Polypeptide and nucleic acid capable of changing amylose content (ac) in plant, and use thereof

Abstract

A mutant granule-bound starch synthase 1 (GBSS1) polypeptide and a nucleic acid, and use thereof are provided. Compared to an amino acid sequence of a parent GBSS1, the mutant GBSS1 polypeptide has a mutation at an amino acid corresponding to amino acid 427 and/or amino acid 428 of an amino acid sequence shown in SEQ ID NO: 1. An amylose content (AC) in a plant changes after the plant undergoes GBSS1 mutation, which has very promising application prospects in the improvement of edible quality of rice.

Claims

1. A polynucleotide encoding a mutant GBSS1 polypeptide capable of increasing an amylose content (AC) in a plant, wherein the polynucleotide comprises a nucleotide sequence having at least 80% identity with SEQ ID NO: 16, SEQ ID NO: 17, or SEQ ID NO: 18, and wherein the mutant GBSS1 polypeptide comprises an amino acid sequence having at least 80% identity with SEQ ID NO: 1 and further comprises a mutation(s) at amino acid residue 427 and/or 428 compared to the amino acid sequence shown in SEQ ID NO: 1, wherein the amino acid residue 427 is mutated into arginine (R) and/or the amino acid residue 428 is mutated into glycine (G).

2. A nucleic acid construct, comprising the polynucleotide according to claim 1 and a regulatory element operably linked to the polynucleotide; wherein the regulatory element is one or more selected from the group consisting of an enhancer, a transposon, a promoter, a terminator, a leader sequence, a polynucleotide sequence, and a marker gene.

3. A host cell, the host cell comprising: a mutant granule-bound starch synthase 1_(GBSS1) polypeptide capable of increasing an amylose content (AC) in a plant, the mutant GBSS1 polypeptide comprising an amino acid sequence at least 80% identity with SEQ ID NO: 1, further comprising a mutation(s) at amino acid residue 427 and/or 428 compared to the amino acid sequence shown in SEQ ID NO: 1, wherein the amino acid residue 427 is mutated into arginine (R) and/or the amino acid residue 428 is mutated into glycine (G), a polynucleotide encoding a mutant GBSS1 polypeptide capable of increasing an amylose content (AC) in a plant, wherein the polynucleotide comprises a nucleotide sequence having at least 80% identity with SEQ ID NO: 16, SEQ ID NO: 17, or SEQ ID NO: 18, and wherein the mutant GBSS1 polypeptide comprises an amino acid sequence having at least 80% identity with SEQ ID NO: 1 and further comprises a mutation(s) at amino acid residue 427 and/or 428 compared to the amino acid sequence shown in SEQ ID NO: 1, wherein the amino acid residue 427 is mutated into arginine (R) and/or the amino acid residue 428 is mutated into glycine (G), or a nucleic acid construct comprising a polynucleotide encoding the mutant GBSS1 polypeptide capable of increasing an AC in a plant, wherein the polynucleotide comprises a nucleotide sequence having at least 80% identity with SEQ ID NO: 16, SEQ ID NO: 17, or SEQ ID NO: 18, and wherein the mutant GBSS1 polypeptide comprising an amino acid sequence having at least 80% identity with SEQ ID NO: 1 and further comprising a mutation(s) at amino acid residue 427 and/or 428 compared to the amino acid sequence shown in SEQ ID NO: 1.wherein the amino acid residue 427 is mutated into arginine (R) and/or the amino acid residue 428 is mutated into glycine (G), and a regulatory element operably linked to the polynucleotide encoding the mutant GBSS1 polypeptide, wherein the regulatory element is one or more selected from the group consisting of an enhancer, a transposon, a promoter, a terminator, a leader sequence, a polynucleotide sequence, and a marker gene.

4. A method for preparing a plant with a increased (AC), comprising a step of expressing a mutant granule-bound starch synthase 1 (GBSS1) polypeptide in a plant cell, a plant seed, a plant tissue, a plant part, or the plant, wherein the mutant GBSS1 polypeptide is capable of increasing AC, the mutant GBSS1 polypeptide comprises an amino acid sequence having at least 80% identity with SEQ ID NO: 1, and wherein the amino acid residue 427 is mutated into arginine (R) and/or the amino acid residue 428 is mutated into glycine (G) compared to SEQ ID NO: 1.

5. The method according to claim 4, wherein the step of expressing a mutant granule-bound starch synthase 1 (GBSS1) polypeptide further comprises the steps of: introducing a polynucleotide encoding the mutant GBSS1 polypeptide capable of increasing an amylose content (AC) in a plant, wherein the polynucleotide comprises a nucleotide sequence having at least 80% identity with SEQ ID NO: 16, SEQ ID NO: 17, or SEQ ID NO: 18, and mutating the plant to express the mutant GBSS1 polypeptide.

6. The method according to claim 4, wherein the plant is Oryza sativa.

7. The polynucleotide according to claim 1, wherein the polynucleotide encoding the mutant GBSS1 is derived from Oryza sativa.

8. The host cell according to claim 3, wherein the host cell is Oryza sativa.

9. The host cell according to claim 3, wherein the polynucleotide encoding the mutant GBSS1 is derived from Oryza sativa.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a schematic diagram of a CBE-nCas9 base editor, where OsU6 and ZmUbi are promoters; sgRNA is a gRNA; bp-NLS is a nuclear localization signal; and NOS is a terminator.

(2) FIG. 2 is a schematic diagram of an ABE-nCas9 base editor, where OsU6 and ZmUbi are promoters; sgRNA is a gRNA; bp-NLS is a nuclear localization signal; and NOS is a terminator.

(3) FIG. 3 shows AC observation results of gene-edited seeds (P168L, T237A, and E411K) and wild-type seeds by staining.

(4) FIG. 4 shows the appearance of rice produced from a wild-type plant, a T237A homozygous mutant plant, and an E411K homozygous mutant plant and the morphology of rice endosperm under a scanning electron microscope.

(5) FIG. 5 shows the comparison of gel consistency (GC) of rice endosperm starch among the wild-type plant, the T237A homozygous mutant plant, and the E411K homozygous mutant plant.

(6) FIG. 6 shows the comparison of rice starch viscosity among the wild-type plant, the T237A homozygous mutant plant, and the E411K homozygous mutant plant.

(7) FIG. 7A-FIG. 7J show the comparison of agronomic traits of rice produced by the wild-type plant, the T237A homozygous mutant plant, and the E411K homozygous mutant plant.

(8) FIG. 8 shows AC observation results of gene-edited seeds (Q427R and E428G) and wild-type seeds by staining.

(9) TABLE-US-00001 Sequence Listing SEQ ID NO: Description 1 Amino acid sequence of Oryza sativa wild-type GBSS1 2 Amino acid sequence of P168L mutant GBSS1 3 Amino acid sequence of T237A mutant GBSS1 4 Amino acid sequence of P168L + T237A mutant GBSS1 5 Nucleic acid sequence of P168L mutant GBSS1 6 Nucleic acid sequence of T237A mutant GBSS1 7 Nucleic acid sequence of P168L + T237A mutant GBSS1 8 Nucleic acid sequence of Oryza sativa wild-type GBSS1 9 Nucleic acid sequence of L409L base mutation, Nucleic acid sequence encoding mutation of three bases of L at position 409 into cta 10 Nucleic acid sequence of Q412Q base mutation, Nucleic acid sequence encoding mutation of three bases of Q at position 412 into caa 11 Nucleic acid sequence of E410E base mutation, Nucleic acid sequence encoding mutation of three bases of E at position 410 into gaa 12 Nucleic acid sequence of E411K base mutation, Nucleic acid sequence encoding mutation of three bases of E at position 411 into aaa 13 Amino acid sequence of Q427R mutant GBSS1 14 Amino acid sequence of E428G mutant GBSS1 15 Amino acid sequence of Q427R + E428G mutant GBSS1 16 Nucleic acid sequence of Q427R mutant GBSS1 17 Nucleic acid sequence of E428G mutant GBSS1 18 Nucleic acid sequence of Q427R + E428G mutant GBSS1

DETAILED DESCRIPTION OF THE EMBODIMENTS

(10) The present disclosure will be further explained below in conjunction with examples. The following examples are only preferred examples of the present disclosure, and are not intended to limit the present disclosure in other forms. Any technical personnel familiar with the profession may use the technical content disclosed above to derive equivalent examples through equivalent changes. Any simple modification or equivalent change made to the following examples according to the technical essence of the present disclosure without departing from the content of the solutions of the present disclosure shall fall within the protection scope of the present disclosure.

Example 1 Construction of a Gene Editing Vector and Screening of a Mutation Site

(11) 1. A CBE-nCas9 base editor (as shown in FIG. 1) and an ABE-nCas9 base editor (as shown in FIG. 2) targeting the endogenous GBSS1 gene in Oryza sativa were constructed.

(12) The CBE base editor could realize the C/G->T/A base conversion within a specified sequence window, and the ABE base editor could realize the A/T->G/C base conversion within a specified sequence window. In the present disclosure, the CBE-nCas9 base editor and the ABE-nCas9 base editor were used as vectors, and several sgRNAs were designed in the Oryza sativa endogenous GBSS1 gene (with sgRNAs shown in Table 1 as examples) and cloned into the CBE-nCas9 and ABE-nCas9 base editor vectors to form several base editors targeting the Oryza sativa endogenous GBSS1 gene. An amino acid encoded by the Oryza sativa endogenous GBSS1 gene was shown in SEQ ID NO: 1.

(13) TABLE-US-00002 TABLE 1 sgRNA sequences targeting Oryza sativa GBSS1 gene sgRNA No. guide-PAM sequence (5′-3′) SEQ ID NO: 1 GGACCATCCGTCATTCCTGG 19 2 GGCACACTGGCCCACTGGCG 20 3 AAGAACAACTACCAGCCCAA 21 4 TCTGCAACGACTGGCACACT 22

(14) 2. Oryza sativa genetic transformation and single-mutant plant identification

(15) Oryza sativa Xiushui 134 was used as an experimental material. The base editors constructed above were transformed into the Oryza sativa plants by A. tumefaciens to obtain gene-edited plants. The above plants were identified by PCR and sequencing, and it was found that some plants had expected base substitutions within a target range. Specific types of base editing were shown in Table 2.

(16) Dry seeds of each plant in the following table were collected, crushed or ground with a sampler, and dried overnight at 37° C. in an oven. 25 mg of a resulting dry sample powder was taken, 0.5 ml of ethanol was added and then 4.5 ml of 1 N NaOH was added, and a resulting mixture was thoroughly shaken and subjected to a boiling bath for 10 min. A 0.5 ml to 50 ml centrifuge tube was taken, then 25 ml of ddH.sub.2O, 0.5 ml of 1 N HAc, and 0.5 ml of an I-KI reagent were added, and a resulting mixture was diluted to 50 ml and then stood for 10 min to enable thorough mixing. The optical density reading at 720 nm was determined by a spectrophotometer, and the AC was calculated according to a fitted equation of a standard curve (with potato amylose samples of Sigma as standard samples). The AC in seeds of each plant (AC (%)) was shown in table 2.

(17) TABLE-US-00003 TABLE 2 Mutation types and AC of edited plants Amino acid mutation Plant No. Base mutation type type AC (%) WT Non-mutated Wild-type 19.87 (±0.77) H-410 C502, 503 −> T P168L 10.60 (±0.85) 199 1-3 A2515 −> G T237A 13.72 (±0.90)

(18) As shown in Table 2, the seed ACs of the edited plants H-410 and 199 1-3 were significantly decreased to 50% to 75% of the seed AC of the wild-type plant.

(19) In addition, the above-mentioned seeds with reduced AC were stained by the following method: seeds of normal and edited plants Xiushui 134 were prepared, and glumes were removed from the above seeds to obtain brown rice; the brown rice was cut in half along a back line of the brown rice using a single-sided knife, and an I-KI solution was applied on an exposed endosperm section at a constant dosage; and the endosperm section stood for 10 min and photographed to record a staining result.

(20) Results in FIG. 3 showed that seeds of the edited Oryza sativa were lighter in color than seeds of the wild-type Oryza sativa, indicating that the seeds of the edited Oryza sativa had lower AC.

(21) 3. Measurement of AC in hybrid and double-mutant edited plants

(22) The H-410 and 199 1-3 plants were crossbred, and the double-mutant plants with P168L and T237A were screened out by PCR and sequencing. The AC was measured according to the above method, and results showed that double-mutant plants with P168L and T237A had significantly-reduced AC.

(23) 4. Experimental conclusion

(24) The mutation of amino acid 168 and/or amino acid 237 of the GBSS1 polypeptide can endow a plant with low AC. The present disclosure has important application values in the cultivation of a GBS S 1-mutant crop with low AC.

Example 2 Determination of Relative AC in Other Mutants

(25) With reference to the method in Example 1, the applicants also cultivated Oryza sativa plants of other GBSS1 polypeptide mutation types, and the AC was also determined for homozygous plants (Oryza sativa) of other mutation types. Results were shown in Table 3. The experimental results showed that:

(26) When the mutation occurs at nucleotide positions corresponding to amino acids 409 to 412, the AC of a mutant plant will be greatly reduced. Specifically, mutation types include L409L (three bases encoding L at position 409 are mutated into cta, but such a base change does not result in an amino acid change), E410Q (three bases encoding E at position 410 are mutated into cag), E410K (three bases encoding E at position 410 are mutated into aag), E410E (three bases encoding E at position 410 are mutated into gaa), E411K (three bases encoding E at position 411 are mutated into aaa), and Q412Q (three bases encoding Q at position 412 are mutated into caa). When the nucleic acid sequence undergoes any one of the above mutations, the AC in rice will be significantly reduced to a level of soft rice even if encoded amino acids do not change (for example, L409L, E410E, and Q412Q do not cause an amino acid to change). In addition, when the amino acid 236 is changed from H to R, the AC in rice will also be significantly reduced to the level of soft rice.

(27) When mutations such as G252S (three bases encoding G at position 252 are mutated into agc) or I253V (three bases encoding I at position 253 are mutated into gtc) occur, the AC in rice will be increased.

(28) When mutations such as G252N, N246S, N247D, G393N, and G3935 occur, the AC is basically unchanged.

(29) TABLE-US-00004 TABLE 3 Results of AC (AC(%)) changes caused by different types of amino acid mutations Genotype amino acid substitution AC (%) waxy.sup.abe1 H236R  1.58 (±0.57) waxy.sup.abe2 T237A 13.72 (±0.90) waxy.sup.abe3.1 N246S 18.41 (±0.34) waxy.sup.abe3.2 N247D 17.80 (±0.42) waxy.sup.abe4.1 G252S 21.41 (±0.47) waxy.sup.abe4.2 G252N 19.34 (±0.86) waxy.sup.abe5 I253V 21.83 (±0.60) waxy.sup.abe6 Q389Q 20.78 (±0.48) waxy.sup.abe7.1 A392A/G393N 19.05 (±0.54) waxy.sup.abe7.2 A392A/G393S 20.51 (±0.50) waxy.sup.abe8.1 L409L/E410Q  2.28 (±0.62) waxy.sup.abe8.2 L409L/E410K  0.30 (±0.53) waxy.sup.abe9.1 E411K  2.88 (±0.59) waxy.sup.abe9.2 E410E/E411K  3.06 (±0.26) waxy.sup.abe9.3 E410K/E411K/Q412Q  1.46 (±0.22) XS134 — 19.87 (±0.77)

Example 3 Determination of Other Traits of T237A Mutant

(30) In this example and the drawings, the T237A mutant plant could be represented by waxy.sup.abe2, and the E411K mutant plant could be represented by waxy.sup.abe9.1.

(31) Transparency

(32) T237A (three codon bases encoding T at position 237 were mutated into gct) and E411K (AC was basically the same as that of sticky rice) were compared, and it could be found that rice of the E411K mutant plant became white and completely opaque and the phenotype of rice of T237A was similar to that of the wild-type Xiushui 134 (XS134) (as shown in FIG. 4).

(33) The cross-sectional morphologies of the three kinds of rice starch granules were observed using a scanning electron microscope. Endosperm starch granules of T237A and wild-type Xiushui 134 had small particle sizes and showed basically the same morphology, which were all in polygonal shapes with sharp edges and corners, smooth or slightly-concave surfaces, and no structural fragments. However, the starch granules of E411K (sticky rice) were more irregular than the starch granules of the wild-type Xiushui 134 and T237A. In addition, there were many small pores in cores of starch granules in sticky endosperm of E411K (sticky rice), while the starch granules of the transparent wild-type Xiushui 134 and T237A did not have a similar structure (as shown in FIG. 4, the third row of the figure).

(34) Rice GC

(35) Rice GC was measured 4 times according to the measurement method specified in GB/T 22294-2008, and an average was taken. Compared with the wild-type and E411K (sticky rice), the rice GC of T237A was relatively moderate, as shown in FIG. 5.

(36) Viscosity

(37) The viscosity was measured with an RVA instrument (pertentecmaster, Sweden). A sample with a water content of 12% was ground into a flour, and then 3.00 g of the flour was taken and added to 25 ml of distilled water. An RVA procedure was as follows: 50° C. for 1 min; increasing to 95° C. (3.75 min) at a constant rate, and keeping at 95° C. for 2.5 min; and decreasing to 50° C. (3.75 min) at a constant rate, and keeping at 50° C. for 2 min. Data analysis was conducted by TCW 3.0 (Thermal Cycle Win-Dows).

(38) Compared with the wild-type and E411K, T237A showed a high breakdown (2155.00 cP) and a low setback value (−1177.00 cP), indicating that the T237A mutant rice showed excellent cooking quality (ECQ). Results were shown in FIG. 6.

(39) Rice Size

(40) In paddy fields, the T237A and E411K plants showed no significant difference in grain width (FIG. 7A, FIG. 7C, FIG. 7E, and FIG. 7G), grain length (FIG. 7B, FIG. 7D, FIG. 7F, and FIG. 7H), seed setting rate (FIG. 7I), and plant phenotypic traits (FIG. 7J) from the XS134 control.

(41) Experimental results showed that the mutation types of the present disclosure can regulate the AC without affecting other agronomic traits, which is of great significance for cultivating high-quality rice varieties with low AC.

Example 4 Construction of Gene Editing Vectors for Increasing AC and Screening of Mutation Sites

(42) 1. sgRNA was designed in the Oryza sativa endogenous GBSS1 gene (sgRNA shown in Table 4) and cloned into the ABE-nCas9 vector to form a base editor targeting the Oryza sativa endogenous GBSS1 gene. An amino acid sequence encoded by the Oryza sativa endogenous GBSS1 gene was shown in SEQ ID NO: 1.

(43) TABLE-US-00005 TABLE 4 sgRNA sequence targeting Oryza sativa GBSS1 gene sgRNA No. guide-PAM sequence (5′-3′) SEQ ID NO: A-GBSS10 ATGCAGGAGGACGTCCAGAT 23

(44) 2. Oryza sativa genetic transformation and transgenic plant identification

(45) Oryza sativa Xiushui 134 was used as an experimental material. The base editor constructed above was transformed into the Oryza sativa plants by A. tumefaciens to obtain gene-edited plants. The above plants were identified by PCR and sequencing, and it was found that some plants had expected base substitutions within a target range. Specific types of base editing were shown in Table 5.

(46) Dry seeds of each plant in the following table were collected, crushed or ground with a sampler, and dried overnight at 37° C. in an oven. 25 mg of a resulting dry sample powder was taken, 0.5 ml of ethanol was added and then 4.5 ml of 1 N NaOH was added, and a resulting mixture was thoroughly shaken and subjected to a boiling bath for 10 min. A 0.5 ml to 50 ml centrifuge tube was taken, then 25 ml of ddH.sub.2O, 0.5 ml of 1 N HAc, and 0.5 ml of an I-KI reagent were added, and a resulting mixture was diluted to 50 ml and then stood for 10 min to enable thorough mixing. The optical density reading at 720 nm was determined by a spectrophotometer, and the AC was calculated according to a fitted equation of a standard curve (with potato amylose samples of Sigma as standard samples). The AC in seeds of each plant was shown in table 5.

(47) TABLE-US-00006 TABLE 5 Mutation types and AC of edited plants Amino acid mutation Plant No. Base mutation type type AC WT Non-mutated Wild-type 18.38% 203-1-3 A1280 −> G Q427R 29.78% 203-1-4 A1280, 1283 −> G Q427R, E428G 25.90% 203-2-2 A1280 > G Q427R 27.25% 203-2-5 A1283 −> G E428G 28.84% 303-2-6 A1283 −> G E428G 26.72% 203-3-3 A1280, 1283 −> G Q427R, E428G 27.84% 203-4-1 A1280 −> G Q427R 27.37% 203-5-1 A1280 −> G Q427R 30.07% 203-5-2 A1280 −> G Q427R 29.13% 203-5-3 A1280 −> G Q427R 28.49% 203-5-5 A1280 −> G Q427R 30.19% 203-5-6 A1280, 1283 −> G Q427R, E428G 29.31% 203-6-2 A1280 −> G Q427R 26.67% 203-6-4 A1280 −> G Q427R 28.72% 203-6-5 A1280 −> G Q427R 29.37% 203-6-6 A1283 −> G E428G 27.02%

(48) As shown in Table 5, the seed AC in an edited plant obtained from the mutation Q427R, the mutation E428G, or the mutation of both was significantly increased compared with the seed AC in the wild-type plant.

(49) In addition, the above-mentioned seeds with increased AC were stained by the following method: seeds of normal and edited plants Xiushui 134 were prepared, and glumes were removed from the above seeds to obtain brown rice; the brown rice was cut in half along a back line of the brown rice using a single-sided knife, and an I-KI solution was applied on an exposed endosperm section at a constant dosage; and the endosperm section stood for 10 min and photographed to record a staining result.

(50) Results in FIG. 8 showed that seeds of the edited Oryza sativa were darker in color than seeds of the wild-type Oryza sativa, indicating that the seeds of the edited Oryza sativa had higher AC.

(51) 3. Experimental Conclusion

(52) The mutation of amino acid 427 and/or amino acid 428 of the GBSS1 polypeptide can endow a plant with high AC. The present disclosure has important application values in the cultivation of a GBS S 1-mutant crop with high AC.

(53) All documents mentioned in the present disclosure are cited as references in the present application, as if each document was individually cited as a reference. In addition, it should be understood that various changes or modifications may be made to the present disclosure by those skilled in the art after reading the above teaching content of the present disclosure, and these equivalent forms also fall within the scope defined by the appended claims of the present disclosure.