polypeptide has between about 70-100% of the activity of the wild type Nif activity.
[0349] The fusion polypeptide may comprise more than one MTP and/or more than one NP, for example, the fusion polypeptide may comprise a MTP, a NifD polypeptide and a NifK polypeptide. The fusion polypeptide may also comprise an oligopeptide linker, for example, linking two NPs. Preferably, the linker is of sufficient length to allow the two or more functional domains, for example, two NPs such as NifD and NifK, to associate in a functional configuration in a plant cell. Such a linker may be between 8 and 50 amino acid residues in length, preferably about 25-35 amino acids in length, more preferably about 30 amino acid residues in length. A fusion polypeptide may be obtained by conventional means, e.g., by means of gene expression of the polynucleotide sequence encoding for said fusion polypeptide in a suitable cell.
[0350] As used herein, a substantially purified polypeptide means a polypeptide which is substantially free from components (e.g., lipids, nucleic acids, carbohydrates) that normally associate with the polypeptide, for example, in a cell. Preferably, the substantially purified polypeptide is at least 90% free from said components.
[0351] Plant cells, transgenic plants and parts thereof of the invention comprise a polynucleotide encoding a polypeptide of the invention. Polypeptides of the invention are not naturally occurring in plant cells, in particular not in the mitochondria of plant cells, and therefore the polynucleotide encoding the polypeptide may be referred to herein as an exogenous polynucleotide since it is not naturally occurring in a plant cell but has been introduced into the plant cell or a progenitor cell. The cells, plants and plant parts of the invention which produce a polypeptide of the invention can therefore be said to produce a recombinant polypeptide. The term recombinant in the context of a polypeptide refers to the polypeptide encoded by an exogenous polynucleotide when produced by a cell, which polynucleotide has been introduced into the cell or a progenitor cell by recombinant DNA or RNA techniques such as, for example, transformation. Typically, the plant cell, plant or plant part comprises a non-endogenous gene that causes an amount of the polypeptide to be produced, at least at some time in the life-cycle of the plant cell or plant.
[0352] In an embodiment, a polypeptide of the invention is not a naturally occurring polypeptide. In an alternative embodiment, the polypeptide of the invention is naturally occurring but is present in a plant cell, preferably in a mitochondrion of a plant cell, in which it does not naturally occur.
Nif Polypeptide
[0353] As used herein, the terms Nif polypeptide and Nif protein are used interchangeably and mean a polypeptide which is related in amino acid sequence to naturally occurring polypeptides involved in nitrogenase activity, where the Nif polypeptide of the invention is selected from the group consisting of a NifD polypeptide, a NifH polypeptide, a NifK polypeptide, a NifB polypeptide, a NifE polypeptide, a NifN polypeptide, a NifF polypeptide, a NifJ polypeptide, a NifM polypeptide, a NifQ polypeptide, a NifS polypeptide, a NifU polypeptide, a NifV polypeptide, a NifW polypeptide, a NifX polypeptide, a NifY polypeptide and a NifZ polypeptide, each of which as defined herein. Nif polypeptides of the invention include Nif fusion polypeptides which, as used herein, means a polypeptide homolog of a naturally occurring Nif polypeptide that has additional amino acid residues joined to the N-terminus or C-terminus, or both, relative to a corresponding naturally occurring Nif polypeptide. As mentioned above, the Nif fusion polypeptide may be lacking the translation initiation Met or the two N-terminal Met residues realtive to a corresponding wild-type Nif polypeptide. The amino acid residues of a Nif fusion polypeptide that correspond to the naturally occurring Nif polypeptide, i.e., without the additional amino acid residues joined to the N-terminus or C-terminus or both, are also referred to herein as a Nif polypeptide, abbreviated in this case to NP, or as a NifD) polypeptide (ND) etc. In a preferred embodiment, the additional amino acid residues joined to the N-terminus or C-terminus or both comprise a mitochondrial targeting peptide (MTP) or a processed MTP joined to the N-terminus of the NP, or an epitope sequence (tag) which is N-terminal or C-terminal to the NP or both, or both an MTP or processed MTP and an epitope sequence.
[0354] Naturally occurring Nif polypeptides occur only in some bacteria including the nitrogen-fixing bacteria, including free living nitrogen fixing bacteria, associative nitrogen fixing bacteria and symbiotic nitrogen fixing bacteria. Free living nitrogen fixing bacteria are capable of fixing significant levels of nitrogen without the direct interaction with other organisms. Without limitation, said free living nitrogen fixing bacteria include the members of the genera Azotobacter, Beijerinckia, Klebsiella, Cyanobacteria (classified as aerobic organisms) and the members of the genera Clostridium, Desulfovibrio and the named purple sulphur bacteria, purple non-sulphur bacteria and green sulphur bacteria. Associative nitrogen fixing bacteria are those prokaryotic organisms that are able to form close associations with several members of the Poaceae (grasses). These bacteria fix appreciable amounts of nitrogen within the rhizosphere of the host plants. Members of the genera Azospirillum are representative of associative nitrogen fixing bacteria. Symbiotic nitrogen fixation bacteria are those bacteria which fix nitrogen symbiotically by partnering with a host plant. The plant provides sugars from photosynthesis that are utilized by the nitrogen fixing bacteria for the energy it needs for nitrogen fixation. Members of the genera Rhizobia are representative of associative nitrogen fixing bacteria.
[0355] The Nif polypeptide or Nif fusion polypeptide of the invention is selected from the group consisting of NifH, NifD, NifK, NifB, NifE, NifN, NifF, NifJ, NifM, NifQ, NifS, NifU, NifV, NifW, NifX, NifY and NifZ polypeptides.
[0356] A polypeptide or class of polypeptides may be defined by the extent of identity (% identity) of its amino acid sequence to a reference amino acid sequence, or by having a greater % identity to one reference amino acid sequence than to another. A polypeptide or class of polypeptides may also be defined by having the same biological activity as a naturally occurring Nif polypeptide, in addition to the extent of identity in sequence.
[0357] The % identity of a polypeptide is determined by GAP (Needleman and Wunsch, 1970) analysis (GCG program) with a gap creation penalty=5, and a gap extension penalty=0.3, or by Blastp version 2.5 or updated versions thereof (Altschul et al, 1997), where in each case the analysis aligns two sequences including a reference sequence over the entire length of the reference sequence. As used herein, reference sequences include those provided for naturally occurring Nif polypeptides from K. pneumoniae, SEQ ID NOs: 1-20.
[0358] In the following definitions, the extent of identity of an amino acid sequence to a reference sequence provided as a SEQ ID NO is determined by Blastp, version 2.5 or updated versions thereof (Altschul et al, 1997), using the default parameters except for the maximum number of target sequences which is set at 10,000, and is determined along the full length of the reference amino acid sequence.
[0359] A NifH polypeptide in naturally occurring bacteria is a structural component of nitrogenase complex and is often termed the iron (Fe) protein. It forms a homodimer, with a Fe.sub.4S.sub.4 cluster bound between the subunits and two ATP-binding domains. NifH is the obligate electron donor to the MoFe protein (NifD/NifK heterotetramer) and therefore functions as the nitrogenase reductase (EC 1.18.6.1). NifH is also involved in FeMoCo biosynthesis and apo-MoFe protein maturation. As used herein, a NifH polypeptide means a polypeptide comprising amino acids whose sequence is at least 41% identical to the amino acid sequence provided as SEQ ID NO:5 and which comprises one or more of the domains TIGR01287, PRK13236, PRK13233 and cd02040. The TIGR01287 domain is present in each of molybdenum-iron nitrogenase reductase (NifH), vanadium-iron nitrogenase reductase (VnfH), and iron-iron nitrogenase reductase (AnfH) but excludes the homologous protein from the light-independent protochlorophyllide reductase. As used herein, NifH polypeptides therefore include the subclass of iron-binding polypeptides which comprise amino acids whose sequence is at least 41% identical to SEQ ID NO:5, the VnfH iron-binding polypeptides and the AnfH iron-binding polypeptides. A naturally occurring NifH polypeptide typically has a length of between 260 and 300 amino acids and the natural monomer has a molecular weight of about 30 kDa. A great number of NifH polypeptides have been identified and numerous sequences are available in publically available databases. For example, NifH polypeptides have been reported from Klebsiella michiganensis (Accession No. WP_049123239.1, 99% identical to SEQ ID NO:5), Brenneria goodwinii (WP_048638817.1, 93% identical), Sideroxydans lithotrophicus (WP_013029017.1, 84% identical), Denitrovibrio acetiphilus (WP_013010353.1, 80% identical), Desulfovibrio africanus (WP_014258951.1, 72% identical), Chlorobium phaeobacteroides (WP_011744626.1, 69% identical), Methanosaeta concilii (WP_013718497.1, 64% identical), Rhodobacter (WP_009565928.1, 61% identical), Methanocaldococcus infernus (WP_013099472.1, 42% identical) and Desulfosporosinus youngiae (WP_007781874.1, 41% identical). NifH polypeptides have been described and reviewed in Thiel et al., (1997), Pratte et al., (2006), Boison et al., (2006) and Staples et al., (2007).
[0360] As used herein, a functional NifH polypeptide is a NifH polypeptide which is capable of forming a functional nitrogenase protein complex together with the other required subunits, for example, NifD and NifK, and the FeMo or other cofactor.
[0361] As used herein, a NifD polypeptide means a polypeptide comprising amino acids whose sequence is at least 33% identical to the amino acid sequence provided as SEQ ID NO:6 and which comprises (i) one or both of the domains TIGR01282 and COG2710, both of which are found in the iron-molybdenum binding polypeptides including the polypeptide having the amino acid sequence shown in SEQ ID NO:6, or (ii) the iron-vanadium binding domain TIGR01860 in which case the NifD polypeptide is in the subclass of VnfD polypeptides, or (iii) the iron-iron binding domain TIGR1861 in which case the NifD polypeptide is in the subclass of AnfD polypeptides.
[0362] As used herein, NifD polypeptides include the subclass of iron-molybdenum (FeMoCo) binding polypeptides comprising amino acids whose sequence is at least 33% identical to SEQ ID NO:6, the VnfD iron-vanadium polypeptides and the AnfD polypeptides. A naturally occurring NifD polypeptide typically has a length of between 470 and 540 amino acids. A great number of NifD polypeptides have been identified and numerous sequences are available in publically available databases. For example, NifD polypeptides have been reported from Raoultella ornithinolytica (Accession No. WP_044347161.1, 96% identical to SEQ ID NO:6), Kluyvera intermedia (WP_047370273.1, 93% identical), Dickeya dadantii (WP_038902190.1, 89% identical), Tolumonas sp. BRL6-1 (WP_024872642.1, 81% identical), Magnetospirillum gryphiswaldense (WP_024078601.1, 68% identical), Thermoanaerobacterium thermosaccharolyticum (WP_013298320.1, 42% identical), Methanothermobacter thermautotrophicus (WP_010877172.1, 38% identical), Desulfovibrio africanus (WP_014258953.1, 37% identical), Desulfotomaculum sp. LMal (WP_066665786.1, 37% identical), Desulfomicrobium baculatum (WP_015773055.1, 36% identical), the VnfD polypeptide of Fischerella muscicola (WP_016867598.1, 34% identical) and the AnfD polypeptide from Opitutaceae bacterium TAV5 (WP 009512873.1, 33% identical). NifD polypeptides have been described and reviewed in Lawson and Smith (2002), Kim and Rees (1994), Eady (1996), Robson et al., (1989), Dilworth et al., (1988), Dilworth et al., (1993), Miller and Eady (1988), Chiu et al., (2001), Mayer et al., (1999), and Tezcan et al., (2005).
[0363] NifD polypeptides of the iron-molybdenum subclass are a key subunit of nitrogenase complexes, being the a subunit of the .sub.2.sub.2 MoFe protein complex at the core of nitrogenase, and the site of substrate reduction with the FeMo cofactor. As used herein, a functional NifD polypeptide is a NifD polypeptide which is capable of forming a functional nitrogenase protein complex together with the other required subunits, for example, NifH and NifK, and the FeMo or other cofactor.
[0364] As used herein, a NifK polypeptide means a polypeptide comprising amino acids whose sequence is at least 31% identical to the amino acid sequence provided as SEQ ID NO:7 and which comprises one or more of the conserved domains cd01974, TIGR01286, or cd01973 in which case the NifK polypeptide is in the subclass of VnfK polypeptides. As used herein, NifK polypeptides include the VnfK polypeptides from iron-vanadium nitrogenase. A naturally occurring NifK polypeptide typically has a length of between 430 and 530 amino acids. A great number of NifK polypeptides have been identified and numerous sequences are available in publically available databases. For example, NifK polypeptides have been reported from Klebsiella michiganensis (Accession No. WP_049080161.1, 99% identical to SEQ ID NO:7), Raoultella ornithinolytica (WP_044347163.1, 96% identical), Klebsiella variicola (SBM87811.1, 94% identical), Kluyvera intermedia (WP 047370272.1, 89% identical), Rahnella aquatilis (WP_014333919.1, 82% identical), Tolunmonas auensis (WP_012728880.1, 75% identical), Pseudomonas stutzeri (WP_011912506.1, 68% identical), Vibrio natriegens (WP 065303473.1, 65% identical), Azoarcus toluclasticus (WP_018989051.1, 54% identical), Frankia sp., (prf112106319A, 50% identical) and Methanosarcina acetivorans (WP_011021239.1, 31% identical). There are some examples of polypeptides in databases annotated as NifK which have less than 31% identity to SEQ ID NO:7 but do not contain any of the domains listed above and are therefore not included as NifK polypeptides herein. NifK polypeptides have been described and reviewed in Kim and Rees (1994), Eady (1996), Robson et al., (1989), Dilworth et al., (1988), Dilworth et al., (1993), Miller and Eady (1988), Igarashi and Seefeldt (2003), Fani et al., (2000) and Rubio and Ludden (2005).
[0365] NifK polypeptides of the iron-molybdenum subclass are a key subunit of nitrogenase complexes, being the B subunit of the .sub.2.sub.2 MoFe protein complex at the core of nitrogenase. As used herein, a functional NifK polypeptide is a NifK polypeptide which is capable of forming a functional nitrogenase protein complex together with the other required subunits, for example, NifD and NifH, and the FeMo or other cofactor. In a preferred embodiment, when aligned with the amino acid sequence SEQ ID NO:7, the amino acid sequence of the NifK polypeptide of the invention has at its C-terminus the amino acids DLVR (residues 517-520 of SEQ ID NO:7), the arginine being the C-terminal amino acid. That is, the NifK polypeptide and the NifK fusion polypeptide of the invention preferably has the same C-terminus as the native NifK polypeptides, i.e., it does not have an artificial addition to the C-terminus. Such preferred NifK polypeptides are better able to form a functional nitrogenase complex with NifD and NifH polypeptides, as shown in the Examples.
[0366] A NifB polypeptide in naturally occurring bacteria is a protein which is involved in FeMoCo synthesis, converting [4Fe-4S] clusters into NifB-co, an FeS cluster of higher nuclearity with a central C atom that serves as a precursor of FeMoCo (Guo et al., 2016). NifB therefore catalyses the first committed step in the FeMoCo synthesis pathway. The NifB-co product of NifB is able to bind to the NifE-NifN complex and can be shuttled from NifB to NifE-NifN by the metallocluster carrier protein NifX.
[0367] As used herein, a NifB polypeptide means a polypeptide whose amino acid sequence comprises amino acids whose sequence is at least 27% identical to the amino acid sequence provided as SEQ ID NO:9. Most NifB polypeptides comprise one or more of the conserved domain TIGR01290, the NifB conserved domain cd00852, the NifX-NifB superfamily conserved domain c100252 and the Radical_SAM conserved domain cd01335. As used herein, NifB polypeptides include naturally occurring polypeptides which have been annotated as having NifB function but which do not have one of these domains. A naturally occurring NifB polypeptide typically has a length of between 440 and 500 amino acids and the natural monomer has a molecular weight of about 50 kDa. A great number of NifB polypeptides have been identified and numerous sequences are available in publically available databases. For example, NifB polypeptides have been reported from Raoultella ornithinolytica (Accession No. WP_041145602.1, 91% identical to SEQ ID NO:9), Kosakonia radicincitans (WP_043953592.1, 80% identical), Dickeya chrysanthemi (WP 040003311.1, 76% identical), Pectobacterium atrosepticum (WP_011094468.1, 70% identical), Brenneria goodwinii (WP 048638849.1, 63% identical), Halorhodospira halophila (WP_011813098.1, 59% identical), Methanosarcina barkeri (WP 048108879.1, 50% identical), Clostridium purinilyticum (WP_050355163.1, 40% identical), Geofilum rubicundum (GA028552.1, 35% identical) and Desulfovibrio salexigens (WP_015850328.1, 27% identical). As used herein, a functional NifB polypeptide is a NifB polypeptide which is capable of forming NifB-co from [4Fe-4S] clusters. NifB polypeptides have been described and reviewed in Curatti et al., (2006) and Allen et al., (1995).
[0368] The NifEN complex is a scaffold complex that is required for the correct assembly of dinitrogenase and is also structurally similar to the dinitrogenase (Fay et al., 2016). The NifEN complex is comprised of 2 subunits of each of NifE and NifN, respectively, forming a heterotetramer, here termed EN.sub.2.sub.2. A NifE polypeptide in naturally occurring bacteria is a polypeptide which is the a subunit of the EN.sub.2.sub.2 tetramer with the NifN polypeptide, and this EN.sub.2.sub.2 tetramer is required for FeMoCo synthesis and is proposed to function as a scaffold on which FeMoCo is synthesized.
[0369] As used herein, a NifE polypeptide means a polypeptide comprising amino acids whose sequence is at least 32% identical to the amino acid sequence provided as SEQ ID NO:10 and which comprises one or both of the domains TIGR01283 and PRK14478. Members of TIGR01283 domain protein family are also members of the superfamily c102775. A naturally occurring NifE polypeptide typically has a length of between 440 and 490 amino acids and the natural monomer has a molecular weight of about 50 kDa. A great number of NifE polypeptides have been identified and numerous sequences are available in publically available databases. For example, NifE polypeptides have been reported from Klebsiella michiganensis (Accession No. WP_049114606.1, 99% identical to SEQ ID NO:10), Klebsiella variicola (SBM87755.1, 92% identical), Dickeya paradisiaca (WP_012764127.1, 89% identical), Tolumonas auensis (WP_012728883.1, 75% identical), Pseudomonas stutzeri (WP_003297989.1, 69% identical), Azotobacter vinelandii (WP_012698965.1, 62% identical), Trichormus azollae (WP_013190624.1, 55% identical), Paenibacillus durus (WP_025698318.1, 50% identical), Sulfuricurvum kujiense (WP_013460149.1, 44% identical), Methanobacterium formicicum (AIS31022.1, 39% identical), Anaeromusa acidaminophila (WP_018701501.1, 35% identical) and Megasphaera cerevisiae (WP_048514099.1, 32% identical). As used herein, a functional NifE polypeptide is a NifE polypeptide which is capable of forming a functional tetramer together with NifN such that the complex is capable of synthesizing FeMoCo. NifE polypeptides have been described and reviewed in Fay et al., (2016), Hu et al., (2005), Hu et al., (2006) and Hu et al., (2008).
[0370] A NifF polypeptide in naturally occurring bacteria is a flavodoxin which is an electron donor to NifH. As used herein, a NifF polypeptide means a polypeptide comprising amino acids whose sequence is at least 34% identical to the amino acid sequence provided as SEQ ID NO:16 and which comprises one or both of the flavodoxin long domain domain TIGR01752 and the flavodoxin FLDA domain found on Nif proteins from Azobacter and other bacterial genera PRK09267. NifF polypeptides encompass flavodoxins associated with pyruvate formate-lyase activation and cobalamin-dependent methionine synthase activity in non-nitrogen fixing bacteria but exclude other flavodoxins involved in broader functions. A naturally occurring NifF polypeptide typically has a length of between 160 and 200 amino acids and the natural monomer has a molecular weight of about 19 kDa. A great number of NifF polypeptides have been identified and numerous sequences are available in publically available databases. For example, NifF polypeptides have been reported from Klebsiella michiganensis (Accession No. WP_004122417.1, 99% identical to SEQ ID NO:16), Klebsiella variicola (WP_040968713.1, 85% identical), Kosakonia radicincitans (WP_035885760.1, 76% identical), Dickeya chrysanthemi (WP_039999438.1, 72% identical), Brenneria goodwinii (WP_048638838.1, 62% identical), Methylomonas methanica (WP_064006977.1, 56% identical), Azotobacter vinelandii (WP_012698862.1, 50% identical), Chlorobaculum tepidum (WP_010933399.1, 39% identical), Campylobacter showae (WP 002949173.1, 37% identical) and Azotobacter chromococcum (WP_039801725.1, 34% identical). As used herein, a functional NifF polypeptide is a NifF polypeptide which is capable of being an electron donor to a NifH polypeptide. NifF polypeptides have been described and reviewed in Drummond (1985).
[0371] A NifJ polypeptide in naturally occurring bacteria is a pyruvate:flavodoxin (ferredoxin) oxidoreductase which is an electron donor to NifH. As used herein, a NifJ polypeptide means a polypeptide comprising amino acids whose sequence is at least 40% identical to the amino acid sequence provided as SEQ ID NO:18 and which comprises the conserved domain TIGR02176. A naturally occurring NifJ polypeptide typically has a length of between 1100 and 1200 amino acids and the natural monomer has a molecular weight of about 128 kDa. A great number of Nif polypeptides have been identified and numerous sequences are available in publically available databases. For example, NifJ polypeptides have been reported from Klebsiella michiganensis (Accession No. WP_024360006.1, 99% identical to SEQ DI NO:18), Raoultella ornithinolytica (WP_044347157.1, 95% identical), Klebsiella quasipneumoniae (WP_050533844.1, 92% identical), Kosakonia oryzae (WP_064566543.1, 82% identical), Dickeya solani (WP_057084649.1, 78% identical), Rahnella aquatilis (WP_014683040.1, 72% identical), Thermoanaerobacter mathranii (WP_013149847.1, 64% identical), Clostridium botulinum (WP_053341220.1, 60% identical), Spirochaeta africana (WP_014454638.1, 52% identical) and Vibrio cholerae (CSA83023.1, 40% identical). As used herein, a functional NifJ polypeptide is a NifJ polypeptide which is capable of being an electron donor to a NifH polypeptide. NifJ polypeptides have been described and reviewed in Schmitz et al., (2001).
[0372] A NifM polypeptide in naturally occurring bacteria is a polypeptide required for maturation of NifH. In the absence of NifM, NifH was present at only low levels in E. coli and yeast when expressed heterologously and was not able to donate electrons to NifD-NifK. As used herein, a NifM polypeptide means a polypeptide comprising amino acids whose sequence is at least 26% identical to the amino acid sequence provided as SEQ ID NO:19 and which comprises the domain TIGR02933. NifM polypeptides are homologous to peptidyl-prolyl cis-trans isomerases and appear to be accessory proteins for NifH. A naturally occurring NifM polypeptide typically has a length of between 240 and 300 amino acids and the natural monomer has a molecular weight of about 30 kDa. A great number of NifM polypeptides have been identified and numerous sequences are available in publically available databases. For example, NifM polypeptides have been reported from Klebsiella oxytoca (Accession No. WP_064342940.1, 99% identical to SEQ ID NO:19), Klebsiella michiganensis (WP_004122413.1, 97% identical), Raoultella ornithinolytica (WP 044347181.1, 85% identical), Klebsiella variicola (WP_063105800.1, 75% identical), Kosakonia radicincitans (WP_035885759.1, 59% identical), Pectobacterium atrosepticum (WP_011094472.1, 42% identical), Brenneria goodwinii (WP_048638837.1, 33% identical), Pseudomonas aeruginosa PAO1 (CAA75544.1, 28% identical), Marinobacterium sp. AK27 (WP_051692859.1, 27% identical) and Teredinibacter turnerae (WP_018415157.1, 26% identical). As used herein, a functional NifM polypeptide is a NifM polypeptide which is capable of complexing with a NifH polypeptide for maturation of the NifH polypeptide. NifM polypeptides have been described and reviewed in Petrova et al., (2000).
[0373] A NifN polypeptide in naturally occurring bacteria is the 0 subunit of the EN.sub.2.sub.2 tetramer with the NifE polypeptide, and the EN.sub.2.sub.2 tetramer is required for FeMoCo synthesis and is proposed to function as a scaffold on which FeMoCo is synthesized. As used herein, a NifN polypeptide means (i) a polypeptide comprising amino acids whose sequence is at least 76% identical to the sequence provided as SEQ ID NO:11 and/or (ii) a polypeptide comprising amino acids whose sequence is at least 34% identical to the sequence provided as SEQ ID NO:11 and which comprises one or more of the conserved domains TIGR01285, cd01966 and PRK14476. NifN is related in structure to the molybdenum-iron protein chain NifK. Polypeptides comprising the conserved TIGR01285 covers most examples of NifN polypeptides but excludes some NifN polypeptides, such as the putative NifN of Chlorobium tepidum, and therefore the definition of NifN is not limited to polypeptides comprising the conserved TIGR01285 domain. Members of PRK14476 domain protein family are also members of the superfamily c102775. A naturally occurring NifN polypeptide typically has a length of between 410 and 470 amino acids, although when fused naturally to NifB it may have about 900 amino acid residues, and the natural monomer has a molecular weight of about 50 kDa. A great number of NifN polypeptides have been identified and numerous sequences are available in publically available databases. For example, NifN polypeptides have been reported from Klebsiella oxytoca (Accession No. WP_064391778.1, 97% identical to SEQ ID NO:11), Kluyvera intermedia (WP_047370268.1, 80% identical), Rahnella aquatilis (WP_014683026.1, 70% identical), Brenneria goodwinii (WP_048638830.1, 65% identical), Methylobacter tundripaludum (WP_027147663.1, 46% identical), Calothrix parietina (WP_015195966.1, 41% identical), Zymomonas mobilis (WP_023593609.1, 37% identical), Paenibacillus massiliensis (WP_025677480.1, 35% identical) and Desulfitobacterium hafniense (WP_018306265.1, 34% identical). As used herein, a functional NifN polypeptide is a NifN polypeptide which is capable of forming a functional tetramer together with NifE such that the complex is capable of synthesizing FeMoCo. NifN polypeptides have been described and reviewed in Fay et al., (2016), Brigle et al., (1987), Fani et al., (2000), and Hu et al., (2005).
[0374] A NifQ polypeptide in naturally occurring bacteria is a polypeptide involved in FeMoCo synthesis, probably in early MoO.sub.4.sup.2- processing. The conserved C-terminal cysteine residues may be involved in metal binding. As used herein, a NifQ polypeptide means a polypeptide comprising amino acids whose sequence is at least 34% identical to the amino acid sequence provided as SEQ ID NO:12 and which is a member of the CL04826 domain protein family and a member of the pfam04891 domain protein family. A naturally occurring NifQ polypeptide typically has a length of between 160 and 250 amino acids, although they may be as long as 350 amino acid residues, and the natural monomer has a molecular weight of about 20 kDa. A great number of NifQ polypeptides have been identified and numerous sequences are available in publically available databases. For example, NifQ polypeptides have been reported from Klebsiella oxytoca (Accession No. WP_064391765.1, 95% identical to SEQ ID NO:12), Klebsiella variicola (CTQ06350.1, 75% identical), Kluyvera intermedia (WP_047370257.1, 63% identical), Pectobacterium atrosepticum (WP_043878077.1, 59% identical), Mesorhizobium metallidurans (WP 008878174.1, 46% identical), Rhodopseudomonas palustris (WP_011501504.1, 42% identical), Paraburkholderia sprentiae (WP_027196569.1, 41% identical), Burkholderia stabilis (GAU06296.1, 39% identical) and Cupriavidus oxalaticus (WP_063239464.1, 34% identical). As used herein, a functional NifQ polypeptide is a NifQ polypeptide which is capable of processing MoO.sub.4.sup.2-. NifQ polypeptides have been described and reviewed in Allen et al., (1995) and Siddavattam et al., (1993).
[0375] A NifS polypeptide in naturally occurring bacteria is a cysteine desulfurase involved in iron-sulfur (FeS) cluster biosynthesis e.g. which is involved in mobilisation of sulfur for FeS cluster synthesis and repair. As used herein, a NifS polypeptide means (i) a polypeptide comprising amino acids whose sequence is at least 90% identical to the amino acid sequence provided as SEQ ID NO:13 and/or (ii) a polypeptide comprising amino acids whose sequence is at least 36% identical to the sequence provided as SEQ ID NO:13 and which comprises one or both of the conserved domains TIGR03402 and COG1104. The TIGR03402 domain protein family includes a clade nearly always found in extended nitrogen fixation systems plus a second clade more closely related to the first than to IscS and also part of NifS-like/NifU-like systems. The TIGR03402 domain protein family does not extend to a more distant clade found in the epsilon proteobacteria such as Helicobacter pylori, also named NifS in the literature, built instead in TIGR03403. The COG1104 domain protein family includes cysteine sulfinate desulfinase/cysteine desulfurase or related enzymes. Some NifS polypeptides include the asparate aminotransferase domain c118945. A naturally occurring NifS polypeptide typically has a length of between 370 and 440 amino acids and the natural monomer has a molecular weight of about 43 kDa. A great number of NifS polypeptides have been identified and numerous sequences are available in publically available databases. For example, NifS polypeptides have been reported from Klebsiella michiganensis (Accession No. WP_004138780.1, 99% identical to SEQ ID NO:13), Raoultella terrigena (WP_045858151.1, 89% identical), Kluyvera intermedia (WP_047370265.1, 80% identical), Rahnella aquatilis (WP_014333911.1, 73% identical), Agarivorans gilvus (WP_055731597.1, 64% identical), Azospirillum brasilense (WP_014239770.1, 60% identical), Desulfosarcina cetonica (WP_054691765.1, 55% identical), Clostridium intestinale (WP_021802294.1, 47% identical), Clostridiisalibacter paucivorans (WP_026894054.1, 36% identical) and Bacillus coagulans (WP_061575621.1, 42% identical and which is in COG1104). As used herein, a functional NifS polypeptide is a NifS polypeptide which is capable of functioning in iron-sulfur (FeS) cluster biosynthesis and/or repair. NifS polypeptides have been described and reviewed in Clausen et al., (2000), Johnson et al., (2005), Olson et al., (2000) and Yuvaniyama et al., (2000).
[0376] A NifU polypeptide in naturally occurring bacteria is a molecular scaffold polypeptide involved in iron-sulfur (FeS) cluster biosynthesis for nitrogenase components. As used herein, a NifU polypeptide means a polypeptide comprising amino acids whose sequence is at least 31% identical to the sequence provided as SEQ ID NO:14 and which comprises the domain TIGR02000. Members of the TIGR02000 domain protein family are specificlly involved in nitrogenase maturation. NifU comprises an N-terminal domain (pfam01592) and a C-terminal domain (pfam01106). Three different but partially homologous FeS cluster assembly systems have been described: Isc, Suf, and Nif. The Nif system, of which NifU is a part, is associated with donation of an FeS cluster to nitrogenase in a number of nitrogen-fixing species. Isc and Suf homologs with an equivalent domain architecture from Helicobacter and Campylobacter are excluded from the definition of NifU herein. NifU, therefore, is specific for NifJU polypeptides involved in nitrogenase maturation. Members of the related TIGR01999 domain protein family which are IscU proteins (from for example, Escherichia. coli and Saccharomyces cerevisiae and Homo sapiens) that comprise a homolog of the N-terminal region of NifU are also excluded from the definition of NifU herein. A naturally occurring NifU polypeptide typically has a length of between 260 and 310 amino acids and the natural monomer has a molecular weight of about 29 kDa. A great number of NifU polypeptides have been identified and numerous sequences are available in publically available databases. For example, NifU polypeptides have been reported from Klebsiella michiganensis (Accession No. WP_049136164.1, 97% identical to SEQ ID NO:14), Klebsiella variicola (WP_050887862.1, 90% identical), Dickeya solani (WP_057084657.1, 80% identical), Brenneria goodwinii (WP_048638833.1, 73% identical), Tolumonas auensis (WP_012728889.1, 66% identical), Agarivorans gilvus (WP_055731596.1, 58% identical), Desulfocurvus vexinensis (WP_028587630.1, 54% identical), Rhodopseudomonas palustris (WP_044417303.1, 49% identical), Helicobacter pylori (WP_001051984.1, 31% identical) and Sulfurovum sp. PC08-66 (KIM05011.1, 31% identical). As used herein, a functional NifU polypeptide is a NifU polypeptide which is capable of functioning as a molecular scaffold polypeptide involved in iron-sulfur (FeS) cluster biosynthesis. NifU polypeptides have been described and reviewed in Hwang et al., (1996), Miihlenhoff et al., (2003) and Ouzounis et al., (1994).
[0377] A NifV polypeptide in naturally occurring bacteria is a homocitrate synthase (EC 2.3.3.14), producing homocitrate by the transfer of the acetyl group from acetyl-coenzyme A (acetyl-CoA) to 2-oxoglutarate. Homocitrate is then used in the synthesis of the FeMoCo. As used herein, a NifV polypeptide means a polypeptide comprising amino acids whose sequence is at least 39% identical to the amino acid sequence provided as SEQ ID NO:20 and which comprises one or both of the domains TIGR02660 and DRE_TIM. Members of the TIGR02660 domain protein family are homologous to enzymes that include 2-isopropylmalate synthase, (R)-citramalate synthase, and homocitrate synthase associated with processes other than nitrogen fixation. The cd07939 domain protein family also includes the NifV proteins of Heliobacterium chlorum and Gluconacetobacter diazotrophicus, which appear to be orthologous to FrbC. This family belongs to the DRE-TIM metallolyase superfamily. DRE-TIM metallolyases include 2-isopropylmalate synthase (IPMS), alpha-isopropylmalate synthase (LeuA), 3-hydroxy-3-methylglutaryl-CoA lyase, homocitrate synthase, citramalate synthase, 4-hydroxy-2-oxovalerate aldolase, re-citrate synthase, transcarboxylase 5S, pyruvate carboxylase, AksA, and FrbC. These members all share a conserved triose-phosphate isomerase (TIM) barrel domain consisting of a core beta(8)-alpha(8) motif with the eight parallel beta strands forming an enclosed barrel surrounded by eight alpha helices. The domain has a catalytic center containing a divalent cation-binding site formed by a cluster of invariant residues that cap the core of the barrel. In addition, the catalytic site includes three invariant residuesan aspartate (D), an arginine (R), and a glutamate (E)which is the basis for the domain name DRE-TIM. A naturally occurring NifV polypeptide typically has a length of between 360 and 390 amino acids, although some members are about 490 amino acid residues in length, and the natural monomer has a molecular weight of about 41 kDa. A great number of NifV polypeptides have been identified and numerous sequences are available in publically available databases. For example, NifV polypeptides have been reported from Klebsiella michiganensis (Accession No. WP_049083341.1, 95% identical to SEQ ID NO:20), Raoultella ornithinolytica (WP 045858154.1, 86% identical), Kluyvera intermedia (WP_047370264.1, 81% identical), Dickeya dadantii (WP_038912041.1, 70% identical), Brenneria goodwinii (WP_048638835.1, 59% identical), Magnetococcus marinus (WP_011712856.1, 46% identical), Sphingomonas wittichii (WP_037528703.1, 43% identical), Frankia sp. EI5c (OAA29062.1, 41% identical) and Clostridium sp. Maddingley MBC34-26 (EKQ56006.1, 39% identical). As used herein, a functional NifV polypeptide is a NifV polypeptide which is capable of functioning as a homocitrate synthase. NifV polypeptides have been described and reviewed in Hu et al., (2008), Lee et al., (2000), Masukawa et al., (2007) and Zheng et al., (1997).
[0378] A NifX polypeptide in naturally occurring bacteria is a polypeptide which is involved in FeMoCo synthesis, at least assisting in transferring FeMoCo precursors from NifB to NifE-NifN. As used herein, a NifX polypeptide means a polypeptide comprising amino acids whose sequence is at least 29% identical to the amino acid sequence provided as SEQ ID NO:15 and which comprises one or both of the conserved domains TIGR02663 and cd00853. NifX is included in a larger family of iron-molybdenum cluster-binding proteins that includes NifB and NifY, in that NifX, NafY and the C-terminal region of NifB all comprise the pfam02579 domain, and each are involved in the synthesis of FeMoCo. Therefore, some NifX polypeptides have been annotated in databases as NifY, and vice versa. A naturally occurring NifX polypeptide typically has a length of between 110 and 160 amino acids and the natural monomer has a molecular weight of about 15 kDa. A great number of NifX polypeptides have been identified and numerous sequences are available in publically available databases. For example, NifX polypeptides have been reported from Klebsiella michiganensis (Accession No. WP_049070199.1, 97% identical to SEQ ID NO: 15), Klebsiella oxytoca (WP_064342937.1, 97% identical), Raoultella ornithinolytica (WP_044347173.1, 91% identical), Klebsiella variicola (WP_044612922.1, 83% identical), Kosakonia radicincitans (WP_043953583.1, 75% identical), Dickeya chrysanthemi (WP_039999416.1, 68% identical), Rahnella aquatilis (WP_047608097.1, 58% identical), Azotobacter chroococcum (WP 039800848.1, 34% identical), Beggiatoa leptomitiformis (WP_062149047.1, 33% identical) and Methyloversatilis discipulorum (WP_020165972.1, 29% identical). As used herein, a functional NifX polypeptide is a NifX polypeptide which is capable of transferring FeMoCo precursors from NifB to NifE-NifN. NifX polypeptides have been described and reviewed in Allen et al., (1994) and Shah et al., (1999).
[0379] A NifY polypeptide in naturally occurring bacteria is a polypeptide which is involved in FeMoCo synthesis, at least assisting in transferring FeMoCo precursors from NifB to NifE-NifN. As used herein, a NifY polypeptide means a polypeptide comprising amino acids whose sequence is at least 34% identical to the amino acid sequence provided as SEQ ID NO:8 and which comprises one or both of the conserved domains TIGR02663 and cd00853. NifY is included in a larger family of iron-molybdenum cluster-binding proteins that includes NifB and NifX, in that NifX, NafY and the C-terminal region of NifB all comprise the pfam02579 domain, and each are involved in the synthesis of FeMoCo. A great number of NifY polypeptides have been identified and numerous sequences are available in publically available databases. For example, NifY polypeptides have been reported from Klebsiella michiganensis (Accession No. WP_049089500.1, 99% identical to SEQ ID NO:8), Klebsiella oxytoca (WP_064342935.1, 98% identical), Klebsiella quasipneumoniae (WP_044524054.1, 90% identical), Klebsiella variicola (WP_049010739.1, 81% identical), Kluyvera intermedia (WP_047370270.1, 69% identical), Dickeya chrysanthemi (WP_039999411.1, 62% identical), Serratia sp. ATCC 39006 (WP_037382461.1, 57% identical), Rahnella aquatilis (WP_014683024.1, 47% identical), Pseudomonas putida (AEX25784.1, 37% identical) and Azotobacter vinelandii (WP_012698835.1, 34% identical). As used herein, a functional NifY polypeptide is a NifY polypeptide which is capable of transferring FeMoCo precursors from NifB to NifE-NifN.
[0380] A NifZ polypeptide in naturally occurring bacteria is a polypeptide which is involved in FeS cluster synthesis, specifically required for coupling of a second Fe.sub.4S4 pair. As used herein, a NifZ polypeptide means a polypeptide comprising amino acids whose sequence is at least 28% identical to the sequence provided as SEQ ID NO:17 and which comprises the conserved domain pfam04319. This domain of about 75 amino acid residues is found in isolation in some members and in the amino terminal half of the longer NifZ proteins. A naturally occurring NifZ polypeptide typically has a length of between 70 and 150 amino acids and the natural monomer has a molecular weight of about 9 to about 16 kDa. A great number of NifZ polypeptides have been identified and numerous sequences are available in publically available databases. For example, NifZ polypeptides have been reported from Klebsiella michiganensis (Accession No. WP_057173223.1, 93% identical to SEQ ID NO:17), Klebsiella oxytoca (WP_064342939.1, 95% identical), Klebsiella variicola (WP_043875005.1, 77% identical), Kosakonia radicincitans (WP 043953588.1, 67% identical), Kosakonia sacchari (WP_065368553.1, 58% identical), Ferriphaselus amnicola (WP_062627625.1, 47% identical), Paraburkholderia xenovorans (WP_011491838.1, 41% identical), Acidithiobacillus ferrivorans (WP_014029050.1, 35% identical) and Bradyrhizobium oligotrophicum (WP 015665422.1, 28% identical). As used herein, a functional NifZ polypeptide is a NifZ polypeptide which is capable of coupling a Fe4S4 cluster in FeS cluster synthesis. NifZ polypeptides have been described and reviewed in Cotton (2009) and Hu et al., (2004).
[0381] A NifW polypeptide in naturally occurring bacteria is a polypeptide which associates with NifZ polypeptide to form higher order complexes (Lee et al., 1998), and is involved in MoFe protein (NifD-NifK) synthesis or activity. NifW and NifZ appear to be involved in the formation or accumulation of MoFe protein (Paul and Merrick, 1989). As used herein, a NifW polypeptide means a polypeptide whose amino acid sequence comprises amino acids whose sequence is at least 28% identical to the amino acid sequence provided as SEQ ID NO:74 and which comprises the conserved NifW superfamily protein domain, architecture ID number 10505077 and is in Pfamily PF03206. A number of NifW polypeptides have been identified and numerous sequences are available in publically available databases. For example, NifW polypeptides have been reported from Klebsiella oxytoca (Accession No.
[0382] WP_064342938.1, 98% identical to SEQ ID NO:74), Klebsiella michiganensis (WP_049080155.1, 94% identical), Enterobacter sp. 10-1 (WP 095103586.1; 90% identical), Klebsiella quasipneumoniae (WP_065877373.1, 81% identical), Pectobacterium polaris (WP_095699971.1, 69% identical), Dickeya paradisiaca (WP_012764136.1, 58% identical), Brenneria goodwinii (WP_053085547.1, 36% identical), Aquaspirillum sp. LM (WP_077299824.1, 44% identical), Candidatus Muproteobacteria bacterium RBG_1664_10 (OGI40729, 34% identical), Azotobacter vinelandii (AC076430.1, 32% identical) and Methylocaldum marinum (BBA37427.1, 28% identical). As used herein, a functional NifW polypeptide is a NifW polypeptide which promotes or enhances one or more of the formation, accumulation or activity of MoFe protein. A functional NifW may interact with NifZ and/or play a role in the oxygen protection of the MoFe-protein (Gavini et al., (1998)).
[0383] With regard to a defined polypeptide, it will be appreciated that % identity figures higher than those provided above will encompass preferred embodiments. Thus, where applicable, in light of the minimum % identity figures, it is preferred that the polypeptide comprises an amino acid sequence which is at least 30%, more preferably at least 35%, more preferably at least 40%, more preferably at least 45%, more preferably at least 50%, more preferably at least 55%, more preferably at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, and even more preferably at least 99.9% identical to the relevant nominated SEQ ID NO.
[0384] Amino acid sequence mutants of the polypeptides defined herein can be prepared by introducing appropriate nucleotide changes into a nucleic acid defined herein, or by in vitro synthesis of the desired polypeptide. Such mutants include for example, one or more amino acid deletions, insertions, or substitutions. A combination of deletion, insertion and substitution mutations can be made to arrive at the final construct, provided that the final polypeptide product possesses the desired characteristics. Preferred amino acid sequence mutants have only one, two, three, four or less than 10 amino acid changes relative to the reference wildtype polypeptide.
[0385] Mutant (altered) polypeptides can be prepared using any technique known in the art, for example, using directed evolution or rational design strategies (see below). Products derived from mutated/altered DNA can readily be screened using techniques described herein to determine if their expression in a plant alters its phenotype relative to a corresponding wild-type plant, for example, if their expression results in increased yield, biomass, growth rate, vigor, nitrogen gain derived from biological nitrogen fixation, nitrogen use efficiency, abiotic stress tolerance, and/or tolerance to nutrient deficiency relative to the corresponding wild-type plant.
[0386] In designing amino acid sequence mutants, the location of the mutation site and the nature of the mutation will depend on characteristic(s) to be modified. The sites for mutation can be modified individually or in series for example, by (1) substituting first with conservative amino acid choices and then with more radical selections depending upon the results achieved, (2) deleting the target residue, or (3) inserting other residues adjacent to the located site.
[0387] Amino acid sequence deletions generally range from about 1 to 15 residues, more preferably about 1 to 10 residues and typically about 1 to 5 contiguous residues.
[0388] Substitution mutants have at least one amino acid residue in the polypeptide molecule removed and a different residue inserted in its place. Where it is desirable to maintain a certain activity it is preferable to make no, or only conservative substitutions, at amino acid positions which are highly conserved in the relevant protein family. Examples of conservative substitutions are shown in Table 1 under the heading of exemplary substitutions.
[0389] In a preferred embodiment a mutant/variant polypeptide has one or two or three or four conservative amino acid changes when compared to a naturally occurring polypeptide. Details of conservative amino acid changes are provided in Table 1. In a preferred embodiment, the changes are not in one or more of the motifs or domains which are highly conserved between the different polypeptides of the invention. As the skilled person would be aware, such minor changes can reasonably be predicted not to alter the activity of the polypeptide when expressed in a recombinant cell.
[0390] The primary amino acid sequence of a polypeptide of the invention can be used to design variants/mutants thereof based on comparisons with closely related polypeptides. As the skilled person will appreciate, residues highly conserved amongst closely related proteins are less likely to be able to be altered, especially with non-conservative substitutions, and activity maintained than less conserved residues (see above). A more stringent test to identify conserved amino acid residues is to align more distantly related polypeptides of the same function. Highly conserved residues should be maintained in order to retain function, whereas non-conserved residues are more amenable to substitutions or deletion while maintaining function.
[0391] Also included within the scope of the invention are polypeptides of the present invention which are differentially modified during or after synthesis in a cell, e.g., by glycosylation, acetylation, phosphorylation or proteolytic cleavage.
TABLE-US-00001 TABLE 1 Exemplary substitutions. Original Exemplary Residue Substitutions Ala (A) val; leu; ile; gly Arg (R) lys Asn (N) gln; his Asp (D) glu Cys (C) ser Gln (Q) asn; his Glu (E) asp Gly (G) pro, ala His (H) asn; gln Ile (I) leu; val; ala Leu (L) ile; val; met; ala; phe Lys (K) arg Met (M) leu; phe Phe (F) leu; val; ala Pro (P) gly Ser (S) thr Thr (T) ser Trp (W) tyr Tyr (Y) trp; phe Val (V) ile; leu; met; phe, ala
Rational Design
[0392] A protein can be designed rationally, on the basis of known information about protein structure and folding. This can be accomplished by design from scratch (de novo design) or by redesign based on native scaffolds (see, for example, Hellinga, 1997; and Lu and Berry, Protein Structure Design and Engineering, Handbook of Proteins 2, 1153-1157 (2007)). See, for example, Example 10 herein. Protein design typically involves identifying sequences that fold into a given or target structure and can be accomplished using computer models. Computational protein design algorithms search the sequence-conformation space for sequences that are low in energy when folded to the target structure. Computational protein design algorithms use models of protein energetics to evaluate how mutations would affect a protein's structure and function. These energy functions typically include a combination of molecular mechanics, statistical (i.e. knowledge-based), and other empirical terms. Suitable available software includes IPRO (Interative Protein Redesign and Optimization), EGAD (A Genetic Algorithm for Protein Design), Rosetta Design, Sharpen, and Abalone.
Mitochondrial Protein Import in Plants
[0393] Almost all mitochondrial proteins are nuclear encoded and translated in the cytosol, therefore requiring their translocation into the mitochondria. Signal sequences within the polypeptides direct their import to four different intra-mitochondrial locations: the outer membrane (OM), the intermembrane space (IS), the inner membrane (IM), or the matrix (MM). These signal sequences are distinguished by their biochemical properties and guide trafficking via at least four distinct import pathways which direct the polypeptides to one or more of the four locations (Chacinska et al., 2009). These four pathways are: (1) the general import pathway, also referred to as the classical pre-sequence pathway, which directs polypeptides to the MM, the IS or the IM; (2) the carrier import pathway, used for transport to the IM, (3) the mitochondrial intermembrane space (MIA) assembly pathway, and (4) the sorting and assembly machinery (SAM) pathway used for transport of polypeptides to the OM. The general import pathway imports polypeptides having a cleavable pre-sequence, also known as a signal sequence. These polypeptides may also have a hydrophobic sorting signal (HSS). The carrier import pathway imports polypeptides with internal pre-sequence like signals and a hydrophobic region. The MIA pathway imports polypeptides with twin cysteine residues. The SAM pathway imports polypeptides that contain a 3 signal and a putative TOM20 signal. All of these pathways make use of a translocase of the outer membrane (TOM) and the first and second pathways also use a TIM23 translocase of the intermembrane complex. Only the first pathway uses matrix processing peptidase (matrix processing protease, MPP).
[0394] A common characteristic of all mitochondrial targeted polypeptides is the presence of at least one domain within the polypeptide that guides transport to the correct location. The best studied of these is the classic N-terminal pre-sequence domain that is cleaved in the matrix by MPP (Murcha et al., 2004). It has been estimated that about 70% of plant and animal mitochondrial proteins have a cleavable pre-sequence but both internal and C-terminal signal sequences have also been found (reviewed in Pfanner and Geissler (2001), Schleiff and Soll (2000)). In Arabidopsis, these pre-sequences range in length from 11 to 109 amino acid residues with an average length of 50 amino acid residues. Although there is no consensus sequence that fully defines a pre-sequence for the first pathway, they tend to contain a high proportion of hydrophobic and positively charged amino acids. A further characteristic is their ability to form an amphiphilic -helix, usually starting within the first 10 amino acid residues (Roise et al., 1986). These domains are rich in hydrophobic (Ala, Leu, Phe, Val), hydroxylated (Ser, Thr) and positively charged (Arg, Lys) amino acid residues, and deficient in acidic amino acids. Over a large number of mitochondrial proteins, serine (16-17%) and alanine (12-13%) are greatly over-represented in mitochondrial signal peptides, and arginine is abundant (12%). The MPP cleavage point is defined for most pre-sequences by the presence of a conserved arginine residue, usually at position P2 (2 as from the scissile bond), or P3 in most other cases (Huang et al., 2009).
[0395] Mitochondrial pre-sequences interact with the Tom20 receptor through hydrophobic residues. Studies have shown that the hydrophobic surface of the -helix facilitates recognition of the peptide by the TOM20 component of the TOM import complex, whereas the positive charges are recognised by the TOM22 subunit (Abe et al., 2000). Finally, most pre-sequences guide transport of the polypeptide in association with Hsp70, and accordingly nearly all plant pre-sequences contain at least one binding motif for Hsp70 molecular chaperone (Zhang and Glaser, 2002). The chaperone Hsp70 is involved in protein folding, prevents protein aggregations, and functions as a molecular motor, pulling the precursor across the mitochondrial membranes. The electrical membrane potential () (100 mV, negative inside) across the inner membrane also drives translocation of the positively charged pre-sequence via an electrophoretic effect.
[0396] The majority of proteins with cleavable pre-sequences are destined for the mitochondrial matrix via the general import pathway, which utilises the transporter of the outer membrane (TOM) complex and the transporter of the inner membrane 23 complex (TIM23). However some proteins with cleavable pre-sequences can assemble in the inner membrane (Murcha et al., 2005) or the inter membrane space, if they also contain a hydrophobic sorting signal (HSS) (Glick et al., 1992). There are very few examples of matrix localised proteins that do not have their pre-sequences cleaved. In Arabidopsis, only Glutamate dehydrogenase has been found in the matrix with an unprocessed full length pre-sequence (Huang et al., 2009).
[0397] For proteins that are not matrix targeted, a variety of internal non-cleavable localisation signals are employed. These are typically associated with a specific trafficking pathway, and are additionally tailored for the particular class of protein. In plants, no studies thus far have determined what precisely constitutes an internal signal sequence for intermembrane space proteins. However, it appears a motif with twin cysteine residues is associated with transport via the mitochondrial intermembrane space assembly pathway (MIA) (Carrie et al., 2010; Darshi et al., 2012). Finally, non-cleavable internal sequences are also utilised by proteins destined for the inner membrane via the carrier pathway, which utilises the TOM and TIM22 apparatus to insert proteins with multiple transmembrane regions (Kerscher et al., 1997; Sirrenberg et al., 1996). These sequences typically contain a hydrophobic region followed by a pre-sequence like internal sequence, and are thus similar to N-terminal pre-sequences, but distinguished by their internal location within their cognate protein.
[0398] In photosynthetic organisms, nuclear encoded mitochondrial proteins have a requirement for differentiation between chloroplast and mitochondrial trafficking, despite many similarities between these two organelles and their proteomes. The -helix that occurs mostly in mitochondria pre-sequences is usually absent in chloroplast pre-sequences (Zhang and Glaser, 2002), which tend to be more unstructured and show high sheet domain structure (Bruce, 2001).
[0399] In plants, the MPP is anchored to the inner membrane bound Cytbc.sub.1 complex, although the active MPP site is located facing the matrix, and the functions of the two proteins are independent (Glaser and Dessi, 1999).
Mitochondrial Targeting Peptide
[0400] As used herein, the term mitochondrial targeting peptide or MTP means an amino acid sequence, comprising at least 10 amino acids and preferably between 10 and about 80 amino acid residues in length that directs a target protein to a mitochondrion and which can be used heterologously in an MTP-target protein translational fusion to direct a selected target protein such as a Nif polypeptide, Gus, GFP etc to a mitochondrion.
[0401] The MTP typically comprises at its N-terminus a translation initiator methionine of the polypeptide from which it is derived. The MTP is translationally fused to a Nif polypeptide or target protein by a peptide bond to the Met residue that corresponds to the initiator Met of the target protein, or that Met residue may be omitted and the peptide bond is directly fused to the amino acid residue that in the wild-type is the second amino acid of the target protein. The MTP is typically rich in basic and hydroxylated amino acids and usually lacks acidic amino acids or extended hydrophobic stretches. The MTP may form amphiphilic helices.
[0402] While not wanting to be limited by theory, the MTP typically comprises an uptake-targeting sequence that binds to receptors on the outer membrane of the mitochondrion. Upon binding to the outer membrane, the fusion polypeptide preferably undergoes membrane translocation to transport channel proteins, and passages through the double membrane of the mitochondrion to the mitochondrial matrix (MM). The uptake-targeting sequence is then typically cleaved and the mature fusion protein folded.
[0403] The MTP may comprise additional signals that subsequently target the protein to different regions of the mitochondria, such as the mitochondrial matrix (MM). In an embodiment, the uptake-targeting sequence is a matrix targeting sequence.
[0404] The MTP may be cleavable or non-cleavable when translationally fused to the Nif polypeptide. In an embodiment, at least 50% of the MTP-Nif fusion polypeptide that is produced in the cell is cleaved in the cell. In an alternative embodiment, less than 50% of the MTP-Nif fusion polypeptide is cleaved in the cell, for example, the MTP is not cleaved. In an embodiment, the MTP does not comprise a cleavage site for MPP. The MTP may comprise a cleavage site (within the MTP sequence). Upon cleavage, the N-terminal part of the resultant processed product (i.e., the mature NP) may comprise one or more C-terminal amino acids of the MTP. Alternatively, the cleavage site may be located within the fusion polypeptide such that the entire MTP sequence is cleaved, for example, the linker may comprise the cleavage sequence.
[0405] Native mitochondrial targeting peptides are localized at the N-terminus of the precursor proteins and an N-terminal part are typically cleaved off during or after import into mitochondria. Cleavage is typically catalysed by the general matrix processing protease (MPP), which, in plants, is integrated into the bc.sub.1 complex of the respiratory chain. This protease recognizes the cleavage sites of nearly 1000 precursor proteins that have a wide range of amino acid sequences which show little conservation. In an embodiment, the MTP comprises a protease cleavage site for MPP. In a further embodiment, the processed product is produced by cleavage of the fusion protein within the MTP by MPP.
[0406] In an embodiment, the MTP is not cleaved. The present inventors have demonstrated that incorporation of the MTP did not always lead to complete processing of Nif proteins. In some instances (NifX-FLAG, NifD-HA.sub.opt1 and NifDK-HA), both processed and unprocessed Nif proteins were observed. Considering there is no general consensus sequence for MTPs, and internal protein sequences can influence mitochondrial targeting (Becker et al., 2012), it is perhaps not surprising that the present inventors found differences in processing efficiency amongst the Nif proteins.
[0407] Suitable MTPs that can be used in the context of the present invention include, without limitation, peptides having the general structure as defined by von Heijne (1986) or by Roise and Schatz (1988). Non limiting examples of MTPs are the mitochondrial targeting peptides defined in Table I of von Heijne (1986).
[0408] In an embodiment, the MTP is an F1-ATPase -subunit (pFA). An example of a suitable pFA MTP is that from A. thaliana (Lee et al., 2012). In an embodiment, the pFA MTP is 77 amino acids in length, the cleavage of which by an MMP leaves 38 MTP residues at the N-terminus of the fusion polypeptide. In a preferred embodiment, the pFA MTP is less than 77 amino acids in length. For example, the pFA MTP may be about 51 amino acids in length, the cleavage of which by an MMP leaves 9 MTP residues at the N-terminus of the fusion polypeptide.
[0409] The skilled person will appreciate that software exists for predicting mitochondrial proteins and their targeting sequence, for example, MitoProtII, PSORT, TargetP, NNPSL.
[0410] MitoProtlI is a program that predicts mitochondrial localization of a sequence based on several physiochemical parameters (e.g., amino acid composition in the N-terminal part, or the highest total hydrophobicity for a 17 residues window). PSORT is a program that predicts subcellular locations based on various sequence-derived features such as the presence of sequence motifs and amino acid compositions. TargetP predicts the subcellular location of eukaryotic proteins based on the predicted presence of any of the N-terminal presequences: chloroplast transit peptide, mitochondrial targeting peptide or secretory pathway signal peptide. TargetP requires the N-terminal sequence as an input into two layers of artificial neural networks (ANN), utilizing the earlier binary predictors, SignalP and ChloroP. For the sequences predicted to contain an N-terminal presequence a potential cleavage site can also be predicted. NNPSL is another ANN-based method using the amino acid composition to assign one of four subcellular localization (cytosolic, extracellular, nuclear and mitochondrial) to a query sequence.
[0411] The skilled person would be readily able to determine if the chosen MTP targeted the fusion polypeptide to the mitochondrial matrix based on routine methods and methods disclosed herein. The present inventors chose a targeting peptide previously demonstrated as capable of transporting GFP in Arabidopsis protoplasts (Lee et al., 2012), and which is relatively long, to assist detection of processed protein. As shown in the Examples herein, the chosen MTP targeted all of the selected nitrogenase proteins to the MM. This conclusion is based on several lines of evidence. Firstly, the sizes observed for N. benthamiana expressed Nif polypeptides were consistent with the expected size resulting from MM peptidase processing. This was also reflected by the difference in size observed between bacterial (full length unprocessed), and plant mitochondrial expressed Nifs of small sizes (NifF and NifZ). Additionally, mutation of the MTP, rendering it incapable of being processed by the mitochondrial import machinery, produced a larger band for both NifD and GFP fusions, consistent with the difference in size between processed and unprocessed protein. Finally, mass spectrometry for an exemplary fusion polypeptide determined that MTP-NifH was cleaved between residues 42-43 of the MTP as predicted for specific processing in the matrix.
[0412] It may be useful in some embodiments of this invention to use multiple tandem copies of a chosen MTP. The coding sequence for a duplicated or multiplied targeting peptide may be obtained through genetic engineering from an existing MTP. The amount of MTP can be measured by cellular fractionation, followed by, for example, quantitative immunoblot analysis. Thus, in the present invention, the term mitochondrial targeting peptide or MTP encompasses one or more copies of one amino acid peptide that directs a target Nif protein to the mitochondria. In a preferred embodiment, the MTP comprises two copies of a chosen MTP. In another embodiment, the MTP comprises three copies of a chosen MTP. In another embodiment, the MTP comprises four copies or more of a chosen MTP.
[0413] The skilled person will appreciate that the MTP sequence is not limited to native MTP sequences but may comprise amino acid substitutions, deletions and/or insertions, relative to a naturally-occurring MTP, provided that the sequence variant still functions for mitochondrial targeting.
[0414] The skilled person will understand that the MTP may be flanked by amino acids at its N- or C-terminus as a result of the cloning strategy and may function as a linker. These additional amino acids may be considered to form part of the MTP.
[0415] The skilled person will also understand that the MTP may be N- or C-terminally fused to an oligopeptide linker and/or tag such as an epitope tag. In a preferred embodiment, one or more or all of the Nif fusion polypeptides of the invention produced in a plant cell lack added epitope tags relative to a corresponding wild-type Nif polypeptide.
Linker
[0416] As used herein in the context of polypeptides, the term linker or oligopeptide linker means one or more amino acids that covalently join two or more functional domains, for example, the MTP and the NP, two NPs, a NP and a tag. The amino acids are covalently joined through peptide bonds, both within the linker and between linker and functional domains. The linker may provide for freedom of movement of one functional domain with respect to the other, without causing a substantial detrimental effect on the function of the two or more domains. The linker may help promote proper folding and functioning of one or both of the functional domains. The skilled person will understand that the size of a linker can be determined empirically or can be modelled based on protein folding information.
[0417] The linker may comprise a cleavage site for a protease such as MPP. Such a linker can also be considered to be part of an MTP.
[0418] The skilled person will appreciate that the C-terminus of the MTP can be translationally fused to the N-terminal amino acid of the NP without a linker or via a linker of one or more amino acid residues, for example of 1-5 amino acid residues. Such a linker can also be considered to be part of the MTP.
[0419] In embodiments, the linker comprises at least 1 amino acid, at least 2 amino acids, at least 3 amino acids, at least 4 amino acids, at least 5 amino acids, at least 6 amino acids, at least 7 amino acids, at least 8 amino acids, at least 9 amino acids, at least 10 amino acids, at least 12 amino acids, at least 14 amino acids, at least 16 amino acids, at least 18 amino acids, at least 20 amino acids, at least 25 amino acids, at least 30 amino acids, at least 35 amino acids, at least 40 amino acids, the least 45 amino acids, at least 50 amino acids, at least 60 amino acids, at least 70 amino acids, at least 80 amino acids, at least 90 amino acids, or about 100 amino acids. In embodiments, the maximal size of the linker is 100 amino acids, preferably 60 amino acids, more preferably 40 amino acids.
[0420] In some embodiments, the linker will permit the movement of one functional domain with respect to the other in order to increase stability of the fusion polypeptide. If desired, the linker can encompass either: repetitions of poly-glycine or combinations of glycine, proline and alanine residues.
[0421] Linkers for joining two Nif polypeptides such as NifD-linker-NifK and NifE-linker-NifN are preferably selected, for the number and sequence of the amino acids in the linker, based on several criteria. These are: a lack of cysteine residues to avoid formation of unwanted disulphide linkages, few or preferably no charged residues (Glu, Asp, Arg, Lys) to reduce the likelihood of unwanted surface salt bridge interactions, few or no hydrophobic residues (Phe, Trp, Tyr, Met, Val, Ile, Leu) as such residues may promote a tendency to penetrate the surface of the polypeptide, and lacking amino acids which may be post-translationally modified. In this context few charged residues means less than 10% of the amino acid residues in the linker, and few hydrophobic residues means less than 15% of the amino acid residues in the linker.
[0422] In an embodiment, the linker does not comprise a cysteine residue.
[0423] In an embodiment, the linker comprises four, three, or two, or one, or no charged residues. Preferably, in total the linker comprises four, three, or two, or one, or no glutamic acid, asparartic acid, argninine and lysine residues.
[0424] In an embodiment, the linker comprises four, three, or two, or one or no hydrophobic residues. Preferably, in total the linker comprises four, three, or two, or one or no phenylalanine, tryptophan, tyrosine, methionine, valine, isoleunce and leucine residues.
[0425] In an embodiment, at least 70%, or at least 80%, or at least 90%, of the linker comprises residues selected from threonine, serine, glycine and alanine.
[0426] The use of oligopeptide linkers in modifying polypeptides is reviewed in Chen et al., (2013) and Zhang et al., (2009).
Tag
[0427] In a particular embodiment, the fusion polypeptide comprises at least one tag adequate for detection or purification of the fusion polypeptide or a processed product thereof. The tag is typically bound to the C-terminal or N-terminal domain of the fusion polypeptide. In a preferred embodiment, the tag is bound to the C-terminus of the Nif polypeptide. The tag is generally a peptide or amino acid sequence capable of binding to one or more ligands, for example, one or more ligands of an affinity matrix such as a chromatography support or bead, or an antibody, with high affinity. The skilled person will understand that the tag is preferably located in the fusion protein at a location which does not result in the removal of the tag from the NP once the MTP is cleaved off after import into the mitochondria. Further, the tag should not interfere with the mitochondria import machinery. In a preferred embodiment, the polynucleotide of the invention encodes a fusion polypeptide that comprises, in the N- to C-terminal order, a N-terminal MTP, the Nif polypeptide and the detection/purification tag. In an alternate embodiment, the fusion polypeptide comprises, in the N- to C-terminal order, a N-terminal MTP, the detection/purification tag and the Nif polypeptide.
[0428] Additional illustrative, non-limiting examples of tags useful for detecting, isolating or purifying a fusion polypeptide or a processed product thereof include, human influenza hemagglutinin (HA) tag, histidine tags comprising for example, 6 or 8 histidine residues, fluoresecent tags such as fluorescein, resourfin and derivatives thereof, Arg-tag, FLAG-tag, Strep-tag, an epitope capable of being recognized by an antibody, such as c-myc-tag (recognized by an anti-c-myc antibody), SBP-tag, S-tag, calmodulin binding peptide, cellulose binding domain, chitin binding domain, glutathione S-transferase-tag, maltose binding protein, NusA, TrxA, DsbA, Avi-tag, etc.
Translational Fusions Involving Nif Polypeptides
[0429] Translational fusions have been made to several Nif polypeptides as reported in the scientific literature. These are summarised in Table 2 and in the review by Buren and Rubio, (2018). Most of them involve the artificial addition of epitopes or binding domains such as Histidine tags or Strep tags to the proteins for detection and purification purposes and only a few have been expressed in plant cells. There are a few reports of naturally occurring fusions between Nif polypeptides, in bacteria. For assays in bacterial hosts, His tags of different lengths (7-10 histidines) were added to NifD (Christiansen et al., 1998), NifE (Goodwin et al., 1998), NifM (Gavini et al., 2006) and both full length and truncated versions of NifB (Fay et al., 2015).I In each case, Nif function was retained for the modified Nif polypeptide as demonstrated in bacteria or in in vitro nitrogenase reconstitution assays.
[0430] Thiel et al., (1995) identified a naturally occurring deletion of 29 nucleotides and therefore deleting 9 amino acids and the NJE stop codon in the intergenic region between the NifE and NifN genes in the blue-green alga Anabaena variabilis. The deletion resulted in a NifE-NifN polypeptide fusion which retained at least some nitrogenase function of the NifE and NifN polypeptides. The NifE-NifN fusion polypeptide also had 19 other amino acid substitutions in the region of the fusion junction, which might have affected Nif function but in unknown ways. The fusion gene was expressed but only under strictly anaerobic conditions. It was not reported if there was a reduction in activity relative to the non-fused genes.
[0431] Suh et al., (1996) created an artificial junction between the NifD and NifK genes of the chromosome of A. vinelandii by a deletion including the stop codon of NifD and the translation start codon (ATG) of NiJK, forming a vector designated pBG1404. The deletion resulted in a net loss of three amino acids and seven amino acid substitutions in amino acids 2-10 of the NifK polypeptide. The A. vinelandii host cells containing pBG1404 were compromised in their growth in low nitrogen media relative to the corresponding wild-type bacteria.
[0432] Wiig at al (2011) used a naturally occuring translational fusion between NifN and NifB genes found in Clostridium pastuerianum and determined that it is functional for NifN and NifB activity in bacterial and biochemical complementation assays. This fusion was direct without any peptide linker, i.e. the C-terminus of NifN was directly covalently linked to the N-terminus of NifB.
[0433] In yeast and plant cells, translational fusions have been used to direct proteins encoded in the nucleus to mitochondrial matrix. In yeast expression assays, translational fusions of mitochondrial targeting peptide (MTP) and some Nif polypeptides (NifH, NifM, NifS, and NifU) were shown to be functional when grown under aerobic conditions (Lopez-Torrejon et al., 2016). Epitope fusions (FLAG and HIS) were also shown to be functional when fused to NifH, NifM, NifS and NifU, although these fusions were intended for localisation within the yeast cytoplasm and were only functional when the yeast were grown under anaerobic conditions. Buren et al., (2017) showed that a mitochondrial-matrix targeted version of a soluble variant of NifB was functional in invitro complementation assays when re-isolated from the mitochondria of yeast. This version of NifB included a N-terminal MTP, a truncated variant of NifB (without the NifX-like domain) and a C-terminal 10His epitope tag. A large number of MTP-Nif fusions were also generated in yeast expression assays. However, this large ensemble of co-expressed proteins failed to show activity in yeast (Buren et al., 2017).
[0434] An MTP from a CPN-60 gene was fused to the N-terminus of NifH, NifM, NifS and NifU and shown to be functional via in vitro complementation assays when the FeProtein was re-isolated from plants grown under reduced oxygen tension at 10% oxygen (US2016/0304842).
TABLE-US-00002 TABLE 2 Summary of gene fusions of Nif polypeptides as reported in the literature Function and Number of which amino acid organism (no, Gene Naturally or residues partial, yes, fusion synthetic changed not tested) Reference Bacterial expression GST-NafY synthetic 26 kDa on N Yes, in bacteria Rubio et al., terminus 2004 NifD-7xHis synthetic 7 extra Yes, in bacteria Christiansen et al., at the C histidines 1998 terminus NifE-NifN Natural: Deletion of Yes, in bacteria Thiel et al., Anabaena about 10 1995 variabilis amino acids 7xHis-NifE synthetic 7 His at N Yes, in bacteria Goodwin et al., terminus 1998 N-(zero Naturally Yes, in bacteria Dean and linker)-B occurring in Jackobson, cited Clostridium in Wiig et al., pasteruienum 2011 8xHis-N- synthetic Direct NifN- Yes, in bacteria Wiig et al., zero linker- NifB fusion, 2011 B zero length linker NifD-NifK synthetic Net deletion partial (50%), in Suh et al., of 3 amino bacteria 1996 acids, 7 substitutions 7-10xHis- synthetic Not specified Yes, in bacteria Gavini et al NifM (7-10?) at the 2006 N terminus Eukaryotic expression His-NifU synthetic Epitope at the Yes, yeast, Lopez-Torrejon N terminus Cytoplasmic et al., 2016 location, and functional if the yeast are grown anaerobically NifB- Synthetic 10xHis at C Yes, tested in Buren et al., truncated- terminus of a yeast grown 2017 10xHis NifB aerobically truncated for the NifX-like domain MTP-Strep Synthetic 28 amino acid Expressed in Buren et al., tag-NifB N terminal plants, targeted 2017 (truncated) Strep tag, to MM, more between the soluble than the MTP and full length NifB version, not tested for function 6xHis-NifB- synthetic 6 His at N Yes, tested in Fay et al., truncated terminus of a yeast 2015 NifB PNAS truncated for the NifX-like domain at the C-terminus CPN-60- synthetic MTP Yes, in vitro US2016/0304842 NifS targeting in Nicotiana ssp CPN-60- synthetic MTP Yes, in vitro US2016/0304842 NifU targeting in Nicotiana ssp CPN-60- synthetic MTP Yes, in vitro US2016/0304842 NifH targeting in Nicotiana ssp CPN-60- synthetic MTP Yes, in vitro US2016/0304842 NifM targeting in Nicotiana ssp
Polynucleotides
[0435] The terms polynucleotide and nucleic acid are used interchangeably herein. They mean a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. A polynucleotide defined herein may be of genomic, cDNA, semisynthetic, or synthetic origin, single-stranded or preferably double-stranded and by virtue of its origin or manipulation: (1) is not associated with all or a portion of a polynucleotide with which it is associated in nature (e.g., a Nif polynucleotide that does not comprise a native promoter encoding sequence), (2) is linked to a polynucleotide other than that to which it is linked in nature (e.g., a Nif polynucleotide linked to a MTP encoding nucleotide sequence and/or a non-native promoter encoding sequence), or (3) does not occur in nature (e.g., polynucleotides encoding MTP-Nif fusion polypeptides of the invention). The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, chimeric DNA of any sequence, nucleic acid probes, and primers. A polynucleotide may comprise modified nucleotides such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization such as by conjugation with a labeling component.
[0436] An isolated polynucleotide is substantially free from components that are normally linked (e.g., regulatory sequences) or associate with the polynucleotide.
[0437] Thus, an isolated polynucleotide is substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. Preferably, the isolated polynucleotide is at least 60% free, more preferably at least 75% free, and more preferably at least 90% free from said components.
[0438] As used herein, the term gene is to be taken in its broadest context and includes the deoxyribonucleotide sequences comprising the transcribed region and, if translated, the protein coding region, of a structural gene and including sequences located adjacent to the coding region on both the 5 and 3 ends for a distance of at least about 2 kb on either end and which are involved in expression of the gene. In this regard, the gene includes control signals such as promoters, enhancers, translation and transcription termination and/or polyadenylation signals that are naturally associated with a given gene, or heterologous control signals, in which case, the gene is referred to as a chimeric gene. The sequences which are located 5 of the protein coding region and which are present on the mRNA are referred to as 5 non-translated sequences. The sequences which are located 3 or downstream of the protein coding region and which are present on the mRNA are referred to as 3 non-translated sequences. The term gene encompasses both cDNA and genomic forms of a gene. A genomic form or clone of a gene contains the coding region which may be interrupted with non-coding sequences termed introns, intervening regions, or intervening sequences. Introns are segments of a gene which are transcribed into nuclear RNA (nRNA). Introns may contain regulatory elements such as enhancers. Introns are removed or spliced out from the nuclear or primary transcript; introns therefore are absent in the mRNA transcript. The mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide. The term gene includes a synthetic or fusion molecule encoding all or part of the proteins of the invention described herein and a complementary nucleotide sequence to any one of the above.
[0439] As used herein, chimeric DNA, also referred to herein as a DNA construct, means any DNA molecule that is not naturally found in nature but which artificially joins two DNA parts into a single molecule, each part of which might be found in nature but the whole is not found in nature. For example, a DNA construct encoding a MTP-Nif fusion polypeptide of the invention. Typically, chimeric DNA comprises regulatory and transcribed or protein coding sequences that are not naturally found together in nature (e.g., a Nifpolynucleotide linked to a non-native promoter encoding sequence). Accordingly, chimeric DNA may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature. The open reading frame may or may not be linked to its natural upstream and downstream regulatory elements. The open reading frame may be incorporated into, for example, the plant genome, in a non-natural location, or in a replicon or vector where it is not naturally found such as a bacterial plasmid or a viral vector. The term chimeric DNA is not limited to DNA molecules which are replicable in a host, but includes DNA capable of being ligated into a replicon by, for example, specific adaptor sequences.
[0440] A transgene is a gene that has been introduced into the genome by a transformation procedure. The term includes a gene in a progeny cell, plant, seed, non-human organism or part thereof which was introducing into the genome of a progenitor cell thereof. Such progeny cells etc may be at least a 3.sup.rd or 4.sup.th generation progeny from the progenitor cell which was the primary transformed cell. Progeny may be produced by sexual reproduction or vegetatively such as, for example, from tubers in potatoes or ratoons in sugarcane. The term genetically modified, and variations thereof, is a broader term that includes introducing a gene into a cell by transformation or transduction, mutating a gene in a cell and genetically altering or modulating the regulation of a gene in a cell, or the progeny of any cell modified as described above.
[0441] A genomic region as used herein refers to a position within the genome where a transgene, or group of transgenes (also referred to herein as a cluster), have been inserted into a cell, or predecessor thereof. Such regions only comprise nucleotides that have been incorporated by the intervention of man such as by methods described herein.
[0442] A recombinant polynucleotide of the invention refers to a nucleic acid molecule which has been constructed or modified by artificial recombinant methods. The recombinant polynucleotide may be present in a cell in an altered amount or expressed at an altered rate (e.g., in the case of mRNA) compared to its native state. In one embodiment, the polynucleotide is introduced into a cell that does not naturally comprise the polynucleotide. Typically an exogenous DNA is used as a template for transcription of mRNA which is then translated into a continuous sequence of amino acid residues coding for a polypeptide of the invention within the transformed cell. In another embodiment, the polynucleotide is endogenous to a bacterial cell and its expression is altered by recombinant means, for example, an exogenous control sequence is introduced upstream of an endogenous gene of interest to enable the transformed cell to express the polypeptide encoded by the gene.
[0443] A recombinant polynucleotide of the invention includes polynucleotides which have not been separated from other components of the cell-based or cell-free expression system, in which it is present, and polynucleotides produced in said cell-based or cell-free systems which are subsequently purified away from at least some other components. The polynucleotide can be a contiguous stretch of nucleotides existing in nature (e.g., Nif polynucleotide), or comprise two or more contiguous stretches of nucleotides from different sources (naturally occurring and/or synthetic) joined to form a single polynucleotide (e.g., a Nif polynucleotide linked to a MTP encoding nucleotide sequence and/or a non-native promoter encoding sequence). Typically, such chimeric polynucleotides comprise at least an open reading frame encoding a polypeptide of the invention operably linked to a promoter suitable of driving transcription of the open reading frame in a cell of interest.
[0444] With regard to the defined polynucleotides, it will be appreciated that % identity figures higher than those provided above will encompass preferred embodiments. Thus, where applicable, in light of the minimum % identity figures, it is preferred that the polynucleotide comprises a polynucleotide sequence which is at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, and even more preferably at least 99.9% identical to the relevant nominated SEQ ID NO.
[0445] A polynucleotide of, or useful for, the present invention may selectively hybridise, under stringent conditions, to a polynucleotide defined herein. As used herein, stringent conditions are those that: (1) employ during hybridisation a denaturing agent such as formamide, for example, 50% (v/v) formamide with 0.1% (w/v) bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium citrate at 42 C.; or (2) employ 50% formamide, 5SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5Denhardt's solution, sonicated salmon sperm DNA (50 g/ml), 0.1% SDS and 10% dextran sulfate at 42 C. in 0.2SSC and 0.1% SDS, and/or (3) employ low ionic strength and high temperature for washing, for example, 0.015 M NaCl/0.0015 M sodium citrate/0.1% SDS at 50 C.
[0446] Polynucleotides of the invention may possess, when compared to naturally occurring molecules, one or more mutations which are deletions, insertions, or substitutions of nucleotide residues. Polynucleotides which have mutations relative to a reference sequence can be either naturally occurring (that is to say, isolated from a natural source) or synthetic (for example, by performing site-directed mutagenesis or DNA shuffling on the nucleic acid as described above).
[0447] Polynucleotdies of the invention may be codon-modified for expression in a plant cell. The skilled person will appreciated that the protein coding region may be codon optimised relative to, for example, the coding region of a naturally occurring polynucleotide in a nitrogen fixing bacterium.
Nucleic Acid Constructs
[0448] The present invention includes nucleic acid constructs comprising one or more polynucleotides of the invention, and vectors and host cells containing these, methods of their production and use, and uses thereof. The present invention refers to elements which are operably connected or linked. Operably connected or operably linked and the like refer to a linkage of polynucleotide elements in a functional relationship. Typically, operably connected nucleic acid sequences are contiguously linked and, where necessary to join two protein coding regions, contiguous and in reading frame. A coding sequence is operably connected to another coding sequence when RNA polymerase will transcribe the two coding sequences into a single RNA, which if translated is then translated into a single polypeptide having amino acids derived from both coding sequences. The coding sequences need not be contiguous to one another so long as the expressed sequences are ultimately processed to produce the desired protein.
[0449] As used herein, the term cis-acting sequence, cis-acting element or cis-regulatory region or regulatory region or similar term shall be taken to mean any sequence of nucleotides, which when positioned appropriately and connected relative to an expressible genetic sequence, is capable of regulating, at least in part, the expression of the genetic sequence. Those skilled in the art will be aware that a cis-regulatory region may be capable of activating, silencing, enhancing, repressing or otherwise altering the level of expression and/or cell-type-specificity and/or developmental specificity of a gene sequence at the transcriptional or post-transcriptional level. In preferred embodiments of the present invention, the cis-acting sequence is an activator sequence that enhances or stimulates the expression of an expressible genetic sequence.
[0450] Operably connecting a promoter or enhancer element to a transcribable polynucleotide means placing the transcribable polynucleotide (e.g., protein-encoding polynucleotide or other transcript) under the regulatory control of a promoter, which then controls the transcription of that polynucleotide. In the construction of heterologous promoter/structural gene combinations, it is generally preferred to position a promoter or variant thereof at a distance from the transcription start site of the transcribable polynucleotide which is approximately the same as the distance between that promoter and the protein coding region it controls in its natural setting; i.e., the gene from which the promoter is derived. As is known in the art, some variation in this distance can be accommodated without loss of function. Similarly, the preferred positioning of a regulatory sequence element (e.g., an operator, enhancer etc) with respect to a transcribable polynucleotide to be placed under its control is defined by the positioning of the element in its natural setting; i.e., the gene from which it is derived.
[0451] Promoter or promoter sequence as used herein refers to a region of a gene, generally upstream (5) of the RNA encoding region, which controls the initiation and level of transcription in the cell of interest. A promoter includes the transcriptional regulatory sequences of a classical genomic gene, such as a TATA box and CCAAT box sequences, as well as additional regulatory elements (i.e., upstream activating sequences, enhancers and silencers) that alter gene expression in response to developmental and/or environmental stimuli, or in a tissue-specific or cell-type-specific manner. A promoter is usually, but not necessarily (for example, some PolIII promoters), positioned upstream of a structural gene, the expression of which it regulates. Furthermore, the regulatory elements comprising a promoter are usually positioned within 2 kb of the start site of transcription of the gene. Promoters may contain additional specific regulatory elements, located more distal to the start site to further enhance expression in a cell, and/or to alter the timing or inducibility of expression of a structural gene to which it is operably connected.
[0452] Constitutive promoter refers to a promoter that directs expression of an operably linked transcribed sequence in many or all tissues of an organism such as a plant. The term constitutive as used herein does not necessarily indicate that a gene is expressed at the same level in all cell types, but that the gene is expressed in a wide range of cell types, although some variation in level is often detectable. Selective expression as used herein refers to expression almost exclusively in specific organs of, for example, the plant, such as, for example, endosperm, embryo, leaves, fruit, tubers or root. In a preferred embodiment, a promoter is expressed selectively or preferentially in roots, leaves and/or stems of a plant, preferably a cereal plant. Selective expression may therefore be contrasted with constitutive expression, which refers to expression in many or all tissues of a plant under most or all of the conditions experienced by the plant.
[0453] Selective expression may also result in compartmentation of the products of gene expression in specific plant tissues, organs or developmental stages. Compartmentation in specific subcellular locations such as the plastid, cytosol, vacuole, or apoplastic space may be achieved by the inclusion in the structure of the gene product of appropriate signals, eg. a signal peptide, for transport to the required cellular compartment, or in the case of the semi-autonomous organelles (plastids and mitochondria) by integration of the transgene with appropriate regulatory sequences directly into the organelle genome.
[0454] A tissue-specific promoter or organ-specific promoter is a promoter that is preferentially expressed in one tissue or organ relative to many other tissues or organs, preferably most if not all other tissues or organs in, for example, a plant. Typically, the promoter is expressed at a level 10-fold higher in the specific tissue or organ than in other tissues or organs.
[0455] In an embodiment, the promoter is a stem-specific promoter, a leaf-specific promoter or a promoter which directs gene expression in an aerial part of the plant (at least stems and leaves) (green tissue specific promoter) such as a ribulose-1,5-bisphosphate carboxylase oxygenase (RUBISCO) promoter.
[0456] Examples of stem-specific promoters include, but are not limited to those described in U.S. Pat. No. 5,625,136, and Bam et al. (2008).
[0457] In an embodiment, the promoter is a root specific promoter, Examples of root specific promoters include, but are not limited to, the promoter for the acid chitinase gene and specific subdomains of the CaMV 35S promoter.
[0458] The promoters contemplated by the present invention may be native to the host plant to be transformed or may be derived from an alternative source, where the region is functional in the host plant. Other sources include the Agrobacterium T-DNA genes, such as the promoters of genes for the biosynthesis of nopaline, octapine, mannopine, or other opine promoters, tissue specific promoters (see, e.g., U.S. Pat. No. 5,459,252 and WO 91/13992); promoters from viruses (including host specific viruses), or partially or wholly synthetic promoters. Numerous promoters that are functional in mono- and dicotyledonous plants are well known in the art (see, for example, Greve, 1983; Salomon et al., 1984; Garfinkel et al., 1983; Barker et al., 1983); including various promoters isolated from plants and viruses such as the cauliflower mosaic virus promoter (CaMV 35S, 19S). Non-limiting methods for assessing promoter activity are disclosed by Medberry et al. (1992, 1993), Sambrook et al. (1989, supra) and U.S. Pat. No. 5,164,316.
[0459] Alternatively or additionally, the promoter may be an inducible promoter or a developmentally regulated promoter which is capable of driving expression of the introduced polynucleotide at an appropriate developmental stage of the, for example, plant. Other cis-acting sequences which may be employed include transcriptional and/or translational enhancers. Enhancer regions are well known to persons skilled in the art, and can include an ATG translational initiation codon and adjacent sequences. When included, the initiation codon should be in phase with the reading frame of the coding sequence relating to the foreign or exogenous polynucleotide to ensure translation of the entire sequence if it is to be translated. Translational initiation regions may be provided from the source of the transcriptional initiation region, or from a foreign or exogenous polynucleotide. The sequence can also be derived from the source of the promoter selected to drive transcription, and can be specifically modified so as to increase translation of the mRNA.
[0460] The nucleic acid construct of the present invention may comprise a 3 non-translated sequence from about 50 to 1,000 nucleotide base pairs which may include a transcription termination sequence. A 3 non-translated sequence may contain a transcription termination signal which may or may not include a polyadenylation signal and any other regulatory signals capable of effecting mRNA processing. A polyadenylation signal functions for addition of polyadenylic acid tracts to the 3 end of a mRNA precursor. Polyadenylation signals are commonly recognized by the presence of homology to the canonical form 5 AATAAA-3 although variations are not uncommon. Transcription termination sequences which do not include a polyadenylation signal include terminators for Poll or PolIII RNA polymerase which comprise a run of four or more thymidines. Examples of suitable 3 non-translated sequences are the 3 transcribed non-translated regions containing a polyadenylation signal from an octopine synthase (ocs) gene or nopaline synthase (nos) gene of Agrobacterium tumefaciens (Bevan et al., 1983). Suitable 3 non-translated sequences may also be derived from plant genes such as the ribulose-1,5-bisphosphate carboxylase (ssRUBISCO) gene, although other 3 elements known to those of skill in the art can also be employed.
[0461] As the DNA sequence inserted between the transcription initiation site and the start of the coding sequence, i.e., the untranslated 5 leader sequence (5UTR), can influence gene expression if it is translated as well as transcribed, one can also employ a particular leader sequence. Suitable leader sequences include those that comprise sequences selected to direct optimum expression of the foreign or endogenous DNA sequence. For example, such leader sequences include a preferred consensus sequence which can increase or maintain mRNA stability and prevent inappropriate initiation of translation as, for example, described by Joshi (1987).
Vectors
[0462] The present invention includes use of vectors for manipulation or transfer of genetic constructs. A vector is a nucleic acid molecule, preferably a DNA molecule, that can be used to artificially carry foreign genetic material; into another cell, where it can be replicated or expressed. A vector containing foreign DNA is reffered to as a recombinant vector. Examples of vectors include, but are not limited to, plasmids, viral vectors, cosmids, extrachromosomal elements, minichromosomes, artificial chromosomes. The vector may comprise a transposable element.
[0463] A vector preferably is double-stranded DNA and contains one or more unique restriction sites and may be capable of autonomous replication in a defined host cell including a target cell or tissue or a progenitor cell or tissue thereof, or capable of integration into the genome, preferably the nuclear genome, of the defined host such that the cloned sequence is reproducible. Accordingly, the vector may be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a linear or closed circular plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any means for assuring self-replication. Alternatively, the vector may be one which, when introduced into a cell, is integrated into the genome, preferably the nuclear genome, of the recipient cell and replicated together with the chromosome(s) into which it has been integrated. A vector system may comprise a single vector or plasmid, two or more vectors or plasmids, which together contain the total DNA to be introduced into the host cell, or a transposon. The choice of the vector will typically depend on the compatibility of the vector with the cell into which the vector is to be introduced. The vector may also include a selection marker such as an antibiotic resistance gene, a herbicide resistance gene or other gene that can be used for selection of suitable transformants. Examples of such genes are well known to those of skill in the art.
[0464] The nucleic acid construct of the invention can be introduced into a vector, such as a plasmid. Plasmid vectors typically include additional nucleic acid sequences that provide for easy selection, amplification, and transformation of the expression cassette in prokaryotic and eukaryotic cells, for example, pUC-derived vectors, pSK-derived vectors, pGEM-derived vectors, pSP-derived vectors, pBS-derived vectors, or binary vectors containing one or more T-DNA regions. Additional nucleic acid sequences include origins of replication to provide for autonomous replication of the vector, selectable marker genes, preferably encoding antibiotic or herbicide resistance, unique multiple cloning sites providing for multiple sites to insert nucleic acid sequences or genes encoded in the nucleic acid construct, and sequences that enhance transformation of prokaryotic and eukaryotic (especially plant) cells.
[0465] By marker gene is meant a gene that imparts a distinct phenotype to cells expressing the marker gene and thus allows such transformed cells to be distinguished from cells that do not have the marker. A selectable marker gene confers a trait for which one can select based on resistance to a selective agent (e.g., a herbicide, antibiotic, radiation, heat, or other treatment damaging to untransformed cells). A screenable marker gene (or reporter gene) confers a trait that one can identify through observation or testing, i.e., by screening (e.g., -glucuronidase, luciferase, GFP or other enzyme activity not present in untransformed cells). The marker gene and the nucleotide sequence of interest do not have to be linked.
[0466] To facilitate identification of transformants, the nucleic acid construct desirably comprises a selectable or screenable marker gene as, or in addition to, the foreign or exogenous polynucleotide. The actual choice of a marker is not crucial as long as it is functional (i.e., selective) in combination with thehost cell, preferably a plant host cell. The marker gene and the foreign or exogenous polynucleotide of interest do not have to be linked, since co-transformation of unlinked genes as, for example, described in U.S. Pat. No. 4,399,216 is also an efficient process in plant transformation.
[0467] Examples of bacterial selectable markers are markers that confer antibiotic resistance such as ampicillin, erythromycin, chloramphenicol or tetracycline resistance, preferably kanamycin resistance. Exemplary selectable markers for selection of plant transformants include, but are not limited to, a hyg gene which encodes hygromycin B resistance; a neomycin phosphotransferase (nptII) gene conferring resistance to kanamycin, paromomycin, G418; a glutathione-S-transferase gene from rat liver conferring resistance to glutathione derived herbicides as, for example, described in EP 256223; a glutamine synthetase gene conferring, upon overexpression, resistance to glutamine synthetase inhibitors such as phosphinothricin as, for example, described in WO 87/05327; an acetyltransferase gene from Streptomyces viridochromogenes conferring resistance to the selective agent phosphinothricin as, for example, described in EP 275957; a gene encoding a 5-enolshikimate-3-phosphate synthase (EPSPS) conferring tolerance to N-phosphonomethylglycine as, for example, described by Hinchee et al. (1988); a bar gene conferring resistance against bialaphos as, for example, described in WO91/02071; a nitrilase gene such as bxn from Klebsiella ozaenae which confers resistance to bromoxynil (Stalker et al., 1988); a dihydrofolate reductase (DHFR) gene conferring resistance to methotrexate (Thillet et al., 1988); a mutant acetolactate synthase gene (ALS), which confers resistance to imidazolinone, sulfonylurea or other ALS-inhibiting chemicals (EP 154,204); a mutated anthranilate synthase gene that confers resistance to 5-methyl tryptophan; or a dalapon dehalogenase gene that confers resistance to the herbicide.
[0468] Preferred screenable markers include, but are not limited to, a uidA gene encoding a -glucuronidase (GUS) enzyme for which various chromogenic substrates are known; a -galactosidase gene encoding an enzyme for which chromogenic substrates are known; an aequorin gene (Prasher et al., 1985), which may be employed in calcium-sensitive bioluminescence detection; a green fluorescent protein gene (Niedz et al., 1995) or derivatives thereof; a luciferase (luc) gene (Ow et al., 1986), which allows for bioluminescence detection, and others known in the art. By reporter molecule as used in the present specification is meant a molecule that, by its chemical nature, provides an analytically identifiable signal that facilitates determination of promoter activity by reference to protein product.
[0469] Preferably, the nucleic acid construct is stably incorporated into the genome of for example, the plant. Accordingly, the nucleic acid comprises appropriate elements which allow the molecule to be incorporated into the genome, or the construct is placed in an appropriate vector which can be incorporated into a chromosome of a plant cell.
[0470] One embodiment of the present invention includes a recombinant vector, which comprises at least one polynucleotide defined herein, and is capable of delivering the polynucleotide into a host cell. Such a vector contains heterologous nucleic acid sequences, that is nucleic acid sequences that are not naturally found adjacent to nucleic acid molecules of the present invention and that preferably are derived from a species other than the species from which the nucleic acid molecule(s) are derived. The vector can be either RNA or DNA, either prokaryotic or eukaryotic, and typically is a virus or a plasmid.
[0471] Recombinant vectors of the invention comprise fusion sequences which lead to the expression of nucleic acid molecules as fusion proteins.
[0472] Recombinant vectors may also include intervening and/or untranslated sequences surrounding and/or within the nucleic acid sequence of a polynucleotide defined herein.
[0473] Preferably, the recombinant vector is stably incorporated into the genome of a host cell such as a plant cell. Accordingly, the recombinant vector may comprise appropriate elements which allow the vector to be incorporated into the genome, or into a chromosome of the cell.
Recombinant Cells
[0474] Another embodiment of the present invention includes a recombinant cell, for example, a recombinant plant cell, which is a host cell transformed with one or more polynucleotides, constructs, or vectors of the present invention, or progeny cells thereof. The term recombinant cell is used interchangeably with the term transgenic cell herein.
[0475] Transformation of a nucleic acid molecule into a cell can be accomplished by any method by which a nucleic acid molecule can be inserted into the cell. Transformation techniques include, but are not limited to, transfection, electroporation, microinjection, lipofection, adsorption, and protoplast fusion. A recombinant cell may remain unicellular or may grow into a tissue, organ or a multicellular organism. Transformed nucleic acid molecules of the present invention can remain extrachromosomal or can integrate into one or more sites within a chromosome of the transformed cell in such a manner that their ability to be expressed is retained.
[0476] Preferred host cells are plant cells, more preferably cells of a cereal plant, more preferably barley or wheat cells, and even more preferably a wheat cell.
[0477] The recombinant cell may be a cell in culture, a cell in vitro, or in an organism such as, for example, a plant, or in an organ such as, for example, a root, leaf or stem. Preferably, the cell is in a plant, more preferably in roots, leaves, and/or stems of a plant.
[0478] In an embodiment, expression of active NifDK in a plant cell requires expression of NifD, NifK, NifH, NifB, NifE, NifN and optionally, NifU, NifS, NifO, NifV, NifY, NifW, and/or NifZ.
[0479] In another or further embodiment, expression of active NifH in a plant cell requires expression of NifH and NifM and optionally, NifU and/or NifN.
[0480] In an embodiment, reconstitution of nitrogenase activity in a plant cell requires expression of at least NifD, NifK, NifH, NifB, NifE, NifN and NifM.
[0481] The skilled person will appreciate that a smaller subset of Nif proteins may result in functional nitrogenase reconstitution in a plant cell. To the best of the inventors' knowledge, the only report of nitrogenase gene transfer to any photosynthetic organism described introduction of NifH in the chloroplast genome of Chlamydomonas (Cheng et al., 2005). Nif-H was able to complement a chlorophyll biosynthesis mutant, despite the fact that the NifH biosynthetic precursor proteins NifM, NifS and NifU were not co-expressed. This demonstrated that endogenous eukaryotic equivalents may functionally substitute for certain Nif proteins. Indeed a recent report, demonstrating that E. coli can reconstitute nitrogenase function using only eight Nif proteins (Wang et al., 2013), implies achieving function is plants may be less complex than expressing the full complement of Nif proteins. Whilst the inventors have yet to establish functionality of Nif proteins in planta, it is promising that the repertoire of biosynthetic and functional Nif proteins can be expressed in an environment potentially supportive of nitrogenase function.
Transgenic Plants
[0482] The term plant as used herein as a noun refers to whole plants and refers to any member of the Kingdom Plantae, but as used as an adjective refers to any substance which is present in, obtained from, derived from, or related to a plant, such as for example, plant organs (e.g. leaves, stems, roots, flowers), single cells (e.g. pollen), seeds, plant cells and the like. Plantlets and germinated seeds from which roots and shoots have emerged are also included within the meaning of plant. The term plant parts as used herein refers to one or more plant tissues or organs which are obtained from a plant and which comprises genomic DNA of the plant. Plant parts include vegetative structures (for example, leaves, stems), roots, floral organs/structures, seed (including embryo, cotyledons, and seed coat), plant tissue (for example, vascular tissue, ground tissue, and the like), cells and progeny of the same. The term plant cell as used herein refers to a cell obtained from a plant or in a plant and includes protoplasts or other cells derived from plants, gamete-producing cells, and cells which regenerate into whole plants. Plant cells may be cells in culture. By plant tissue is meant differentiated tissue in a plant or obtained from a plant (explant) or undifferentiated tissue derived from immature or mature embryos, seeds, roots, shoots, fruits, tubers, pollen, tumor tissue, such as crown galls, and various forms of aggregations of plant cells-in culture, such as calli. Exemplary plant tissues in or from seeds are cotyledon, embryo and embryo axis. The invention accordingly includes plants and plant parts and products comprising these.
[0483] As used herein, the term seed refers to mature seed of a plant, which is either ready for harvesting or has been harvested from the plant, such as is typically harvested commercially in the field, or as developing seed which occurs in a plant after fertilisation and prior to seed dormancy being established and before harvest.
[0484] A transgenic plant as used herein refers to a plant that contains a nucleic acid construct not found in a wild-type plant of the same species, variety or cultivar. That is, transgenic plants (transformed plants) contain genetic material (a transgene) that they did not contain prior to the transformation. The transgene may include genetic sequences obtained from or derived from a plant cell, or another plant cell, or a non-plant source, or a synthetic sequence. Typically, the transgene has been introduced into the plant by human manipulation such as, for example, by transformation but any method can be used as one of skill in the art recognizes. The genetic material is preferably stably integrated into the genome of the plant, preferably the nuclear genome. The introduced genetic material may comprise sequences that naturally occur in the same species but in a rearranged order or in a different arrangement of elements, for example an antisense sequence. Plants containing such sequences are included herein in transgenic plants.
[0485] In a preferred embodiment, the transgenic plants are homozygous for each and every gene that has been introduced (transgene) so that their progeny do not segregate for the desired phenotype. The transgenic plants may also be heterozygous for the introduced transgene(s), such as, for example, in F1 progeny which have been grown from hybrid seed. Such plants may provide advantages such as hybrid vigour, well known in the art.
[0486] Transgenic plants, as defined in the context of the present invention include progeny of the plants which have been genetically modified using recombinant techniques, wherein the progeny comprise the transgene of interest. Such progeny may be obtained by self-fertilisation of the primary transgenic plant or by crossing such plants with another plant of the same species. This would generally be to modulate the production of at least one protein defined herein in the desired plant or plant organ. Transgenic plant parts include all parts and cells of said plants comprising the transgene such as, for example, cultured tissues, callus and protoplasts.
[0487] Transgenic plants can be produced using techniques known in the art, such as those generally described in A. Slater et al., Plant BiotechnologyThe Genetic Manipulation of Plants, Oxford University Press (2003), and P. Christou and H. Klee, Handbook of Plant Biotechnology, John Wiley and Sons (2004).
[0488] A non-transgenic plant is one which has not been genetically modified by the introduction of genetic material by recombinant DNA techniques. As used herein, the term compared to an isogenic plant, or similar phrases, refers to a plant which is isogenic relative to the transgenic plant but without the transgene of interest. Preferably, the corresponding non-transgenic plant is of the same cultivar or variety as the progenitor of the transgenic plant of interest, or a sibling plant line which lacks the construct, often termed a segregant, or a plant of the same cultivar or variety transformed with an empty vector construct, and may be a non-transgenic plant. Wild type, as used herein, refers to a cell, tissue or plant that has not been modified according to the invention. Wild-type cells, tissue or plants may be used as controls to compare levels of expression of an exogenous nucleic acid or the extent and nature of trait modification with cells, tissue or plants modified as described herein.
[0489] Transgenic plants, as defined in the context of the present invention include progeny of the plants which have been genetically modified using recombinant techniques, wherein the progeny comprise the transgene of interest. Such progeny may be obtained by self-fertilisation of the primary transgenic plant or by crossing such plants with another plant of the same species. Transgenic plant parts include all parts and cells of said plants comprising the transgene such as, for example, cultured tissues, callus and protoplasts.
[0490] Plants contemplated for use in the practice of the present invention include both monocotyledons and dicotyledons. Target plants include, but are not limited to, the following: cereals (for example, wheat, barley, rye, oats, rice, maize, sorghum and related crops); grapes; beet (sugar beet and fodder beet); pomes, stone fruit and soft fruit (apples, pears, plums, peaches, almonds, cherries, strawberries, raspberries and black-berries); leguminous plants (beans, lentils, peas, soybeans); oil plants (rape or other Brassicas, mustard, poppy, olives, sunflowers, safflower, flax, coconut, castor oil plants, cocoa beans, groundnuts); cucumber plants (marrows, cucumbers, melons); fibre plants (cotton, flax, hemp, jute); citrus fruit (oranges, lemons, grapefruit, mandarins); vegetables (spinach, lettuce, asparagus, cabbages, carrots, onions, tomatoes, potatoes, paprika); lauraceae (avocados, cinnamon, camphor); or plants such as maize, tobacco, nuts, coffee, sugar cane, tea, vines, hops, turf, bananas and natural rubber plants, as well as ornamentals (flowers, shrubs, broad-leaved trees and evergreens, such as conifers). Preferably, the plant is a cereal plant, more preferably wheat, rice, maize, triticale, oats or barley, even more preferably wheat.
[0491] As used herein, the term wheat refers to any species of the Genus Triticum, including progenitors thereof, as well as progeny thereof produced by crosses with other species. Wheat includes hexaploid wheat which has genome organization of AABBDD, comprised of 42 chromosomes, and tetraploid wheat which has genome organization of AABB, comprised of 28 chromosomes. Hexaploid wheat includes T aestivum, T. spelta, T. macha, T compactum, T. sphaerococcum, T. vavilovii, and interspecies cross thereof. A preferred species of hexaploid wheat is T. aestivum ssp aestivum (also termed breadwheat). Tetraploid wheat includes T. durum (also referred to herein as durum wheat or Triticum turgidum ssp. durum), T. dicoccoides, T. dicoccum, T polonicum, and interspecies cross thereof. In addition, the term wheat includes potential progenitors of hexaploid or tetraploid Triticum sp. such as T. uartu, T. monococcum or T. boeoticum for the A genome, Aegilops speltoides for the B genome, and T. tauschii (also known as Aegilops squarrosa or Aegilops tauschii) for the D genome. Particularly preferred progenitors are those of the A genome, even more preferably the A genome progenitor is T. monococcum. A wheat cultivar for use in the present invention may belong to, but is not limited to, any of the above-listed species. Also encompassed are plants that are produced by conventional techniques using Triticum sp. as a parent in a sexual cross with a non-Triticum species (such as rye [Secale cereale]), including but not limited to Triticale.
[0492] As used herein, the term barley refers to any species of the Genus Hordeum, including progenitors thereof, as well as progeny thereof produced by crosses with other species. It is preferred that the plant is of a Hordeum species which is commercially cultivated such as, for example, a strain or cultivar or variety of Hordeum vulgare or suitable for commercial production of grain.
[0493] Four general methods for direct delivery of a gene into cells have been described: (1) chemical methods (Graham et al., 1973); (2) physical methods such as microinjection (Capecchi, 1980); electroporation (see, for example, WO 87/06614, U.S. Pat. Nos. 5,472,869, 5,384,253, WO 92/09696 and WO 93/21335); and the gene gun (see, for example, U.S. Pat. Nos. 4,945,050 and 5,141,131); (3) viral vectors (Clapp, 1993; Lu et al., 1993; Eglitis et al., 1988); and (4) receptor-mediated mechanisms (Curiel et al., 1992; Wagner et al., 1992).
[0494] Acceleration methods that may be used include, for example, microprojectile bombardment and the like. One example of a method for delivering transforming nucleic acid molecules to plant cells is microprojectile bombardment. This method has been reviewed by Yang et al., Particle Bombardment Technology for Gene Transfer, Oxford Press, Oxford, England (1994). Non-biological particles (microprojectiles) that may be coated with nucleic acids and delivered into cells by a propelling force. Exemplary particles include those comprised of tungsten, gold, platinum, and the like. A particular advantage of microprojectile bombardment, in addition to it being an effective means of reproducibly transforming monocots, is that neither the isolation of protoplasts, nor the susceptibility of Agrobacterium infection are required. A particle delivery system suitable for use with the present invention is the helium acceleration PDS-1000/He gun is available from Bio-Rad Laboratories. For the bombardment, immature embryos or derived target cells such as scutella or calli from immature embryos may be arranged on solid culture medium.
[0495] In another alternative embodiment, plastids can be stably transformed. Method disclosed for plastid transformation in higher plants include particle gun delivery of DNA containing a selectable marker and targeting of the DNA to the plastid genome through homologous recombination (U.S. Pat. Nos. 5,451,513, 5,545,818, 5,877,402, 5,932,479, and WO 99/05265.
[0496] Agrobacterium-mediated transfer is a widely applicable system for introducing genes into plant cells because the DNA can be introduced into whole plant tissues, thereby bypassing the need for regeneration of an intact plant from a protoplast. The use of Agrobacterium-mediated plant integrating vectors to introduce DNA into plant cells is well known in the art (see, for example, U.S. Pat. Nos. 5,177,010, 5,104,310, 5,004,863, 5,159,135). Further, the integration of the T-DNA is a relatively precise process resulting in few rearrangements. The region of DNA to be transferred is defined by the border sequences, and intervening DNA is usually inserted into the plant genome.
[0497] Agrobacterium transformation vectors are capable of replication in E. coli as well as Agrobacterium, allowing for convenient manipulations as described (Klee et al., Plant DNA Infectious Agents, Hohn and Schell, (editors), Springer-Verlag, New York, (1985): 179-203). Moreover, technological advances in vectors for Agrobacterium-mediated gene transfer have improved the arrangement of genes and restriction sites in the vectors to facilitate construction of vectors capable of expressing various polypeptide coding genes. The vectors described have convenient multi-linker regions flanked by a promoter and a polyadenylation site for direct expression of inserted polypeptide coding genes and are suitable for present purposes. In addition, Agrobacterium containing both armed and disarmed Ti genes can be used for the transformations. In those plant varieties where Agrobacterium-mediated transformation is efficient, it is the method of choice because of the facile and defined nature of the gene transfer.
[0498] A transgenic plant formed using Agrobacterium transformation methods typically contains a single genetic locus on one chromosome. Such transgenic plants can be referred to as being hemizygous for the added gene. More preferred is a transgenic plant that is homozygous for the added structural gene; i.e., a transgenic plant that contains two added genes, one gene at the same locus on each chromosome of a chromosome pair. A homozygous transgenic plant can be obtained by sexually mating (selfing) an independent segregant transgenic plant that contains a single added gene, germinating some of the seed produced and analyzing the resulting plants for the gene of interest.
[0499] It is also to be understood that two different transgenic plants can also be mated to produce offspring that contain two independently segregating exogenous genes. Selfing of appropriate progeny can produce plants that are homozygous for both exogenous genes. Back-crossing to a parental plant and out-crossing with a non-transgenic plant are also contemplated, as is vegetative propagation. Descriptions of other breeding methods that are commonly used for different traits and crops can be found in Fehr, Breeding Methods for Cultivar Development, J. Wilcox (editor) American Society of Agronomy, Madison Wis. (1987).
[0500] Transformation of plant protoplasts can be achieved using methods based on calcium phosphate precipitation, polyethylene glycol treatment, electroporation, and combinations of these treatments. Application of these systems to different plant varieties depends upon the ability to regenerate that particular plant strain from protoplasts. Illustrative methods for the regeneration of cereals from protoplasts are described (Fujimura et al., 1985; Toriyama et al., 1986; Abdullah et al., 1986).
[0501] Other methods of cell transformation can also be used and include but are not limited to introduction of DNA into plants by direct DNA transfer into pollen, by direct injection of DNA into reproductive organs of a plant, or by direct injection of DNA into the cells of immature embryos followed by the rehydration of desiccated embryos.
[0502] The regeneration, development, and cultivation of plants from single plant protoplast transformants or from various transformed explants is well known in the art (Weissbach et al., Methods for Plant Molecular Biology, Academic Press, San Diego, (1988)). This regeneration and growth process typically includes the steps of selection of transformed cells, culturing those individualized cells through the usual stages of embryonic development through the rooted plantlet stage. Transgenic embryos and seeds are similarly regenerated. The resulting transgenic rooted shoots are thereafter planted in an appropriate plant growth medium such as soil.
[0503] The development or regeneration of plants containing the foreign, exogenous gene is well known in the art. Preferably, the regenerated plants are self-pollinated to provide homozygous transgenic plants. Otherwise, pollen obtained from the regenerated plants is crossed to seed-grown plants of agronomically important lines. Conversely, pollen from plants of these important lines is used to pollinate regenerated plants. A transgenic plant of the present invention containing a desired exogenous nucleic acid is cultivated using methods well known to one skilled in the art.
[0504] Methods for transforming dicots, primarily by use of Agrobacterium tumefaciens, and obtaining transgenic plants have been published for cotton (U.S. Pat. Nos. 5,004,863, 5,159,135, 5,518,908); soybean (U.S. Pat. Nos. 5,569,834, 5,416,011); Brassica (U.S. Pat. No. 5,463,174); peanut (Cheng et al., 1996); and pea (Grant et al., 1995).
[0505] Methods for transformation of cereal plants such as wheat and barley for introducing genetic variation into the plant by introduction of an exogenous nucleic acid and for regeneration of plants from protoplasts or immature plant embryos are well known in the art, see for example, CA 2,092,588, AU 61781/94, AU 667939, U.S. Pat. No. 6,100,447, WO 97/048814, U.S. Pat. Nos. 5,589,617, 6,541,257, and other methods are set out in WO 99/14314. Preferably, transgenic wheat or barley plants are produced by Agrobacterium tumefaciens mediated transformation procedures. Vectors carrying the desired nucleic acid construct may be introduced into regenerable wheat cells of tissue cultured plants or explants, or suitable plant systems such as protoplasts. The regenerable wheat cells are preferably from the scutellum of immature embryos, mature embryos, callus derived from these, or the meristematic tissue.
[0506] To confirm the presence of the transgenes in transgenic cells and plants, a polymerase chain reaction (PCR) amplification or Southern blot analysis can be performed using methods known to those skilled in the art. Expression products of the transgenes can be detected in any of a variety of ways, depending upon the nature of the product, and include Western blot and enzyme assay. One particularly useful way to quantitate protein expression and to detect replication in different plant tissues is to use a reporter gene, such as GUS. Once transgenic plants have been obtained, they may be grown to produce plant tissues or parts having the desired phenotype. The plant tissue or plant parts, may be harvested, and/or the seed collected. The seed may serve as a source for growing additional plants with tissues or parts having the desired characteristics.
[0507] The polymerase chain reaction (PCR) is a reaction in which replicate copies are made of a target polynucleotide using a pair of primers or set of primers consisting of upstream and a downstream primer, and a catalyst of polymerization, such as a DNA polymerase, and typically a thermally-stable polymerase enzyme. Methods for PCR are known in the art, and are taught, for example, in PCR (M. J. McPherson and S. G Moller (editors), BIOS Scientific Publishers Ltd, Oxford, (2000)). PCR can be performed on cDNA obtained from reverse transcribing mRNA isolated from plant cells expressing a polynucleotide of the invention. However, it will generally be easier if PCR is performed on genomic DNA isolated from a plant.
[0508] A primer is an oligonucleotide sequence that is capable of hybridising in a sequence specific fashion to the target sequence and being extended during the PCR. Amplicons or PCR products or PCR fragments or amplification products are extension products that comprise the primer and the newly synthesized copies of the target sequences. Multiplex PCR systems contain multiple sets of primers that result in simultaneous production of more than one amplicon. Primers may be perfectly matched to the target sequence or they may contain internal mismatched bases that can result in the introduction of restriction enzyme or catalytic nucleic acid recognition/cleavage sites in specific target sequences. Primers may also contain additional sequences and/or contain modified or labelled nucleotides to facilitate capture or detection of amplicons. Repeated cycles of heat denaturation of the DNA, annealing of primers to their complementary sequences and extension of the annealed primers with polymerase result in exponential amplification of the target sequence. The terms target or target sequence or template refer to nucleic acid sequences which are amplified.
[0509] Methods for direct sequencing of nucleotide sequences are well known to those skilled in the art and can be found for example in Ausubel et al., (supra) and Sambrook et al., (supra). Sequencing can be carried out by any suitable method, for example, dideoxy sequencing, chemical sequencing or variations thereof. Direct sequencing has the advantage of determining variation in any base pair of a particular sequence.
Plant/Grain Processing
[0510] Grain/seed of the invention, preferably cereal grain, or other plant parts of the invention, can be processed to produce a food ingredient, food or non-food product using any technique known in the art.
[0511] In one embodiment, the product is whole grain flour such as, for example, an ultrafine-milled whole grain flour, or a flour made from about 100% of the grain. The whole grain flour includes a refined flour constituent (refined flour or refined flour) and a coarse fraction (an ultrafine-milled coarse fraction).
[0512] Refined flour may be flour which is prepared, for example, by grinding and bolting cleaned grain such as wheat or barley grain. The particle size of refined flour is described as flour in which not less than 98% passes through a cloth having openings not larger than those of woven wire cloth designated 212 micrometers (U.S. Wire 70). The coarse fraction includes at least one of: bran and germ. For instance, the germ is an embryonic plant found within the grain kernel. The germ includes lipids, fiber, vitamins, protein, minerals and phytonutrients, such as flavonoids. The bran includes several cell layers and has a significant amount of lipids, fiber, vitamins, protein, minerals and phytonutrients, such as flavonoids. Further, the coarse fraction may include an aleurone layer which also includes lipids, fiber, vitamins, protein, minerals and phytonutrients, such as flavonoids. The aleurone layer, while technically considered part of the endosperm, exhibits many of the same characteristics as the bran and therefore is typically removed with the bran and germ during the milling process. The aleurone layer contains proteins, vitamins and phytonutrients, such as ferulic acid.
[0513] Further, the coarse fraction may be blended with the refined flour constituent. The coarse fraction may be mixed with the refined flour constituent to form the whole grain flour, thus providing a whole grain flour with increased nutritional value, fiber content, and antioxidant capacity as compared to refined flour. For example, the coarse fraction or whole grain flour may be used in various amounts to replace refined or whole grain flour in baked goods, snack products, and food products. The whole grain flour of the present invention (i.e.-ultrafine-milled whole grain flour) may also be marketed directly to consumers for use in their homemade baked products. In an exemplary embodiment, a granulation profile of the whole grain flour is such that 98% of particles by weight of the whole grain flour are less than 212 micrometers.
[0514] In further embodiments, enzymes found within the bran and germ of the whole grain flour and/or coarse fraction are inactivated in order to stabilize the whole grain flour and/or coarse fraction. Stabilization is a process that uses steam, heat, radiation, or other treatments to inactivate the enzymes found in the bran and germ layer. Flour that has been stabilized retains its cooking characteristics and has a longer shelf life.
[0515] In additional embodiments, the whole grain flour, the coarse fraction, or the refined flour may be a component (ingredient) of a food product and may be used to product a food product. For example, the food product may be a bagel, a biscuit, a bread, a bun, a croissant, a dumpling, an English muffin, a muffin, a pita bread, a quickbread, a refrigerated/frozen dough product, dough, baked beans, a burrito, chili, a taco, a tamale, a tortilla, a pot pie, a ready to eat cereal, a ready to eat meal, stuffing, a microwaveable meal, a brownie, a cake, a cheesecake, a coffee cake, a cookie, a dessert, a pastry, a sweet roll, a candy bar, a pie crust, pie filling, baby food, a baking mix, a batter, a breading, a gravy mix, a meat extender, a meat substitute, a seasoning mix, a soup mix, a gravy, a roux, a salad dressing, a soup, sour cream, a noodle, a pasta, ramen noodles, chow mein noodles, lo mein noodles, an ice cream inclusion, an ice cream bar, an ice cream cone, an ice cream sandwich, a cracker, a crouton, a doughnut, an egg roll, an extruded snack, a fruit and grain bar, a microwaveable snack product, a nutritional bar, a pancake, a par-baked bakery product, a pretzel, a pudding, a granola-based product, a snack chip, a snack food, a snack mix, a waffle, a pizza crust, animal food or pet food.
[0516] In alternative embodiments, the whole grain flour, refined flour, or coarse fraction may be a component of a nutritional supplement. For instance, the nutritional supplement may be a product that is added to the diet containing one or more additional ingredients, typically including: vitamins, minerals, herbs, amino acids, enzymes, antioxidants, herbs, spices, probiotics, extracts, prebiotics and fiber. The whole grain flour, refined flour or coarse fraction of the present invention includes vitamins, minerals, amino acids, enzymes, and fiber. For instance, the coarse fraction contains a concentrated amount of dietary fiber as well as other essential nutrients, such as B-vitamins, selenium, chromium, manganese, magnesium, and antioxidants, which are essential for a healthy diet. For example 22 grams of the coarse fraction of the present invention delivers 33% of an individual's daily recommend consumption of fiber. The nutritional supplement may include any known nutritional ingredients that will aid in the overall health of an individual, examples include but are not limited to vitamins, minerals, other fiber components, fatty acids, antioxidants, amino acids, peptides, proteins, lutein, ribose, omega-3 fatty acids, and/or other nutritional ingredients. The supplement may be delivered in, but is not limited to the following forms: instant beverage mixes, ready-to-drink beverages, nutritional bars, wafers, cookies, crackers, gel shots, capsules, chews, chewable tablets, and pills. One embodiment delivers the fiber supplement in the form of a flavored shake or malt type beverage, this embodiment may be particularly attractive as a fiber supplement for children.
[0517] In an additional embodiment, a milling process may be used to make a multi-grain flour or a multi-grain coarse fraction. For example, bran and germ from one type of grain may be ground and blended with ground endosperm or whole grain cereal flour of another type of cereal. Alternatively bran and germ of one type of grain may be ground and blended with ground endosperm or whole grain flour of another type of grain. It is contemplated that the present invention encompasses mixing any combination of one or more of bran, germ, endosperm, and whole grain flour of one or more grains. This multi-grain approach may be used to make custom flour and capitalize on the qualities and nutritional contents of multiple types of cereal grains to make one flour.
[0518] It is contemplated that the whole grain flour, coarse fraction and/or grain products of the present invention may be produced by any milling process known in the art. An exemplary embodiment involves grinding grain in a single stream without separating endosperm, bran, and germ of the grain into separate streams. Clean and tempered grain is conveyed to a first passage grinder, such as a hammermill, roller mill, pin mill, impact mill, disc mill, air attrition mill, gap mill, or the like. After grinding, the grain is discharged and conveyed to a sifter. Further, it is contemplated that the whole grain flour, coarse fraction and/or grain products of the present invention may be modified or enhanced by way of numerous other processes such as: fermentation, instantizing, extrusion, encapsulation, toasting, roasting, or the like.
Malting
[0519] A malt-based beverage provided by the present invention involves alcohol beverages (including distilled beverages) and non-alcohol beverages that are produced by using malt as a part or whole of their starting material. Examples include beer, happoshu (low-malt beer beverage), whisky, low-alcohol malt-based beverages (e.g., malt-based beverages containing less than 1% of alcohols), and non-alcohol beverages.
[0520] Malting is a process of controlled steeping and germination followed by drying of the grain such as barley and wheat grain. This sequence of events is important for the synthesis of numerous enzymes that cause grain modification, a process that principally depolymerizes the dead endosperm cell walls and mobilizes the grain nutrients. In the subsequent drying process, flavour and colour are produced due to chemical browning reactions. Although the primary use of malt is for beverage production, it can also be utilized in other industrial processes, for example as an enzyme source in the baking industry, or as a flavouring and colouring agent in the food industry, for example as malt or as a malt flour, or indirectly as a malt syrup, etc.
[0521] In one embodiment, the present invention relates to methods of producing a malt composition. The method preferably comprises the steps of:
[0522] (i) providing grain, such as barley or wheat grain, of the invention,
[0523] (ii) steeping said grain,
[0524] (iii) germinating the steeped grains under predetermined conditions and
[0525] (iv) drying said germinated grains.
[0526] For example, the malt may be produced by any of the methods described in Hoseney (Principles of Cereal Science and Technology, Second Edition, 1994: American Association of Cereal Chemists, St. Paul, Minn.). However, any other suitable method for producing malt may also be used with the present invention, such as methods for production of speciality malts, including, but limited to, methods of roasting the malt.
[0527] Malt is mainly used for brewing beer, but also for the production of distilled spirits. Brewing comprises wort production, main and secondary fermentations and post-treatment. First the malt is milled, stirred into water and heated. During this mashing, the enzymes activated in the malting degrade the starch of the kernel into fermentable sugars. The produced wort is clarified, yeast is added, the mixture is fermented and a post-treatment is performed.
Detection of Nitrogenase Complex
[0528] Detection of the nitrogenase complex can be carried out by any method which allows for the detection of the interaction between the NifDK protein complex and the NifH protein. Methods suitable for detecting the interaction between the NifDK protein complex and the NifH protein include any method known in the art for detecting protein-protein interaction including co-immunoprecipitation, affinity blotting, pull down, FRET and the like.
[0529] Alternatively, the detection of the nitrogenase complex can be carried out by measuring the activity of the resulting nitrogenase complex.
[0530] Methods suitable for measuring nitrogenase activity include any method known in the art for detecting the enzymatic reduction of dinitrogen to ammonia wherein electrons are transferred from the NifH protein to the NifDK protein complex. For example, the nitrogen fixation activity can be estimated by the acetylene reduction assay. Briefly, this technique is an indirect method which uses the ability of the nitrogenase complex to reduce triple bounded substrates. The nitrogenase enzyme reduces acetylene (C.sub.2H.sub.2) to ethylene (C.sub.2H.sub.4). Both gases can be quantified using gas chromatography. Nitrogen fixation may also be measured by the hydrogen evolution assay. H.sub.2 is an obligate by-product of N.sub.2 fixation. An indirect measure of nitrogenase activity can thereofere be obtained by quantifying the H.sub.2 concentration in a gas stream using a flow-through H.sub.2 sensor or gas chromatograph.
Detection of N.SUB.2 .Fixation
[0531] Nitrogen fixation can be estimated by determining a net increase in total N of a plant-soil system (N balance method); 2) separating plant N into the fraction taken up from the soil and the fraction derived from the N.sub.2 fixation (N difference, 15N natural abundance, 15N isotype dilution and ureide methods) and 3) measuring the activity of the nitroegnase (acetylene reduction and hydrogen evolution assays).
EXAMPLES
Example 1. Materials and Methods
Expression of Genes in Plant Cells in a Transient Expression System
[0532] Genes were expressed in plant cells using a transient expression system essentially as described by Wood et al., (2009). Binary vectors containing the coding region to be expressed in plant cells by a strong, constitutive 35S promoter were introduced into Agrobacterium tumefaciens strain AGL1 or GV3101. A chimeric binary vector, 35S:p19, for expression of the p19 viral silencing suppressor was separately introduced into AGL1, as described in WO2010/057246. The recombinant A. tumefaciens cells were grown to stationary phase at 28 C. in LB broth supplemented with 50 mg/L kanamycin and 50 mg/L rifampicin. The bacteria were then pelleted by centrifugation at 5000 g for 5 min at room temperature before being resuspended to OD600=1.0 in an infiltration buffer containing 10 mM MES pH 5.7, 10 mM MgCl.sub.2 and 100 M acetosyringone. The cells were then incubated at 28 C. with shaking for 3 hr after which the OD600 was measured and a volume of each culture, including the viral suppressor construct 35S:p19, required to reach a final concentration of OD600=0.125 added to a fresh tube. The final volume was made up with the infiltration buffer. Leaves were then infiltrated with the culture mixture and the plants were typically grown for a further three to five days after infiltration before leaf discs were recovered for analysis.
[0533] For over-expression of more than one gene of interest in combination, each additional gene was introduced separately into an A. tumefaciens strain and grown as before. Bacterial suspensions were mixed so that each bacterial strain was at a final concentration of OD600=0.125. The bacterial strain containing the gene encoding the viral silencing suppressor 35S:p19 was included in all mixtures at the same concentration. For example, to express four genes in a transient leaf assay and including the viral suppressor construct, the final OD600 of the infiltrated mixture was 50.125=0.625 units. The simultaneous over-expression of at least five genes each from separate T-DNA vectors within plant cells in the transient assay formats has previously been demonstrated (Wood et al., 2009).
Protein Extraction from Leaf Tissue
[0534] To analyse polypeptides produced in plant cells after T-DNA introduction, Nicotiana benthamiana leaf samples were harvested by excising about 22 cm leaf pieces from the infiltrated regions 5 days after infiltration (unless otherwise stated). These were frozen immediately in liquid nitrogen and ground to a powder in 2 mL Eppendorf tubes. 300 L of buffer was added to each powder sample. The buffer contained 125 mM Tris-HCl pH 6.8, 4% sodium dodecyl sulphate (SDS), 20% glycerol, 60 mM dithiothreitol (DTT). Samples were heated at 95 C. for 3 min before centrifugation at 12000 g for 2 min. Supernatant containing the extracted polypeptides was removed and 10 L to 100 L used for Western blotting depending on the expected level of polypeptide to be detected.
Western Blot Analysis
[0535] Polypeptides in extracted samples were separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) on NuPAGE Bis Tris 4-12% gels (ThermoFisher) at 200 V for about 1 hr. The separated polypeptides were transferred from each gel to a PVDF membrane using a semi-dry apparatus according to the supplier's instructions (Thermofisher). After blotting, the gels were stained with Coomassie stain for 1 hr, then rinsed in water for visualisation of remaining proteins, to show transfer of the polypeptides had occurred. Membranes with bound polypeptides were blocked overnight in TBST buffer containing 5% skim milk powder at 4 C. TBST buffer is. Anti-HA, and anti-FLAG antibodies were purchased from Sigma. Anti-GFP antibody was a gift from Leila Blackman (Australian National University, Canberra, Australia). Antibodies were added at a 1:5000 dilution in TBST with 5% skim milk powder and the membranes incubated in the solution for 2 hr. Membranes were then washed for 320 min with TBST. The secondary antibody, Immun-Star Goat Anti-Mouse (GAM)-HRP conjugate (Biorad) was added at 1:5000 in TBST with 5% skim milk and the membranes incubated for 1 hour, followed by washing the membrane for 315 min with TBST. For secondary antibody detection, Amersham ECL reagent was used and membranes were developed either with an X-ray developer or on an Amersham imager (Amersham).
Protoplast Preparation
[0536] To isolate protoplasts from leaf tissues, a protocol was adapted from Breuers et al., (2012) as follows. Three days post infiltration (3 dpi), a 2 cm square area of infiltrated leaf was excised, cut into pieces and transferred to a 5 ml syringe. 2 ml of digestion solution containing 1.5% (w/v) cellulase R-10, 0.4% (w/v) macerozyme R-10, 0.4 M mannitol, 20 mM KCl, 20 mM MES pH 5.6, 10 mM CaCl.sub.2 and 0.1% (w/v) BSA was added and a gentle vacuum was manually applied to facilitate entry of the solution into the intercellular spaces in the leaf tissue. The solution and the leaf pieces were transferred to a 2 ml Eppendorf tube and the mixture was incubated for 1 hr at room temperature. The resultant protoplasts were gently extracted by manually inverting the tube. Leaf debris were removed using a forceps and the protoplasts were allowed to sediment before the solution was replaced with imaging solution (0.4 M mannitol, 20 mM KCl, 20 mM MES pH 5.6, 10 mM CaCl.sub.2), 0.1% BSA).
Confocal Laser-Scanning Microscopy and Mitochondria Staining
[0537] Protoplasts were imaged using an upright Leica confocal laser-scanning microscope with a 40 water immersion objective. GFP was excited at 488 nm and emission was recorded at 499-535 nm. Mitochondria were stained for 10-20 min using a 100 nM solution of MitoTrackerR Red CMXRos (ThermoFisher Scientific). MitoTrackerR Red CMXRos was excited at 561 nm and emission was recorded at 570-624 nm.
RNA Extraction, cDNA Synthesis and Analysis
[0538] To extract RNA from N. benthamiana cells which had been infiltrated with Agrobacterium, leaf pieces of about 22 cm in area were frozen with liquid nitrogen, ground to a powder, and 500 l of Trizol buffer (Thermo Fisher Scientific) added per sample. Following this, the Trizol supplier's instructions were followed except with these modifications: the chloroform extraction was repeated and the RNA was dissolved at 37 C. The extracted RNA was treated with RQ1 DNAse (Promega) to remove any extracted DNA. The RNA preparations were then further purified using Plant RNAeasy columns (Qiagen). When performed, cDNA synthesis was carried out using Superscript II reverse transcriptase (Thermo Fisher Scientific) according to the supplier's protocol with an oligo-dT primer. For RT-PCR analysis of each RNA sample, three separate cDNA synthesis reactions were carried out. The 20 l cDNA reactions were diluted 20-fold in nuclease free water. qRT-PCR was carried out on a Qiagen rotor gene Q real-time PCR machine. 9.6 l of each cDNA was added to 10 l of 2 sensifast no ROX SYBR Taq (Bioline) and 0.4 l of forward and reverse primers at 10 mol each, for a final reaction volume of 20 l. All qPCR reactions (for both reference and specific genes) were carried out in triplicate under the following cycling conditions: 1 cycle of 95 C./5 min, 45 cycles of 95 C./15 sec, 60 C./15 sec and 72 C./20 sec. Fluorescence was measured at the 72 C. step. A 55 C. to 99 C. melting cycle was then carried out. Control amplifications for a constitutively expressed N. benthamiana GADPH mRNA were used to normalise gene expression using the comparative quantitation program in the rotor gene software package. The values for each set of three cDNAs, representing the average of triplicate assays, were averaged, allowing for a calculation of the standard error of the mean (SEM).
Tandem Mass Spectral Analysis
[0539] Infiltrated N. benthamiana tissue was ground under liquid N.sub.2 then processed using a Retsch tissue-lyser in 2 mL Eppendorf tubes in 50 mM Tris-HCL pH 7.5, 1 mM EDTA, 150 mM NaCl, 0.2% SDS, 10% glycerol, 5 mM DTT, 0.5 mM PMSF and 1% protease inhibitor cocktail for plants (Sigma, catalog number P9599). Protein extracts were cleared by centrifugation and the supernatants used directly as input for overnight incubation with monoclonal anti-HA antibody conjugated to agarose beads (Sigma, catalog number A2095). Unbound proteins were removed by a series of washes with 150 mM Tris-HCL pH 7.5, 5 mM EDTA, 150 mM NaCl, 0.1% Triton X-100, 5% glycerol, 5 mM DTT, 0.5 mM PMSF and 1% protease inhibitor cocktail. Bound proteins were eluted by incubating beads in Laemmli buffer (50 mM Tris-HCl, pH 6.8, 2% (w/v) SDS, 0.1% (w/v) bromophenol blue, 10% (v/v) glycerol, 100 mM DTT) at 95 C. for 10 minutes. Input and immuno-precipitated protein samples were separated by SDS-PAGE and the area of gel that contained the fusion polypeptide (MTP::NifH::HA) determined by concurrent Western analysis from a replicate gel. The region containing the fusion polypeptide was excised, treated with in-gel tryptic digestion, and the tryptic products analysed by tandem mass spectral analysis using an Agilent Chip Cube system coupled to an Agilent Q-TOF 6550 mass spectrometer (Campbell et al., 2014). Mass spectra derived from tryptic peptides from common contaminants such as the added trypsin and keratin were identified before the remaining mass spectral data were used to search against a database containing all protein sequences from Nicotiana species from the NCBI (database number Oct. 3, 2015) plus the HA sequence using SpectrumMill software (Agilent Rev B.04.01.141 SP1) with a precursor mass tolerance of 15 ppm, product mass tolerance of 50 ppm, default Q-TOF scoring and stringent default autovalidation settings. Modification of cysteine residues by acrylamide was a required modification and oxidation of methionine was allowed as a variable modification. Initially, tryptic cleavage was required and up to two missed cleavages were allowed. After validating peptide matches, the search was repeated with the remaining unmatched spectra allowing for non-tryptic cleavage.
Software Used for Molecular Modelling
[0540] All homology models were constructed using the MODELLER program (Sali and Blundell, 2013) as implemented in Accelrys Discovery Studio 3.5. Suitable templates upon which to build the homology models were identified using BLAST searching against the Brookhaven Protein Databank. All sequence alignments were carried out using the ClustalW algorithm (Sali and Blundell, 2013) as implemented in Discovery Studio 3.5. All molecular dynamics simulations were performed with Amber 12.
Transformation of Azotobacter vinelandii
[0541] Plasmids were transformed into Azotobacter vinelandii according to the method of Dos Santos (2011). Briefly, A. vinelandii DJ1271 was struck on to solid Burk's medium lacking molybdate from DMSO stocks and passaged an additional time to rid the cells of DMSO contamination. A loopful of cells was used to inoculate 50 mL of modified Burk's medium lacking molybdate and added iron in a 125 mL Erlenmeyer flask. The culture was incubated at 28 C. shaking at 160 rpm for 20-24 hr. 1 ng of the desired plasmid DNA was added to 50 L aliquots of the competent cells and incubated at room temperature for 20 min. The cell-DNA mixture was then added to 3.8 mL of modified Burk's medium and recovered for 24 hr at 28 C. shaking at 160 rpm. Aliquots of the recovered cells were plated on solid modified Burk's medium containing 6 g/mL kanamycin and 20 g/mL ampicillin to select for the carriage of pMMB66EH and its derivatives. The plates were incubated at 28 C. for 3-5 days. Single colonies were re-passaged on solid modified Burk's medium to obtain single colony isolates. Re-passaged isolates that retained ampicillin resistance were used to inoculate solid modified Burk's medium for the preparation of DMSO stocks and further testing.
Example 2. Use of a MTP from a Yeast CoxIV Gene to Target Nif Polypeptides to Plant Mitochondria
[0542] To the best of the inventors' knowledge, there are no published reports of the production of bacterial nitrogenase (Nif) polypeptides in higher plants, including for example in plant mitochondria. To attempt such production in mitochondria, the inventors developed a plant-based, transient expression system in Nicotiana benthamiana leaves to determine if Nif polypeptides could be produced and detected in plant cells, and to test whether fusion polypeptides based on bacterial Nif polypeptides could be targeted to mitochondria in the plant cells by using mitochondrial targeting peptides (MTP). To test localisation to mitochondria, a MTP derived from the N-terminal region of a yeast cytochrome-c oxidase subunit IV (CoxIV) protein was selected. The CoxIV MTP had been shown to provide for mitochondrial localisation and processing of a fusion polypeptide with GFP in plant cells (Kohler et al., 1997). The CoxIV MTP (SEQ ID NO:1) was only 29 amino acids long prior to cleavage, being shorter than many other MTPs (Huang et al., 2009). When this MTP was processed in yeast cells, either 17 or 25 amino acids were removed (Hurt et al., 1985), potentially leaving as few as 4 amino acid residues from the MTP attached to the N-terminus of the polypeptide. Later studies (Huang et al, 2009) in plant cells predicted, however, that processing in the mitochondrial matrix (MM) by the mitochondrial matrix protease (MMP) would cleave the peptide immediately upstream of the serine-serine at amino acids 20-21, generating a processed fusion polypeptide with an added 10 amino acid residues from the MTP at the N-terminal end of the fusion polypeptide. It was considered by the inventors that a shorter MTP sequence might be an advantage, in particular if the post-cleavage fusion added only 10 amino acids.
[0543] A derivative of the CoxIV MTP, referred to herein as dCoxIV (SEQ ID NO:2), was designed. The dCoxIV comprises conserved arginine and serine residues in the motif xRxxxSSx (SEQ ID NO:3) involved in import and processing of polypeptides into mitochondria according to Huang et al., (2009), who found from genome-wide studies into mitochondrial targeting and processing sites that the most important residues for import and processing in the plant mitochondrial matrix (MM) were an arginine at position either three or four residues upstream of the cleavage site (3R or 4R) and two serine residues immediately after the cleavage site (+1S, +2S). The dCoxIV had two additional amino acids inserted towards the N-terminal end and also had a glutamate at position 28 in SEQ ID NO:2 rather than a corresponding glutamine in the native CoxIV MTP. These changes were not expected to affect the localization or cleavage of the dCoxIV peptide.
Construction of Vectors pCW440 and pCW441
[0544] For introduction of genes into plant cells, a multi-purpose plant/bacterial expression vector was designed and made, pCW440. This was based on a binary vector to allow for replication and selection in both Escherichia coli and Agrobacterium tumefaciens bacteria as well as containing a T-DNA region for transfer of genes from A. tumefaciens into plant cells. To make pCW440, pORE1 (Coutu et al., 2007) was treated to remove the plant selectable marker gene, generating pORE1-null. This vector contained a 35S promoter and a nos 3 transcription terminator region. A DNA fragment was synthesized to contain, in order, a promoter for T7 RNA polymerase, a 5UTR sequence, a nucleotide sequence encoding the dCoxIV MTP initiated by the ATG start codon, a cloning site for the restriction enzyme AscI, and a transcription termination region for T7 RNA polymerase. The sequence of this fragment was based in part on the pET14b vector (Novogene). The fragment was flanked by restriction sites to allow ligation into pORE-null between the 35S promoter and nos 3 region, thus generating pCW440. The nucleotide sequence of the T-DNA region of pCW440 is provided as SEQ ID NO:4.
[0545] The components of the expression cassette within the T-DNA of the vector were, in order in the direction of transcription, a CaMV 35S promoter (nucleotides 219-1564 of SEQ ID NO:4), flanked by a HindIII site and an XhoI site for cloning purposes, to drive expression of a downstream protein coding region in plant cells to produce the fusion polypeptide, then the T7 promoter (nucleotides 1571-1587) which allowed for expression in suitable E. coli cells of the coding region to produce the same polypeptide, then nucleotides encoding the dCoxIV MTP (nucleotides 1650-1742) initiated by an ATG start codon, followed by a restriction enzyme site for AscI (nucleotides 1743-1750) as a cloning site for insertion of the protein coding region, then the T7 RNA polymerase transcription termination sequence (nucleotides 1810-1856) and finally the nos 3 plant transcription termination sequence (nucleotides 1861-2084). A genetic map of pCW440 is shown schematically in
[0546] The nucleotide sequence encoding the MTP was inserted into pCW440 in a manner to allow for insertion of any desired protein coding region into the AscI site to provide an in-frame fusion of the encoded protein to the C-terminus of the dCoxIV amino acids in the translated polypeptide. The vector and its derivatives were stable in E. coli and can be used to produce proteins by the T7 polymerase promoter system (Studier and Moffatt, 1986). The multi-purpose pCW440 was therefore designed as a base vector to express fusion polypeptides in bacteria using commercially-available T7 RNAs polymerase cell lines, such as BL21 gold, in which the T7 promoter and terminator control the expression of the fusion protein. As bacteria lack mitochondria, no processing would occur in the E. coli of a full-length fusion polypeptide comprising a MTP. The same vector can be used in plant cells to express the same fusion polypeptide under the control of the 35S promoter and the nos 3 terminator controlling gene expression using the endogenous transcription machinery in the plant cells.
[0547] To generate pCW441, a DNA fragment encoding the open reading frame of GFP (Brosnan et al., 2007) without its initial methionine residue was amplified by PCR, flanked by AscI sites to allow insertion into the AscI site of pCW440 and permitting a translational fusion between dCoxIV and GFP. The insertion at the AscI site introduced three additional amino acids at the junction of the fusion polypeptide. The DNA fragment was inserted into pCW440 to generate pCW441.
[0548] To test whether the dCoxIV region was able to direct a GUS-fusion polypeptide to plant mitochondria, A. tumefaciens cells comprising pCW441 (dCoxIV::GFP) were infiltrated into N. benthamiana leaves using the method as described in Example 1. It was known that N-terminal fusions to GFP generally do not affect its fluorescing activity (Kohler et al., 1997), therefore the dCoxIV::GFP polypeptide was expected to retain fluorescing activity if it were expressed. Control infiltrations were done at the same time with A. tumefaciens containing constructs for expressing a cytoplasmically located GFP, pUQ214 (Brosnan et al., 2007). All infiltrations included A. tumefaciens cells comprising a construct encoding the viral suppressor of silencing, p19, which was also used alone as a control infiltration. Four days after infiltration, the infiltrated leaf zones were examined for fluorescence by light microscopy with blue light excitation at 488 nm and a GFP filter to detect any GFP polypeptide. Fluorescence was observed in the cells of leaves infiltrated with pCW441. Under the microscope, numerous small subcellular structures were observed to fluoresce, a result consistent with a previous report (Kohler et al., 1997). Those structures were highly mobile and tended to congregate at the edges of the cell, consistent with them being mitochondria. In contrast, cells into which the gene encoding the cytoplasmic GFP had been introduced fluoresced more evenly. It was concluded that dCoxIV was sufficient to direct the dCoxIV::GFP polypeptide into plant mitochondria as evident by the movement of small the mitochondria-like particles within the plant cell.
Design and Construction of Vectors pCW446, pCW447, pCW448 and pCW449
[0549] Based on the observation that the dCoxIV::GFP fusion polypeptide was produced in plant cells after transient expression and appeared to be localised to mitochondria, a series of vectors was designed and constructed to provide for expression of dCoxIV::Nif fusion polypeptides. Initially, genetic constructs were designed and made to express fusions to Klebsiella pneumoniae NifH, NifD, NifK and NifY. The amino acid sequences for the wild-type K. pneumoniae NifH, NifD, NifK and NifY are provided as SEQ ID NOs:5, 6, 7 and 8 respectively. In an attempt to improve translation efficiencies, the protein coding regions for these polypeptides were codon-modified using a human codon bias, and cryptic splice sites, cryptic polyadenylation signals, and internal repeat sequences were removed from the nucleotide sequences by the commercial supplier (Geneart). For each fusionpolypeptide, the Nif initiator methionine was omitted. Furthermore, the open reading frames each included a nucleotide sequence encoding a C-terminal extension to each polypeptide, the extension including either an HA- or a FLAG-epitope (for example, Wood et al., 2006) to provide for easier detection of the polypeptides using antibodies to the epitopes from commercial sources. When the translated polypeptides had a similar size, different epitopes were added to allow the proteins to be distinguished by use of different antibodies, which are commercially available. For example, the NifD and NifK fusion polypeptides had a similar size and therefore NifD) was fused to a FLAG epitope and NifK to a HA epitope. The amino acid sequences that were added at each C-terminus are provided as SEQ ID NO:21 for the HA epitope, and SEQ ID NO:22 for the FLAG epitope. The amino acid sequences for the fusion polypeptides including the dCoxIV MTP and the epitopes are provided as SEQ ID NOs:23, 24, 25 and 26, respectively.
[0550] The codon-optimised nucleotide sequences encoding the NifH::HA, NifD::FLAG, NifK::HA and NifY::HA polypeptides are provided as SEQ ID NOs: 27, 28, 29 and 30, respectively. DNA fragments having these nucleotide sequences were synthesised by a commercial supplier, each including flanking AscI restriction sites, and each was inserted into the AscI site of pCW440 to generate the vectors pCW446 (pCoxIV::NifH::HA), pCW447 (pCoxIV::NifD::FLAG), pCW448 (pCoxIV::NifK::HA) and pCW449 (pCoxIV::NifY::HA).
Expression of the Fusion Polypeptides in Bacteria
[0551] The multi-purpose nature of these vectors allowed for the expression of the genes and production of the fusion polypeptides in suitable bacterial cells, to provide a source of the polypeptides which could be used as controls in gel electrophoresis and immuno-detection experiments. Therefore, these vectors were introduced into E. coli strain BL21.1-Gold (Stratagene) which allows for expression from the T7 promoter in the genetic constructs after induction by growth in Overnight Express media (EMD-Millipore) at 37 C. The bacterial cultures harbouring pCW446, pCW447, pCW448 or pCW449 were centrifuged to collect the cells. The cells were lysed in half volume BugBuster reagent (EMD-Millipore) for 2 min at room temperature. The lysate was further centrifuged to collect the inclusion bodies which were washed a further two times in half volume BugBuster reagent. The inclusion bodies were dissolved in standard Laemmli Buffer which contained SDS and further diluted as required to generate a clear signal on Western blots. Western blots were probed with commercially available antibodies recognising the HA or FLAG epitope at 1:5000 dilution and a rabbit anti-mouse HRP secondary, with ChemStar chemiluminescent reagent (Amersham) as the final detection solution.
Expression of the Fusion Polypeptides in Plant Cells
[0552] Each of the genetic constructs for expression of the dCoxIV::Nif::HA or FLAG tagged fusion polypeptides were introduced separately into N. benthamiana leaves using the method described in Example 1. As mentioned above, all infiltrations included A. tumefaciens cells comprising a construct encoding the viral suppressor of silencing, p19, to reduce gene silencing responses. After 5 days, the infiltrated zones were harvested and treated as described in Example 1 and as above for the bacterially-produced extracts, by Western blot techniques using the antibodies that bound the HA or FLAG epitopes. This detected the polypeptides and assayed their sizes and relative expression levels. In the gel electrophoresis step, aliquots of the bacterial and plant extracts were applied to adjacent lanes to allow for detection of possible small changes in size of the polypeptides, which were predicted if the dCoxIV MTP were cleaved. For example, the size of the full-length dCoxIV::NifY::HA polypeptide was approximately 30 kDa whereas the size of a processed dCoxIV::NifY::HA polypeptide was predicted to be 28 kDa.
[0553] When the Western blots (
[0554] For the dCoxIV::NifD::FLAG fusion polypeptide, quite a different result was observed for the plant cells compared to the bacteria cells. When the fusion polypeptide was expressed from pCW447 in the bacteria and the samples assayed by Western blot using the antibody to detect FLAG-tagged polypeptides, a strong band was observed at 55 kDa, as expected for the full-length fusion polypeptide (
[0555] The experiment with the NifD construct was repeated several times to check the result. Again, the dCoxIV::NifD::FLAG polypeptide was not detected in extracts from the plant cells, even after extended exposures of the Western blots. The genetic construct was checked by sequencing with NifD-specific and 35S-specific primers to confirm the correct sequences of the promoter and NifD fragment in the pCW440 backbone. It was clear that the open reading frame was intact because the same construct expressed well in the E. coli strain.
Expression of Other Nif Fusion Polypeptides in Plant Cells
[0556] Analogous genetic constructs were made encoding a larger set of Nif fusion polypeptides, using the K. pneumoniae sequences in each case, and using pCW440 as the base vector. This included codon optimisation of the protein coding regions, omission of the native Nif initiator methionine, and addition of a C-terminal extension containing an HA- or FLAG-epitope tag to each fusion polypeptide. These constructs were pCW452 (dCoxIV::NifB::HA; amino acid sequence SEQ ID NO:31); pCW454 (dCoxIV::NifE::HA; SEQ ID NO:32); pCW455 (dCoxIV::NifN::FLAG; SEQ ID NO:33); pCW456 (dCoxIV::NifQ::HA; SEQ ID NO:34); pCW450 (dCoxIV::NifS::HA; SEQ ID NO:35); pCW451 (dCoxIV::NifU::FLAG; SEQ ID NO:36) and pCW453 (dCoxIV:NifX::FLAG; SEQ ID NO:37).
[0557] For each of these, production of the full-length fusion polypeptide in N. benthamiana cells was readily detected after introduction of the relevant T-DNA from Agrobacterium. In each case, the size of the detected full-length polypeptide was the same as the size of the corresponding bacterially-produced polypeptide, indicating a lack of cleavage of the MTP by MMP in the plant cells. In some cases, multiple bands were observed on the Western blots. In particular, expression of the dCoxIV translational fusion polypeptides to NifH::HA, NifS::HA and NifN::FLAG produced some smaller bands on the Western blots, possibly due to translation starting at cryptic, internal start codons within the open reading frames or due to cleavage of the polypeptide in the plant cells or during extraction such that the epitope at the C-terminal end was still present in the detected band. From this analysis, production of the NifH, NifS, NifU and NifX fusion polypeptides appeared to be at greater levels than the others, whereas the NifK, NifY, NifE, NifN, NifB and NifQ fusion polypeptides were detected at moderate to low levels. Once again, production of the NifD fusion polypeptide in the plant cells was not detected. The inventors concluded that all of the Nif fusion polypeptides except for the NifD polypeptide could be expressed in plant cells using this approach, although expressed at different levels despite similar codon usage parameters and identical promoter and polyadenylation regulatory sequences, or accumulating at different abundances. Importantly, the inventors concluded that there was something unusual about the construct or the fusion polypeptide for NifD, as it was clearly the standout.
Example 3. Further Attempts to Detect Production of a NifD Fusion Polypeptide in Plant Cells
[0558] Given the lack of detection of the dCoxIV::NifD::FLAG fusion polypeptide as described in Example 2, the inventors hypothesised that this Nif fusion polypeptide might be sensitive to degradation, related perhaps to oxygen concentration, photosynthesis in the leaf cells or potentially mis-folding and therefore instability of the polypeptide, perhaps due to a lack of a putative chaperone protein (Ribbe and Burgess, 2001). To test these hypotheses, A. tumefaciens containing the vector pCW447 whose T-DNA encoded the pCoxIV::NifD::FLAG polypeptide was infiltrated into N. benthamiana leaves. The infiltrated plant tissues were excised and maintained on liquid culture medium for 24 hr under varied conditions. Combinations of each of these variations were also tested. The variations included maintaining the plant tissues at oxygen concentrations of 21% (ambient oxygen concentration), 5% or 1% in the dark or in the light. Co-introduction of a genetic construct to express a GroEL polypeptide (Ribbe and Burgess, 2001) or a leghaemoglobin (Ott et al., 2005) was also carried out in some infiltrations (Lhb;
[0559] None of these variations in the conditions or the genes resulted in the detection of the dCoxIV::NifD::FLAG fusion polypeptide in the N. benthamiana cells, even though the control infiltrations yielded strong production of other Nif fusion polypeptides such as the dCoxIV::NifN:FLAG polypeptide.
[0560] The inventors concluded from these experiments that expression of a NifD fusion polypeptide in plant cells presented a problem that needed to be solved.
Example 4. Expression of Multiple Vectors Expressing a Combination of Nif Polypeptides in Plant Cells
[0561] The inventors also tested whether four Nif fusion polypeptides could be co-expressed in the N. benthamiana leaf system, and whether this might improve the level of production of the dCoxIV::NifD polypeptide. This was attempted by mixing four A. tumefaciens cell suspensions, each containing a different gene for expression, namely for dCoxIV fusions to NifY::HA, NifD::FLAG, NifK::HA and NifH::HA, along with A. tumefaciens containing the p19 construct. When extracts from the infiltrated leaf tissues were assayed as before by Western blotting, this four Nif gene co-infiltration experiment generated bands for dCoxIV::NifK, dCoxIV::NifY and dCoxIV::NifH, although each were detected at much lower levels than when expressed singly, but no detectable band for dCoxIVNifD. Therefore, once again, the NifD fusion polypeptide appeared to be different to the other Nif polypeptides. The combination of dCoxIV::NifK::HA, dCoxIV::NifH::HA and dCoxIV::NifY::HA did not enhance production of the co-expressed dCoxIV::NifD::FLAG to detectable levels.
DISCUSSION
[0562] In the experiments described above, genetic constructs were synthesized and used, each encoding a derivative of a yeast mitochondrial targeting peptide (MTP), dCoxIV, fused separately to ten different Nif polypeptides. These were also fused to either a HA or a FLAG epitope tag at each C-terminus to detect the polypeptides when produced in the bacterial or plant cells, and shown to be expressed in leaf tissues after introduction of the T-DNAs by A. tumefaciens. Processing of the MTP within the mitochondria was tested by carefully comparing the sizes of the polypeptides extracted from the bacterial and N. benthamiana cells. It was observed that all ten of the dCoxIV-Nif fusion polypeptides were readily detected in the Western blot assays after being produced in E. coli bacteria, but only nine of the polypeptides were detected after introduction into the N. benthamiana cells. The exception was the dCoxIV::NifD::FLAG polypeptide which was consistently not detected. Varying the environmental conditions under which the plant tissues were maintained did not result in detection of that polypeptidereduced oxygen concentrations, maintaining the plant tissues in the dark vs in the light, or the presence of a co-expressed leghaemoglobin or a GroEL chaperonin protein.
[0563] NifD is a critical component of the nitrogenase enzyme complex. Therefore, the experiments in the following Examples were carried out in attempts to alleviate the lack of expression of a NifD fusion polypeptide.
Example 5. Validation of a pFA MTP for Directing Proteins into Plant Mitochondria
[0564] As described in Examples 2-4, production of ten of eleven tested Nif fusion polypeptides was demonstrated in N. benthamiana leaf cells using a dCoxIV MTP, the sole exception being the NifD fusion polypeptide. In each case, processing of the targeting peptide was not observed. The inventors therefore tested whether a different MTP sequence fused with NifD and other Nif polypeptides would provide detectable expression in plant cells and cleavage of the fusion polypeptide. For that purpose, the inventors selected a MTP from an A. thaliana F1-ATPase -subunit (pFA). That MTP of 77 amino acid residues in length had been functionally validated in Arabidopsis protoplasts (Lee et al., 2012) by fusions with a GFP reporter polypeptide. Cleavage of the pFA MTP sequence by matrix processing protease (MPP) occurs after amino acid 42, leaving a C-terminal part of 35 amino acids fused to the N-terminus of the fusion polypeptide. It was not known how many of the 35 amino acids were required for mitochondrial localisation and processing in N. benthamiana leaf cells, therefore the inventors decided to use the entire 77 amino acid sequence. The ability of the pFA MTP to transport fused Nif polypeptides to the MM of intact plant leaf cells was therefore tested using the N. benthamiana transient leaf assay system.
[0565] A DNA fragment of 970 bp was chemically synthesised which encoded a 319 amino acid polypeptide consisting of 77 amino acids of the pFA MTP (amino acids 1-77 of SEQ ID NO:38) fused to GFP (GFP 65T, GenBank accession No. U43284; Haas et al., 1996) separated by the three amino acids gly-ala-pro (GAP) and also included flanking NcoI and AscI restriction sites. After NcoI and AscI (partial) digestion, the fragment was inserted into the NcoI to AscI sites of pCW441, generating the vector pRA01. Digestion of pRA01 with AscI excised the GFP coding region but left the pFA MTP sequence and the GAP amino acids, generating the vector pRAOO which was used as the base vector for cloning of Nif fusion polypeptides. When a Nif or other polypeptide was fused downstream of pFA MTP plus the GAP amino acids by insertion of a DNA sequence at the AscI site, the resultant genetic construct encoded the pFA MTP plus the GAP amino acids at the junction of the fusion, thereby adding an 80 amino acid N-terminal extension to the Nif or other polypeptide (SEQ ID NO:38). Processing of the pFA MTP in mitochondria was expected to cleave off the 42 amino acids from the N-terminus including the initiator methionine, reducing the size of the expressed polypeptide by about 4.6 kDa. Cleavage of the MTP was therefore expected to leave 38 amino acids from the C-terminal extension fused N-terminally to the Nif or other polypeptide.
[0566] As a control vector which would encode the same length N-terminal extension but not provide mitochondrial processing by MPP, a second vector was made which encoded a disabled version of the pFA MTP. In this vector, 24 amino acid substitutions were introduced in regions of the MTP required for its mitochondrial recognition and processing (Lee et al., 2012), including the amino acids at the cleavage site of pFA. Each substitution replaced the wild-type amino acids in the pFA MTP of pRA1 with alanine residues (
[0567] To test the ability of the pFA MTP to localise fusion polypeptides to the mitochondria in plant cells, pRA01 was utilized in transient N. benthamiana leaf assays. As a control to detect matrix processing of the pFA::GFP fusion polypeptide in plant cells, a corresponding vector encoding the mFA::GFP fusion polypeptide was also made, designated pRA21 (Table 3). Five days after infiltration of leaves with A. tumefaciens containing either pRA01 or pRA21, leaf samples from the infiltrated zones were harvested and protein extracts prepared as described in Example 1. SDS-PAGE gel electrophoresis and Western blotting were carried out on the protein extracts using a GFP antibody. From introduction of pRA01 (pFA::GFP), a polypeptide band was observed on the Western blots having the expected size (30 kDa) for a GFP polypeptide which had been cleaved at the predicted site, whereas for pRA21 (mFA::GFP), a larger sized band was observed (35 kDa) of the expected size for the unprocessed fusion polypeptide (
[0568] To visualise the localisation of the GFP polypeptide, protoplasts were prepared as described in Example 1 from the leaf tissues containing pRA01 (pFA::GFP) and were examined by confocal microscopy. Protoplasts were imaged using an upright Leica confocal laser-scanning microscope with a 40 water immersion objective. GFP was excited at 488 nm and emission was recorded at 499-535 nm. As a counterstain to identify mitochondria, the protoplasts were also stained for 10-20 min using a 100 nM solution of MitoTrackerR Red CMXRos (ThermoFisher Scientific, Cat. No. M7512). MitoTrackerR Red CMXRos was excited at 561 nm and emission was recorded at 570-624 nm. In this way, fluorescence images for both fluorophores could be overlaid. By these means, it was observed that the GFP fluorescence co-localised with the MitoTrackerR and therefore was localised to the mitochondria. The inventors therefore concluded that, at least for pFA::GFP, the MTP was translocating the fusion polypeptide to the MM in N. benthamiana leaf cells and also provided for its cleavage by MPP (
TABLE-US-00003 TABLE 3 Genetic constructs encoding Nif fusion polypeptides Mol Wt Mol Wt SEQ ID NO Nif Construct Encoded Codon (unprocessed) (processed) of the encoded polypeptide ID polypeptide optimization Epitope (kDa) (kDa) polypeptide none pRA00 pFA Arabidopsis none N/A N/A 38 (pFA) none pRA01 pFA::GFP N/A none 35.7 31 none pRA21 mFA::GFP N/A none 35.7 35.7 B pRA03 pFA::NifB::HA human HA 61 56.3 46 D pRA07 pFA::NifD::FLAG human FLAG 63.8 59.1 47 E pRA09 pFA::NifE::HA human HA 60.3 55.6 48 F pRA05 pFA::NifF::HA Arabidopsis HA 29 24.3 40 H pRA10 pFA::NifH::HA human HA 42 37.3 42 J pRA06 pFA::NifJ::FLAG Arabidopsis FLAG 137.9 133.2 49 K pRA11 pFA::NifK::HA human HA 68 63.3 50 M pRA18 pFA::NifM::HA Arabidopsis HA 40.6 35.9 51 N pRA13 pFA::NifN::FLAG human FLAG 60.3 55.6 52 Q pRA08 pFA::NifQ::HA human HA 29.8 25.1 53 S pRA16 pFA::NifS::HA human HA 53.3 48.6 54 U pRA15 pFA::NifU::FLAG human FLAG 39.4 34.7 55 V pRA17 pFA::NifV::FLAG Arabidopsis FLAG 51 46.3 56 X pRA14 pFA::NifX::FLAG human FLAG 28 23.3 57 Y pRA12 pFA::NifY::HA human HA 34.9 30.2 58 Z pRA04 pFA::NifZ::FLAG Arabidopsis FLAG 26.5 21.8 41 D pRA19 pFA::NifD::HA human HA 63.8 59.1 59 D pRA22 mFA::NifD::HA human HA 63.8 63.8 D pRA24 pFA::NifD::HA Arabidopsis HA 63.8 59.1 59 DK pRA02 pFA::NifDK::FLAG Arabidopsis FLAG 124 119.3 64 DK pRA20 pFA::NifDK-FLAG::HA Arabidopsis FLAG + HA 124 119.3 65 H pRA23 mFA::NifH::HA human HA 42 42 K pRA25 pFA::NifK human none 67 62.4 60
indicates data missing or illegible when filed
Example 6. Translocation of Nif Fusion Polypeptides into Plant Mitochondria
[0569] The inventors next wanted to test whether the pFA MTP was capable of translocating Nif fusion polypeptides to the MM and whether it could provide for cleavage of the MTP by MPP. To first test this, two Nif proteins (NifF and NifZ) were chosen for construction of fusion polypeptides because of their relatively small molecular weights, which would enable clear discrimination of the cleaved and uncleaved polypeptides by Western blotting. Protein coding regions for the Klebsiella pneumoniae NifF and NifZ polypeptides fused to either HA or FLAG epitopes as C-terminal fusions were human-codon optimised and synthesised by a commercial supplier. The DNA fragments were inserted into the AscI site of pRAOO such that the Nif open reading frames were translationally fused with the N-terminal pFA MTP, generating the vectors pRA05 and pRA04 (Table 3). The HA and FLAG epitopes were incorporated at the C-terminus of the NifF and NifZ polypeptides, respectively, to allow for detection by the corresponding antibodies. To generate unprocessed versions of these pFA::Nif fusion polypeptides as controls, the same constructs were expressed in E. coli by T7 RNA polymerase. Given that the MTP is not processed in bacteria which have no MPP, the difference in size between plant- and bacterially-expressed polypeptides enabled processing to be detected by gel electrophoresis and Western blot methods. The amino acid sequences of the pFA::NifF::HA and pFA::NifZ::FLAG fusion polypeptides prior to processing are provided as SEQ ID NOs:40 and 41, respectively.
[0570] The Western blot (
Example 7. Demonstrating MTP Cleavage by Mass Spectrometry
[0571] To prove that the predicted MTP processing site in the pFA part of the fusion polypeptides was cleaved in the mitochondria by MPP, peptide products were analysed by mass spectrometry. To do this, the inventors designed and made a genetic construct based on pRAOO which encoded the fusion polypeptide pFA::NifH::HA, designated pRA10 (Table 3). The amino acid sequence of this fusion polypeptide prior to processing is provided as SEQ ID NO:42. The NifH fusion polypeptide was selected due to the importance of NifH as a core component of the nitrogenase enzyme complex and the high level expression of the dCoxIV::NifH::HA polypeptide observed previously in plant cells (Example 2). The pRA10 construct was introduced into N. benthamiana leaf cells and infiltrated tissues harvested 4 days later. The tissue was ground under liquid nitrogen and then processed using a Retsch tissuelyser in 2 mL Eppendorf tubes in the presence of protein extraction buffer (PEB) containing 50 mM Tris-HCl, pH 7.5, 1 mM EDTA, 150 mM NaCl, 10% glycerol, 5 mM DTT, 0.5 mM PMSF and 1% protease inhibitor cocktail for plants (Sigma, Catalog number P9599). To improve solubility of the NifH fusion polypeptide targeted to the mitochondria, 0.2% (w/v) SDS was added to the PEB. The crude protein extracts were cleared by centrifugation and then incubated in the presence of monoclonal anti-HA antibody conjugated to agarose beads (Sigma, Catalog number A2095) to immuno-precipitate HA-containing polypeptides. Unbound proteins were removed by a series of washes with 150 mM Tris-HCl, pH 7.5, 5 mM EDTA, 150 mM NaCl, 0.1% Triton X-100, 5% glycerol, 5 mM DTT, 0.5 mM PMSF and 1% protease inhibitor cocktail for plants. Bound proteins were eluted by incubating the beads in Laemmli buffer at 95 C. for 10 min and then further purified by electrophoresis on denaturing SDS-PAGE. The area of the gel determined to contain the pFA::NifH::HA fusion polypeptide by concurrent Western blot analysis was excised and subjected to in-gel digestion with trypsin followed by tandem mass spectral analysis of the resultant peptides as described in Example 1 using an Agilent Chip Cube system coupled to an Agilent Q-TOF 6550 mass spectrometer (Campbell et al., 2014). This analysis found 5 fully digested tryptic peptides identical to regions within NifH and a sixth semi-tryptic peptide consistent with exact cleavage of the MTP between residues 42 and 43 (
[0572] These data conclusively demonstrated that at least the MTP part of the pFA::NifH::HA polypeptide had been translocated to the MM and had been cleaved at the preselected site in the MTP within the N-terminal extension by the MPP. The data implied that the pFA MTP contained all of the signals necessary for translocation and processing in the MM.
Example 8. Expression of Multiple Nitrogenase Proteins in the Mitochondrial Matrix of Plants
[0573] Given the success of expression and processing in mitochondria of the GFP, NifF, NifZ and NifH polypeptides fused to the pFA MTP in N. benthamiana leaf cells, the inventors attempted to express the remaining 13 Nif polypeptides as fusion polypeptides to the pFA MTP. In the model diazatroph, Klebsiella pneumoniae, 16 Nif proteins are involved in nitrogenase biosynthesis or function, while four others are of unknown function or involved in transcriptional regulation (Oldroyd and Dixon, 2014). The inventors were particularly interested in whether the pFA MTP would provide for production and cleavage of a NifD fusion polypeptide in view of the data presented in Examples 2-4.
[0574] Codon-optimised versions of DNA fragments encoding the 16 Nif polypeptides of K. pneumonia were obtained and each was separately inserted at the AscI site of pRAOO to make a series of genetic constructs (Table 3). Each genetic construct encoded a fusion polypeptide having an N-terminal pFA MTP, then the Nif sequence (with or without its initiator methionine), and then a C-terminal extension comprising either an HA or FLAG epitope for detection by the appropriate antibody. For plant expression, each construct included the 35S promoter and nos 3 transcription terminator regions flanking the protein coding region. The amino acid sequences for the 16 fusion polypeptides are presented in SEQ ID NOs:40-42, and 46-58.
[0575] A. tumefaciens cells containing each the 16 genetic constructs were separately infiltrated into N. benthamiana leaves and, 4 days later, protein extracts prepared and analysed by gel electrophoresis and Western blotting as before. For each of the constructs encoding HA-tagged pFA-Nif polypeptides, bands were detected on the Western blots which were approximately the size as predicted for the MPP (Table 3,
[0576] FLAG-tagged pFA::Nif::FLAG fusion polypeptides were observed in the Western blots for each of the constructs including the NifJ, NifN, NifV, NifU, NifX and NifZ sequences (
[0577] Remarkably considering that 15 of the 16 genetic constructs yielded detectable polypeptide production, and despite numerous replications of the infiltrations, the inventors were unable to detect any specific bands for the pFA::NifD::FLAG construct (pRA07) in these plant assays, even though expression of the same genetic construct in E. coli readily yielded a visible band of the expected molecular weight (
[0578] As nitrogenase activity requires the concerted action of many Nif proteins, it was anticipated that functional nitrogenase reconstitution in plants would require many of the Nif proteins utilised by diazotrophic bacteria for biosynthesis and function. The inventors therefore wanted to determine if multiple Nif proteins could be expressed in the N. benthamiana MM using the pFA MTP. To test this concept, genetic constructs encoding four of the Nif fusion polypeptides of different sizes were chosen that would enable the resultant polypeptides to be identified by Western blot analysis, namely the constructs encoding pFA::NifB::HA (pRA03), pFA::NifS::HA (pRA16), pFA::NifH::HA (pRA10) and pFA::NifY::HA (pRA12). The four A. tumefaciens cultures transformed with these constructs were mixed in equal amounts and the mixture was then infiltrated into N. benthamiana leaves. The accumulated polypeptide levels were compared to when each culture was infiltrated separately. It was observed that each polypeptide was more abundant when expressed from a single construct than from the four gene combination. Nevertheless, all four Nif fusion polypeptides were readily detected in the protein extracts from the gene combination, and the molecular weight observed for each polypeptide was identical for the individual and combination infiltrations. This showed that combinations of Nif fusion polypeptides could be produced in the plant cells with the desired targeting and processing of each Nif fusion polypeptide to the mitochondria.
Example 9. Attempts to Improve NifD Fusion Polypeptide Production in N. benthamiana
[0579] Given the key role of NifD in the catalytic activity of nitrogenase, the inventors tried to identify the reason for the lack of NifD fusion polypeptide production and tested several approaches to improve its abundance in plant assays. Firstly, they tested whether the lack of NifD fusion polypeptide production/accumulation could be attributed to low transgene transcription or mRNA instability, by measuring the mRNA expression level. To do this, the level of mRNA in the infiltrated N. benthamiana cells from pRA07 was firstly measured by qRT-PCR as described in Example 1 and compared to the level of mRNA transcribed from the construct encoding pFA::NifU::FLAG (pRA15). This second construct was used as a control since it provided high levels of polypeptide production in the plant cells, as described above. In order to remove any bias in amplification efficiency, oligonucleotide primers were used which annealed within the pFA MTP region shared by both Nif fusion genes. The results from the RT-PCR assay showed that the level of pFA::NifD::FLAG mRNA was more than three-fold greater than pFA::NifU::FLAG mRNA. Secondly, cDNA was synthesized from the plant-produced mRNA transcribed from pRA07, cloned and sequenced, and its nucleotide sequence proved to be base perfect. Therefore, the lack of accumulation of the pFA::NifD::FLAG fusion polypeptide was not due to low mRNA expression or instability. These experiments also showed that the T-DNA in pRA07 encoding pFA::NifD::FLAG was fully functional and that the 35S promoter in that construct was likewise functional. Therefore, the inability to detect the NifD fusion polypeptide in N. benthamiana cells was not due to any lesions in expression of the mRNA.
[0580] As transcription of the gene encoding pFA::NiD::FLAG and mRNA accumulation were clearly not limiting the NifD fusion polypeptide production, several modifications were made to the genetic construct in attempts to overcome the lack of accumulation of NifD fusion polypeptide. Firstly, the possibility was considered and tested that the presence of the FLAG epitope in the C-terminal extension was causing either lack of production or instability of the NifD fusion polypeptide. To test this possibility, a construct was designed and made in which the FLAG epitope was substituted with an HA epitope, designated pRA19 (pFA::NifD::HA). The HA epitope had allowed for accumulation and detection of each of the tagged Nif fusion polypeptides that had been tested with that epitope (Table 3). The amino acid sequence of this fusion polypeptide is provided as SEQ ID 59. Secondly, the codon usage of the NifD::HA open reading frame was modified to more closely resemble the codon usage in A. thaliana rather than optimised for translation in human cells, in an attempt to determine whether a different mRNA sequence might improve translation efficiency. That construct was designated pRA24; it encoded the same pFA::NifD::HA polypeptide (SEQ ID NO:59) as pRA19. Additionally, a genetic construct was made encoding a version of the NifD fusion polypeptide with the mutated mFA N-terminal extension rather than pFA as described in Example 5 (mFA::NifD::HA). This construct (pRA22) was made in order to test whether mitochondrial targeting and/or processing, if they occurred, were at least partially responsible for the lack of NifD fusion polypeptide production. The three constructs designed to address these questions are listed in Table 3.
[0581] N. benthamiana leaves were infiltrated with A. tumefaciens containing these constructs and protein extracts prepared from the infiltrated tissues and analysed. Remarkably, the Western blot showed HA-containing bands of the molecular weights expected for both matrix-processed and unprocessed NifD fusion polypeptides when either pRA19 or pRA24 (pFA::NifD::HA) constructs were introduced (
[0582] The inventors concluded that the substitution of the FLAG epitope with an HA epitope was responsible, at least in part, for improving the accumulation of the NifD fusion polypeptide.
DISCUSSION
[0583] In the experiments described above, the inventors demonstrated that all 16 of the Nif polypeptides required for nitrogenase function in Klebsiella could be expressed from genetic constructs in plant leaf cells as MTP::Nif fusion polypeptides and that the polypeptides accumulated in processed forms in mitochondria. Furthermore, the experiments showed that these proteins could be targeted to the MM, a subcellular location potentially accommodating for nitrogenase function. The inventors believe that these experiments are the first practical demonstration of the feasibility of such an approach.
[0584] The conclusion on targeting of the Nif fusion polypeptides to the MM was based on several lines of evidence. Firstly, the size of each of the plant-expressed Nif polypeptides was consistent with the expected size that would result from processing by MPP. The smaller molecular weights observed for the plant-expressed Nif fusion polypeptides compared to the bacterially-produced polypeptides (full-length, unprocessed), indicated processing of the Nif fusion polypeptides by the MPP. Additionally when the MTP sequence was mutated, rendering the MTP incapable of being processed by the mitochondrial import machinery, a larger polypeptide was observed for both NifD and GFP fusion polypeptides, consistent with the difference in size between processed and unprocessed polypeptides. Finally and conclusively, mass spectrometry determined that pFA::NifH was cleaved between residues 42-43 of the MTP as predicted for specific processing in the matrix, showing that the MTP sequence could be cleaved when fused to Nif polypeptides.
[0585] The presence of the MTP did not always lead to complete processing of Nif proteins. For example, the NifX::FLAG construct and two of the NifD::HA constructs resulted in the accumulation of both processed and unprocessed fusion polypeptides. Moreover, despite use of the strong, constitutive 35S promoter, a considerable degree of variability in polypeptide accumulation levels was observed for the various Nif fusion polypeptides. Additional, shorter than expected polypeptides were observed for some of the Nif fusion polypeptides, detected via the presence of an epitope at the C-terminus of the polypeptides.
[0586] Of all the Nif fusion polypeptides, the NifD polypeptide was the most difficult to produce at detectable levels. This was not due to a lack of NifD gene expression or instability of the mRNA, but poor translation and/or protein instability may have limited NifD fusion polypeptide abundance. Given the critical importance of NifD in nitrogenase function, including its requirement to be highly expressed in bacteria (Poza-Carrion et al., 2014), this problem needed to be overcome.
Example 10. Investigating Nitrogenase Polypeptide Structure and Function Using in Silico Modelling
[0587] Bacterial nitrogenase is a metalloprotein complex comprised of multiple, different Nif polypeptides which are required to associate to form the active enzyme. The inventors considered whether amino acid extensions at either the N-terminus or the C-terminus of each Nif polypeptide relative to each corresponding wild-type polypeptide might interfere with the biochemical function of each individual polypeptide and assembly and function of an enzyme complex within a plant cell. In the examples described above, the Nif fusion polypeptides encoded by transgenes introduced into the plant cells were directed to the mitochondrial matrix using a mitochondrial targeting peptide (MTP). However that process extended the N-terminus of each nitrogenase polypeptide with either a longer sequence prior to cleavage by MPP or a shorter sequence after cleavage. To test whether the extensions might affect the function of a nitrogenase complex by interfering with catalytic centres or protein-protein interfaces required for function, the inventors first used homology models of bacterial nitrogenase subunits to predict the impact of N- and C-terminal extensions on the nitrogenase polypeptides NifH, NifD, NifK, NifE, NifN, NifS and NifU. Similarly, epitope tags such as the FLAG, HA and MYC epitopes are commonly added to the C-terminus of polypeptides to allow detection or purification from cell extracts. Many of the individual components and protein complexes forming wild-type bacterial nitrogenase have been crystallised and their structures as single polypeptides or multiprotein complexes have been investigated. Therefore, the inventors used these high resolution structures to model the impact of various changes such as extensions and translational fusions to each Nif polypeptide, based on the K. pneumoniae amino acid sequences.
Methods: Software Used for Molecular Modelling
[0588] Homology models for each Nif polypeptide and the complexes containing these polypeptides were constructed using the MODELLER program (Sali and Blundell, 2013) as implemented in Accelrys Discovery Studio 3.5. Suitable templates upon which to build the homology models were identified using BLAST searching against the Brookhaven Protein Databank. The template polypeptides are listed in Table 4, most of them from A. vinelandii. Sequence alignments were carried out using the ClustalW algorithm (Sali and Blundell, 2013) as implemented in Discovery Studio 3.5. All molecular dynamics simulations were performed with Amber 12.
TABLE-US-00004 TABLE 4 Template polypeptides used for molecular modelling Klebsiella Identity Similarity Nif Organism Template (PDB ID) (%) (%) NifD A. vinelandii NifD (1FP4)1 73.2 86.7 NifK A. vinelandii NifK (1FP4) 65 82.8 NifH A. vinelandii NifH (1N2C)2 89.9 95.6 NifE A. vinelandii NifD (1N2C) 28.1 54.6 NifN A. vinelandii NifK (1N2C) 22.7 45.4 NifE A. vinelandii NifE (3PDI) 3 64.4 77.7 NifN A. vinelandii NifN (3PDI) 45.6 67.1 NifS E. coli Cysteine desulfurase 39.5 62.3 (1P3W).sup.i NifU Aquifex Iron sulfur cluster 41.8 69.5 aeolicus protein (2Z7E)4 .sup.1Sorlie et al., (2001); .sup.2Schindelin et al., (1997); .sup.3Kaiser et al.; .sup.4Cupp-Vickery et al., (2003)
Results: NifH Structure
[0589] The A. vinelandii NifH structure from the NifD-NifK-NifH complex was 17 amino acid residues shorter at the C-terminus compared to the K. pneumoniae NifH sequence, but otherwise the two NifH polypeptides were more highly homologous than the other Nif polypeptides tested (Table 4). The homology models constructed as described below using the K. pneumoniae NifH polypeptide sequence were therefore constructed after omitting these 17 residues from the sequence.
NifD-NifK and NifD-NifK-NifH Complexes
[0590] A model of the structure of a NifD-NifK .sub.2.sub.2 heterotetramer using the NifD and NifK polypeptides from K. pneumoniae was constructed and tested by molecular dynamics simulation. The model was constructed using the MODELLER algorithm as implemented in Accelrys Discovery Studio 3.5 using the crystal structure of the NifD-NifK complex from A. vinelandii (PDB ID: 1FP4, NifD and NifK only) as a template. The NifD identity between K. pneumoniae and A. vinelandii was 73.2% and for NifK, 65%. A second model was then constructed using PDB ID: IN2C for a complex including all three of the K. pneumoniae NifD, NifK and NifH polypeptides (NifD-NifK-NifH .sub.2.sub.2.sub.4 heterooctamer). This was done to test whether the second model revealed interactions of NifD-NifK with the NifH subunit that might have been adversely affected by C- or N-terminal extensions. The inventors observed from the second model that the C-terminus of the NifK subunit was buried in the core of the complex and made contact with several residues of both the adjacent NifK and the NifD subunits, including hydrogen bonds and salt bridges between the five C-terminal residues of NifK and the adjacent subunits. This was consistent with what was observed in the NifD-NifK model. The inventors concluded that any C-terminal extension to the NifK polypeptide relative to the wild-type K. pneumoniae sequence would likely result in disruption of the complex, leading to either a less stable form or a completely non-functional complex with respect to nitrogenase activity. In contrast, the C-termini of the NifD and NifH subunits lay at the surface of the complex and it was therefore predicted that extensions could be made to the C-termini of NifD and NifH polypeptides without disrupting the formation and function of the enzyme complex. The model of the A. vinelandii NifH structure predicted that the 17 amino acid residues which had been omitted from the C-terminus of K. pneumoniae would also terminate at the surface as there were no holes in the NifD-NifK-NifH complex that were within reach of a 17 residue extension. Similarly, the N-termini for the NifD, NifK and NifH subunits also lay at the surface of the complex and it was concluded these N-termini should be amenable to addition of an extension.
NifEN Complex
[0591] Whilst a NifE-NifN .sub.2.sub.2 heterotetramer structure was available in the Brookhaven Protein Databank with reasonable homology to the K. pneumoniae NifE-NifN sequences, there were 23 residues missing from the C-terminus in the NifN structure that would likely fold back into the core of the complex as seen in the equivalent NifD-NifK .sub.2.sub.2 heterotetramer structures that were available. Additionally, there were 22 residues missing from the N-terminus of the NifE structure that would have added unnecessary uncertainty to the models. As the NifE-NifN .sub.2.sub.2 heterotetramer shared the same fold as the NifD-NifK .sub.2.sub.2 heterotetramer from A. vinelandii (PDB ID: IN2C containing a NifH-NifD-NifK-NifH complex, superposition RMSD of 4 for the NifE-NifN and NifD-NifK complexes), the NifD-NifK structure was instead used as a template upon which to build the NifE-NifN homology model. An additional advantage of this was the nearly full coverage of the termini of the NifE and NifN sequences. This also allowed inspection of possible interactions between NifE-NifN termini and NifH, should they exist, and whether alteration of the terminal regions on any of the subunits would potentially interfere with complex formation or active site accessibility.
[0592] A K. pneumoniae NifE-NifN .sub.2.sub.2 heterotetramer model was therefore constructed over the A. vinelandii NifD-NifK structure. Analogous to the NifD-NifK model, the C- and N-termini of the NifE and NifN subunits terminated at the surface of the complex, with the exception of the NifN C-terminus which terminated in the core of the structure. The N-terminus of the K. pneumoniae NifE sequence was shorter than the N-terminus of NifD by 18 amino acid residues with a reasonably well-conserved stretch of 19 residues that made contact with an adjacent NifK subunit (NifN in the homology model). It was concluded from the model that extension of the C- or N-termini of NifE would not be expected to have a deleterious effect on the structure or function of the complex, but that the C-terminus of NifN was unlikely to tolerate an extension. A relatively long sequence of 51 amino acid residues was present at the N-terminus of the A. vinelandii NifK structure but no corresponding sequence was present in the K. pneumoniae NifN sequence. In the model, the extra amino acid residues lay along the outside of the interface between the NifD and NifK units. The catalytic core was shielded from this sequence. It was concluded from these observations that the pFA MTP sequence after cleavage by MPP, leaving a N-terminal extension of 35 residues which was positively charged (+8) at physiological pH, would most likely maintain an unstructured aspect and remain solvent exposed. Furthermore, there was precedent from the NifD-NifK template structure that supported the conclusion that extra amino acid residues at the N-terminus of K. pneumoniae NifN could be tolerated. There was nothing to suggest that such an N-terminal extension in NifN would interfere with catalytic function or assembly of any of the units. The C-terminus of NifN, on the other hand, was expected to be buried within the core of the enzyme. Notably, it was 6 residues longer than the highly conserved C-terminus of NifK, so the exact nature of the interactions these residues might be involved in remain unknown. Based upon the similarity in folds between the A. vinelandii NifD-NifK .sub.2.sub.2 heterotetramer and the K. pneumoniae NifE-NifN .sub.2.sub.2 heterotetramer, it was predicted that alterations to the C-terminus of NifN, particularly extensions, would have detrimental effects on the secondary structure and the quaternary structure of the complex. It was concluded that a C-terminus the same as a wild-type NifN polypeptide should be used.
NifS Model
[0593] A homology model of K. pneumoniae NifS was constructed over the structure of a cysteine desulfurase from E. coli whose functional unit was a homodimer. The last 11 amino acid residues at the C-terminus of K. pneumoniae NifS were not included in the modelling. The homology model for K. pneumoniae NifS was constructed as a homodimer and it was observed that the N- and C-termini lay at the surface of the structure. As for most of the Nif polypeptides analysed, it was predicted that the pFA MTP amino acid residues remaining after processing by MPP would not have an adverse effect on the homodimer. It has been shown that NifU and NifS polypeptides can interact (Yuvaniyama et al., 2000) however the precise physical nature of the interaction remains unknown. It is possible that extension of either the N- or C-termini could disrupt a physical interaction between NifU and NifS, if one existed.
NifU Model
[0594] The closest match in the Brookhaven Protein Databank to the K. pneumoniae NifU was PDB ID: 2Z7E, an iron-sulfur cluster protein (IscU) from Aquifex aeolicus that crystallised as a homotrimer. Although the alignment showed good homology for a monomer of 2Z7E, (120 residues), the NifU sequence was considerably longer (271 residues), leaving approximately 150 residues at the C-termini unmodelled. Therefore a homology model of K. pneumoniae NifU, excluding its C-terminal 151 residues, was constructed using the iron-sulfur cluster protein (IscU) from Aquifex aeolicus as a template. The N-termini were well covered and clustered at the top of the subunit. It could not be predicted with certainty whether the structure would allow for interaction with a NifS polypeptide if the N-terminus of the NifU polypeptide was fused to an MTP sequence.
[0595] In summary, it was concluded that amino acid extensions at the N-termini on most of the Nif polypeptides were predicted to be tolerated without necessary loss of function. Extensions to the C-termini of NifK and NifN were predicted to be the most sensitive to disruption of complex formation and function. These results were then used by the inventors to help guide the design of functional nitrogenase polypeptides for expression from transgenes in the nuclear genome and translocation into the matrix of plant mitochondria.
Example 11. Co-Expression of NifD and Other Nif Fusion Polypeptides
[0596] The inventors attempted further approaches to improve the production and accumulation of NifD fusion polypeptides. In nitrogen fixing bacteria, NifD, NifK and NifH strongly interact through hydrogen bonding, electrostatic interactions and hydrophobic interactions to form a catalytic core of the nitrogenase complex. The protein structure modelling described in Example 10 revealed that effective complex formation between NifK and the other two polypeptides, NifD and NifH, was reliant on the presence of the wild-type C-terminal amino acid sequence in NifK, namely the amino acid residues DLVR (SEQ ID NO:69) as the last four residues at the C-terminus (for example, residues 517-520 of SEQ ID NO:7). In the experiments described above, the inventors had used a NifK fusion polypeptide which had an added C-terminal sequence of 17 amino acids including an HA epitope of 9 amino acids. The modelling described in Example 10 predicted that that NifK sequence would not have been optimal for interaction with NifD because of the C-terminal extension. The inventors therefore decided to test whether co-expression of a NifK polypeptide having a wild-type C-terminus with the NifD construct might improve co-accumulation of a NifD fusion polypeptide.
[0597] A genetic construct was made which encoded a pFA::NifK fusion without a C-terminal extension, using pRAOO as the base vector. This construct was designated pRA25 (Table 3). The amino acid sequence of the polypeptide is provided as SEQ ID NO:60. Infiltrations were performed in N. benthamiana leaves with the combinations pRA25 (pFA::NifK) with pRA24 (pFA::NifD::HA), and compared to the previously used pRA11 (pFA::NifK::HA) with pRA24. The levels of the NifD polypeptide were compared by gel electrophoresis and Western blotting using the HA antibody. Surprisingly, the co-infiltration with pRA25 (pFA::NifK without C-terminal extension or epitope) substantially increased the accumulation of the NifD fusion polypeptide compared to co-infiltration with pRA11 (pFA::NifK with C-terminal extension). In this experiment, the inclusion of pRA11 in the mix did not appear to enhance accumulation of the NifD fusion polypeptide, but in repeat experiments there was some increase using pRA11. A photograph of a Western blot is shown in
[0598] For other infiltrations, the pFA::NifH::HA construct pRA10 was added to the combination of NifD and NifK (lanes 1-3 of
[0599] To test whether the improved accumulation of the NifD fusion polypeptide was occurring in the mitochondrial matrix, the pFA::NifH::HA (pRA10) and pFA::NifK (pRA25) constructs were co-expressed with the version of NifD having the non-functional MTP (pRA22, mFA::NifD::HA). That fusion polypeptide differed from pFA::NifD::HA only in the amino acids in the N-terminal domain. It was observed that the non-matrix targeted mFA::NifD::HA fusion polypeptide did not accumulate to the same level as the matrix targeted pFA::NifD::HA polypeptide (compare lanes 2 and 3,
[0600] When the codon-optimized construct pRA24 was used with the NifK (no C-terminal extension) and NifH constructs, the NifD fusion polypeptide accumulated at even higher levels (lane 1,
[0601] To determine whether co-expression of the constructs encoding NifK, with or without the C-terminal extension, could also enhance pFA::NifD::FLAG accumulation, the combination of pRA25 and pRA07 was introduced into leaf cells. Further combination with pRA10 was also carried out in some infiltrations. Using an antibody detecting the FLAG epitope, a NifD::FLAG fusion polypeptide was detected in the Western blot (upper panel,
[0602] A Western blot from further infiltrations is shown in
[0603] Taken together, these results indicated that a combination of NifH, NifK and NifD polypeptides improved the accumulation of the NifD fusion polypeptides in the mitochondria of plants. To the inventors' knowledge, this is the first report of the enhancement of NifD accumulation in plant cells, particularly when targeted to the mitochondria, by co-expression with NifH and NifK. It was also concluded that a wild-type C-terminus of NifK was beneficial for accumulation of NifD, and that NifH further increased the abundance of the NifD fusion polypeptide. The positive effect of the NifH and NifK polypeptides on NifD) accumulation was further enhanced by codon-optimisation of the NifD coding region. It was also noted that the abundance of the NifD fusion polypeptide in lane 1 of
[0604] Based on the beneficial effect of NifK and NifH on NifD fusion polypeptide levels, the inventors next tested whether co-expression of a NifS fusion polypeptide might enhance NifD accumulation. NifS is a cysteine desulfiurase involved in the early stages of nitrogenase assembly, whereby it mobilises sulfur (S) for FeS cluster formation. These FeS clusters are integral to the nitrogenase complex. To do this, combinations of A. tumefaciens each containing one of the constructs were co-infiltrated into N. benthamiana leaves. The construct encoding the pFA::NifD::FLAG (pRA07) fusion polypeptide was used in this experiment. Surprisingly, the combination of the pFA::NifS::HA construct (pRA16) with the NifD::FLAG construct also increased the accumulation of the latter polypeptide (compare lanes 6 and 11 in
[0605] The inventors observed another surprising and unexpected phenomenon in this experiment. As can be seen in
[0606] To show that these polypeptides are associating in the plant cells, protein extracts after introduction of gene combinations including pRA07 are incubated with antibody binding the FLAG epitope to immuno-precipitate the NifD::FLAG polypeptide and any other polypeptide bound to it. The precipitated polypeptide(s) are electrophoresed and the blot probed with antibody directed to the HA epitope. Polypeptides which are immuno-precipitated and which contain the HA epitope are detected, such as pFA::NifH::HA. Size exclusion chromatography under non-denaturing conditions can also be used to demonstrate the formation of multi-polypeptide protein complexes, in particular the association of the NifD, NifH and NifK fusion polypeptides.
Example 12. Construction of a NIfDK Fusion Polypeptide
[0607] The finding that the co-expression of NifH and NifK fusion polypeptides had an effect on stabilising NifD levels in plant cells led the inventors to design a way to fuse NifK, the hetero-tetrameric partner of NifD in nitrogenase, to NifK polypeptide. It was thought that this strategy might also protect the NifD polypeptide from possible protease activity, which the inventors thought might have been responsible for the low levels of NifD accumulation. Furthermore, in bacteria the NifD and NifK polypeptides are present in almost equal amounts (Poza-Carrion et al., 2014) and the subunits are found in a 1:1 ratio in the crystal structure of nitrogenase (Schmid et al., 2002). The inventors thought that a direct fusion of the two polypeptides would ensure an equal ratio of the polypeptides.
[0608] However, this strategy was found to require the insertion of an amino acid linker for joining the NifD and NifK units, to provide for proper protein folding of the single polypeptide chain, as follows. A homology model of the NifD-K .sub.2.sub.2 hetero-tetramer from K. pneumoniae was constructed using the crystal structure of the NifD-K complex from Azotobacter vinelandii (PDB ID: 1FP4, (Schmid et al., 2002)) as a template. Aligning the K. pneumoniae and corresponding A. vinelandii polypeptides, the amino acid sequence identities were 72.2% for the NifD polypeptides and 67.3% for the NifK polypeptides. In the structural model for the K. pneumoniae D.sub.2K.sub.2 hetero-tetramer, the C-terminus of each NifD subunit was approximately 47 from the N-terminus of its NifK partner. Therefore, a linker of that length was designed to connect the two units. The linker was 30 residues in length and consisted of an 11-residue section from a known unstructured linker region from Hypocrea jecorina cellobiohydrolase II (Accession no. AAG39980.1, ATPPPGSTTTR; SEQ ID NO:61) with the final arginine replaced by an alanine, then an 8-residue FLAG epitope (DYKDDDDK; SEQ ID NO:62) followed finally by another copy of the 11-residue unstructured linker sequence with the arginine replaced by an alanine (full linker sequence: ATPPPGSTTTADYKDDDDKATPPPGSTTTA; SEQ ID NO:63). The replacement of arginine was designed to reduce potential electrostatic interactions with the negatively charged residues in the central FLAG epitope of the linker. To ensure that no obvious interactions or conformational strains were present between either the NifD-NifK units and the linker of the fusion polypeptide, or within the linker itself, that might be detrimental to the ability of the D and K units to associate in their native orientation, a geometry optimisation and equilibration was carried out on the dimer of the composite fusion polypeptide (without the inclusion of any of the metal centres) at constant pressure in an octahedral TIP3P water box with minimum boundary distance from the solute of 10.0 . The calculation was carried out using Amber 12 employing the ff99SB force field at 298 K over 5 ns in total using 2 fs timesteps and SHAKE constraints.
[0609] The predicted structure of the NifD-linker-NifK composite polypeptide, including its 30-amino acid linker, (
[0610] In a second construct, a C-terminal extension comprising an HA epitope was added to the C-terminus of the NifK unit of the encoded polypeptide to enable detection of the fusion protein with HA antibody, otherwise the remainder of the encoded polypeptide was the same as for pRA02. The second construct was designated pRA20. The amino acid sequence of the pFA::NifD-linker-NifK::HA fusion polypeptide is provided as SEQ ID NO:65. The first encoded fusion polypeptide had the structural components pFA::NifD-linker (FLAG)-NifK, whereas the second was pFA::NifD-linker (FLAG)-NifK::HA.
[0611] When pRA20 was introduced into N. benthamiana cells and protein extracts examined by Western blotting (
Example 13. Creation of Multi-Gene Constructs for Co-Expression of Nitrogenase Polypeptides in Planta
[0612] To produce a functional nitrogenase in plant cells, genes encoding the three core structural proteins NifD, NifH and NifK and a number of accessory Nif proteins including NifB, NifE and NifN will need to be introduced and expressed co-ordinately in the cells. Genomic integration of multiple transgenes may be achieved using a transformation construct that contains multiple expression cassettes within one T-DNA, each directing expression of a different Nif polypeptide. Such a design would provide for integration of the T-DNA into one genomic location, if desired. The inventors therefore designed and made three independent multi-gene constructs which, if combined in a single transformation event, allowed for the integration of three T-DNAs comprising 15 transgenes into the plant genome. The three T-DNAs each contained a different selectable marker gene so they could be independently selected, as follows.
[0613] The binary vector pDCOT, obtained from Dr Thomas Vanhercke (CSIRO Agriculture and Food, Canberra, Australia), was used as a starting vector. It has the same backbone sequence and left- and right-border T-DNA sequences as the binary vector pORE_O4 (Coutu et al., 2007; GenBank Accession No. AY562542.1). In addition to a selectable marker gene cassette, the T-DNA region of pDCOT contained four expression cassettes, each cassette comprising a strong, constitutive promoter and transcription terminator/polyadenylation region flanking a unique restriction site for cloning purposes. Following each promoter, each expression cassette also contained a tobacco mosaic virus f leader sequence (TMVQ) immediately before the unique cloning site for optimised translation from the mRNA that would be produced in plant cells. The promoter and terminator sequences in the different cassettes were varied to limit sequence repetition within the vector, considering that this would reduce silencing of expression within the plant following transformation. Additionally, cassettes 1 and 2, and cassettes 4 and the selectable marker cassette were each separated by a matrix-associated region (MAR) sequence to reduce transcriptional interference from one expression cassette into another. The selectable marker gene cassette in pDCOT was a NPTII gene conferring resistance to the antibiotic kanamycin. The pDCOT vector was modular in the arrangement of the expression cassettes, in that each expression cassette comprising in order a promoter, TMV, a cloning site and a terminator/polyadenylation sequence was flanked by unique restriction sites, allowing for the straightforward exchange of cassettes.
[0614] In order to increase the number of individual gene expression cassettes within the transformation vector, a fifth expression cassette was inserted into pDCOT between unique KpnI/AatII sites that existed in the original pDCOT vector, as follows. A DNA fragment for the fifth expression cassette was designed and synthesized to contain an enhanced CaMV 35S promoter followed by a TMV(Z leader sequence, then a unique cloning site for transgene insertion (Bstz171/SbfI) and finally a nos 3 terminator region. The entire selection cassette, flanked by a 5 KpnI site and a 3 AatII site was inserted into pDCOT, using the restriction sites for directional cloning into pDCOT. This inserted the fifth expression cassette between a MAR sequence and the selectable marker gene cassette. The structure of pKT100 is shown schematically in
[0615] Some of the promoters in pDCOT and its derivative pKT100 were from an A. thaliana Rubisco small subunit gene (Arath-Rubisco/SSU) which provided for transgene expression in green tissues in the light, whereas other cassettes in the vectors used the CaMV 35S promoter sequence for constitutive expression. For initial constructs for expression of Nif polypeptides, it was desired that all should be constitutively expressed, so the Arath-Rubisco/SSU promoters were replaced with other plant virus-based constitutive promoters, while reducing sequence repetition within the final vectors. The alternate constitutive promoters selected were a derivative of the Cestrum Yellow Leaf Curling Virus (CmYLCV) promoter Cm4 (Sahoo et al., 2014) and the Subterranean Clover Stunt Virus (SCSV) promoters S7 and S4 (Schunmann et al., 2003). The Cm4 promoter sequence used included nucleotides from 271 to +5 relative to the CmYLCV transcription start site (Sahoo et al., 2014) so as to avoid a MIuI site at the 5 end and the presence of any unnecessary 3 UTR sequence. Each promoter sequence included the TMV leader sequence in the 5 UTR and was flanked by the unique restriction sites that matched those used for the promoters they were to replace, specifically MluI/BamHI for CmYLCV Cm4, NruI/ApaI for SCSV S7 and XmaI/NotI for SCSV S4. Each promoter sequence was synthesized by a commercial supplier. Standard restriction digestion and directional cloning was used to exchange each promoter sequence in a sequential fashion to produce pKT-HC.
[0616] To co-ordinately express up to 15 transgenes in plant cells using three vectors, it was desired that each vector had a different selectable marker gene. The selectable marker gene in the pDCOT selection cassette encoded a NptII enzyme conferring kanamycin resistance (Bevan et al., 1983). Alternate genes encoding Hpt (Waldron et al., 1985) and Bar (Block et al., 1987), conferring resistance to hygromycin B and glufosinate ammonium/phosphinothricin (BASTA) respectively, were selected as these were suitable to use for selection in plants. DNA fragments encoding these polypeptides were made by a commercial supplier, flanked by FseI/AscI restriction sites, which matched the restriction sites flanking the NptII coding region in the selection cassette of pDCOT. Standard restriction digestion and directional cloning was used to replace the NptII coding region in pKT-HC with either the Hpt coding region or the Bar coding region, creating a set of three multi-gene vectors, referred to as pKT-HC, pKT-IC and pKT-JC. Each had the genetic structure as shown in
TABLE-US-00005 TABLE 5 Components in multi-expression cassettes in T-DNA vectors. Presence Cassette No Promoter of TMV Cloning site Terminator 1 CaMV e35S yes SacI nos3 2 CmYLCV Cm4 yes BamHI/EcoRI Glyma-lectin 3 3 SCSV S7 yes ApaI/XhoI nos3 4 SCSV S4 yes NotI/SalI Glyma-lectin 3 5 CaMV e35S yes Bstz171/SbfI nos3 Selectable enTCUP2 no FseI/AscI nos3 marker
Example 14. Expression of Nif Polypeptides in Plant Cells from Multi-Gene Vectors
[0617] To demonstrate and compare the transgene expression capability of each expression cassette in the multi-gene vectors, a set of 5 constructs were made where a protein coding region encoding the pFA::NifH::HA fusion polypeptide was inserted separately into each of the expression cassettes. Constructs with correct insertion of MTP-NifJ-HA were identified by their HindIII restriction enzyme digest pattern, and used to transform the Agrobacterium tumefaciens strain GV3101. The N. benthamiana transient leaf expression system (Example 1) was then used to assess protein expression, with leaves infiltrated with a mixture of three GV3101 strains, namely one containing a pFA::NifH::HA construct, a second pRA01, and the third a strain containing the vector for expression of the p19 silencing suppressor protein, each driven by a 35S promoter. In this experiment, pRA01 served as a positive control for protein synthesis by GFP fluorescence. Leaf tissue was harvested after 4 days and proteins extracts analysed by gel electrophoresis and Western blotting as described above. Western blots were probed with anti-HA and anti-GFP primary antibodies and with Goat anti-Mouse secondary antibody linked to horseradish peroxidase (BioRad). Chemiluminescent signals were generated by applying Amersham ECL Western Blotting Detection Reagent (GE Healthcare Life Sciences) and documented using a CCD imager. Expression of pFA::NifH::HA was observed from each individual expression cassette (
[0618] A multi-gene vector was then constructed which encoded five individual Nif fusion polypeptides in one T-DNA, based on the pKT-HC vector. Each Nif coding region was inserted in a sequential fashion by means of the unique cloning site in each expression cassette. A coding region for pFA::NifH::HA was inserted into cassette 1, one for pFA::NifS::HA was inserted into cassette 2, one for pFA::NifM::MYC was inserted into cassette 3, one for pFA::NifU::HA was inserted into cassette 4 and one for pFA::NifZ::MYC was inserted into cassette 5 (
[0619] Stable Transformation of Plants.
[0620] Agrobacterium tumefaciens strains containing genetic constructs were used to transform A. thaliana by the dipping method (Bechtold et al., 1993), specifically HC13. Seeds were collected from the treated plants. The seeds are plated on tissue culture media containing the appropriate selective agent to select for stably transformed plants, which are transferred to soil for growth to maturity. Seed from plants which are shown to be transgenic are collected and sown to produce progeny plants. Progeny plants which are homozygous for the transgenes are identified and selected. The expression levels of the transgenes are analysed by standard qRT-PCR methods and the levels of accumulation of the fusion polypeptides which contain epitopes are determined by Western blot methods as for the transient expression experiments described above.
Examples 15. Effect of a NifD Construct on Co-Expressed Transgenes
[0621] As described in Example 11, it was unexpectedly observed that when constructs encoding specific NifD fusion polypeptides (pRA07, pRA19) were co-infiltrated with other Nif-expressing constructs, expression of all of the Nif-expressing constructs was significantly reduced (
[0622] Firstly, to see if this effect was specific to the combination of pRA19 and pRA01, the T-DNA from pRA01 (pFA::GFP) was introduced into a N. benthamiana leaf cells either alone or in combination with pRA19 (pFA::NifD::HA, human codon optimised) or pRA16 (pFA::NifS::HA), or all three pRA01, pRA19 and pRA16 were combined. As previously, A. tumefaciens comprising a construct expressing the silencing suppressor p19 was included in all infiltrations including the controls. Four days after the infiltrations, the abaxial surface of the infiltrated N. benthamiana leaf was exposed to ultraviolet (UV) light and photographed to determine the intensity of GFP expression. Compared to the fluorescence seen for the region infiltrated with pRA01, there was a significant reduction in GFP fluorescence for pRA19+pRA01, with fluorescence barely visible. By contrast fluorescence was clearly visible for pRA16+pRA01, although some reduction in fluorescence was observed compared to pRA01 alone, as might be expected from dilution when using two T-DNAs. Next, the levels of GFP and NifS fusion polypeptide accumulation were compared by gel electrophoresis and Western blotting using anti-HA and anti-GFP antibodies. Consistent with the observed GFP fluorescence levels, the level of pFA::GFP accumulation was reduced when pRA19 was co-infiltrated with pRA01, whereas the level of pFA::GFP was only slightly down when pRA16 and pRA01 were co-introduced (
[0623] To further examine the scope and mode of this down-regulation, additional constructs were introduced singly or in combination with pRA19 or with other constructs encoding a NifD fusion polypeptide, and both protein and mRNA transgene expression levels were analysed as well as fluorescence intensities under UV light. As before, the introduction of the T-DNA from pRA19 led to a reduction of GFP fluorescence and of protein levels for both GFP and pFA::NifS::HA fusion polypeptide from co-introduced pRA16. However this was not the case when pRA24 (pFA::NifD::HA, codon-optimised by Arabidopsis codon usage) or pRA20 was co-introduced, encoding the NifD-NifK fusion polypeptide (pFA::NifD-linker-NifK::HA). Notably, pRA24 and pRA20 encoded an identical NifD amino acid sequence to pRA19 but used a different nucleotide sequence since they were codon-optimised based on Arabidopsis codon usage. Based on these observations, the inventors considered the down-regulatory effect of pRA19 was possibly triggered by the specific NifD-encoding RNA sequence transcribed from the T-DNA of pRA19.
[0624] To determine if the down-regulation effect occurred at the protein and/or RNA level, RNA was extracted from the same infiltrated regions and analysed by qRT-PCR. Using GFP specific primers, it was found that the level of GFP mRNA for the pRA19+pRA01 combination was reduced down to about 25% relative to the level for pRA01 alone. When pRA16 and pRA01 were combined, the reduction was less than 50% compared to pRA01 alone, as expected when combining two constructs. Next, using primers that annealed to the portion of the RNA encoding the pFA peptide, where the primers would amplify the mRNA region from both transgenes expressed simultaneously, the qRT-PCR assay determined that the level of transgene reduction was approximately 50% greater for the pRA19+pRA01 combination compared to pRA16+pRA01. Taken together, these results showed that the introduction of pRA19 into N. benthamiana leaf cells had the effect of reducing both mRNA and protein levels of co-expressed transgenes. This appeared not to be a general mRNA/protein down-regulation effect, as the level of expression of a control gene (GADPH) was constant across all infiltration experiments, and the levels of total protein synthesis appeared similar for all infiltrations as evidenced by Coomassie staining of the gels. Taken together, these results indicated that an intrinsic property of the mRNA encoding the NifD polypeptide produced from the T-DNA of pRA19 led to down-regulation of co-introduced transgenes at the mRNA and protein level.
[0625] One well established mode of RNA-mediated gene silencing is known to be effected by siRNAs of 21-24 nucleotides in length that guide the Argonaute protein to reduce expression of polynucleotides with complementary or near-complementary sequences, a process termed RNA interference (RNAi). However, alignment of the RNA sequences of human codon-optimised coding region from pRA19 with RNA sequences encoded by pRA01 (GFP) or pRA16 (NifS) found no stretch of homology sufficient to provide the sequence complementarity required for Argonaute mediated silencing. Based on this finding, it was hypothesised that although the specific NifD RNA sequence was triggering the silencing of co-introduced transgenes, the silencing effector resided elsewhere in the pRA19 constructin a region that shared sequence complementarity with GFP and other transgenes. To test this hypothesis, pRA22 (mFA::NifD::HA), which was identical to pRA19 but contained the mMTP and therefore possessed different RNA sequence in parts of the MTP region, was co-introduced with pRA01. For comparison, pRA19+pRA01 and pRA24+pRA01 combinations were also introduced. From the fluorescence intensities, it appeared that the pRA22+pRA01 combination expressed GFP at about the same level as the pRA24+pRA01 combination. From the Western blotting, both the pRA24+pRA01 and pRA22+pRA01 combinations showed little reduction in GFP protein accumulation, whereas pRA19+pRA01 showed a significant decrease in GFP protein. These results demonstrated that modifying the MTP sequence to a sequence with reduced complementarity to the other transgenes relieved the down-regulation by the human codon-optimised NifD sequence. This suggested that the human codon-optimised NifD RNA in pRA19, in combination with the pFA sequence, triggered the transgene down-regulation. Alternately, but not mutually exclusive, the NifD nucleotide sequence itself was sufficient to trigger initiation of down-regulation, but regions upstream of the NifD RNA were required to be complementary to transgenes to cause their down-regulation.
[0626] To confirm that the down-regulatory effect of human codon-optimised NifD on other transgenes was a property of the NifD RNA and not NifD protein, a construct was designed that had an almost identical RNA sequence to pRA19 but with two nucleotide changes that created a premature stop codon and a frame shift within the MTP. This was called pRA26 (FA::NifD::HA). If the mechanism of the down-regulation was RNA- and not protein-mediated, pRA26 would be expected to downregulate GFP and other Nif constructs similar to pRA19. As a further test, a human codon-optimised NifD construct pRA07 (pFA::nifD::FLAG) was also co-introduced. pRA07 would express an identical RNA sequence to pRA19 in the NifD region but not in the epitope region, since the HA epitope was replaced by FLAG. After five days, the level of fluorescence was observed in the infiltrated zones. Consistent with the previous experiments, GFP fluorescence was reduced for the pRA19+pRA01 combination. Fluorescence was also significantly decreased for both pRA26+pRA01 and pRA7+pRA01 combinations. Western blotting indicated that pRA26 had a similar effect in reducing GFP expression compared to pRA19. It was concluded that the human codon-optimised NifD mRNA was able to reduce expression of other transgenes even when no NifD protein was produced or if the epitope was changed. Combined with earlier results showing that a change of the human codon-optimised NifD RNA sequence prevented transgene down-regulation, it was conclusively demonstrated that the reduction of transgene expression by the NifD sequence in pRA19 occurred as a consequence of the specific NifD human codon-optimised RNA sequence. The nucleotide sequence of the pFA::NifD::HA fusion polypeptide coding region in pRA19 is provided as SEQ ID NO:68.
Example 16. Bacterial Expression Experiments to Test Nif Polypeptide Function
[0627] As described in the Examples above, genetic constructs were made and tested for production of Nif fusion polypeptides in plant cells, exemplified using the N. benthamiana leaf cell system with introduction of the synthetic genes by A. tumefaciens. The fusion polypeptides were designed to have in-frame fusions of a mitochondrial targeting peptide (MTP) added to the N-terminus of the Nif polypeptides and an epitope tag added in a C-terminal extension. Although modelling of protein folding and association (Example 10) predicted that most of the N-terminal and C-terminal extensions should not prevent complex formation and function, the inventors wanted to test in an in vivo biological system whether these extensions might affect the function of the fusion polypeptides relative to the native Nif polypeptides.
[0628] The Nif fusion polypeptides that were designed for expression in plant cells and translocation into the mitochondria, and their processed polypeptide products, were tested for their function in a bacterial nitrogenase expression system. The inventors set up a system that allowed each modified polypeptide to be assayed individually by addition to the nitrogenase system, or iteratively or even in combinations with other modified Nif polypeptides. This system, in E. coli, used a wild-type nitrogenase gene cluster that was modified by exchanging single Nif genes encoding the Nif fusion polypeptides that were to be tested, in place of the corresponding gene encoding the wild-type Nif polypeptide. This was followed by assay for nitrogenase or nitrogenase reductase activity using the ethylene and hydrogen production assays, respectively, to determine whether the Nif fusion polypeptide could function in place of the corresponding wild-type Nif polypeptide. A bacterial nitrogenase vector system based on that of Smanski et al. (2014) was the basis for this. In this system, all of the wild-type genes required for nitrogenase activity were contained within a single, broad host-range expression vector, pMIT2.1, where expression of the genes was controlled with an inducible promoter/T7-RNA polymerase system from a second plasmid, pN249. When expressed in E. coli, the full set of wild-type bacterial Nif polypeptides were produced and together provided a nitrogenase enzyme complex whose activity could be assayed by the production of ethylene from acetylene in a standard acetylene reduction assay (ARA, a de facto measurement for nitrogenase activity), or by hydrogen production for nitrogenase reductase activity.
[0629] The methods used with pMIT2.1 and its derivatives were as follows. Cells of E. coli strain DH5 were transformed with the two plasmids pMIT2.1 and pN249 which conferred resistance to the antibiotics chloramphenicol and spectinomycin, respectively. The transformed cells were selected by growth on LB medium (10 g/L tryptone, 5 g/L yeast extract, 10 g/L NaCl) containing chloramphenicol (34 mg/L) and spectinomycin (80 mg/L). Transformed cells were grown aerobically overnight at 37 C. in LB medium with antibiotics to an optical density of 1.0. The cultures were centrifuged at 10,000 g for 1 minute and the supernatant discarded. The cells were re-suspended in one volume of an induction medium which was free of N sources, containing 25 g/L Na.sub.2HPO.sub.4, 3 g/L KH.sub.2PO.sub.4, 0.25 g/L MgSO.sub.4.7H.sub.2O, 1 g/L NaC, 0.1 g/L CaCl.sub.2.2H.sub.2O, 2.9 mg/L FeCl.sub.3, 0.25 mg/L Na.sub.2MoO.sub.4.2H.sub.2O, and 20 g/L sucrose (minimal medium) supplemented with 1.5 mL/L of 10% serine. Stock solutions were filter sterilized. For induction of Nif gene expression, the medium was supplemented with isopropyl--D-1-thiogalactopyranoside (IPTG; Gold Bio #12481C25 259) at a final concentration of 0.1 mM, 0.5 mM or 1.0 mM unless otherwise stated, generally 1.0 mM. The cell suspensions were transferred to 13 cc culture flasks and capped with a gas-tight rubber seal using a crimp-lock system and the headspace was sparged with pure N.sub.2 gas for 20 min. The suspensions were then incubated at 30 C. with shaking at 200 rpm for 5 hours. After this, acetylene reduction assays (ARA) were started by the injection of 1.5 cc of pure C.sub.2H.sub.2 (BOC gases, instrument grade) and further incubation for 3 hr and then to 18 hours. Production of ethylene at both time points was measured by gas chromatography with Flame Ionisation Detection (GC-FID) using an Agilent 6890N GC instrument. Headspace samples (0.5 cc) were manually injected into a split/splitless inlet on a 10:1 split mode. The instrument was operated under the following parameters: inlet and FID temperatures of 200 C., average velocity for the carrier He of 35 cm/sec, isothermal oven temperature at 120 C. A RT-Alumina Bond/MAPD column (30 m0.32 mm5 m) was used with a 5 m particle trap column coupled to the detector end. Analytical performance of the instrument was assessed by running suitable blanks and standards. Under these conditions, ethylene emitted from the column at about 2.3 minutes and acetylene at about 3.1 minutes. This GC system was able to detect ethylene at levels as low as 0.00001% atm with clear resolution from acetylene as the only other detectable peak in this format, so was extremely sensitive. For ethylene production, headspace samples of 0.5 cc were taken at different time points after IPTG addition, generally at 3 hr and 18 hr.
[0630] The assay system using wild-type pMIT2.1 and pN249 in E. coli strain DH5 as the positive control produced only a trace level of ethylene when no IPTG was added to the growth medium, whereas addition of IPTG to the growth medium at 0.1 mM, 0.5 mM or 1.0 mM greatly increasing the amount of ethylene produced. The rate of ethylene production increased greatly from 3 hr sampling to 18 hr, and also as the IPTG concentration was increased, indicating increased nitrogenase activity with increased Nif gene expression. These results showed that IPTG rapidly induced Nif gene expression and nitrogenase formation in this expression system, consistent with the report of Smanski et al., (2014).
[0631] As described in the previous Examples, the pFA MTP amino acid sequence was cleaved in plant mitochondria to leave 38 amino acid residues fused to the N-terminus of the Nif polypeptide of the processed Nif fusion polypeptides. To test whether such a N-terminal extension would alter the function of the fusion polypeptides, and to demonstrate that the bacterial assay system worked, a DNA fragment (SEQ ID NO:70) of 117 bp was synthesized by PCR using pRA10 DNA as a template. This DNA fragment encoded 38 amino acids of the same sequence as the C-terminal portion of pFA MTP except for substitution of the N-terminal Ile residue with a Met for translation initiation, plus an additional Thr residue at the C-terminus. It was designed so that, when fused in-frame directly upstream of the start codon of a gene encoding any one of the Nif polypeptides, the chimeric gene would encode a translational fusion to the selected Nifpolypeptide. The amino acid sequence of the 39 amino acid polypeptide, hereafter termed pFA-C, is provided as SEQ ID NO:71.
[0632] The DNA fragment for pFA-C was inserted immediately upstream of the translation start codon of the genes encoding NifH, NifM, NifD, NifK, NifE, NifN or NifB in pMIT2.1 by various techniques, including blunt end ligations, splice overlap PCR and guided ligase cycling techniques (de Kok et al., 2014). As an example, the 117 bp DNA fragment was fused in-frame with the protein coding region of the NifD gene on pMIT2.1, as follows. pMIT2.1 DNA was amplified using primers to generate a linear DNA product so that the start codon (ATG) of the NifD gene was at the 5 terminus and the nucleotide sequence of the NifD gene immediately 5 of the translation start codon formed the 3 end of the product. To achieve this, PCR was conducted using the primers NifD-F 5-ATGATG ACTAATGCTACTGGCGAACGTAACCTG-3 (SEQ ID NO:72) and NifD-R 5-CCGGCTCCTCCGCTAGATAAAAATGTGA-3 (SEQ ID NO:73). The amplification was conducted using Phusion-HF Proofreading polymerase (NEB, catalogue M05081L) with the pMIT2.1 DNA template, with a PCR protocol of 96 C. for 30 sec, then 30 cycles of 92 C. for 20 sec, 55 C. for 20 sec, and 72 C. for 6 min, then 72 C. for 10 min. The reaction products were treated with DpnI to remove vector template DNA. The PCR product was essentially a linearised form of pMIT2.1, opened up immediately upstream of the NifD translation start codon. The 117 bp fragment was ligated to the linearised pMIT2.1 using T4 DNA ligase, generating pCW1001. Ligation of the 117 bp fragment was also achieved using ligation cycling reaction conditions (LCR) using Illumina Ampligase (Illumina, A8101) and conditions outlined in de Kok et al. (2014).
[0633] To determine the fidelity and accuracy of the amplification reaction on the pMIT2.1 DNA and demonstrate that nucleotide substitutions had not occurred in the wild-type Nif genes, a sample of the linearised pMIT2.1 DNA was ligated to regenerate circular molecules and used to transform E. coli DH5a. About 10 separate colonies containing the re-ligated pMIT2.1 are assayed for ethylene production from acetylene as described above, to demonstrate that inactivating mutations are not incorporated in the DNA by the PCR amplification. Vectors can also be sequenced to ensure the accuracy and fidelity of construction.
[0634] The vectors pCW1001 and pN249 were introduced into DH5 and transformed cells selected with chloramphenicol and spectinomycin. Cultures grown from these cells in induction media are tested for ethylene production in ARA assays, using 1 mM IPTG to induce gene expression and N.sub.2 gas as headspace, with addition of acetylene gas as the substrate. The production of ethylene indicates that the 39 amino acid N-terminal extension to an otherwise wild-type NifD polypeptide is tolerated for nitrogenase activity.
[0635] An analogous approach is used to modify other Nif genes in pMIT2.1, including, for example NifH, NifK, NifB, NifE, NifM and NifN, using the appropriate primer pairs in each case to linearise pMIT2.1 DNA at the position immediately upstream of the translation start codon and inserting the 117 bp fragment at that position. Successive rounds of Nif gene modification are also performed to generate combinations of two or more Nif gene modifications in a single vector, to test whether combinations of modified Nif fusion polypeptides retain function in an otherwise wild-type nitrogenase complex.
[0636] An alternate assay system to test the biological function of the Nif fusion polypeptides is a bacterial complementation assay using mutants of A. vinelandii which are mutant in specific Nif genes. To accomplish this, genetic sequences encoding the Nif fusion polypeptides are individually inserted into a broad host range plasmid such as pMMB66EH (Furste et al. 1986) that can be propagated in strains of the bacterium A. vinelandii. Each resultant genetic construct is introduced into a mutant strain of A. vinelandii, for example strain DJ1271 which lacks 200 bp from the 5 end of the endogenous nifH gene for testing NifH fusion polypeptide function. Other mutant strains lacking individual Nif activities are listed in Table 6. These mutations render the mutants unable to fix atmospheric nitrogen under the appropriate growth conditions. Expression of a functional NifH gene in DJ1271, for example, restores nitrogenase activity. This is therefore a useful test system for assessing modified NifH fusion polypeptides for function when associated with the other Nif polypeptides.
[0637] In order to assess the function of these polypeptides, the growth of transformants can be assessed on nitrogen-free medium. In the absence of added nitrogen sources in the growth medium, A. vinelandii must fix atmospheric nitrogen in order to grow. If the modified NifH fusion polypeptides are functional, then over-expression of these polypeptides in DJ1271 should restore the ability to grow on solid medium lacking added nitrogen. Alternately, nitrogenase function can be assayed through an acetylene reduction assay (ARA), in a method as outlined above. The ARA measures nitrogenase activity with greater sensitivity than growth on nitrogen-free medium.
[0638] These expression systems test the function of Nif fusion polypeptides in bacteria where all of the other Nif components required for nitrogenase function are encoded in the bacterium.
TABLE-US-00006 TABLE 6 Mutant strains of A. vinelandii which can be used to test Nif fusion polypeptides for nitrogenase function (bacterial complementation). Strain Reduces ID Comments acetylene? DJ11 nifHDK, KpnI deletion No DJ13 nifK inframe PstI deletion (aa136 aa293) No DJ33 nifDK KpnI deletion No DJ97 nifZ:kn No DJ99 nifU:kn No DJ100 nifD inframe KpnI deletion (aa103 aa376) No DJ112 nifZM No DJ349 nifM::kn Nif DJ525 nifH, removed 5 coding region of nifH No DJ771 nifU::kn No DJ1025 nifH::KanR + H-D stem loop No DJ1151 nifH:: KanR. No DJ1271 nifH :KanR No DJ1469 nifUS, Pscr-lacZ:kn No DJ262 nifUS No DJ536 nifUSVWZM No WT Wild-type Nif+
Example 17. Modification of MTP Sequences and their Use with Nif Polypeptides
[0639] The pFA MTP sequence of 77 amino acid residues in length (amino acids 1-77 of SEQ ID NO:38) as described and used in Examples 5 to 9 was derived from the Arabidopsis thaliana F1-ATPase-gamma-subunit (Lee et al, 2012), the fragment of which is here designated MTP-FA.sup.77. The cloning protocol used in Example 5 for making a gene sequence encoding the translational fusion between MTP-FA.sup.77 and distal Nif polypeptides used an intervening 9 nucleotide linker at the fusion junction that consisted of an AscI cloning site and an extra base to maintain the reading frame. Use of this linker resulted in a further three amino acids, namely Gly-Ala-Pro (GAP), between the C-terminus of MTP-FA.sup.77 and the N-terminus of the polypeptide of interest (e.g. GFP or Nif). Therefore the encoded polypeptides included, prior to cleavage in the mitochondria, an N-terminal extension of 80 amino acids which was shown to be effective in transfer of the fusion polypeptides into mitochondria and cleavage at the predicted site by mitochondrial matrix peptidase (MMP). As described in Examples 5-9, it was concluded that MTP-FA.sup.77 was capable of directing 16 different Nif fusion polypeptides to the plant mitochondrial matrix and that the MTP-FA.sup.77 sequence was processed within the mitochondria by MMP. Cleavage occurred after 42 amino acids, leaving an N-terminal extension of 38 amino acid residues fused to the GFP or Nif polypeptides of interest, 35 residues coming from MTP-FA.sup.77 plus the GAP. This N-terminal extension is here termed FA-scar.sup.38.
[0640] The inventors sought to shorten the MTP sequence from the 77 amino acids of MTP-FA.sup.77 for use with Nif polypeptides in plant cells, while still retaining MTP function. The inventors examined whether 26 amino acids could be trimmed from the C-terminus of MTP-FA.sup.77 to generate an MTP designated as MTP-FA.sup.51 (SEQ ID NO:75). The inventors predicted that MTP-FA.sup.51 would be cleaved by MPP after amino acid 42, leaving 9 amino acids (ISTQVVRNR; SEQ ID NO:76) from MTP-FA.sup.51 at the N-terminus of the processed fusion polypeptide. This 9-amino acid sequence was designated as FA-scar.sup.9.
[0641] To test the function of MTP-FA.sup.51, genetic constructs were made encoding this MTP fused to NifH or to GFP. These constructs included modified Nif/H or GFP genes that were identical to the NifH gene in pRA10 (SEQ ID NO:42) or the GFP gene in pRA01 (SEQ ID NO:38) except that MTP-FA.sup.51 was fused to the N-terminus of each polypeptide rather than MTP-FA.sup.77 plus the GAP. The resultant constructs were designated pRA34 (MTP-FA.sup.51::NifH) and pRA35 (MTP-FA.sup.51::GFP). The truncation was carried out by ligation cycling reaction (de Kok et al 2014), using pRA01 as an example. pRA01 without the nucleotides coding for the C-terminal 29 amino acids of MTP-FA.sup.77 and the additional 9 nucleotides coding for amino acids GAP were amplified by PCR using primers 5-ATGGTGAGCAAGGGCGAGGAG-3 (SEQ ID NO.xxx) and 5-GCGGTTACGCACCACTTGAGTTG-3 (SEQ ID NO.xxx) and pRA01 as template. The resulting PCR product was ligated with bridging oligo 5-CTCCTCGCCCTTGCTCACCATGCGGTTACGCACCACTTGAGTTG-3 and Illumina Ampligase (Illumina, A8101) with conditions outlined in de Kok et al. (2014). These constructs were tested in the N. benthamiana leaf system and compared to the corresponding constructs having MTP-FA.sup.77 plus the GAP. For pRA34 and pRA10, protein extracts were produced from the infiltrated leaf tissues. The extracts were subjected to SDS PAGE and Western blot analysis using HA-antibody to assess protein expression levels and MPP processing efficiency for the comparison.
[0642] Protein extracts from E. coli expressing the constructs encoding MTP-FA.sup.51::NifH::HA (pRA34) and MTP-FA.sup.77+GAP::NifH::HA (pRA10), used as controls for the unprocessed fusion polypeptides, yielded polypeptide bands of the expected sizes for unprocessed MTP::NifH. Protein extracts from the N. benthamiana leaf tissues infiltrated with these constructs yielded polypeptide bands of smaller sizes than the corresponding bacterial extracts, corresponding to the sizes expected for the processed polypeptides. For example, expression of the MTP-FA.sup.51::NifH::HA polypeptide yielded a band at a smaller MW than MTP-FA9.sup.77+GAP::NifH::HA in accordance with the difference in expected size between these two polypeptides. It was therefore concluded that the MTP-FA.sup.51 amino acid sequence was capable of targeting Nif polypeptides to the mitochondrial matrix in plant cells and provided for processing by MPP. The polypeptide expression levels and processing efficiencies were as good as for the longer MTP. Additionally, fewer polypeptide bands of smaller sizes, thought to indicate degradation products, were detected with the HA antibody in the blots for pRA34. The inventors concluded that the shorter MTP sequence unexpectedly reduced N-terminal MTP::Nif degradation.
[0643] Experiments were also carried out with pRA35 encoding the fusion-GFP polypeptide to compare it to pRA01. To visualise localisation of the polypeptide by fluorescence, leaf tissues infiltrated with the pRA01 (pFA.sup.77+GAP::GFP) or pRA35 (FA.sup.51::GFP) encoding constructs were examined by confocal microscopy. The leaf samples were imaged using an upright Leica microscope with a 40 water immersion objective. GFP was excited at 488 nm and fluorescence emission was recorded. For both constructs, GFP fluorescence was observed to be localised in small subcellular bodies, with identical localisation patterns. Based on the comparison with pRA01 which had been tested for mitochondrial localisation as described in Example 1 and from the processing data for pRA34, the inventors concluded that the shortened MTP-FA.sup.51 was capable of directing synthetic fusion polypeptides to the mitochondria of plant cells and was capable of providing for their processing by MPP in the mitochondria.
[0644] A range of different MTP sequences were tested to assess their performance in translocating Nif polypeptides to the mitochondrial matrix of plant cells. The GoldenGate cloning system (Weber et al., 2011) was used for assembling the different gene elements, including the promoters, 5-UTR, 3-UTR, N- and C-terminal extensions and terminators. Each element had defined boundaries that allowed for modular assembly and easy exchange of elements. This cloning system with components as described by Engler et al., (2014) was therefore used for testing a large variety of different genetic constructs for production of MTP::Nif fusion polypeptides. Since the GoldenGate cloning system utilised type IIS restriction enzymes that cut outside their recognition sequence, it was possible to avoid the use of restriction enzyme cloning sites within the junction sequences. This allowed construction of genes encoding MTP::Nif fusions without the Gly-Ala-Pro sequence present in pRAOO and avoided the use of AscI restriction sites as described in Examples 5-9. A Gly-Gly bridge at the junction of the MTP::polypeptide fusions was used instead, to fit the GoldenGate system. Glycine was chosen as the standard amino acid for this linkage due to its common occurrence at the 1 position of MTP sequences.
[0645] A range of different MTPs of differing lengths (30-70 amino acid residues) were selected, predicted to leave different remaining amino acid residues (scar) fused at the N-termini of the Nif polypeptides after cleavage by MPP (Table 7). The scar sequences ranged from 0-36 amino acid residues in length. Using the GoldenGate cloning system, 17 different genetic constructs were assembled using combinations of these MTPs with several Nifs (Table 8) for expression in plant cells. The NifD and NifS polypeptide sequences used in these fusions were variants of the sequences used in Examples 5-9, instead using the sequences according to Temme et al., (2012). The variant amino acid sequences are provided in SEQ ID NO:95 and SEQ ID NO:96, respectively. The variant NifD amino acid sequence (SEQ ID NO:95) differed from the sequence of 483 amino acids provided as SEQ ID NO:6 by six amino acid substitutions, at positions 39, 41, 87, 96, 355 and 483. For all these vectors, the promoters, 5 and 3UTRs and terminators were identical. Agrobacterium cultures containing these constructs, each mixed with the construct producing P19 silencing suppressor protein, were individually introduced into N. benthamiana leaves and protein extracts produced 5 days post-infiltration. SDS-PAGE and Western blot analyses were carried out on the protein extracts. For infiltrations with the MTP::NifD construct, pRA25 (pFA::NifK) was co-infiltrated, since co-expression of NifK without a C-terminal extension had been shown to enhance NifD abundance (Example 11). Table 8 summarises the results for detection of polypeptides produced in the plant cells and cleavage by MPP (processing) for each MTP::Nif fusion polypeptide.
TABLE-US-00007 TABLE7 DetailsofMTPsusedfortestinginplantsusingtheGoldenGatesystem,the Gly-Glyresiduesatthejunctionishighlightedinbold(exceptforCPN60/No linker).kDAF/P:sizeofprocessed,unprocessedMTP. kDa MTPName MTP F/P Scar CPN60 MYRFASNLASKARIAQNARQVSSR 3.77/ GG (AT2G33040) MSWSRNYGG(SEQIDNO:77) 0.13 (PrasadandStewart 1992) CPN60/NoGG MYRFASNLASKARIAQNARQVSSR 3.65/ none linker(AT2G33040) MSWSRNY(SEQIDNO:78) 0 (PrasadandStewart 1992) Superoxide MAIRCVASRKTLAGLKETSSRLLRIR 3.34/ IQGG(SEQID dismutase(SOD) GIQGG(SEQIDNO:79) 0.37 NO:88) (At3G10920) (Huang,Tayloretal. 2009) Superoxide MAIRCVASRKTLAGLKETSSRLLRIR 6.65/ IQGG(SEQID dismutasedoubled GIQMAIRCVASRKTLAGLKETSSRLL 0.37 NO:89) (2SOD) RIRGIQGG(SEQIDNO:80) (At3G10920) (Huang,Tayloretal. 2009) Superoxide MAIRCVASRKTLAGLKETSSRLLRIR 3.1/ GG dismutasemodified GGG(SEQIDNO:81) 0.13 (SODmod) (At3g10920) (Marques,Santoset al.2014) Superoxide MAIRCVASRKTLAGLKETSSRLLRIR 6.07/ GG dismutasemodified GMAIRCVASRKTLAGLKETSSRLLRI 0.13 (2SODmod)doubled RGGG(SEQIDNO:82) (At3g10920) (Marques,Santoset al.2014) L29(At1G07830) MFLTRFVGRRFLAAASARSESTTAA 3.5/ ESTTAAAAAS (Huang,Tayloretal. AAASTIRGG(SEQIDNO:83) 1.36 TIRGG(SEQ 2009) IDNO:90) Neurosporacrassa MASTRVLASRLASQMAASAKVARP 7.5/ YSGG(SEQID F0ATPasesubunit9 AVRVAQVSKRTIQTGSPLQTLKRTQ 0.38 NO:91) MTP(SU9) MTSIVNATTRQAFQKRAYSGG(SEQ (Burn,Youngetal. IDNO:84) 2017) gATPasegamma MAMAVFRREGRRLLPSIAARPIAAIR 5.75/ ISTQVVRNRG subunit(FA51) SPLSSDQEEGLLGVRSISTQVVRNRG 1.19 G(SEQID (At2G33040) G(SEQIDNO:85) NO:92) (Huang,Tayloretal. 2009) CoxIVtwinstrep MLSLRQSIRFFKPATRTLCSSRYLLQ 6.61/ QQKPSAWSH (ABM97483) QKPSAWSHPQFEKGGGSGGGSGGS 3.64 PQFEKGGGSG (Burn,Jiangetal. AWSHPQFEKGG(SEQIDNO:86) GGSGGSAWS 2017) HPQFEKGG (SEQID NO:93) CoxIV10xHis MLSLRQSIRFFKPATRTLCSSRYLLQ 5.07/ KPGGHHHHH (ABM97483) QKPGGHHHHHHHHHHGG(SEQID 1.84 HHHHHGG (unpublished) NO:87) (SEQID NO:94)
TABLE-US-00008 TABLE 8 Western blot analysis of polypeptides produced after introduction of constructs (designated by SN number) into leaf cells for expression of NifH, NifD, NifM, NifS and NifU. Western MTP SN# Nif Signal? Processed FA51 10 D Y Y FA51 30 M Y Y (p) FA51 31 S Y Y FA51 32 U Y Y FA51 18 H Y UD FA51/HA 29 H Y UD CPN60 11 D Y N CPN60 No GG 4 D Y Y (p) link 2SOD 12 D Y UD SOD 13 D Y N SU9 14 D Y Y SODmod 15 D N n/a 2SODmod 16 D N n/a L29 17 D Y UD CoxIV twin strep 19 D Y Y CoxIV twin strep 28 H ? ? CoxIV 10His 20 D ? ? Pro: processed, (p) = partial -less than 50% of processed form detected by Western blot. UD: unable to discriminate processing based on band size.
[0646] When translationally fused as a MTP::Nif fusion, MTP-FA.sup.51 yielded a cleaved MTP::Nif polypeptide for all of the Nif polypeptides tested (Table 7). The NifM fusion polypeptide was only partially processed when fused to FA.sup.51, whereas other Nif fusion polypeptides were processed more efficiently, demonstrating that processing efficiency for different Nifs can vary for the one MTP. A version of FA.sup.51 was tested that had a HA epitope fused at the C terminus of the MTP, then fused to NifH (SN29). The polypeptide expressed from this construct was detected by Western blot analysis (Table 8).
[0647] Two versions were tested of the CPN60 MTP fused to NifD. In one version, the MTP was fused such that a Gly-Gly linker was placed between the CPN60 MTP (SEQ ID:77) and NifD (SN11). In the other version (SN4), the CPN60 MTP (SEQ ID:78) was fused directly to the first methionine of NifD polypeptide. As CPN60 was predicted to be cleaved immediately after the C-terminal tyrosine in its amino acid sequence, this construct would theoretically produce NifD polypeptide with a wild-type N-terminus, i.e. no scar, whereas the SN11 construct was predicted to leave a Gly-Gly extension after cleavage of the MTP(GlyGly)::NifD fusion. Surprisingly, these very similar constructs produced differing outcomes as evidenced by Western blot analysis: SN11 yielded a polypeptide band at the size expected for unprocessed CPN60(GlyGly)::NifD, whereas SN4 yielded bands corresponding to both processed and unprocessed polypeptides, with more unprocessed polypeptide present than processed polypeptide. Furthermore, when protein from the infiltrations with SN4 was compared by Western blot to protein extracted from a parallel pRA24+pRA25 (FA.sup.77+GAP::NifD::HA+FA.sup.77+GAP::NifK) infiltration (see also Example 11), it was apparent that the SN4 construct produced considerably less correctly processed polypeptide than the pRA24 construct. Therefore it appeared that, although the CPN60 MTP was able to target the fusion polypeptide and allowed for matrix processing to produce a wild-type NifD polypeptide, the expression level and processing efficiency was low (US2016/0304842). For SN11, the Gly-Gly linkage between CPN60 and NifD may have prevented processing of the MTP.
[0648] A variety of MTPs from superoxide dismutase polypeptides were also tested, either as single or tandem MTPs, and with or without the inclusion of Ile and Gln at the C terminus prior to the Gly-Gly linkage. Polypeptides were not detected by Western blot analysis for the versions containing the SOD MTP (SN15, SEQ ID NO:81 and SN16, SEQ ID NO:82) that did not contain the Ile and Gln residues, whereas the versions that retained the Ile and Gin residues (SN12, SEQ ID NO:79 and SN13, SEQ ID NO:80) did produce detectable polypeptides, although it appeared that they were not processed by the MPP. In contrast, another MTP tested, L29 (SN17, SEQ ID NO:83), yielded strong polypeptide signals when fused to NifD. Due to the small difference in size between processed and unprocessed forms with this MTP, additional experiments will be required to determine processing efficiency. It is expected that the L29 MTP yielded cleaved Nifpolypeptide in an efficient manner. Finally, the inventors tested the CoxIV MTP with a twin strep tag (Burn et al. 2017) fused at the C terminus, but upstream of the Gly-Gly linkage (SN19, SEQ ID NO:86). This MTP when fused to NifD gave strong signals by Western blot analysis, of a size consistent with mitochondrial matrix processing.
Functional Testing of Different Scar Sequences Fused to Nif Polypeptides in the Bacterial System
[0649] The consequence on Nif polypeptide function of incorporating various MTPs and of the sequences remaining at the N terminus of the Nif fusion polypeptides after cleavage was assessed in the MIT2.1 system. For example, the DNA fragment encoding pFA-scar.sup.9, with a Met as the first amino acid instead of Ile, was inserted immediately upstream of the translation start codon of Nif genes in pMIT2.1 by guided ligase cycling techniques (de Kok et al., 2014). The methods used to make the constructs were as described for NifB in Example 16. The 27 bp DNA fragment encoding pFA-scar.sup.9 was fused to the 5 terminus of various Nif genes in pMIT2.1. Transformation of E. coli and testing for nitrogenase function using the acetylene reduction assay was performed as per Example 16.
[0650] These assays showed that the addition of the 9 amino acid extension to the N-terminus of NifB did not change nitrogenase function when compared to the level of ethylene production seen with the unmodified pMIT2.1. In analogous manner, NifH, NifD, NifK, NifE and NifN also tolerated the 9 amino acid extension at their respective N-termini, with full activity for NifH but with some reduction of activity in other cases. The 9 amino acid extensions to the N-termini of NifD, NifK, NifE and NifN yielded levels of acetylene reduction activity which were 50%, 70%, 30%, and 50% compared to that of the unmodified pMIT2.1, respectively. The other Nif polypeptides, namely NifJ, NifY, NifQ, NifF, NifU, NifS, NifV, NifW, NifZ and NifM, are tested in the same manner. Using such assays, optimal MTP sequences are selected for each Nif polypeptide.
Example 18. Addition to the C-Terminus of NifK Destroys its Activity
[0651] As described in Example 10, the inventors concluded from modelling of the structure of the NifK polypeptide from K. pneumoniae that the C-termini of the NifK subunits were buried in the core of the NifD-NifK-NifH protein complex and that any C-terminal extension to the NifK polypeptide relative to the wild-type sequence would likely result in disruption of the complex. This was tested functionally using the bacterial nitrogenase system described in Example 16 by modification of the pMIT2.1 plasmid. The plasmid was modified in order to express a modified NifK polypeptide having a 9 amino acid C-terminal extension relative to the wild-type sequence, by addition of the amino acid sequence YPYDVPDYA (SEQ ID NO:97), as follows.
[0652] To introduce the NifK modification, a nucleotide sequence coding for the amino acids YPYDVPDYA (SEQ ID NO:97), codon optimised for expression in E. coli, was added to the 5 of the reverse primer at the 3 end of NifK. That primer, 5-TCATCAAGCGTAATCAGG AACATCGTAGGGGTAACGAACCAGATCGAAAGAATAGTCGG-3 (SEQ ID NO:98), and a forward primer 5-AAGGGCGAATTCCAGCACACTGG-3 (SEQ ID NO:99) were used in PCR with pTopoH-J (Example 16) DNA as template, containing the first half of pMIT2.1, to give a 7909 bp product. The remaining 7222 bp was also amplified by PCR using primers 5-CCTGATTGTATCCGCATCTGATGCTAC-3 (SEQ ID NO:100) and 5-AACCTGCAGGGCTAACTAACTAACCACGGACAAAAAACC-3 (SEQ ID NO:101). In similar fashion as described in Example 16, the two PCR fragments were then ligated together using ligation cycling reaction (LCR) with the primers BO1, 5-GGTAGCATCAGATGC GGATACAATCAGGTCATCAAGCGTAATCAGGAACATCGAGG-3 (SEQ ID NO:102) and BO2, 5-CCAGTGTGCTGGAATTCGCCCTTAACCTGCAGGGCTAACTAACTAAC CACG-3 (SEQ ID NO:103) using the method of de Kok et al., (2014). The ligated DNA fragment was digested with SbjI and ligated to the SbfI fragment from pB-ori containing the unmodified NifBQFUSVWZM genes, yielding the modified MIT2.1 vector encoding a fusion polypeptide having a C-terminal extension added to NifK.
[0653] The resultant genetic construct was introduced into E. coli strain DH5 containing pN249 and cultures of cells transformed with both vectors were grown as described in Example 16. The cultures were tested for ethylene production in acetylene reduction assays. The results showed that the 9-amino acid C-terminal extension added to NifK completely abolished ethylene production. The control, unmodified pMIT2.1, yielded positive ethylene production. The inventors concluded that a translationally fused extension at the C-terminus of NifK relative to the wild-type C-terminus abolished nitrogenase activity as measured by reduction of acetylene, in agreement with the modelling studies described in Example 10.
[0654] Given the biochemical tests above demonstrated that an extension to the C terminus of NifK abolished nitrogenase function, and previous in planta experiments had shown that co-expression of NifD and NifK with a wild-type C terminus enhanced NifD abundance (Example 11), the inventors concluded that a wild-type C terminus in NifK polypeptide was critical for both stability and function of the NifD-NifK hetero-tetramer and therefore nitrogenase activity.
[0655] This was further investigated by expressing different versions of genes expressing NifD together with NifK having a wild-type C terminus (pRA25) and assessing NifD abundance. Example 20 describes a series of genetic constructs each comprising a NifD gene that were made to assess NifD abundance in N. benthamiana. NifD in this experiment included a C-terminal HA epitope. After co-infiltration of these constructs (Table 8) in the presence of a genetic construct to express the silencing suppressor P19, as used for all N. benthamiana infiltrations, and with or without a co-infiltrated pRA25 (NifK), protein abundance and MPP processing of NifD::HA were assessed by SDS PAGE and Western blot analysis using anti-HA antibody. The analysis (
[0656] Of further note, a polypeptide band of approximately 48 kDa and thought to be a degradation product of NifD was observed for all of the tested constructs. Since this polypeptide was detected with the anti-HA antibody and was observed as a sharply defined polypeptide band on the gels, it must have represented a specific cleavage product including the C-terminus of NifD. Unexpectedly, the amount of this product was also enhanced by co-expression of pRA25 (NifK). This indicated an interaction between the NifD and NifK polypeptides. Based on these observations, the inventors considered that the NifD degradation was mitochondrial matrix specific and provided support for an interaction of NifD and NifK in the MM.
[0657] One possibility that was tested regarding the polypeptide of approximately 48 kDa produced when NifD::HA encoding constructs were introduced into plant cells was that the 48 kDa polypeptide was produced from a second, downstream translation initiation. The NifD gene has a number of ATG codons corresponding to Met residues in the region which might lead to a 48 kDa translation product. To test this possibility, a genetic construct was made (pRA30) that was identical to pRA24 except that the second to fifth Met codons downstream of the NifD start codon were replaced with Ala codons. After infiltration of pRA30 and pRA24 separately into N. benthamiana leaves and analysis by SDS-PAGE and Western blotting, the banding pattern for pRA24 and pRA30 were the same, with the approximately 48 kDa polypeptide product still being present. This observation refuted the hypothesis that the 48 kDa sized bands seen for when the NifD::HA gene was expressed was due to alternate translation initiation. It was concluded that this polypeptide was produced by an unknown degradation process in the MM.
Example 19. Assessing NifD-NifK and NifE-NifN Fusion Polypeptides
[0658] Example 12 describes the design and construction of a gene encoding a NifD-NifK fusion polypeptide, using a linker consisting of 30 amino acid residues between the C-terminus of NifD and the N-terminus of NifK. The linker comprised a FLAG epitope for detection of the polypeptide. A second gene was now designed and constructed which had the same arrangement of NifD-(FLAG) linker-NifK except that the FLAG epitope was replaced with a HA epitope. The amino acid sequence, also of 30 amino acid residues, encoded by the linker in this second gene was ATPPPGSTTTAYPYDVPDYATPPPGSTITA (SEQ ID NO:104) with the HA epitope as amino acids 12-20 in the linker. Both of these fusion polypeptides were tested for functionality by acetylene reduction assays in the pMIT2.1 vector-based bacterial system described in Example 16, as follows.
[0659] First, the NiJD::HAlinker::NifK gene from pRA31 was PCR amplified using primers pRA31DK-FW 5-ATGATGACTAACGCTACAGGAGAA-3 (SEQ ID NO:105), and pRA31 DK-RV 5-TCATCATCTAACCAAATCAAAACTGTAATCTG-3 (SEQ ID NO:106). The nucleotide sequence in that gene was codon-optimised for expression in Arabidopsis thaliana. The first half of pMIT2.1 without the nifD and nifK genes was also generated by PCR using primers D_start_RV 5-CCGGCTCCTCCGCTAGATAAAAATGTG AATTTTTGCATGCAGCC-3 (SEQ ID NO:107), and K_end_FW 5-CCTGATTGTATCCGCATCTGATGCTACCGTGGTTGA-3 (SEQ ID NO:108). The amplified PCR products were ligated by ligation cycling reaction using bridging oligos 5-TTCTCCTGTAGCGTTAGTCATCATCCGGCTCCTCCGCTA-3 (SEQ ID NO: 109) and 5-CAGATGCGGATACAATCAGGTCATCATCTAACCAAATCAAAACTG-3 (SEQ ID NO:110), and digested with SbfI. The digested DNA fragment was ligated to pB-ori DNA which had also been digested with SbfI, generating a modified form of pMIT2.1 including the NifD::HAlinker::NifK fusion gene.
[0660] Functional testing in E. coli (DH5a) cells showed that the modified pMIT2.1 vector comprising the NifD::HAlinker::NifK gene could reduce acetylene to ethylene, at about 10% of the level of the unmodified pMIT2.1. That is, the fused polypeptide with a 30 amino acid linker between otherwise wild-type NifD and NifK polypeptides was clearly functional even though with 10-fold reduced activity in the bacterial system.
[0661] In an attempt to increase the nitrogenase activity of the fusion polypeptide, two changes were made and the experiment essentially repeated. The changes were firstly to use a variant amino acid sequence for NifD (Temme et al., 2012), see Example 17, and secondly to use nucleotide sequences codon-optimised for K. pneumoniae rather than A. thaliana. The constructs were generated in the same manner as described above. That is, the operon structure between nifD and nifK in the unmodified pMIT2.1, encoding separate NifD and NifK polypeptides, was replaced with a nucleotide sequence encoding the translational fusions of NifD-linker-NifK, thus forming NifD::linker::NifK genes in modified pMIT2.1 for each of the FLAG- and HA-containing linkers. Functional testing in E. coli (DH5a) cells showed that the modified NifD::FLAGlinker:NifK and NifD::HAlinker:NifK genes in pMIT2.1 reduced acetylene to produce ethylene at about 100% and 80%, respectively, of the amount relative to the amount for the unmodified pMIT2.1. It was concluded that the reduced activity for the first NifD-linker-NifK fusion was due to the less than ideal NifD amino acid sequence, or the plant-optimised codon usage, or both. This demonstrated the importance of using the appropriate polypeptide sequences and codon-optimisation according to the host cells.
[0662] For expression in plant cells and import into the mitochondrial matrix, an MTP sequence would be required and an N-terminal extension was predicted to remain after cleavage within the MTP. For example, use of MTP-FA.sup.51 (Example 17) followed by cleavage by MPP would leave a 9-amino acid N-terminal extension fused to the Nif polypeptide. Therefore, the effect of adding such a 9 amino acid extension to the NifD-linker-NifK polypeptide was tested, except that the first residue of the 9 (Ile) was replaced with a Met residue to provide for efficient translation. The 9-amino acid sequence was added to the N-terminus of the NifD portion of the NifD::linker.:NifK fusion polypeptide, using the cloning approach as described above. The acetylene reduction ability of the combination of these two modifications was then tested in the pMIT2.1 system.
[0663] To generate the constructs, a DNA sequence of 27 nucleotides coding for the 9 amino acid extension (MSTQVVRNR, SEQ ID NO:111) was added to the 5 end of the NifD::linker::NifK fusion genes, for each of the FLAG and HA epitopes in the linker. Acetylene reduction assays on E. coli containing the constructs showed that the addition of the 9 amino acid N-terminal extension to the NifD::HAlinker::NifK polypeptide yielded approximately the same level of ethylene production as the NifD::HAlinker::NifK lacking the 9 amino acid extension at the N-terminus, i.e. the N-terminal extension was well tolerated and did not reduce nitrogenase activity. This was consistent with previous findings that the 9 amino acid extension could be added to wild-type NifD without reducing its activity.
[0664] The inventors also tested the function of a translational fusion between NifD and NifK without any linker sequence in the MIT2.1 system by removing the stop codon of the nifD gene, spacer sequence and ribosomal binding site for the nifK coding region from unmodified MIT2.1. This direct fusion of reading frames to encode a NifD-NifK polypeptide (termed herein NifD-no linker-NifK) reduced the acetylene reduction activity to 5% compared to the positive control. This reduction in function of NifD-no linker-NifK showed the benefit of including a flexible linker of about 30 amino acid residues that allowed proper conformational association between the NifD and NifK parts of the fusion polypeptide to form a functional dinitrogenase structure.
NiJE-NifN Fusions
[0665] Similar to NifD and NifK, NifE and NifN are known to form a hetero-tetramer. The function of this complex with respect to nitrogenase activity is to receive the FeMo cofactor core from NifB, molybdenum from NifQ, and homocitrate from NifV for FeMo cofactor maturation (Hu and Ribbe, 2011). The inventors realised that NifE and NifN should be expressed at an equimolar level for optimal nitrogenase function and that fusing the two polypeptides would reduce the number of promoters, MTPs and terminators required for recombinant expression of nitrogenase. A gene encoding a fusion polypeptide between NifE and NifN was therefore designed and made, following the rationale for NifD and NifK fusion (above), except that a linker of 46 amino acid residues was used instead of 30 amino acid residues for the NifD-linker-NifK fusion polypeptides. This was designed, constructed and tested as follows.
[0666] A homology model of the NifE-NifN .sub.2.sub.2 hetero-tetramer from K. pneumoniae was constructed using the crystal structure of the NifE-NifN complex from Azotobacter vinelandii (PDB ID: 3PDI, (Kaiser et al., 2011)) as a template. Aligning the K. pneumoniae and corresponding A. vinelandii polypeptides, the amino acid sequence identities were 68.1% for the NifE polypeptides and 44.2% for the NifN polypeptides. The inventors realised that, in the structural model for the K. pneumoniae .sub.2.sub.2 hetero-tetramer (NifE.sub.2NifN.sub.2), the C-terminus of each NifE subunit was approximately 70 from the N-terminus of its NifN partner. Therefore, a linker of a suitable length was designed to connect the two units, having 46 amino acid residues. The inventors considered that the linker should curve around the surface of the hetero-tetramer and have a length of about 104 , therefore the number of 46 amino acid residues was selected. The inventors also considered that the linker should optimally have several other characteristics, including flexibility.
[0667] The amino acid sequence of the selected 46-residue linker was based on a naturally occurring linker between the carbohydrate binding domain and the catalytic domain of a cellobiohydrolase from Talaromyces funiculosus (UniProtKB: Q8WZJ4). It was chosen based on several criteria, including a lack of cysteine residues to avoid formation of unwanted disulphide linkages, few or no charged residues (Glu, Asp, Arg, Lys) to reduce the likelihood of unwanted surface salt bridge interactions, few or no hydrophobic residues (Phe, Trp, Tyr, Met, Val, Ile, Leu) as such residues may promote a tendency to penetrate the surface of the polypeptide, and the linker sequence lacked post-translationally modified amino acidssee Uniprot entry www.uniprot.org/uniprot/Q8WZJ4, in which the linker is residues 457-493. A Phe residue at position 2 in the cellobiohydrolase sequence was replaced with a Ser to reduce hydrophobicity. The HA epitope sequence YPYDVPDYA (SEQ ID NO:112) was inserted between amino acids 16 and 17 of the linker, merely to aid detection and quantification of the fusion polypeptidethe linker does not need such an epitope for function. The HA epitope was positioned closer to the N-terminus than the centre of the linker in order to distance it from the single, positively charged lysine residue which was retained. The resulting linker sequence was TSSGGTSTGGSTTTTAYPYDVPDYASGTTSTKASTTSTSSTSTGTG (SEQ ID NO:113), containing the HA epitope as amino acids 17-25 and the retained lysine at position 32.
[0668] To create a genetic construct and test the function of the NifE-linker-NifN fusion polypeptide, the region between the NiJE and NifN cistrons in pMIT2.1 was replaced with a nucleotide sequence encoding the translational fusion including the 46-residue linker, using the same cloning approach as for previous constructs in modifying pMIT2.1. The nucleotide sequence was codon-optimised for Arabidopsis thaliana, even though the fusion gene was to be tested in E. coli. The nifE::HAlinker::nifN gene was PCR amplified from pRA01-EN using primers pRAEN-FW 5-ATGAAGGGAAATGAGATTCTTGCTCTT-3 (SEQ ID NO: 114), and pRAEN-RV 5-TCATCAATCAGCAGCATAAGCACC-3 (SEQ ID NO: 115). The first half of pMIT2.1, without niJE and nifN, was also generated by PCR using primers E_start_RV 5-TTGTAATAACCTCCAGTGATGAATTGAATA-3 (SEQ ID NO:116), and N_end_FW 5-CTAGAGATTAATATGGAGAAATTAAGCATG-3 (SEQ ID NO:117). The amplified PCR products were ligated using ligation cycling reaction using bridging oligos 5-AAGAGCAAGAATCTCATTTCCCTTCATTTGTAATAACCTCCAGTGATGAATTGAT AGTG-3 (SEQ ID NO:118) and 5-TAGTTTTCATGCTTAATTTCTCCATATTAATCTCT AGTCATCAATCAGCAGCATAAGCACC-3 (SEQ ID NO:119), after which the second half of pMIT2.1 (pB-ori) that was not modified was ligated with the modified first half after both DNAs were digested with SbfI. The resultant construct was designated AtNifE::linker.:NifN/MIT2.1.
[0669] Functional testing of the modified MIT2.1 vector comprising the AtNifE::linker::NifN gene in E. coli cells by acetylene reduction assays showed ethylene production at about 40% of the level relative to the unmodified MIT2.1.
[0670] For expression in plant cells and import into mitochondrial matrix, an MTP sequence would be required and an N-terminal extension was likely to remain after cleavage within the MTP sequence by MPP. For example, use of MTP-FA.sup.77 with cleavage by MPP would leave a 38-amino acid N-terminal extension on the fusion polypeptide. Therefore, the effect of adding such a 38 amino acid extension, with substitution of the first Ile residue with a Met residue to provide for efficient translation, was tested by adding a nucleotide sequence encoding it to the AtnifE::linker.:nifN gene. Translation of the gene would thereby add the 38 amino acid extension to the N-terminus of NifE of the NifE::linker:NifN fusion polypeptide. The effect of the combination of these two modifications on nitrogenase activity was tested in the pMIT2.1 system, using the same cloning approach as before.
[0671] The modified pMIT2.1 vector comprising the 38aa::AtNifE::linker.:NifN gene in E. coli yielded ethylene production at about 25% of the level relative to the unmodified pMIT2.1. That is, use of the 38 amino acid extension at the N-terminus yielded positive, although decreased, nitrogenase activity relative to unmodified pMIT2.1. The inventors considered that the reduction might have been due at least in part to the A. thaliana codon usage being suboptimal for effective translation in E. coli, which could readily be tested by creating a translational fusion of the native Klebsiella NifE and NifN with bacterial codon-optimisation. The inventors considered other ways that the NifE-linker-NifN fusion polypeptide function could be optimised, as follows. The 38 amino acid extension at the N-terminus of NifE might interfere with effective FeMo cofactor release from the NifE.sub.2NifN.sub.2 hetero-tetramer, as the N-terminus of the NifE subunit of the hetero-tetramer was in close proximity to the cavity where the FeMo cofactor resides (Kaiser et al., 2011). NifE.sub.2NifN.sub.2 hetero-tetramer activity may be increased by use of a MTP that is completely removed upon MPP processing, or by truncating the N-terminal coding region of NifE to accommodate the extra extension when an MTP sequence was used which was not completely removed. It was also considered possible that the 46 amino acid linker could loop out to partially obstruct the entrance of the FeMo cofactor cavity, thus interfering with either receiving the FeMo cofactor core from NifB or releasing the mature FeMo cofactor. In this case, the linker can be shortened or the C-terminus of NifE can be truncated, or both, to avoid the linker region obstructing the cavity. Variants according to these strategies can readily be tested using the pMIT2.1 system and optimised.
SUMMARY
[0672] Both of the NifD-linker-NifK and NifE-linker-NifN fusion polypeptides were capable of supporting the reduction of acetylene in the pMIT2.1 bacterial system i.e were functional to provide for nitrogenase activity. Addition of a 9 amino acid N-terminal extension to NifD-linker-NifK provided for full nitrogenase activity. Addition of a longer, 38 amino acid N-terminal extension to the NifE-linker-NifN fusion polypeptide was also shown to be functional, although with reduced activity relative to the polypeptide without the N-terminal extension. The inventors concluded that the strategy of expressing these fusion polypeptides using an N-terminal MTP sequence in plant cells, in combination with other required Nif polypeptides, would allow for expression of nitrogenase activity. Additional advantages of the NifD-NifK and NifE-NifN fusion strategies exemplified here included production of the subunits at an equimolar level for optimal nitrogenase function and that fusing two polypeptides, or two pairs of polypeptides, would reduce the number of promoters, MTPs and terminators required for recombinant expression of nitrogenase in plant cells.
Example 20. Testing Different Promoters for Nif Fusion Polypeptide Expression in Plant Cells
[0673] A range of different promoters were assessed for their effectiveness in expressing Nif genes to produce Nif polypeptides in plant cells, exemplified in N. benthamiana leaf cells. Five different promoters were selected for this purpose, namely two versions of the S4 promoter from subterranean clover stunt virus (SCSV-S4) (Schnmann et al., 2003a; Schnmann et al., 2003b), a SCSV-S7 promoter (Schnmann et al., 2003a), and two versions of a CaMV 35S promoter, namely a longer form of the 35S promoter and an enhanced form comprising a duplicated enhancer (235S) for maximising gene expression (Table 9). The SCSV promoters are expressed strongly in most plant tissues and are considered to be constitutive promoters. The NifD polypeptide used in these tests as an example of a Nif polypeptide was the version used in Example 17 (SEQ ID NO:95). NifD was chosen in this experiment as an example of a Nif polypeptide because, of all of the Nif polypeptides tested (Examples 5-9), it was the most difficult to express. Five vectors were made each using a different promoter, but otherwise identical, including a sequence encoding the FA.sup.5 MTP (Table 9) for translocation and processing in plant mitochondria. GoldenGate cloning methods (Weber et al., 2011, Engler et al., 2014) were used to generate the five constructs, allowing for a modular gene assembly approach.
[0674] Agrobacterium cells containing these vectors, each mixed with Agrobacterium cells containing the construct producing P19 silencing suppressor protein, were individually introduced into N. benthamiana leaves and protein extracts produced 5 days post-infiltration. Corresponding, paired infiltrations were carried out with the above constructs with or without addition of pRA25 (pFA.sup.77+GAP::NifK), since co-expression of NifK without a C-terminal extension had been shown to enhance NifD abundance (Example 11). SDS-PAGE and Western blot analyses using anti-HA antibody were carried out on the protein extracts (
[0675] When introduced into the plant cells, all five constructs produced polypeptides detected with the antibody (
[0676] These results demonstrated that, surprisingly, despite the use of the same MTP for each construct, different promoters could have substantial effects not only on protein expression levels but also on the processing efficiency of mitochondrial matrix-targeted Nif proteins. These results also confirmed the enhancing role on Nif) abundance of expression of NifK without a C-terminal extension.
TABLE-US-00009 TABLE 9 Different promoters tested to assess expression of MTP::NifD::HA in N. benthamiana, and processing efficiency of the fusion polypeptide. SEQ ID Promoter NO SN# Processing efficiency SCSV-S4 version 1 120 6 Partial, <50% cleaved SCSV-S4 version 2 121 7 >50% SCSV-S7 122 8 >50% CaMV-35S long 123 9 Partial, <50% cleaved version CaMV-2x25S 124 10 Partial, <50% cleaved
Example 21. Testing Redundancy of NifS and NifU for Nitrogenase Function
[0677] For the function of nitrogenase, there are two Nif proteins that provide the iron-sulphur fragments to different nitrogenase components for their respective iron sulphur (FeS) cluster biosyntheses. NifS is the pyridoxal P-dependent cysteine desulphurase that activates sulphur to supply sulfide (Zheng et al., 1993), and NifU is the molecular scaffold that receives the sulphide from NifS and assembles the FeS cluster (Agar et al., 2000). Together they supply the FeS clusters to NifB for the FeMo cofactor core (L-cluster) assembly (Hu and Ribbe 2011), as well as to the Fe protein (NifH) with the assistance of a peptidyl-prolyl cis/trans isomerase NifM (Gavini et al., 2006) for the [4Fe-4S] and successive P-cluster ([Fe8-S7]) formation with the aid of NifZ (Lee et al., 2009). In eukaryotes, there are orthologues of NifS and NifU that provide FeS fragments to various enzymes that contain FeS clusters (Couturier et al., 2013). In particular, plant mitochondria have NfsI (At5g65720) and IsuI (At4g22220) polypeptides as orthologues of NifS and NifU, respectively, while in plastids Nfs2 (Atlg08490) and SufB (At4g04770) are the functional equivalents for NifS and NifU, respectively. Both of the mitochondrial and plastid systems are aided by additional accessory proteins to fulfil FeS cluster assembly and transfer to their target enzymes in their native organelle environment. It has recently been demonstrated in yeast mitochondria and tobacco plastids that NifS and NifU are not necessary for recombinant Fe protein activity (Lopez-Torrejon et al., 2016; Ivleva et al., 2016).
[0678] To test the functionality of plant orthologues of NifS and NifU in the pMIT2.1 system in E. coli, the Klebsiella NifS and NifU genes are replaced with plant NfsI and IsuI genes, either singly or two replacements in combination. Nitrogenase function of the modified pMIT2.1 is assessed by the acetylene reduction assay. Also, an A. thaliana nfsl mutant (SALK_083681) and an isuI mutant (SALK_006332) are transformed with genetic constructs comprising the Klebsiella NifS and NifU genes, respectively, targeted to the mitochondrial matrix, to see if the bacterial Nif enzymes can complement these plant mutations. This experiment is intended to demonstrate that bacterial Nif proteins can functionally substitute for plant equivalents (Frazzon et al., 2007). Successful complementation demonstrates the capacity of the chosen MTP to target nitrogenase proteins to the mitochondria in a functional state. This experiment provides the first demonstration of the nitrogenase-related function of a Nifpolypeptide in a plant, in this case for NifS and NifU.
Example 22. Measuring Nif Polypeptide Expression Using Mass Spectrometry
[0679] To develop Nif polypeptide detection and quantification techniques that did not use Western blot and antibody detection methods and therefore avoided the use of epitopes to be added to the Nif polypeptides, the inventors sought to directly detect and quantify various Nif proteins using mass spectrometry methods, specifically using a proteolytic digest bottom-up MS/MS protocol. This made use of an Oritrap Fusion Tribrid mass spectrometer (ThermoFisher) which has three mass analysers that work in parallel to provide high mass resolution and mass accuracy with the Orbitrap mass analyser of parent ions in full scan. The methodology and sensitivity of this instrument was thought to be capable of achieving more protein and peptide identifications from complex, unpurified protein mixtures than other instruments available at this time. This instrument was first tested by analysing samples in a data dependent fashion to allow for the untargeted detection of peptides and proteins in bacteria expressing Nif proteins, specifically E. coli cells transformed and expressing pMIT2.1 which encoded 16 different Nif polypeptides. The crude protein mixtures were treated with trypsin to provide peptides in the molecular weight ranges for detection. Once specific peptides were identified which were produced by tryptic digestion of the Nif polypeptides, targeted lists could be created that specifically isolated the parent mass of peptides of interest at their expected retention time. This targeted approach helped to eliminate the possibility that peptides from Nif proteins were missed due to low abundance or were not selected by the data dependent method due to a large number of endogenous bacterial or plant tryptic peptides.
[0680] This mass spectrometry based protocol was successful in detecting the full ensemble of 16 different Nif proteins expressed in E. coli transformed with the pMIT2.1 plasmid. At least one specific peptide was detected for every one of the 16 Nif polypeptides. Multiple specific tryptic peptides were detected for almost all of the Nif polypeptides, up to a maximum of 19 peptides for Nif polypeptides, covering 4-55% of the total Nif polypeptide sequences (Table 10). The Sum PEP score for many of the Nif polypeptides was very high (Table 10) indicating complete confidence in the ability of this method to specifically detect and measure Nif polypeptide levels. In this context, the Sum Posterior Error Probability (PEP) Score is the sum of the negative logarithms of the PEP values of the peptide spectrum matches. The larger the Sum PEP value, the less likely a false positive for detection.
[0681] The method was then tested on crude extracts from N. benthamiana cells expressing various MTP::Nif genetic constructs, using the method described below to process plant leaf samples which had been infiltrated with Agrobacterium containing the vectors of interest. All infiltrations included a mixture with Agrobacterium contained the genetic construct for co-expression of the P19 silencing suppressor protein (SEQ ID NO:125). Detection of two specific tryptic peptides (SEQ ID NO:126; SEQ ID NO:127) from the P19 viral suppressor protein was used as a positive control for the success of the transient expression system.
[0682] The method was successful in specifically detecting between 3 and 16 specific tryptic peptides from each of the NifK, NifB, NifH, NifF, NifJ, NifS and NifX polypeptides when expressed transiently in the plant cells. For example, specific peptides detected in plant cells from these Nif fusion polypeptides are listed below. For each of those transient expression experiments, the two specific peptides from P19 were also detected. In some experiments using genes to express other Nif polypeptides where specific Nif peptides were not detected, the two specific peptides from P19 were also not detected. That indicated poor transformation efficiency in those experiments, probably due to sub-optimal plant health. The experiments are repeated with better plants.
TABLE-US-00010 TABLE 10 Detection of Nif polypeptides expressed in E. coli containing pMIT2.1 Number of Nif peptides Coverage polypeptide detected [%] Sum PEP Score NifK 19 45 84.509 NifD 17 44 83.275 NifY 9 55 74.182 NifS 10 31 72.156 NifH 12 54 71.288 NifU 6 33 52.114 NifB 9 30 29.351 NifN 3 9 21.912 NifJ 5 7 16.1 NifW 4 47 10.093 NifF 3 24 8.315 NifE 3 8 8.104 NifM 3 12 5.97 NifZ 2 22 3.354 NifV 1 4 3 NifQ 1 9 1.54
[0683] Exemplary, Specific Peptides from NifK Detected in Plant Cells:
TABLE-US-00011 (SEQIDNO:128) INSCYPLFEQDEYQELFR (SEQIDNO:129) QLEEAHDAQR (SEQIDNO:130) EALTVDPAK (SEQIDNO:131) TFTADYQGQPGK (SEQIDNO:132) LPKLNLVTGFETYLGNFR (SEQIDNO:133) MMEQMAVPCSLLSDPSEVLDTPADGHYR (SEQIDNO:134) MYSGGTTQQEMK (SEQIDNO:135) EAPDAIDTLLLQPWQLLK (SEQIDNO:136) FGLYGDPDFVMGLTR (SEQIDNO:137) DSEVFINCDLWHFR (SEQIDNO:138) QPDFMIGNSYGK (SEQIDNO:139) AFEVPLIR (SEQIDNO:140) LGFPLFDR (SEQIDNO:141) QTTWGYEGAMNIVTTLVNAVLEK (SEQIDNO:142) LDSDTSQLGK (SEQIDNO:143) TDYSFDLVR
[0684] Specific Peptides from NifH Detected in Plant Cells
TABLE-US-00012 (SEQIDNO:144) LGTQMIHFVPR (SEQIDNO:145) MTVIEYDPACK (SEQIDNO:146) VMIVGCDPK (SEQIDNO:147) CAESGGPEPGVGCAGR (SEQIDNO:148) STTTQNLVAALAEMGK (SEQIDNO:149) STTTQNLVAALAEMGKK (SEQIDNO:150) QTDREDELIIALAEK (SEQIDNO:151) AQEIYIVCSGEMMAMYAANNISK (SEQIDNO:152) AVQGAPTMR (SEQIDNO:153) LGGLICNSR (SEQIDNO:154) AQNTIMEMAAEVGSVEDLELEDVLQIGYGDVR
[0685] Specific Peptides from NifB Detected in Plant Cells
TABLE-US-00013 (SEQIDNO:155) LCLSTNGLVLPDAVDR (SEQIDNO:156) FAAILELLADVK (SEQIDNO:157) GESEADDACLVAVASSR (SEQIDNO:158) AVQGAPTSCSSFSGGK (SEQIDNO:159) INSVLIPGINDSGMAGVSR (SEQIDNO:160) QVAQAIPQLSVVGIAGPGDPLANIAR
[0686] Specific Peptides from NifJ Detected in Plant Cells.
TABLE-US-00014 (SEQIDNO:161) IAGELLPGVFHVSAR (SEQIDNO:162) GTAQNPDIYFQER (SEQIDNO:163) IPFVNFFDGFR (SEQIDNO:164) IEVLEYEQLATLLDRPALDSFR (SEQIDNO:165) SGGITVSHLR
[0687] Specific Peptides from NifS Detected in Plant Cells.
TABLE-US-00015 (SEQIDNO:166) EKEIDYVVATLPPIIDR (SEQIDNO:167) EIDYVVATLPPIIDR (SEQIDNO:168) IAVDGEGALDMAQFR (SEQIDNO:169) EIITSVVEHPATLAACEHMER (SEQIDNO:170) IDMLSCSAHK (SEQIDNO:171) AMNIPYTAAHGTIR (SEQIDNO:172) QVYLDNNATTR (SEQIDNO:173) IPIAVGQTR (SEQIDNO:174) GVGCLYLR
[0688] Specific Peptides from NifX Detected in Plant Cells.
TABLE-US-00016 (SEQIDNO:175) VPADTTIVGLLQEIQLYWYDK (SEQIDNO:176) QFDMVHSDEWSMK (SEQIDNO:177) VVDFSVENGHQTEK (SEQIDNO:178) RAGDYKDDDDKPG (SEQIDNO:179) ARGDYKDDDDKPG (SEQIDNO:180) HVDQHFGATPR (SEQIDNO:181) VAFASSDYR (SEQIDNO:182) LLQEQEWHGDPDPR
[0689] Specific Peptides from NifF Detected in Plant Cells
TABLE-US-00017 (SEQIDNO:183) LASWLEEIKR (SEQIDNO:184) VLGSWTGDSVNYAASR (SEQIDNO:185) QLGELADAPVNINR (SEQIDNO:186) FVGLVLDQDNQFDQTEAR
Methods
[0690] Plant leaf samples were frozen with liquid nitrogen and ground with a mortar and pestle under liquid nitrogen. Two volumes (v/v) of Urea/SDS buffer (6 M urea, 2% SDS, 62.5 mM Tris-HCl pH 6.8, 65 mM DTT) were added to the ground leaf discs and left at room temperature (30 min) for cell lysis and reduction of proteins with DTT. Samples were centrifuged at 16,000 g for 5 min. 10-20 l of the soluble fraction was applied to a microcon-30 MWCO filter with 100 l of Urea buffer and centrifuged at 10,000 g for 10 min. Cysteine residues were inactivated with acrylamide by the addition of 100 l urea buffer and 3.5 l of 40% acrylamide, incubated at room temperature for 30 min followed by centrifugation at 10,000 g for 10 min. Two wash steps of 100 l of ammonium bicarbonate (25 mM in water) and centrifugation as above preceded the tryptic digest with 0.5 g trypsin (Promega) in 60 p1l ABC and incubated overnight at 37 C. Peptides from the tryptic digest were eluted by centrifugation at 10,000 g for 10 min. Optical density at 280 nm was used (Nanodrop) to determine peptide concentration and samples were diluted into LCMS loading buffer to 50 ng/l.
[0691] 250 ng of tryptic digest from each sample was injected onto a Dionex Nanomate 3000 (ThermoFisher) nano LC system directly coupled to an Orbitrap Fusion Tribrid Mass Spectrometer. The peptides were desalted for 5 min on an Acclaim PepMap C18 (300 , 5 mm300 m) trap column at a flow rate of 10 L/min with loading solvent, and separated on an Acclaim PepMap C18 (100 , 150 mm0.075 mm) column at a flow rate of 0.3 L/min at 35 C. A linear gradient from 5% to 40% solvent B over 60 min was employed followed by a wash and re-equilibrate 40-99% B over 5 min, a 5 min hold at 99% B, return to 5% B over 6 min, and held for 7 min. The solvents used were: (A) 0.1% formic acid, 99.9% water, (B) 0.08% formic acid, 80% acetonitrile, 19.92% water. The nano-LC was directly coupled to the Nanospray Flex Ion source of the Orbitrap Fusion MS. The ion spray voltage was set to 2400 V, the sweep gas was set to 1 Arb, and the ion transfer tube temperature was set to 300 C. Data were acquired in data-dependent acquisition mode consisting of a Orbitap-MS survey scan followed by parallel acquisition of a high resolution Orbitrap scan at 120,000 resolution and multiple MS/MS events in the linear ion trap, over a 3 second period. First stage MS analysis was performed in positive ion mode over the mass range of m/z 400-1500 with an AGC target of 410.sup.5 and a maximum injection time of 50 ms. Tandem mass spectra were acquired in the ion trap on precursor ions that exceeded an intensity threshold of 1000 counts with charge state 2-7. Spectra were acquired using quadrupole isolation with a 1.6 m/z isolation window and (Higher energy Collisional Dissociation) HCD set at 28% based on the size and charge of the precursor ion for optimum peptide fragmentation. Ion trap scan rate was set to rapid with an AGC target of 410.sup.3 and a maximum injection time of 300 ms, the instrument was set to utilise the maximum parallelizable time for injecting ions into the trap during a 3 second window whilst the orbitrap was collecting high resolution MS spectra. Dynamic exclusion was set to exclude precursor ions after one occurrence with a 15 sec interval and a mass tolerance of 10 ppm.
[0692] Protein identification was conducted using the Sequest algorithm in Proteome Discoverer v2.1 (ThermoFisher). Carbamidomethyl was selected as the alkylating agent and trypsin, was selected as the digestion enzyme, dynamic modifications for oxidation on H, M, W and deamidated N and Q were selected, with a maximum of three modifications. Tandem mass spectrometry data were searched against in house databases of Nif constructs, common contaminants and organism specific databases annotated from UniProt. The database search results were manually curated to yield the protein identifications using a 1% global false discovery rate (FDR) determined by the in-built FDR tool within Proteome Discoverer software.
[0693] It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the above-described embodiments, without departing from the broad general scope of the present disclosure. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.
[0694] All publications discussed and/or referenced herein are incorporated herein in their entirety.
[0695] Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is solely for the purpose of providing a context for the present invention. It is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed before the priority date of each claim of this application.
REFERENCES
[0696] Abe et al., (2000). Cell 100:551-560. [0697] Allen et al., (1994). Crit. Rev. Biotechnol 14:225-249. [0698] Allen et al., (1995). J. Biol. Chem. 270:26890-26896. [0699] Agar et al., (2000). Journal of Biological Inorganic Chemistry 5:167-177. [0700] Balk and Pilon (2011). Trends Plant Sci 16:218-226. [0701] Bechtold et al., (1993). C.R. Acad. Sci. Paris 316:1194-1199. [0702] Becker et al., (2012). Trends in Biochemical Sciences 37:85-91. [0703] Bevan et al., (1983). Nature 304:184-187. [0704] Boison et al., (2006). Arch. Microbiol. 186:367-376. [0705] Birchler, J. A. (2015). Chromosome Res 23:77-85. [0706] Block et al., (1987). The EMBO journal 6:2513-2518. [0707] Breuers et al., (2012). Front Plant Sci 3. [0708] Brigle et al., (1987). J. Bacteriol. 169.1547-1553. [0709] Brosnan et al., (2007). Proc. Natl. Acad. Sci. USA, 104:14741-14746. [0710] Bruce (2001). Biochimica et Biophysica Acta (BBA)Molecular Cell Research 1541:2-21. [0711] Burn et al., (2017a). Front Plant Sci 8:1567. [0712] Burn et al. (2017b). ACS Synthetic Biology 6(6):1043-1055. [0713] Buren and Rubio (2018) Fems Microbiol Lett 365:fnx274; doi: 10.1093/femsle/fnx274. [0714] Campbell et al., (2014). Insect Biochem Mol Biol 48:40-50. [0715] Carrie et al., (2010). Journal of Biological Chemistry 285:36138-36148. [0716] Chacinska et al., (2009). Cell 138:628-644. [0717] Chen et al., (2013). Advanced Drug Delivery Reviews 65:1357-1369. [0718] Cheng et al., (2005). Biochemical and Biophysical Research Communications 329:966-975. [0719] Chiu et al., (2001). Biochemistry 40:641-650. [0720] Christiansen et al., (1998) Biochemistry-Us 37: 12611-12623. [0721] Clausen et al., (2000). Proc. Nat. Acad. Sci. U.S.A. 97:3856-3861. [0722] Cotton (2009). J. Am. Chem. Soc. 131: 4558-4559. [0723] Coutu et al., (2007). Transgenic Res 16:771-781. [0724] Couturier et al., (2013). Frontiers in Plant Science 4, art. 259. [0725] Cui et al., (2013). Proceedings of the National Academy of Sciences 110, 2052-2057. [0726] Cupp-Vickery et al., (2003). J. Mol. Biol. 330:1049-1059. [0727] Curatti et al., (2006). Proc. Natl. Acad. Sci. U.S.A. 103:5297-5301. [0728] Curatti and Rubio (2014). Plant Sci 225:130-137. [0729] Darshi et al., (2012). Journal of Biological Chemistry 287:39480-39491. [0730] De'ath et al., (2012). Proc. Natl. Acad. Sci. USA 109:17995-17999. [0731] de Bruijn (2015). In: Biological Nitrogen Fixation pp. 1087-1101. John Wiley & Sons, Inc. [0732] de Kok et al., (2014). ACS Synth. Biol. 3:97-106. [0733] Dilworth et al., (1988). Biochem. J. 249:745-751. [0734] Dilworth et al., (1993). Biochem. J. 289:395-400. [0735] Dos Santos (2011). Methods. Mol. Biol. 766: 81-92. [0736] Dos Santos et al., (2012). Bmc Genomics 13:162. [0737] Drummond (1985). Biochem. J. 232:891-896. [0738] Eady (1996). Chem. Rev. 96:3013-3030. [0739] Engler et al., ACS Synthetic Biology 3(11):839-843. [0740] Fani et al., (2000). J. Mol. Evol. 51:1-11. [0741] Fay et al., (2015) Proc Natl Acad Sci USA 112: 14829-14833. [0742] Fay et al., (2016). Proc. Natl. Acad. Sci. U.S.A. 2016:9504-9508. [0743] Frazzon et al., (2007). Plant Molecular Biology 64:225-240. [0744] Furste, et al., (1986). Gene 48:119-131. [0745] Gavini et al., (1998). Biochemical and Biophysical Research Communications. 244(2):498-504. [0746] Gavini et al., (2006). Journal of Bacteriology 188:6020-6025. [0747] Geddes et al., (2015). Curr Opin Biotech 32:216-222. [0748] Geigenberger and Fernie (2014). Antioxid Redox Sign 21:1389-1421. [0749] Glaser and Deshi (1999). J Bioenerg Biomembr 31:259-274. [0750] Glibert et al., (2014). Environ Res Lett 9:e105001; doi.org/10.1088/1748-9326/9/10/105001. [0751] Glick et al., (1992). Cell 69:809-822. [0752] Goodwin et al., (1998) Biochemistry-Us 37: 10420-10428. [0753] Good and Beatty (2011). PLoS Biol 9, e1001124. [0754] Hu et al., (2004). J. Biol. Chem. 279:54963-54971. [0755] Hu et al., (2005). Proc. Natl. Acad. Sci. U.S.A. 102:3236-3241. [0756] Hu et al., (2006). Proc. Natl. Acad. Sci. U.S.A 103:17119-17124. [0757] Hu et al., (2008). Biochemistry 47:3973-3981. [0758] Hu and Ribbe (2011). Coordination Chemistry Reviews 255:1218-1224. [0759] Hu and Ribbe (2013). Bba-Bioenergetics 1827:1112-1122. [0760] Huang et al., (2009). Plant Physiology 150(3):1272-1285. [0761] Hurt et al., (1985). EMBO J. 4:2061-2068. [0762] Hwang et al., (1996). J. Mol. Evol. November; 43:536-540. [0763] Igarashi and Seefeldt (2003). Crit. Rev. Biochem. Mol. Biol. 38:351-384. [0764] Ivleva et al., (2016). PLoS ONE 11, e0160951. [0765] Johnson et al., (2005). Biochem. Soc. Trans. 33:90-93. [0766] Kaiser et al., (2011). Science 331:91-94. [0767] Kerscher et al., (1997). The Journal of Cell Biology 139:1663-1675. [0768] Kim and Rees (1994). Biochemistry 33:389-397. [0769] Kohler et al., (1997). Plant J. 11:613-621. [0770] Lahiri et al., (2005). Biochemical and Biophysical Research Communications 337:677-684. [0771] Lawson and Smith (2002). Met Ions Biol Syst; 39:75-119. [0772] Lee et al., (2000). J. Bactiol. 1827088-7091. [0773] Lee et al., (2009). Proc. Natl. Acad. Sci. U.S.A. 106, 18474-18478. Lee et al., (2012). Plant Cell 24:5037-5057. [0774] Lill and Miihlenhoff (2008). Annual Review of Biochemistry 77:669-700. [0775] Lopez-Torrejon et al., (2016). Nature Communications 7:11426. [0776] Mackenzie and McIntosh (1999). Plant Cell 11:571-585. [0777] Marques et al., (2014). Acta Crystallographica Section F 70(5):669-672. [0778] Masukawa et al., (2007). Appl. Eaviron Microbiol 73:7562-7570. [0779] Mayer et al., (1999). J. Mol. Biol. 292:871-891. [0780] Merrick and Dixon (1984). Trends Biotechnol 2:162-166. [0781] Miller and Eady (1988). Biochem. J. 256:429-432. [0782] Mueller et al., (2012). Nature 490:254-257. [0783] Mhlenhoff et al., (2003). EMBO J. 22:4815-4825. [0784] Murcha et al., (2004). J Mol Biol 344:443-454. [0785] Murcha et al., (2014). Bba-Gen Subjects 1840:1233-1245. [0786] Oldroyd and Dixon (2014) Curr Opin Biotechnol 26:19-24. [0787] Olson et al., (2000). Biochemistry 39:16213-16219. [0788] Orm et al., (1996). Science 273:1392-1395. [0789] Ouzounis et al., (1994). Trends Biochem. Sci. 19:199-200. [0790] Petrie (2014). Plos One 9: Issue 1, e85061. [0791] Petrova et al., (2000). Biochem. Biophys. Res. Commun. 270:863-867. [0792] Pfanner and Geissler (2001) Nat. Rev. Mol. Cell Biol. 2:339-349. [0793] Poza-Carrion et al., (2014). Journal of Bacteriology 196:595-603. [0794] Prasad et al., (1992). Plant Molecular Biology 18(5):873-885. [0795] Pratte et al., (2006). J. Bacteriol. 188:5806-5811. [0796] Rees et al., (2005). Philos Trans A Math Phys Eng Sci. 363:971-984. [0797] Robson and Postgate (1980). Annual Review of Microbiology 34:183-207. [0798] Robson et al., (1989). EMBO J. 8:1217-1224. [0799] Rockstrom et al., (2009). Nature 461:472-475. [0800] Roise et al., (1986) The EMBO Journal 5:1327-1334. [0801] Roise and Schatz (1988). J. Biol. Chem. 263:4509-4511. [0802] Rubio et al., (2004) J Biol Chem 279: 19739-19746. [0803] Rubio and Ludden (2008). Annu Rev Microbiol 62:93-111. [0804] Sahoo et al., (2014). Planta 240:855-875. [0805] Sali and Blundell, (1993). J. Mol. Biol. 234:779-815. [0806] Santi et al., (2013). Ann Bot 111:743-767. [0807] Schleiff and Soll (2000) Planta 211:449-456. [0808] Schmid et al., (2002). Science 296:352-356. [0809] Schmitz et al., (2001). FEMS Microbiol Lett. 195:97-102. [0810] Schunmann et al., (2003a). Functional Plant Biology 30(4):443-452. [0811] Schunmann et al., (2003b). Functional Plant Biology 30(4):453-460. [0812] Seefeldt et al., (2009). Annu Rev Biochem 78:701-722. [0813] Shah et al., (1999). J. Bacteriol. 181:2797-2801. [0814] Siddavattam et al., (1993). Mol. Gen. Genet 239-435-440. [0815] Smil (2002). Ambio 31:126-131. [0816] Smanski et al., (2014). Nature Biotechnology 32:1241-1249. [0817] Sorlie et al., (2001). Biochem. 40:1540-1549. [0818] Schindelin et al., (1997). Nature 387:370-376. [0819] Staples et al., (2007). J. Bacteriol. 189:7392-7398. [0820] Studier and Moffatt (1986). J Mol Biol 189:113-130. [0821] Suh et al., (2003). Journal of Biological Chemistry 278:5353-5360. [0822] Sutton et al., (2008). Environ Pollut 156:583-604. [0823] Temme et al., (2012). Proc. Natl. Acad. Sci. U.S.A. 109(18):7085-7090. [0824] Tezcan et al., (2005). Science 309:1377-1380. [0825] Thiel et al., (1995) Proc Natl Acad Sci USA 92: 9358-9362. [0826] Thiel et al., (1997). J. Bacteriol. 179:5222-5225. [0827] Voinnet et al., (2003). Plant Journal 33:949-956. [0828] von Heijne (1986). EMBO J. 5:1335-1342. [0829] Waldron et al., (1985). Plant Mol Biol 5:103-108. [0830] Wang et al., (2013). PLoS Genet 9, e1003865. [0831] Weber et al., (2011) PloS one. 6(2), pp. e16765. [0832] Wiig et al., (2011) Proc Natl Acad Sci USA 108: 8623-8627. [0833] Wood et al., (2006). Proc. Natl. Acad. Sci. USA. 103:14631-14636. [0834] Wood et al., (2009). Plant Biotechnol J. 7:914-924. [0835] Yuvaniyama et al., (2000). Proc. Natl. Acad. Sci. U.S.A. 97:599-604. [0836] Zhang and Glaser (2002). Trends Plant Sci 7:14-21. [0837] Zhang et al., (2009). Progress in Natural Science 19:1197-1200. [0838] Zheng et al., (1993). Proc. Natl. Acad. Sci. U.S.A. 90:2754-2758 [0839] Zheng et al., (1997). J. Bacteriol. 179:5963-5966.