Ligase activity
10597710 ยท 2020-03-24
Assignee
Inventors
- Gregory Lohman (Cambridge, MA, US)
- Thomas C. Evans, Jr. (Topsfield, MA)
- Larry A. McReynolds (Beverly, MA, US)
Cpc classification
International classification
C12N9/00
CHEMISTRY; METALLURGY
Abstract
Compositions and methods are provided for ligating polynucleotides having a length that is greater than 8 nucleotides on an RNA splint. The ligation reaction provides consistent results in high or low ATP concentrations. The reaction can occur rapidly and is generally at least 10 fold more efficient than T4DNA ligase under optimal conditions for T4DNA ligase and the reaction time is less than 6 hours for example, less than 1 hour.
Claims
1. A method for detecting a polymorphism in an RNA, comprising: (a) hybridizing at least two DNA polynucleotide sequences to a polymorphic sequence in an RNA; (b) ligating the at least two DNA polynucleotide sequences to one another using a ligase that has an amino acid sequence that is at least 90% identical to the Chlorella virus PBCV-1 ligase of SEQ ID NO:1, to produce a ligation product, and (c) detecting the ligation product of (b), thereby detecting the polymorphic sequence.
2. The method of claim 1, wherein the RNA is of biological origin.
3. The method of claim 1, wherein the RNA is the genome of an RNA virus.
4. The method of claim 1, wherein the RNA is a cellular RNA.
5. The method of claim 4, wherein the cellular RNA is a miRNA, long non-coding RNA, mRNA or tRNA.
6. The method of claim 1, wherein the ligation of step (b) is a done in a buffer comprising 1 M to 1.5 mM ATP.
7. The method of claim 1, wherein the RNA has a length of at least 10 nucleotides.
8. The method of claim 1, wherein the ligation product of step (b) is circular.
9. The method of claim 1, wherein the ligation product of step (b) is linear.
10. The method of claim 1, wherein the ligase is PBCV-1 ligase.
11. The method of claim 1, wherein the detecting step (c) comprises amplifying the ligation product of step (b).
12. The method of claim 11, wherein the amplifying is done by PCR.
13. The method of claim 11, wherein the amplifying is done by rolling circle amplification.
14. The method of claim 1, wherein the RNA is complementary to at least 8 nucleotides of each of the at least two DNA polynucleotide sequences.
15. The method of claim 1, wherein the detecting is quantitative.
16. The method of claim 1, wherein the ligase that has an amino acid sequence that is at least 95% identical to the Chlorella virus PBCV-1 ligase of SEQ ID NO:1.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
DETAILED DESCRIPTION
(23) A ligase is described herein that surprisingly ligates ssDNA oligonucleotides splinted by a ssRNA with high efficiency. This ligation efficacy substantially improves the utility of techniques that preferably utilize RNA splinting with two or more oligonucleotides in methods such as RASL and RASL-seq as well as methods that enhance the utility of molecular inversion probes and modified ligase chain reaction/ligase detection reaction for RNA analysis and detection.
(24) The term RNA splint ligase unless specified otherwise refers to an enzyme that is capable of ligating at least two ssDNA polynucleotides splinted by a complementary ssRNA polynucleotide and is capable of achieving ligation in less than 6 hours at molar concentrations of enzyme that are not absolutely required to be in molar excess compared to substrate. For very low concentrations of substrate, the enzyme may be in excess for convenience. Examples of RNA splint ligases are DNA ligases that are naturally occurring or closely related variants having at least 90%, 95%, 98% or 99% amino acid sequence identity to the wild type ligase where the ligase may be derived from algal viruses such as the Chlorella virus, for example, PBCV-1 ligase (SEQ ID NO:1), or may be identified by Blast search of the GenBank or NCBI or other database using for example, the basic local alignment search tool found on blast.ncbi.nlm.nih.gov/Blast.cgi using the query id gi|9632109|ref|NP_048900.1. as of Mar. 14, 2013 and variants and mutants thereof. The RNA splint ligase includes protein fusions including purification tags (e.g. HisTag, chitin binding domain (CBD), maltose binding protein (MBP), biotin) or DNA binding domain fusions (e.g. sso7d, or alkyl guanine transferase (AGT)).
(25) The RNA splint ligase, single stranded polynucleotide and/or splint RNA may be immobilized on a matrix such as a reaction surface, or a magnetic bead to facilitate automated protocols and multiplexing reactions.
(26) Contrary to the publication describing PBCV-1 ligase as inactive in ligating DNA oligonucleotides together on an RNA splint (Sriskanda, et al., (1998)), it has here been shown here that ssDNA oligonucleotides of a size greater than 8 nucleotides can surprisingly be ligated together to form a single oligonucleotide of at least 16 nucleotides when splinted by a complementary RNA with an efficiency that is greater than 10 fold to 1000 fold over T4 DNA ligase.
(27) The term RNA splint includes a ssRNA having a size greater than 8 nucleotides or 10 nucleotides for example, greater than 12 or 15 or 18 or 20 or 22 or 24 or 26 or 28 or 100 nucleotides or a size as large as an RNA virus genome that is capable of hybridizing at least in part to at least two, three or more single stranded polynucleotides for example having a size of at least 8 or 10 or 12 or 14 or 16 or 20 nucleotides or greater in length so as to enable the ligation of the fragments to each other by means of an RNA splint ligase.
(28) The RNA splint may be entirely complementary to the hybridizing polynucleotide, or may extend longer than the complementary region on the hybridizing polynucleotide, for example the splint may be 2, 4, 6, 8, 10 or more nucleotides longer than the hybridizing polynucleotide. The splint may be a portion of a much larger RNA structure for example an mRNA, tRNA, other cellular RNA, or RNA viral genome, such that a region of the RNA is complementary to the hybridizing polynucleotide but the majority of the structure has no complementarity to the hybridizing polynucleotide.
(29) The RNA splint can come from any source. For example, splint RNA can be prepared by chemical synthesis or obtained from mRNA samples, total RNA, microRNAs, long noncoding RNAs or other naturally occurring RNAs, nucleic acid libraries, cells, cultures, tissues, pathogens, bodily fluids, urine, serum, biopsy samples, and environmental samples. Any other source of RNA that is known or can be developed can be used with the disclosed method.
(30) The term polynucleotide includes DNA, RNA or part DNA and part RNA. The polynucleotides when used in a ligation reaction with an RNA splint are preferably single stranded and may be partially or wholly complementary to at least a portion of the RNA splint. An example of a polynucleotide described herein is a ssDNA oligonucleotide comprising at least 8 nucleotides.
(31) The term single stranded DNA oligonucleotide (ss DNA) refers to a probe that may be naturally occurring or synthetic. In one embodiment, the ss DNA oligonucleotide has a known sequence and has been synthesized by means of chemical synthesis. Depending on cost of the synthesis procedure, it may be preferable to design a probe of a length that is less than 100 nucleotides. The probe may contain 4 or more nucleotides that are exactly complementary to an RNA splint sequence or to a specific RNA sequence. The probe may also contain defined sequences at an end that is opposite to the ligation junction. These defined sequences may be used in downstream processing such as for an adaptor for primer dependent amplification; as a marker; and/or as a sequence tag for molecule enrichment either before or after splint ligation.
(32) The ss DNA oligonucleotide may have an unknown sequence and may be derived from a virus, a prokaryotic or a eukaryotic cell or from any other natural source such as a bodily fluid, or environmental source. By using an RNA splint of known sequence, one or more ss DNA oligonucleotides may be identified. If the DNA oligonucleotide or oligonucleotides are naturally occurring or are a product of cloning, there is no particular limit on size for use in RNA splint mediated ligation.
(33) Where the probe sequence is known, the RNA splint may have an unknown sequence. The ss DNA oligonucleotides of known sequence may be used to identify the RNA following ligation by means of the RNA splint ligase. The sequences of several RNA splint ligases that may be used in the present method are set forth in the following Genbank accessions: NP_048900.1, 1P8L_A, 2Q2T_A, AGE48553.1, 1FVI_A, AGE57431.1, AGE54684.1, AGE51623.1, YP_001498739.1, AGE55055.1, AGE54372.1, YP_001497930.1, AGE59692.1, AGE55911.1, AGE49090.1, AGE49418.1, AGE56564.1, AGE50110.1, AGE60028.1, AGE59352.1, AGE53463.1, AGE56452.1, YP_001426668.1 and AGE55586.1, which Genbank entries are incorporated herein in their entireties. The RNA splint ligase may be a protein fusion where the enzyme of portion thereof is fused to a second protein such as a purification tag (e.g. HisTag, chitin binding domain (CBD), maltose binding protein (MBP), biotin) or a DNA binding domain fusions (e.g. sso7d, or alkyl guanine transferase (AGT)). The RNA splint ligase may be at least 5 fold, 10 fold, 20 fold, 30 fold, 40 fold, 50 fold 60 fold, 70 fold, 80 fold, 90 fold, or as much as 100 fold, 200 fold, 300 fold, 400 fold, 500 fold, 600 fold, 700 fold, 800 fold, 900 fold or 1000 fold or 2000 fold, 3000 fold, 4000 fold, 5000 fold or more efficient at ligating oligonucleotide substrate on an RNA splint than T4 DNA polymerase under the same reaction conditions using the same substrate. In one example, splint ligases (such as chlorella virus splint ligase had a faster maximum turnover rate (>20) and a much lower Km (1 nM vs 300 nM for T4) for the RNA:DNA substrates than did T4DNA ligase. The T4 DNA ligase has a Km of about 300 nM compared to 1 nM for the splint ligase.
(34) In some embodiments the RNA splint includes a ssRNA or a denatured double stranded RNA which may be derived from a viral RNA which may be a positive or negative sense single strand RNA or double strand. The RNA splint may be a naturally occurring RNA found in a virus, a prokaryotic or a eukaryotic cell or from any other natural source such as a bodily fluid, or environmental source. Examples of RNA splints include RNAs from human disease viruses such as polio virus, picorna virus, influenza virus, Ebola virus, hepatitis C, West Nile fever, rhinovirus and measles, and RNA viruses of agricultural significance such as tobacco mosaic virus. RNA viruses have a high rate of mutation and therefore the high degree of specificity and sensitivity demonstrated herein (see for example,
(35) The term polymorphism as used herein refers to a nucleotide variation in an RNA, e.g., a miRNA, that differs from a related RNA by a single nucleotide, or two or more nucleotides. The variation may a single nucleotide, or two or more nucleotides, up to the entire sequence recognized by the sequence-specific single strand DNA probes used in the ligation reaction. The variation may be proximal to, e.g., within 5 or 6 bases of, or at the ligation junction.
(36) It must be noted that as used herein and in the appended claims, the singular forms a, an, and the include plural referents unless the context clearly dictates otherwise. It is further noted that the claims can be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as solely, only and the like in connection with the recitation of claim elements, or use of a negative limitation. As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which can be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present teachings. Any recited method can be carried out in the order of events recited or in any other order which is logically possible.
(37) The present teachings encompass various alternatives, modifications, and equivalents, as will be appreciated by those of skill in the art. Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range is encompassed within the present disclosure.
(38) Where the hybridizing polynucleotide has complementary regions to the RNA splint, this may be limited to the ligation junction with non-complementary regions elsewhere. Examples include primer binding regions for PCR amplification, self-complementary regions for reverse molecular beacon design, non-complementary linker regions, or non-complementary regions extending beyond the length of the RNA splint. The hybridizing polynucleotide may be linked together by a long non-complementary region such as for molecular inversion probes for rolling circle amplification (RCA), such that they are a single polynucleotide with two distinct hybridization regions. The polynucleotide may hybridize such that they are fully base paired to the splint at the ligation site with no gaps, or they may hybridize with a gap of for example 4, 6, 8, 10, or more nucleotides apart on the RNA splint such that ligation produces ssRNA loop-out region in the splint RNA.
(39) One or more of the ss polynucleotides for hybridizing to the RNA splint, and/or RNA and/or RNA splint ligase may be coupled to a substrate for example, a matrix such as for example, a magnetic bead, a glass or silica substrate or a surface in a microfluidic device or other reaction chamber. Additional solid-state substrates to which oligonucleotides can be coupled, directly or indirectly include acrylamide, cellulose, nitrocellulose, glass, polystyrene, polyethylene vinyl acetate, polypropylene, polymethacrylate, polyethylene, polyethylene oxide, glass, polysilicates, polycarbonates, teflon, fluorocarbons, nylon, silicon rubber, polyanhydrides, polyglycolic acid, polylactic acid, polyorthoesters, polypropylfumerate, collagen, glycosaminoglycans, and polyamino acids. Solid-state substrates can have any useful form including thin films or membranes, beads, bottles, dishes, fibers, woven fibers, shaped polymers, particles and microparticles (Pease, et al., Proc. Natl. Acad. Sci. USA, 91(11):5022-5026 (1994); Khrapko, et al., Mol Biol (Mosk) (USSR) 25:718-730 (1991); Stimpson, et al., Proc. Natl. Acad. Sci. USA, 92:6379-6383 (1995); Guo, et al., Nucleic Acids Res. 22:5456-5465 (1994); U.S. Pat. Nos. 5,871,928; 554,413; 5,429,807; 5,599,695; and 6,368,801)).
(40) Coupling of polynucleotides to substrates may facilitate the handling of multiple samples singly or in multiplex reactions and in automation of the reaction. Suitable labels and capture tags used to identify products of ligation are known in the art and described in U.S. Pat. No. 6,368,801.
(41) Features of ligating polynucleotides on an RNA splint may include one or more of the following:
(42) Temperature range: Ligation may be achieved at a temperature in the range of 4 C. to 50 C. for example, 16 C., 25 C., and 37 C.
(43) Enzyme concentrations: Ligation may be achieved at a concentration in the range of, for example, 1 nM-1 mM enzyme. Relatively small amounts of RNA splint ligase may be used to ligate ssDNA on an RNA splint with at least 70%, 80%, or 90% efficiency. Examples of substrate to enzyme ratios, include a range of 1:10 to 10:1 or 100:1 to 1:100 or 1:1000 to 1000:1 or 1:10,000 to 10,000:1 with completion of ligation within 6 hours, for example within 5 hours, 4 hours, 3 hours, 2 hours or 1 hour. Completion of ligation can be determined by PCR gel or capillary electrophoresis. T4 DNA ligase requires 10:1 to 100:1 of enzyme to substrate to obtain a reaction product and can take in excess of 12 hours to perform a ligation that may be incomplete. An example of the dramatic difference in activity between an RNA splint ligase and T4 DNA ligase and T4 RNA ligase is shown in
(44) ATP concentrations: Ligation may be achieved in the presence of ATP in a range of less than 1.5 mM ATP for example, 1 M-1 mM ATP, for example, 1 mM, 0.9 mM, 0.8 mM, 0.7 mM, 0.6 mM, 0.5 mM, 0.4 mM, 0.3 mM, 0.2 mM, 0.1 mM, 90 M, 80 M, 70 M, 60 M, 50 M, 40 M, 30 M, 20 M, 10 M, or 1 M. The use of ATP in the higher end of the range provided here may be preferred because if some hydrolysis of ATP occurs during storage or under reaction conditions, the buffer remains effective at stabilizing the RNA splint ligase reaction. Furthermore, reactions can be performed in the absence of ATP, if the RNA splint ligase exists in an adenylated form.
(45) Reaction time: Ligation may be achieved in less than 12 hours. The reaction may be incubated for 5 minutes-60 minutes to achieve effective ligation or for longer periods of time as described above.
(46) pH: Ligation may be achieved at a pH in the range of pH 6-pH 9, showing ligation rates for RNA splint ligases at least 10 faster than T4 DNA ligase within that range.
(47) Ratio of reaction rates between T4 DNA ligase and an RNA splint ligase at high and low concentrations of ATP: In embodiments of the method, the rate of ligation at high ATP concentrations was consistently as much as 100:1 greater for an RNA splint ligase (PBCV-1 ligase) then for T4 DNA ligase or T4 RNA ligase regardless of substrate sequence. At low concentrations of ATP, under conditions optimized for T4 DNA ligase, the RNA splint ligase has at least fivefold or tenfold (10:1) greater activity than T4 DNA ligase.
(48) Consistent improvement in ligation using RNA splint ligases compared with T4 DNA ligase with all substrates tested: The improved ligation as described above was independent of substrate sequence. This is in contrast with ligation reactions using T4 DNA ligase that was substrate sensitive. For example, T4 DNA ligase was able to ligate two oligonucleotides (SEQ ID NO:2 and SEQ ID NO:3) using an RNA splint (SEQ ID NO:4) in optimal conditions of low ATP albeit slowly whereas when the first nucleotide was changed from T to G in SEQ ID NO:3, the T4 DNA ligase in the same reaction conditions showed no detectable ligase activity. In contrast, the RNA splint ligase was able to ligate this altered substrate efficiently as well as the unaltered substrate.
(49) Indeed, the rate of reaction difference between the best substrate and the worst substrate tested using T4 DNA ligase was greater than 1000 fold even using reported low concentrations of ATP for T4 DNA ligase (10 M ATP versus 1 mM ATP).
(50) Using the present embodiments with RNA splint ligase, the reaction difference between the same best substrate and the same worst substrate tested (as for T4 DNA ligase) using RNA splint ligase was less than 50 fold, for example (less than 40 fold, 30 fold or 20 fold) under the same reaction conditions as used for T4 DNA ligase.
(51) The above-described characteristics of the RNA splint ligase for efficient ligation reactions between single stranded polynucleotides that are splinted by RNA can be used to enhance methods of RASL, RASL-seq, and Molecular Inversion Probes (also known as padlock probes). Other uses may include using RNA splints to help build-up long ssDNA through ligation of short fragments followed by RNase treatment (for example, using RNase H or mutants thereof) to remove the RNA splints (see
(52) Quantitative mRNA profiling through RASL is generally accomplished through ligation of two ssDNA oligonucleotides (DNA probes) complementary to an RNA of interest. In standard RASL, cellular mRNA is isolated and treated with defined DNA probes that will anneal in the presence of the target mRNA sequence to form adjacent 5 and 3 DNA termini. The correctly annealed structure without gaps or mis-pairs can be ligated by the splint RNA ligase to form a ligated probe. The probes also contain qPCR primer regions adjacent to the RNA complementary region, such that when the two probes are ligated the product may be amplified, detected and quantified through qPCR. The degree of qPCR signal can be related to the quantity of the target RNA sequence in the original sample. Due to the strong preference of splint RNA ligase for correctly base paired sequences and sequences lacking gaps, splicing variants and single base polymorphisms in the target mRNA can be detected (Yeakley, et al., (2002)).
(53) RASL-seq is a variant of RASL where detection is accomplished through total DNA sequencing. In RASL-seq the qPCR primer regions are replaced with PCR sequences suitable for amplification and sequencing by any high throughput DNA sequencing methodology. Hundreds of probe sets can be run in parallel with RASL-seq and thus expression levels of hundreds of genes can be simultaneously quantified (Li, et al., (2012)).
(54) Through suitable design of probe sequence outside the mRNA complementary region, detection may be performed through other methods. One example is loop-mediated isothermal amplification (LAMP), wherein probes are designed to form LAMP target structures upon ligation (Notomi, et al., Nucleic Acids Res., 28(12):e63 (2000)). Presence of target RNA is then detected via LAMP amplification, enabling advantages such as isothermal reaction conditions, rapid detection, and implementation in field or point-of-care diagnostics. Upon successful ligation, detection of amplification of target nucleic acid via may be performed with traditional qPCR dyes and probes as described above, or with additional methodologies: turbidity detection of precipitated magnesium pyrophosphate (Mori, et. al., Biochem. Biophys. Res. Commun., 289:150-154 (2001)); colorimetric detection using metal-sensitive indicators (Tomita, et. al., Nat. Protocols, 3(5):877-82 (2008); Goto, et al., BioTechniques, 46(3):167-71 (2009)); bioluminescence through pyrophosphate conversion (Gandelman, et al., PLoS One, 5:e14155 (2010)); or detection via change in pH due to amplification in weakly-buffered conditions (Pourmand, et. al., PNAS, 103(17):6466-70 (2006); U.S. Pat. No. 7,888,015; and U.S. patent application Ser. No. 13/799,995.
(55) Molecular inversion probes use a single linear strand of DNA as the probe. Use of molecular inversion probes involves a DNA probe designed to have a complementary region to the RNA target sequence such that the 5 and 3 ends of the DNA anneal to bring the termini adjacent, forming a DNA/RNA hybrid helix connected by a loop of ssDNA. Ligation of the DNA termini in the presence of RNA complement by the RNA splint ligase forms a small circular DNA substrate for detection by, for example, RCA. Circularized DNA can be detected by either addition of RCA primers and amplification, or by removing the ssRNA through RNAse treatment leaving the RNA/DNA hybrid region to act as a primer for RCA. RCA products can then be detected by turbidity, pH change, or readout of the DNA product via gel (Li, et al., Anal. Chem., 81 (12):4906-4913 (2009); Absalan and Ronaghi, Methods in Molecular Biology, 396:315-330 (2007); Hardenbol, et al., (2003)).
(56) Other examples of reactions that rely on RNA splinting which currently use T4 DNA ligase have been described in U.S. Pat. No. 6,368,801. These methods can be improved by replacing this enzyme with an RNA splint ligase include ligase chain reaction, ligation followed by PCR; the use of Padlock probes, and the use of FRET-detected molecular beacons generated by ligation (Peng, et al., Anal Chem., 82(23):9727-35 (2010)).
(57) A common RNA detection method uses reverse transcriptase to synthesize a single stranded cDNA copy of RNA. The cDNA can be amplified by PCR using a heat stable DNA polymerase. The efficiency of cDNA synthesis depends upon the secondary structure of the RNA and the DNA primers used for synthesis. DNA ligases that are able to ligate contiguous DNA in a DNA: RNA hybrid are an attractive alternative to cDNA synthesis. The RNA acts as a splint to join the two DNA probes to allow ligation. In order for this detection method to be sensitive, the ligase needs to very efficiently ligate DNA in an RNA hybrid. For the detection of miRNAs an additional property is for the ligase to join DNA oligonucleotides where one DNA probe has only a short 4 to 6 by complementary sequence with an RNA target. The PBCV ligase has these characteristics. It is over 100 faster than either T4 DNA ligase or T4 RNA ligase 2 for RNA splinted DNA ligation. The PBCV ligase is also capable of ligating short (eg 4-6 nucleotides) regions of single strand DNA that are complementary to the RNA target for ligation.
(58) Some embodiments of the method described herein may have several advantages for RNA splint mediated ligation. For example, the greatly enhanced rate of splint mediated ligation gives the method greater sensitivityit is possible to detect very low levels of target RNAs in a background of excess non target RNAs in a biological or other sample at concentrations as low as, for example, less than 50 attomoles, for example less than 40 attomoles, 35 attomoles, 30 attomoles, 20 attomoles, 10 attomoles, 1 attomole, 0.1 attomoles or 0.05 attomoles of target RNA in 40 cycles, 35 cycles, 30, cycles, 25 cycles or 20 cycles of amplification. This permits use in a wide range of detection methods (see for example
(59) Another potential advantage of such embodiments may be the rapid rate of reaction using an RNA splint ligase such as PBCV-1. Detectable quantitative results can be readily detected by electrophoresis or using fluorescence in less than 4 hours, preferably less than 3 hours, preferably less than 2 hours, preferably less than 1 hour for the low concentrations of target RNA described above in a background of not-target RNAs at a convenient temperature such as a temperature preferably below 60 C., preferably below 45 C. for example 16 C., 25 C. or 37 C.
(60) Another potential advantage of some embodiments is the discriminatory properties of RNA splint mediated ligation. As shown in the experimental section of this disclosure, the RNA splint ligase can discriminate between as few as 1 or more, or 2, 3, or 4 or more mismatches in a 22 nucleotide complementary region of an oligonucleotide with respect to the RNA splint.
(61) Another potential advantage is that of specificity of the RNA splint ligation reaction. An RNA splint ligase can ligate two DNA oligonucleotides using an RNA splint with only a 4 to 6 base overlap of one of the DNA oligos with the RNA splint. The combination of the short overlap and discriminatory properties of the RNA splint ligase (for example a 50-100 preference for completely matched RNA:DNA duplex over a single base mismatch) provides a sensitive assay for detecting single base mismatches. In one embodiment, the mismatch may either be at the ligation junction or one base removed from the ligation junction. Assays that rely on designing oligonucleotides having mismatches provide more flexibility for point mutation detection than cDNA primer based approaches. The ligation junction can detect mismatches at either side of the ligation junction while DNA primer based synthesis is only sensitive to mismatches of the primer to the template. The length of the overlap does not determine the overall size of either RNA splint or DNA oligonucleotides. In either case, these molecules may extend beyond the hybridized sequences at the ends by no additional nucleotides or by many nucleotides with the limitations of cost being more significant than efficacy.
(62) Another advantage is multiplexing RNA splint mediated ligation for high through-put analysis. For example, in an embodiment, high through-put analysis utilizes oligonucleotides having a length of 4 to 30 nucleotides or more that are complementary to a target RNA. 4 to 22 complementary nucleotides may be preferred. In addition, pairs of DNA probes may all have conserved terminal sequences that allow them to be amplified by the same set of PCR primers. The oligonucleotides together with RNA and enzymes are combined in a multiplex reaction. 1000 RNA sequences can for example be tested using for example 50 different DNA probes complementary to 50 miRNAs in a single tube and then sequence the amplified product. The identity of the products can then be determined by DNA sequencing. The reduced cost of sequencing allows this approach to be used for surveys of known miRNA sequences.
(63) In certain embodiments, the method may be used for analyzing an RNA sample that contains a target RNA and one or more variants of the target RNA. These embodiments may involve (a) combining: (i) an RNA splint ligase, (ii) at least two single stranded DNA oligonucleotides that are complementary to adjacent sites in a target RNA; ii) an RNA sample that comprises both the target RNA and a variant of the target RNA that has a sequence variation; (b) permitting the at least two single stranded DNA oligonucleotides to ligate to form a ligation product; and (c) detecting the ligation product. In some cases, the variant of the target RNA may contain one or more nucleotide substitutions in sequences that are complementary to one or both of the single stranded DNA oligonucleotides. In other words, the sequence variation may be in the complementary region to the oligonucleotide sequences. In these embodiments, the oligonucleotides may hybridize to the variant of the target RNA, but no ligation occurs absent complete complementarity. In certain cases, the site of the sequence variation may be proximal to the ligation junction (i.e., within 6, e.g., 6, 5, 4, 3, 2, or 1, nucleotides upstream or downstream of the ligation junction, but on the RNA splint).
(64) In some embodiments, the detecting may be quantitative and, in certain cases, may be done by quantitative PCR. In particular cases, the determining step may comprise determining the amount of the target RNA relative to the amount of the variant of the target RNA. In these embodiments, two or more sets of single stranded DNA oligonucleotides may be used, wherein ligation of oligonucleotides in one set can be differentially detected and measured. This may be done by, e.g., tailing the different sets of oligonucleotides with different PCR primer sites, thereby allowing each ligation product to be amplified independently. For example, a qPCR-detected splint ligation assay is sensitive; it can quantify sub-attomole amounts of miR-122 in rat liver total RNA. For miR-122 detection the SplintR/qPCR assay was about 30 more sensitive than the comparable TaqMan assay.
(65) As noted above and below, the target RNA may be for example, an mRNA, a miRNA or a viral genome.
(66) The highly sensitive and specific RNA splint ligation reactions described herein have numerous applications in the pharmaceutical and diagnostic fields. A few examples are described below but are not intended to be limiting.
(67) Some reports have identified changes in miRNA levels associated with cancer or other clinical conditions. For example: miR-122 expression is restricted to the liver. Increased levels of this miRNA in circulation suggest liver damage. Other RNAs are also found to correlate heart disease and a variety of cancers. Recent studies have focused on RNA released in exosomessmall lipid vesicles that contain a variety of nucleic acids including miRNAs. In combination with high throughput DNA sequencing methods miRNA profiling is an important clinical indicator for many diseases.
(68) Infectious disease can be tracked and analyzed using embodiments provided herein. RNA viruses, including polio, Ebola and influenza can be detected by RNA splint ligation methods. Unlike cDNA based methods the ligation based method is very sensitive to single base mismatches. This would allow a series of probes to be designed to detect defined point mutants in the virus to measure its mutation rate. This can be combined with DNA sequencing of the cDNA to validate these changes.
(69) The minimal hybrid length required for ligation by a splint ligase was determined using 10 pairs of DNA probes that spanned miR-122 in two base increments. Gel electrophoresis was used to measure the extent of ligation of a FAM labeled probe to an unlabeled probe. Surprisingly, probe B required few as only four bases of complementary to the 5 end of miRNA-122 for ligation to probe A. However, the 3 end of the miRNA required probe A to have six to eight bases complementary to miR-122 for ligation. These results demonstrate that for miRNAs at least 12 of the 22 bases can be used as ligation junctions for DNA probes. This allows flexibility in probe design. Using the same set of RNA: DNA hybrids very little ligation was detected with either T4 DNA ligase or T4 RNA ligase 2.
(70) To obtain quantitative data on the ligation rate for three ligases, capillary electrophoresis was used to determine the ratio of ligated to unligated probe A. Probes were named by the number of nucleotides complementary to the miRNA, for example probe A10 (10 complementary bases) was ligated to probe B12 (12 complementary bases). Each probe also contained 21 or 22 nt of additional sequence non-complementary to the miRNA target, designed to match PCR primer regions for qPCR amplification/detection (see below). The CE traces for the elution of ligation reaction at three different reaction times showed the unligated 32 nt starting material (S) and 65 nt ligated product (P). Only FAM labeled probe A is detected; probe B did not contain a fluorescent label. There was a dramatic difference in ligation rates for the three enzymes. At the first time point, 5 minutes, the splint ligase achieved complete ligation of the two probes. However, at two hours T4 DNA ligase and T4 RNA ligase 2 had less than 10% ligated product. Hence the splint ligase was over 200 more efficient under these reaction conditions in ligation of the DNA probes annealed to an RNA splint than either of the T4 phage enzymes, consistent with previous reports (for T4 DNA ligase and T4 RNA ligase 2). The splint ligase had faster turnover and much tighter binding than T4 DNA ligase using an RNA: DNA duplex. The splint ligase had a 20-fold higher kcat than T4 DNA ligase and a KM less than 1 nM compared to a KM of 300 nM for T4 DNA ligase.
(71) To test the utility of a splint ligase in detecting miRNAs in a biological sample a dual quenched probe for miR-122 was designed. MiR-122 was chosen because it is an abundant miRNA that is liver specific. The splint ligation based assay had two steps, ligation of miRNA specific probes followed by PCR amplification and detection using miRNA-specific quenched oligonucleotide (oligo). The dual quenched oligo, synthesized by IDT, Integrated DNA Technologies, contained a 3 quencher and an internal ZEN quencher 8 nucleotides from the 5 fluorescein. During PCR amplification the quencher is separated from the fluor by the 5 to 3 exonuclease activity of the Taq DNA polymerase. Double quenched probes show improved sensitivity and reduced background fluorescence compared to those with a single quencher.
(72) A standard curve was constructed using four-fold serial dilutions of a synthetic miR-122 RNA oligo and 1 g total yeast RNA to mimic conditions in a biological sample. The splint ligase qPCR method could detect less than 10 zeptomoles of the synthetic miR-122 in isolation. To test the sensitivity of the assay in the presence of a mRNA background, the same assay system was used to measure endogenous miR-122 in a rat liver total RNA sample. The assay was performed in triplicate with a series of five-fold dilutions of the total RNA, from 1,000 pg to 8 pg. The calculated concentration of miR-122 from the standard curve is 130 pg per pg rat liver total RNA which is about two fold higher than the reported value of miR-122 of 60 pg/g of total liver RNA (17). The difference in miR-122 concentrations detected between the current and previously reported methods may be due to variation between the rat liver RNA samples.
(73) Members of miRNA gene families (e.g., the let-7 family) often have very similar sequences. There are eight described members of the let-7 family in humans that only differ by one or two nucleotides from the let-7a base sequence (32). The let-7 miRNAs are of interest due to their regulatory role as tumor suppressors and in embryonic development, thus accurate quantitation of let-7 levels in different tissues, stages of the cell cycle, and in tumors is of interest to further elucidate these roles. We used the natural diversity of let-7 family to test the ability of the splint ligase method to detect miRNAs that differ by a single base mismatch. We designed three pairs of DNA probes for the specific detection of let-7b, let-7c or let-7g, fully complementary only to their target sequences. Each set of probes was hybridized and ligated in the presence of all eight members of the let-7 family. Negative controls include the absence of either probe A (A), probe B (B), SplintR ligase (R) or absence of the stacking DNA oligo complementary to probe A, (S). For all three probe sets, ligation is only observed when the specific let-7 probes are hybridized and ligated to their complementary miRNA.
(74) A stacking oligo was used to enhance ligation for reactions that have a short overlap between the miRNA and probe A. The stacking oligo was complementary to probe A and is adjacent to the 3 end of the miRNA, producing a dsDNA. The stacking oligo could not be ligated to the 3 end of the miRNA because it lacks 5 phosphate, thus only serves to extend the region of double stranded nucleotide to provide a binding region for the ligase. These oligos were used in the detection of Let-7b and let-7c, which have only a 5 by and 4 by overlap between the miRNA and probe A. When the stacking oligo was omitted, lane (S), no ligation was observed. The let-7g probe set, which has a six base overlap with the miRNA, does not require a stacking oligo for efficient ligation. The enhanced ligation could be caused by stacking interactions between the 3 terminal base on the miRNA and the adjacent base of the 5 end of the stacking oligo. A second factor the ds DNA generated by the stacking oligo could enhance binding and ligation by SplintR. For dsDNA base stacking has been calculated to add approximately 1 kcal/mole to the stability of the duplex.
(75) The let-7 study demonstrates that SplintR ligase can discriminate single base mismatches on either side of the ligation junction. For example, there is only a single base difference between let-7b and let-7c, a G to A transition at the 6th base from the end of the miRNA. This nucleotide difference is located on the donor side of the ligation junction. A specific probe B was designed that had a 5 terminal C that is complementary to the G. As seen in the upper panel of
(76) Isoform specific detection was achieved even when the mismatched base was one base from the ligation junction. The ligation junction for let-7g is GU|AC while four other let-7 have GU|AU. A vertical line indicates the ligation junction. There are two factors that determine the specificity of ligation, the ability of splint ligase to discriminate between correctly paired nucleotides and the stability of the RNA:DNA hybrid.
(77) Temperature can an important factor for both the activity and specificity of SplintR ligase detection method. It was found that the temperature effected specificity using the let-7b specific probe set, with a 5 base overlap between probe B and the miRNA. These experiments did not contain a stacking oligo. (1) miRNA splinted probes were hybridized and ligated; and (2) In the presence of a let-7 specific dual-labeled probe, qPCR amplification and detection was performed. The hybridization and ligation reactions were incubated 100 min at three different temperatures: 16 C., 25 C. and 37 C. Each ligation reaction included a 15,000 fold excess (w/w) of non-specific yeast RNA over the miRNA target. The exogenous RNA was added to mimic biological conditions were miRNA often makes up less than 0.01% of the total cellular RNA. The let-7 specific probe contained a 5 FAM fluorescent dye and 3 terminal quencher and an internal ZEN quencher 8 bases from the 5 fluor. The qPCR probe is similar in design to the one used for miR-122 detection. The presence of two quenchers increases the signal to noise ratio and improved detection. The let-7 qPCR probe is 24 nt long probe with 21 nt complementary to probe A and only 3 nt complementary to the 3 end of let-7b. Since the last three nucleotides in the let-7 family are conserved this probe can detect all members of the let-7 family.
(78) The specificity of the assay was found to be dependent upon the hybridization temperature. When the ligation reaction was performed at 16 C. there is only a slight preference for detection of let-7b over the other let-7 isoforms was observed, with significant signal observed in the presence of all members of the family. The specificity for Irt-7b improved when the ligation step reaction temperature was increased to 25 C., however, and at 37 C. there was a dramatic increase in specificity for let-7b detection compared to the other let-7 isoforms. Even after 40 cycles there was very little signal observed when the target miRNA were let-7 isoforms other than let-7b. Surprisingly, the increase in specificity gained by increase in ligation temperature was not accompanied by a decrease in sensitivity: for all three temperatures the Cq value for let-7b is 18 to 20 cycles. Very specific ligation was achieved at 37 C., a temperature significantly higher than the calculated Tm, 14 C., for a 5 base pair hybrid between probe A and the 3 end of let-7. However, probe B formed a stable 17 by hybrid with let-7b and had a calculated Tm of 50 C. (34).
(79) The length of the overlap between the miRNA and DNA probe may potentially be an important factor for ligation. Three probes with different length of complementarity to the miRNA; let-7b (4 by overlap), let-7-b (5 by overlap) and let-7g (6 by overlap) were used for splint ligation followed by qPCR detection. The ligation product was amplified by PCR and detected using the dual quenched let-7 qPCR probe described above. Hybridization and ligation were at 37 C. As anticipated the longest overlap resulted in the most efficient ligation. Increasing the length of the probe A overlap with the miRNA from 4 to 5 by results in a 21-fold increase in sensitivity. When the length of overlap is increased to 6 by the sensitivity of the assay increases an additional 130-fold. The ligase-qPCR method was a significantly more sensitive method for detecting ligation products than the gel based assay described above. The gel assay did not show any ligation with a 2 or 4 base overlap and modest ligation with a 6 base overlap. However, the qPCR method for let-7 detection found that DNA ligation can be detected with a 4 or 5 base overlap between the probe and miRNA, albeit at 100 to 1,000 fold lower efficiency compared to detection of a 6 base overlap. All references cited herein are incorporated by reference.
EXAMPLES
Example 1
Assay of Ligation of DNA Oligonucleotide Substrates Using an RNA Splint
(80) In vitro ligation assayLigase substrates were prepared from a variety of sequences. The sequences used as a standard were a 30 nt deoxynucleotide ssDNA fragment modified with a 5-phosphate and a 3-fluorophore (e.g., SEQ ID NO:3) and a 20 deoxynucleotide ssDNA acceptor fragment (e.g., SEQ ID NO:2) with unmodified termini annealed to an unmodified complementary strand composed of either DNA or RNA (e.g., SEQ ID NO:4). Ligations of 100 nM of the labeled, pre-annealed oligonucleotide structure were performed in ligation buffer (50 mM Tris pH 6-9, 10 mM MgCl.sub.2, 1 mM DTT and 10 M ATP-1 mM ATP) at 15 C.-40 C. The assay was initiated by addition of ligase (T4 DNA ligase or PBCV-1 ligase) to a final concentration between 10 M and 10 M and incubated at 16 C. or 20 C. Reactions were quenched with 100 mM EDTA, diluted to 1 nM in DNA with water, and analyzed by high throughput capillary electrophoresis.
(81) Fragment analysis by high throughput capillary electrophoresis (CE)CE samples were prepared by dilution to 0.5 nM-2 nM in total FAM-label using ddH.sub.2O. The GeneScan 120 LIZ Size Standard (Applied Biosystems, Carlsbad, Calif.) was diluted 1:40 in formamide and 10 l of this solution combined with 1 l of each sample before application to either a 3130xl Genetic Analyzer (16 capillary array) or an 3730xl Genetic Analyzer (96 capillary array) (Applied Biosystems, Carlsbad, Calif.) at a 36 cm capillary length with POP7 polymer. Data was collected via Applied Biosystems Data Collection software and analyzed using PeakScanner software (V 1.0) (Applied Biosystems, Carlsbad, Calif.). The retention times and areas of all peaks in the blue (FAM) channel were recorded. Oligonucleotides (30-mer starting material, adenylylated 30-mer, and 50-mer ligation product) were identified by co-elution with synthetic standards. The fraction of each oligonucleotide in the sample was determined by dividing the peak area of each by the total peak area of all three oligonucleotides. The results are shown in
Example 2
Design of RASL Probes for Amplification
(82) TABLE-US-00001 RASLprobes (SEQIDNO:5) L(/5phos/CGGTAAGACCTTTCGGTACTAGATCGGAAGAGCACAC); and (SEQIDNO:6) R(GGAAGCCTTGGCTTTTGGAACGTTGCGTCGAGTTTTC)
were designed to target the 3 region of the luciferase RNA (Promega, Madison, Wis.). Probes at 2.5 nM or 25 nM, with or without 2.5 nM luciferase RNA were mixed together in 25 l of 1T4 DNA ligase buffer (New England Biolabs, Ipswich, Mass.). The mix was heated to 65 C. for 10 minutes to denature the RNA and then at 45 C. for 60 minutes for the probe to anneal. Either 0.25 g of PBCV-1 ligase or T4 DNA ligase (New England Biolabs, Ipswich, Mass. (M0202S, 250 NEB units)) was added and the ligation mix was incubated at 37 C. for 60 minutes. 1 l of the ligation mix was used for qPCR analysis using primers (GTGTGCTCTTCCGATCT (SEQ ID NO:7) and GGAAGCCTTGGCTTTTG (SEQ ID NO:8)) with Taq DNA polymerase using standard condition with PCR condition at 95 C. for 2 minutes and then 50 cycles at 95 C. for 10 minutes, 52 C. for 15 minutes and 68 C. for 30 minutes. The results are shown in
(83) Here, in the absence of template, the background signal using PBCV-1 ligase is reduced compared to T4 DNA ligase where at least 10% and as many as 50% (5-15 cycles) more thermocycles would be required during PCR amplification before a background signal was detected.
(84) Where a positive signal from amplification of an RNA splint ligated DNA was detected, this occurred after 10%-50% (5-15) fewer cycles of amplification than would a positive signal using T4 DNA ligase for the same DNA.
Example 3
Characterization of PBCV-1 Ligase in a Comparison with T4 DNA Ligase at Varying Concentrations of Ligase and ATP
(85)
(86) The results shown in
Example 4
Determining Splice Variants for a Single Gene
(87) Oligonucleotides that hybridize to each exon in a gene can be prepared. Different combinations of oligonucleotides can be mixed together and ligation allowed to occur. Analysis by qPCR on the ligation products will permit determination of the frequency of different splice variants. For example, if a gene has 10 exons, hybridize DNA encoding exon 1 with exons 2-10 where each of 2-10 have a separate detectable label. Perform ligation using an mRNA splint and determine the representation of splice variants.
Example 5
MicroRNA Detection by Splint Ligation
(88) Detection of miR-122 by splint ligation using PBCV-1 ligase.
(89)
Example 6
Detection of miRNAs Using Synthetic DNA Oligonucleotides in a Splint Ligase Mediated Reaction with Enhanced Specificity and Sensitivity
(90) The efficiency of splint ligase mediated detection was tested at various temperatures (for example, 16 C., 25 C. and 37 C.) for short RNA splints as short as 20-22 nucleotides and synthetic oligonucleotides having a variable number of nucleotide overlap but at least a 4 base overlap with the splint sequence where the assay is sensitive to single nucleotide mismatches in the oligonucleotides sequence with respect to the RNA splint.
(91) The assay as shown for
(92) The results obtained when temperatures of 16 C., 25 C. and 37 C. were tested are provided herein. In one embodiment, 1 T4 DNA ligase buffer together with substrates and enzyme was combined in a single vessel in a single reaction. The product could be analyzed by capillary electrophoresis; PAGE qPCR for example using SYBR green dye or TaqMan probes (Life Technologies, Grand Island, N.Y.) that are complementary to the amplified sequence. The ligated DNA probes contained extensions beyond the complementary regions of the RNA target. These extensions included sequences that were complementary to PCR primers that permitted amplification of the ligated product.
(93) This permitted several targets to be detected via ligation and amplified with the same pair of PCR primers. For DNA probes with very short overlaps of 4 to 6 bases we found that a stacking oligonucleotide enhanced sensitivity of the assay. The stacking DNA oligonucleotide is complementary to the region of the DNA probe that extends beyond the RNA target. Hybridization of the stacking oligo to the probe generated a double stranded DNA with a single stranded extension complementary to the miRNA target which enhanced ligation. The reverse PCR primer can be used as a stacking oligonucleotide. Examples of experiments showing the above are described below in Examples 7-12 and also in
Example 7
Comparison of PBCV-1 Ligase, T4 RNA Ligase 2 and T4 DNA Ligase for Their Ability to Ligate Two DNA Oligonucleotides Mediated by an miRNA Splint
(94) Three different ligase, T4 RNA ligase 2, T4 DNA ligase and PBCV-1 ligase (SplintR) (New England Biolabs, Ipswich, Mass.) were compared for their efficiency in ligation of two DNA oligonucleotides; probe A [5 FAM CCTCTCTATGGGCAGTCGGTGCAAACACCATT] (SEQ ID NO:14) and probe B_[5p GTCACACTCCA CTGAGTCGGAGACACGCAGGG] (SEQ ID NO:15) that were hybridized to an miRNA splint. The probes were designed to be complementary to miR-122 [5 UGGAGUGUGACAAUGGUGUUUG] (SEQ ID NO:16). The region of the DNA oligonucleotide that is complementary to miR-122 is shown in bold letters.
(95) Complementary regions of the oligonucleotides are marked by an underline. All oligonucleotides used in these studies were manufactured by Integrated DNA, Coralville, Iowa. An annealing reaction stock was prepared by mixing 60 l (9.36 nmol) of miR-122, 120 l (12 nmol) of DNA probe 7A and 60 l (3 nmol) of DNA probe B and 24 l of 10 T4 DNA ligase buffer in 240 l total volume. The mix was heated at 95 C. for 5 minutes in a heat block then slowly cooled down to 22 C. The concentration of miR-122 was 39 pmol/l, DNA probe A was 12.5 pmol/l and probe B was 50 pmol/l. The ratios and concentrations of miR122, DNA probe A and B in ligation reaction were 39 pmol/l: 12.5 pmol/l: 50 pmol/l. Each ligation reaction contained 2 l of annealing, 1 l of 10 T4 DNA ligase buffer (50 mM Tris pH 7.5 @ 25 C., 10 mM MgCl.sub.2, 10 mM DTT, 1 mM ATP), 1 l of T4 DNA ligase (10 pmol/l) or 1 l of Splint R DNA ligase (10 pmol/l) or 2 l of T4 RNA ligase 2 (5 pmol./l) and H.sub.2O in a total volume of 10 l. RNA ligase 2 was diluted to 5 pmol/l with 1 RNA ligase 2 buffer (50 mM Tris pH 7.5 @ 25 C., 2 mM MgCl.sub.2, 1 mM DTT, 400 M ATP). Three master mixes were prepared for the three ligases. Six ligation tubes for each ligase were incubated at 16 C. for 6 different times (5 minutes, 10 minutes, 15 minutes, 30 minutes, 60 minutes, and 120 minutes). The ligation reactions were stopped by adding an equal volume of 2 stop buffer (50 mM EDTA, 0.1% triton in water) and kept at 20 C. Aliquots (2 l/20 l) was removed and mixed with 198 l of H.sub.2O and analyzed by capillary electrophoresis (CE) fragment analysis on a 96-capillary 3730xl DNA Analyzer (Applied Biosystems/Life Technologies, Grand Island, N.Y.).
(96)
Example 8
Detection of the Minimum Length of Overlapping Sequences Between DNA Oligonucleotides and miRNA for Splint Mediated Ligation Comparing Three Different Ligases
(97) The sequences of ten pairs of DNA oligonucleotides, labeled as probe A or probe B in
(98) TABLE-US-00002 ProbeA [1] (SEQIDNO:17) 5 FAMCCTCTCTATGGGCAGTCGGTGCAAACACCATTGTCACACTC [2] (SEQIDNO:18) 5 FAMCCTCTCTATGGGCAGTCGGTGCAAACACCATTGTCACAC [3] (SEQIDNO:19) 5 FAMCCTCTCTATGGGCAGTCGGTGCAAACACCATTGTCAC [4] (SEQIDNO:20) 5 FAMCCTCTCTATGGGCAGTCGGTGCAAACACCATTGTC [5] (SEQIDNO:21) 5 FAMCCTCTCTATGGGCAGTCGGTGCAAACACCATTG [6] (SEQIDNO:22) 5 FAMCCTCTCTATGGGCAGTCGGTGCAAACACCAT [7] (SEQIDNO:23) 5 FAMCCTCTCTATGGGCAGTCGGTGCAAACACC [8] (SEQIDNO:24) 5 FAMCCTCTCTATGGGCAGTCGGTGCAAACA [9] (SEQIDNO:25) 5 FAMCCTCTCTATGGGCAGTCGGTGCAAA [10] (SEQIDNO:26) 5 FAMCCTCTCTATGGGCAGTCGGTGCA ProbeB [1] (SEQIDNO:27) 5pCACTGAGTCGGAGACACGCAGGG [2] (SEQIDNO:28) 5pTCCACTGAGTCGGAGACACGCAGGG [3] (SEQIDNO:29) 5pACTCCACTGAGTCGGAGACACGCAGGG [4] (SEQIDNO:30) 5pACACTCCACTGAGTCGGAGACACGCAGGG [5] (SEQIDNO:31) 5pTCACACTCCACTGAGTCGGAGACACGCAGGG [6] (SEQIDNO:32) 5pTGTCACACTCCACTGAGTCGGAGACACGCAGGG [7] (SEQIDNO:33) 5pATTGTCACACTCCACTGAGTCGGAGACACGCAGGG [8] (SEQIDNO:34) 5pCCATTGTCACACTCCACTGAGTCGGAGACACGCAGGG [9] (SEQIDNO:35) 5pCACCATTGTCACACTCCACTGAGTCGGAGACACGCAGGG [10] (SEQIDNO:36) 5pAACACCATTGTCACACTCCACTGAGTCGGAGACACGCAGGG
(99) Probe A is 5 FAM labeled and probe B has a 5 phosphate to allow ligation. The miR-122 stock was 156 pmol/l. The DNA probes A and B were at a concentration of 100 pmol/l each. All The H.sub.2O used in this study were DEPC treated. Ten annealing reactions were set with pairs of probes A and B. Each reaction contained 387 pmol of miR122, 550 pmol of DNA probe A and 550 pmol of DNA probe B in 1 T4 DNA ligase buffer, in a volume of 55 l. The ratio and concentrations of miR-122, probe A and probe B were 7.2 pmol/l: 10 pmol/l: 10 pmol/l. The oligonucleotides were heated to 95 C. for 5 minutes in a heat block then allowed to cool to room temperature. T4 DNA ligase, 10 T4 DNA ligase buffer, PBCV-1 ligase, RNA ligase 2 and 10 RNA ligase buffer were all from New England Biolabs, Ipswich, Mass. T4 DNA ligase and PBCV-1 ligase were diluted to 10 pmol/l with 1 T4 DNA ligase buffer (50 mM Tris pH 7.5 @ 25 C., 10 mM MgCl.sub.2, 10 mM DTT, 1 mM ATP). RNA ligase 2 was diluted to 5 pmol/l with 1 RNA ligase 2 buffer (50 mM Tris pH 7.5 @ 25 C., 2 mM MgCl.sub.2, 1 mM DTT, 400 M ATP).
(100) The ligation conditions were the same as describe in Example 2. Five l of the three hybridized oligos (probe A, probe B and miRNA) were mix with 1 l (10 pml) of T4 DNA ligase, 1 l (10 pml) of PBCV-1 DNA ligase or 2 l (10 pml) T4 RNA ligase 2. For the T4 DNA ligase and PBCV-1 DNA ligase reactions 1 l of 10 T4 DNA ligase buffer was added to the reaction. For the T4 RNA ligase 2 reaction 1 l of 10 T4 RNA ligase 2 buffer was used. Final volume for all reactions was 10 l. The ligation reactions were incubated at 16 C. for 1 hour for T4 DNA ligase and PBCV-1 DNA ligase and 37 C. for 1 hour for T4 RNA ligase 2. The ligation products were analyzed by polyacrylamide gel electrophoresis. Two l of the ligation reaction were mixed with 5 l 3 denaturing loading dye, 8 l of H.sub.2O and heated at 95 C. for 5 minutes before loaded onto a Novex 15% TBE urea gel (Invitrogen, Grand Island, N.Y.). A FAM labeled ssDNA ladder was also loaded as size a marker. Gels were scanned with Typhoon 9400 (GE Healthcare bio-Sciences, Pittsburgh, Pa.). The results are shown in
Example 9
Comparison of the Sensitivity of Two Different Ligases for RNA Mediated Splint Ligation Using a Luciferase mRNA Splint in a Background of Non-RNA Splint
(101) The experimental details for this example are provided in Lohman, et al., Nucleic Acids Research, 42:1831-1844 (2014) incorporated herein by reference.
(102)
Example 10
Quantitative Detection of miR-122 by Splint Ligation in Rat Liver Total RNA Using a TaqMan Probe
(103) The miRNA-122 splint ligation by PBCV-1 ligase was used to measure the amount of miR-122 in an RNA sample from rat liver total RNA (see
(104) In
(105) TABLE-US-00003 Probe6A: (SEQIDNO:37) 5 CTCGACCTCTCTATGGGCAGTCACGACCAAACACCAT Probe6B: (SEQIDNO:38) 5 pTGTCACACTCCACTGAGTCGGAGACACGCAGGG qPCRforwardprimer: (SEQIDNO:39) 5 GCTCGACCTCTCTATGGGC qPCRreverseprimer: (SEQIDNO:40) 5 CCCTGCGTGTCTCCGACTCAG miR-122 (SEQIDNO:41) 5 UGGAGUGUGACAAUGGUGUUUG
(106) TaqMan probe for miR-122: 5 6CACGACCAAACACC0 (SEQ ID NO:42) (6: 6-FAM, 0: MGB/NFQ) miR-122 was diluted in 1/4 serial dilution with H.sub.2O from 12.5 fmol/l to 0.003 fmol/l. 1 l of each dilution was mixed with 1 l (1 g) of yeast RNA, 1 l (1 M) of DNA probe 6A (pair 6), 1 l (1 M) of DNA probe 6B (pair 6), 1 l of 10 T4 DNA ligase buffer and 5 l of H.sub.2O in a total volume of 10 l. A negative control that had no mir-122 but yeast RNA was also included for annealing. Annealing reactions were carried out as described in Example 7. One l of each dilution was mixed with 0.5 l (10 pm) of Splint R DNA ligase, 1 l of 10 T4 DNA ligase buffer and 7.5 l of H.sub.2O in a total volume of 10 l. The concentration of miR-122 in the ligation reaction was diluted 10 fold from the annealing reaction to a concentration range of 0.125 fmol/l to 0.03 amol/l. Ligation reactions were incubated at 16 C. for 1 hour.
(107) The qPCR TaqMan assay was performed in 25 l in a 96-well plate. Each reaction contained 2.5 l of 10 ThermoPol detergent-free buffer (New England Biolabs, Ipswich, Mass.), 0.5 l of 10 mM dNTPs, 0.5 l of 100 mM of MgSO4, 0.25 l of Hot start Taq polymerase (New England Biolabs, Ipswich, Mass.), 1 l of ligation reaction, 1 l of 5 M forward primer, 1 l of 5 M of reverse primer and 2 l of TaqMan miR-122 probe. Each miR-122 dilution had triplets for qPCR reaction. The plate was incubated in a qPCR thermocycler with the following program: 95 C. for 3 minutes, 95 C. for 10 seconds, and 55 C. for 30 seconds. The Cq value, where the signal crosses the threshold value were plotted versus the number of cycles in
(108) The miR-122 concentration in rat liver total RNA (
Example 11
Specific Detection of Let-7g and Let-7b by miRNA Splint Mediated Ligation Using PBVC-1 Ligase
(109)
(110) DNA probes used for specific detection of Let-7g are: DNA probe A (specific for Let-7g): 5 FAM CCTCTCTATGGGCAGTCGGTGAAACTGT (SEQ ID NO:43) DNA probe B (specific for Let-7g): 5pACAAACTACTACCTCACTGAGTCGGAGACACGCAGGG (SEQ ID NO:44) Let-7g specific DNA probes A and B were in concentration of 10 pmol/l. The annealing reaction contained 1.6 l (16 pmol) of Let-7a, 7b, 7c, 7d, 7e, 7f, 7g or 7i were mixed with 0.5 l (5 pmol) of Let-7 (g) specific DNA probe A, 2 l (20 pmol) of probe B, 1 l of T4 DNA ligase buffer and 4.9 l of H.sub.2O in a total volume of 10 l. Note, no stacking oligos complementary to probe A was used in annealing for Let-7g specific detection. Two negative controls were included: 1: no probe A and 2: no probe B. All the 8 experimental and 2 negative controls were incubated for annealing as described before. Aliquots (5 l) of each annealing reaction was mixed with 1 l of T4 DNA ligase buffer, 1 l (10 pmol/l) of SplintR DNA ligase and 3 l of H.sub.2O in a 10 l volume. The ligation reactions were stopped by adding 10 l of stop buffer then mixed with 15 l RNA denaturing loading dye. The sample was analyzed by loading 18 l of the mix was loaded onto a 15% TBE-urea gel for electrophoresis. The gel was analyzed by Typhoon 9400.
(111)
Example 12
Specific Detection of Let-7b by miRNA Splint Mediated Ligation Using PBCV-1 Ligase
(112) Let-7 miRNA sequences are shown in
(113) Let-7b detection by qPCR the following oligonucleotides were purchased from Integrated DNA Technologies, Coralville, Iowa.
(114) TABLE-US-00004 ProbeA9.0 (SEQIDNO:45) 5GTCTGGTCAGAATCACCTCCTCGTCATGGGCAGGTACGGTGCAA CC3 ProbeB9.0 (SEQIDNO:46) 5pACACAACCTACTACCTCACTGAGTTGGAGACACGCAGAA3
DNA dual labeled probe for detection of Let7-miRNAs.
(115) TABLE-US-00005 (SEQIDNO:47) 5 56-FAM-CGTCATGGG-ZEN-CAGGTACGGTGCAAC-31ABkFQ3 qPCRforwardprimer: (SEQIDNO:48) 5 GTCTGGTCAGAATCACCTC aPCRreverseprimer: (SEQIDNO:49) 5 TTCTGCGTGTCTCCAACTCA
(116) Annealing and ligation are combined into one reaction as following:1 l (10 fmol) of Le-7a or b or c or d or e or f or g or i was mixed with 1 l (100 fmol) of Let-7b DNA probe A 9.0, 1 l (100 fmol) of Let-7b probe B 9.0, 1 l of T4 DNA ligase buffer (10), 1 l of PBCV-1 DNA ligase (10 M), 1 l of shredded yeast RNA (1 g) and 4 l of H.sub.2O in a total volume of 10 l. The reaction was incubated at 37 C. for 100 minutes. For PCR, initial denaturation was carried out at 95 C. for 3 minutes, then 10 seconds at 95 C. and 30 seconds at 55 C. for the PCR cycle conditions.
(117) qPCR was performed in a triplicate for each ligation as following: Two l of each ligation reaction was mixed with 12.5 l of OneTaq Hot Start PCR 2 mix (New England Biolabs, Ipswich, Mass.), 1 l of forward primer (10 pmol), 1 l of reverse primer (10 pmol), 1 l of dual labeled probe (4 pmol) and 7.5 l of H.sub.2O in a total volume of 25 l. Triplet qPCR was done for each ligation reaction. qPCR was amplified in the same program as for miR122 qPCR.
(118)
(119)
(120) Negative controls include; no probe A (A), no SplintR ligase (R), no stacking oligo (S) and no probe B (B). The oligonucleotides used in each ligation are shown above the gel. The stacking oligo, which is complementary to probe A, is included in reaction with the let-7b and let-7c ligation to enhance ligation. These two probes have only a five and four base overlap with the miRNA. Hybridization of the stacking oligo to probe A results in retarded mobility on the gel.
Example 12
Gel Electrophoresis Showing the Specificity of the Assay Using a Fluorescent Probe A
(121) DNA probes were designed to selectively detected miR-Let-7-b but not other members of the Let-7 family. The sequences of eight Let-7 miRNAs (also shown in
(122) TABLE-US-00006 Let-7family: Let-7a: (SEQIDNO:50) 5 UGAGGUAGUAGGUUGUAUAGUU Let-7b: (SEQIDNO:51) 5 UGAGGUAGUAGGUUGU U
GUU Let-7c: (SEQIDNO:52) 5 UGAGGUAGUAGGUUGUAUGGUU Let-7d: (SEQIDNO:53) 5
GAGGUAGUAGGUUG
AUAGUU Let-7e: (SEQIDNO:54) 5 UGAGGUAGGAGGUUGUAUAGUU Let-7f: (SEQIDNO:55) 5 UGAGGUAGUAGAUUGUAUAGUU Let-7g: (SEQIDNO:56) 5 UGAGGUAGUAG
UUGUACAGUU Let-7i: (SEQIDNO:57) 5 UGAGGUAGUAGUUUGUG
UGUU
(123) The two DNA probes designed to be specific for let-7b are DNA;
(124) TABLE-US-00007 Let-7bspecificprobeA; (SEQIDNO:58) 5 6FAMCCTCTCTATGGGCAGTCGGTGAAACCA Let-7bspecificprobeB; (SEQIDNO:59) 5 pCACAACCTACTACCTCACTGAGTCGGAGACACGCAGGG Stackingoligos: (SEQIDNO:60) 5 TCACCGACTGCCCATAGAGAGG
(125) Let-7 miRNAs, Let-7b specific DNA probe A, B and stacking oligos were all in concentration of 10 pmol/l. The annealing reactions contained 1.6 l (16 pmol) of either Le-7a, 7b, 7c, 7d, 7e, 7f, 7g or 7i which was mixed with 0.5 l (5 pmol) of Let-7b specific DNA probe A, 2 l (20 pmol) of probe B, 1 l of stacking oligos (10 pmol), 1 l of T4 DNA ligase buffer and 3.9 l of H.sub.2O in a total volume of 10 l. Four negative controls were included: 1: no miRNA, 2: no stacking oligos, 3: no probe A, 4: no probe B. All the 8 experimental and 4 negative controls were incubated for annealing as described before.
(126) The 10 l annealing reactions were divided in half and5 l were used for ligation incubation at 16 C. and 5 l for 20 C. incubation. 5 l of annealing were mixed with 1 l of T4 DNA ligase buffer, 1 l (10 pmol/l) of PBCV-1 DNA ligase and 3 l of H.sub.2O in a 10 l volume. The ligation reactions were stopped by adding 10 l of stop buffer then mixed with 15 l RNA denaturing loading dye. 18 l of the mix was loaded onto a 15% TBE-urea gel for electrophoresis. The gel was analyzed by Typhoon 9400. The gel with the results of the ligation is shown in
Example 13
Comparison of Splint Ligase and TagMan Methods
(127) A comparison was made between the splint ligase and TaqMan methods for detection of miR-122 in total rat liver DNA using qPCR. Three different concentrations (1, 0.2 and 0.04 ng) of rat liver total RNA were used. The splint ligase method used miR-122 specific ZEN quenched DNA probe that is described in example 10. The TaqMan assay was performed with the miR-122 specific TaqMan MicroRNA Reverse Transcription Kit and the TaqMan Universal PCR Master Mix. At all three RNA concentrations the splint ligase method was more sensitive. For the 1 ng and 0.2 ng amounts the splint ligase assay was about 30-times more sensitive. At the lowest level, 0.04 ng only the splint ligase method could detect miR-122 (
Example 14
Temperature and Probe Length Alter Ligation Efficiency
(128)