STRAIN OF BACTERIA PRODUCING DHA AND EPA, SIX GENE FRAGMENTS IN THE BACTERIAL GENOME AND THEIR APPLICATIONS
20200087357 ยท 2020-03-19
Inventors
Cpc classification
C12P7/6427
CHEMISTRY; METALLURGY
International classification
C12P7/64
CHEMISTRY; METALLURGY
Abstract
The present invention discloses a strain of bacteria producing DHA and/or EPA, six gene fragments in the bacterial genome, and uses thereof. The strain is Schizoochytrium limacinum HS01, which has the accession number of CGMCC No. 13746 at China General Microbiological Culture Collection Center. The six gene fragments are composed of gene fragment 1 to gene fragment 6, and the nucleotide sequences are sequentially as shown in SEQ ID NO: 3 to SEQ ID NO: 8 in the Sequence Listing. The experiments prove that fermentation broth containing DHA and EPA can be obtained by fermenting Schizoochytrium limacinum HS01; the recombinant strain is obtained by introducing gene fragment 1 to gene fragment 6 into Schizoochytrium limacinum MYA-1381; the ability the recombinant strain for producing DHA and EPA is greatly improved. The bacteria provided by the invention, the six gene fragments, the protein encoded by these six gene fragments, the vector, the cell or the organism containing these six gene fragments all have important application values.
Claims
1. A protein combination, which is the following (X1) or (X2) or (X3) or (X4): (X1) a protein combination including protein 1, protein 2, protein 3, protein 4, protein 5, and protein 6; (X2) a protein combination consisting of the protein 1, the protein 2, the protein 3, the protein 4, the protein 5 and the protein 6; (X3) a protein combination consisting of any two, any three, any four or any five of the protein 1, the protein 2, the protein 3, the protein 4, the protein 5 and the protein 6; (X4) the protein 1, the protein 2, the protein 3, the protein 4, the protein 5 or the protein 6; the protein 1 is a1) or a2) or a3) or a4) or a5): a1) a protein with the amino acid sequence as shown in SEQ ID NO: 9 in the Sequence Listing; a2) a fusion protein obtained by ligating tag(s) to the N-terminus or/and C-terminus of the protein with the amino acid sequence as shown in SEQ ID NO: 9 in the Sequence Listing; a3) a protein obtained by substitution and/or deletion and/or addition of one or more amino acid residues in the amino acid sequence as shown in SEQ ID NO: 9 in the Sequence Listing and having the same function; a4) a protein having 80% or more identity with the amino acid sequence as shown in SEQ ID NO: 9 in the Sequence Listing, derived from Schizochytrium and associated with polyunsaturated fatty acid synthesis; a5) a protein having the amino acid sequence as shown in SEQ ID NO: 9 in the Sequence Listing; the protein 2 is b1) or b2) or b3) or b4) or b5): b1) a protein with the amino acid sequence as shown in SEQ ID NO: 10 in the Sequence Listing; b2) a fusion protein obtained by ligating tag(s) to the N-terminus or/and C-terminus of the protein with the amino acid sequence as shown in SEQ ID NO: 10 in the Sequence Listing; b3) a protein obtained by substitution and/or deletion and/or addition of one or more amino acid residues in the amino acid sequence as shown in SEQ ID NO: 10 in the Sequence Listing and having the same function; b4) a protein having 80% or more identity with the amino acid sequence as shown in SEQ ID NO: 10 in the Sequence Listing, derived from Schizochytrium and associated with polyunsaturated fatty acid synthesis; b5) a protein having the amino acid sequence as shown in SEQ ID NO: 9 in the Sequence Listing; the protein 3 is c1) or c2) or c3) or c4) or c5): c1) a protein with the amino acid sequence as shown in SEQ ID NO: 11 in the Sequence Listing; c2) a fusion protein obtained by ligating tag(s) to the N-terminus or/and C-terminus of the protein with the amino acid sequence as shown in SEQ ID NO: 11 in the Sequence Listing; c3) a protein obtained by substitution and/or deletion and/or addition of one or more amino acid residues in the amino acid sequence as shown in SEQ ID NO: 11 in the Sequence Listing and having the same function; c4) a protein having 80% or more identity with the amino acid sequence as shown in SEQ ID NO: 11 in the Sequence Listing, derived from Schizochytrium and associated with polyunsaturated fatty acid synthesis; c5) a protein having the amino acid sequence as shown in SEQ ID NO: 11 in the Sequence Listing; the protein 4 is d1) or d2) or d3) or d4) or d5): d1) a protein with the amino acid sequence as shown in SEQ ID NO: 12 in the Sequence Listing; d2) a fusion protein obtained by ligating tag(s) to the N-terminus or/and C-terminus of the protein with the amino acid sequence as shown in SEQ ID NO: 12 in the Sequence Listing; d3) a protein obtained by substitution and/or deletion and/or addition of one or more amino acid residues in the amino acid sequence as shown in SEQ ID NO: 12 in the Sequence Listing and having the same function; d4) a protein having 80% or more identity with the amino acid sequence as shown in SEQ ID NO: 12 in the Sequence Listing, derived from Schizochytrium and associated with polyunsaturated fatty acid synthesis; d5) a protein having the amino acid sequence as shown in SEQ ID NO: 12 in the Sequence Listing; the protein 5 is e1) or e2) or e3) or e4) or e5): e1) a protein with the amino acid sequence as shown in SEQ ID NO: 13 in the Sequence Listing; e2) a fusion protein obtained by ligating tag(s) to the N-terminus or/and C-terminus of the protein with the amino acid sequence as shown in SEQ ID NO: 13 in the Sequence Listing; e3) a protein obtained by substitution and/or deletion and/or addition of one or more amino acid residues in the amino acid sequence as shown in SEQ ID NO: 13 in the Sequence Listing and having the same function; e4) a protein having 80% or more identity with the amino acid sequence as shown in SEQ ID NO: 13 in the Sequence Listing, derived from Schizochytrium and associated with polyunsaturated fatty acid synthesis; e5) a protein having the amino acid sequence as shown in SEQ ID NO: 13 in the Sequence Listing; the protein 6 is f1) or f2) or f3) or f4) or f5): f1) a protein with the amino acid sequence as shown in SEQ ID NO: 14 in the Sequence Listing; f2) a fusion protein obtained by ligating tag(s) to the N-terminus or/and C-terminus of the protein with the amino acid sequence as shown in SEQ ID NO: 14 in the Sequence Listing; f3) a protein obtained by substitution and/or deletion and/or addition of one or more amino acid residues in the amino acid sequence as shown in SEQ ID NO: 14 in the Sequence Listing and having the same function; f4) a protein having 80% or more identity with the amino acid sequence as shown in SEQ ID NO: 14 in the Sequence Listing, derived from Schizochytrium and associated with polyunsaturated fatty acid synthesis; f5) a protein having the amino acid sequence as shown in SEQ ID NO: 14 in the Sequence Listing.
2. An expression cassette, recombinant vector, recombinant microorganism or transgenic cell line containing the nucleic acid molecule encoding the protein combination according to claim 1.
3. The recombinant microorganism according to claim 2, wherein the recombinant microorganism is recombinant strain B, the preparation method of which is as follows: increasing the expression and/or activity of the protein combination according to claim 1 in a starting strain to obtain a recombinant strain, i.e., the recombinant strain B.
4. The recombinant microorganism according to claim 3, wherein the step of increasing the expression and/or activity of the protein combination in a starting strain is realized by introducing a substance that increases the expression and/or activity of the protein combination into the starting strain.
5. The recombinant microorganism according to claim 4, wherein the starting strain is Schizochytrium.
6. The recombinant microorganism according to claim 5, wherein the Schizochytrium is the strain Schizochytrium limacinum Honda et Yokochi ATCC MYA-1381.
7. Schizoochytrium limacinum HS01, which has the accession number of CGMCC No. 13746 at China General Microbiological Culture Collection Center.
8. A method of producing docosahexaenoic acid and/or EPA, comprising the step of fermenting the Schizoochytrium limacinum HS01 CGMCC No. 13746 according to claim 7, to obtain docosahexaenoic acid and/or EPA.
9. The method according to claim 8, wherein the fermentation medium solutes used in the fermentation culture and the solubility thereof are: glucose 20-120 g/L, glutamic acid or sodium glutamate 5-15 g/L, corn syrup dry powder 3-15 g/L, Na.sub.2SO.sub.4 5-24 g/L, KCl 0.1-1.0 g/L, MgSO.sub.4 1.0-3.0 g/L, K.sub.2SO.sub.4 0.3-1.5 g/L, KH.sub.2PO.sub.4 0.5-1.5 g/L, (NH.sub.4).sub.2SO.sub.4 0.5-1.5 g/L, CaCl.sub.2 0.1-1.0 g/L; solvent is water; pH 5.0 to 6.5.
Description
DESCRIPTION OF THE DRAWINGS
[0068]
[0069]
DESCRIPTION OF THE DEPOSITION
[0070] Name of the strain: Schizoochytrium limacinum
[0071] Latin name: Schizoochytrium limacinum
[0072] Strain number: HS01
[0073] Depositary institution: China General Microbiological Culture Collection Center
[0074] Abbreviation of the depositary institution: CGMCC
[0075] Address: No. 3, No. 1 Courtyard, Beichen West Road, Chaoyang District, Beijing
[0076] Date of deposit: Mar. 10, 2017
[0077] Accession number in the collection center: CGMCC No. 13746
DETAILED DESCRIPTION OF THE INVENTION
[0078] The present invention will be further described in detail below with reference to the specific embodiments. The examples are given only to illustrate the present invention and are not intended to limit the scope of the present invention.
[0079] The experimental methods in the following examples are conventional methods unless otherwise specified.
[0080] The materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
[0081] For all the quantitative tests in the following examples, three replicate experiments were set, and the results were averaged.
[0082] The medium used in the following examples is as follows:
[0083] Wort agar medium: 150 g malt extract powder was dissolved in 1 L mixed solution (formed by mixing 1 part by volume of natural sea water and 1 part by volume of distilled water), and the pH is natural; then agar powder was added to a concentration of 15 g/100 mL, to obtain the medium.
[0084] Screening liquid medium: 50 g glucose and 15 g yeast powder were dissolved in 1 L mixture (formed by mixing 1 part by volume of natural sea water and 1 part by volume of distilled water), and the pH is natural.
[0085] Screening solid medium: agar powder was added to the screening liquid medium to a concentration of 15 g/100 mL, to obtain the medium.
[0086] Screening plate: a solid plate was prepared by pouring the screening solid medium of about 55 C. into a culture dish and cooling.
[0087] Shake-flask medium: 50 g glucose and 15 g yeast powder were dissolved in 1 L distilled water, and the pH was natural.
[0088] Seed medium: glucose 60 g, yeast powder 10 g, Na.sub.2SO.sub.4 10 g, KCl 0.5 g, MgSO.sub.4 2.0 g, K.sub.2SO.sub.4 1.0 g, KH.sub.2PO.sub.4 1.0 g, (NH.sub.4).sub.2SO.sub.4 1.0 g and CaCl.sub.2 0.5 g were dissolved in 1 L distilled water and the pH was adjusted to 6.0.
[0089] Fermentation medium: glucose 60 g, glutamic acid or sodium glutamate 10 g, corn syrup dry powder 10 g, Na.sub.2SO.sub.4 14 g, KCl 0.5 g, MgSO.sub.4 2.0 g, K.sub.250.sub.4 1.0 g, KH.sub.2PO.sub.4 1.0 g, (NH.sub.4).sub.250.sub.4 1.0 g and CaCl.sub.2 0.5 g were dissolved in 1 L distilled water and the pH was adjusted to 6.0.
[0090] The corn syrup dry powder is a product of Solarbio LIFE SCIENCES, and the catalog number is FA0010. The yeast powder is a product of Angel Yeast Co., Ltd., and the catalog number is LMO2. The yeast genome extraction kit is a product of TIANGEN BIOTECH CO., LTD., and the catalog number is DP307. The high-fidelity TransStart FastPfu DNA polymerase is a product of TransGen Biotech, and the catalog number is AP221. The agarose gel DNA recovery kit is a product of TIANGEN BIOTECH CO., LTD., and the catalog number is DP210. The pEASY-Blunt vector is a product of TransGen Biotech, and the catalog number is CB301-01.
[0091] The strain Schizochytrium limacinum Honda et Yokochi ATCC MYA-1381 is deposited at the American Type Culture Collection (ATCC, address: American Type Culture Collection (ATCC) 10801 University Boulevard Manassas, Va. 20110 USA), and the public can obtain the strain from the American Type Culture Collection. The strain Schizochytrium limacinum Honda et Yokochi ATCC MYA-1381 is hereinafter referred to as MYA-1381 for short.
Example 1. Isolation, Identification and Deposit of Schizoochytrium limacinum HS01 CGMCC No. 13746
[0092] I. Isolation of Schizoochytrium limacinum HS01
[0093] 1. The inventors of the present application collected Schizochytrium from multiple places in the mangroves in Yunxiao County, Zhangzhou City, Fujian Province, and the Schizochytrium were mixed to obtain a mixed solution; After inoculating 0.5 mL of the mixed solution into 5 mL of screening liquid medium and then culturing at 25 C., 200 rpm/min for 2 d, a culture broth was obtained.
[0094] 2. The culture broth obtained in step 1 was evenly spread on a screening plate, and stationarily cultured at 25 C. for 2 d to produce single colonies.
[0095] 3. After completing step 2, single colonies were picked and inoculated into 5 mL fermentation medium, and then cultured at 25 C., 200 rpm/min for 2 d, to obtain a culture broth.
[0096] 4. The culture broth obtained in step 3 was centrifuged at 4 C., 2000 rpm for 5 min, and the cells were collected.
[0097] 5. 1.0-2.0 g of the cells were taken into a measuring cylinder with a plug (specification: 100 mL), 15 mL of 8.3 mol/L HCl aqueous solution was first added, the lid was covered and the measuring cylinder was placed in a 70-80 C. water bath for 50-60 min hydrolysis (during this period, shaking the measuring cylinder with a plug once every 10 minutes on the vortex mixer); after cooling to room temperature, 10 mL of 95% (v/v) ethanol aqueous solution was first added, after fully shaking evenly, 20 mL of anhydrous ether was further added to fully shake and extract for 1-2 min, and finally 20 mL of petroleum ether was added. The mixture was fully shaken and extracted for 1-2 min, and layered by standing. The upper organic phase was placed in a glass weighing dish (which has been dried and the empty weight has been weighed). The glass weighing dish was placed on a boiling water bath in a fume hood to make the organic phase fully evaporate (must fully evaporate) and the liquid phase was oil and fat.
[0098] 6. The oil and fat extracted in step 5 was taken for testing the DHA content according to GB 26400-2011 national food safety standard and testing the composition and content of fatty acid according to the method of AOAC996.06.
[0099] The strain with a higher DHA content was selected and repeatedly purified 24 times. One of the screened Schizochytrium strain was named as Schizoochytrium limacinum HS01.
[0100] The Schizoochytrium limacinum HS01 monoclone was inoculated into the fermentation medium for 12 successive passages and the DHA content was measured according to the above step. The results showed that the stability of DHA produced by Schizoochytrium limacinum HS01 was good.
II. Identification of Schizoochytrium limacinum HS01
1. Morphological Identification
[0101] The Schizoochytrium limacinum HS01 was inoculated onto the wort agar medium, and cultured at 25 C. in the dark. After 5 days, the morphology of the colonies was observed and the morphological characteristics of the strain were analyzed and observed by high-resolution transmission electron microscopy.
[0102] The experimental results are shown in
2. 18s rDNA sequence homology analysis
[0103] The partial sequence of the 18s rDNA of Schizoochytrium limacinum HS01 is as shown in SEQ ID NO: 1 in the Sequence Listing.
[0104] The partial sequence of the 18s rDNA of Schizoochytrium limacinum HS01 is as shown in SEQ ID NO: 2 in the Sequence Listing.
[0105] Based on the above identification results, Schizoochytrium limacinum HS01 is Schizoochytrium limacinum.
III. Deposit of Schizoochytrium limacinum HS01
[0106] The Schizoochytrium limacinum HS01 has been deposited at China General Microbiological Culture Collection Center (Abbreviation: CGMCC, Address: No. 3, No. 1 Courtyard, Beichen West Road, Chaoyang District, Beijing) on Mar. 10, 2017, the accession number is CGMCC No. 13746. The full name of the Schizoochytrium limacinum HS01 is Schizoochytrium limacinum HS01 CGMCC No. 13746, abbreviated as Schizoochytrium limacinum HS01.
Example 2. DHA Production by Schizoochytrium limacinum HS01 Fermentation
[0107] I. DHA Production by Schizoochytrium limacinum HS01 Fermentation
[0108] 1. The Schizoochytrium limacinum HS01 monoclone was inoculated into a shake flask (specification: 10 mL) containing 2 mL shake-flask medium, and cultured at 22-28 C., 150-250 rpm/min for 24-48 h, to obtain a primary seed broth.
[0109] 2. The primary seed broth was taken and inoculated into a shake flask (with a shake flask specification of 1 L) containing 250 mL shake-flask medium with an inoculum amount of 3-10% (v/v), and cultured at 22-28 C., 150-250 rpm/min for 24-48 h, to obtain a secondary seed broth.
[0110] 3. The secondary seed broth was taken and inoculated into a fermenter (with a fermenter specification of 5 L) containing 3 L of seed medium with an inoculum amount of 3-10% (v/v), and cultured at 22-28 C. for 24-48 h (the dissolved oxygen was 10-80%), to obtain a fermented primary seed broth.
[0111] 4. The fermented primary seed broth was taken and inoculated into a fermenter containing 50 L fermentation medium with an inoculum amount of 3-10% (v/v) (the fermenter specification was 100 L; the initial biomass after inoculation was 1.010.sup.8-2.510.sup.8 cfu/mL), and cultured at 22-28 C. for 72-120 h (the dissolved oxygen was 5-80%), to obtain a fermentation broth. The fermentation broth contained DHA.
II. Analysis of Fatty Acid Composition in the Fermentation Broth
[0112] According to the method of step 5 of step I in Example 1, the oil and fat of the fermentation broth was extracted, and then the DHA content was detected according to the GB 26400-2011 national food safety standard, and the composition and content of the fatty acid were detected according to the method of AOAC996.06.
[0113] The experimental results are shown in Table 2. The results showed that DHA accounted for 45.0%-60.0% of oil and fat.
TABLE-US-00002 TABLE 2 Name Composition (%) Lauric acid 0-1.0 Myristic acid 0.5-1.0 Palmitic acid 22-32 Stearic acid 1.0-2.5 Dohomo--linolenic acid 0.1-0.3 Arachidonic acid 0-0.8 EPA 0.2-1.0 DPA 9.0-17.0 DHA 45.0-60.0
III. Separation and Quality Identification of DHA in the Fermentation Broth
[0114] 1. The fermentation broth obtained in step I was taken, and sequentially subjected to the cell wall breaking of the Schizochytrium and the extraction of the crude oil of the DHA algae oil (the methods of cell wall breaking of the Schizochytrium and the extraction of the crude oil of the DHA algae oil are recorded in Chinese patent for invention literature CN 101817738 B).
[0115] 2. The crude oil of the DHA algal oil extracted in step 1 was refined (the method of refining is recorded in the Chinese patent for invention literature CN 103865642 B).
[0116] The quality indicators of the crude oil of the DHA algal oil after refining are shown in Table 3.
TABLE-US-00003 TABLE 3 Product DHA algal oil Indicator Standard DHA % 45.0-66.0 Moisture % 0.05 Acid value (KOH), mg/kg 0.3 Peroxide value, meq/kg 3.0 Trans-fatty acid % 1.0 Unsaponifiable matter % 2.0 Anisidine value 15
Example 3: Large-Scale Fermentation of DHA by Schizoochytrium limacinum HS01
[0117] 1. The Schizoochytrium limacinum HS01 single colony was inoculated into a shake flask (with a shake flask specification of 250 mL) containing 20 mL shake-flask medium, and cultured at 22-28 C., 150-250 rpm/min for 24-48 h, to obtain a primary seed broth.
[0118] 2. The primary seed broth was taken and inoculated into a shake flask (with a shake flask specification of 2 L) containing 250 mL shake-flask medium with an inoculum amount of 3-10% (v/v), and cultured at 22-28 C., 150-250 rpm/min for 24-48 h, to obtain a secondary seed broth.
[0119] 3. The secondary seed broth was taken and inoculated into a fermenter (with a fermenter specification of 1000 L) containing 500 L seed medium with an inoculum amount of 3-10% (v/v), and cultured at 22-28 C. for 24-48 h (the dissolved oxygen was 10-80%), to obtain a fermented primary seed broth with biomass of 15-30 g/L.
[0120] 4. The fermented primary seed broth was taken and inoculated into a fermenter (with a fermenter specification of 8000-10000 L) containing 5000 L seed medium with an inoculum amount of 5-15% (v/v), and cultured at 22-28 C. for 24-48 h (the dissolved oxygen was 10-80%), to obtain a fermented secondary seed broth with biomass of 15-30 g/L.
[0121] 5. The fermented secondary seed broth was taken and inoculated into a fermenter containing 3000 L fermentation medium with an inoculum amount of 5-15% (v/v) (the fermenter specification was 75000 L; the initial biomass after inoculation was 5.010.sup.8-3.010.sup.9 cfu/mL), and cultured at 22-28 C. for 72-120 h (the dissolved oxygen was 5-80%), to obtain a fermentation broth. The fermentation broth contained DHA.
[0122] The fatty acid composition in the fermentation broth was analyzed according to the method of step II in Example 2. The results showed that in the fermentation broth DHA accounted for 35.0-60.0% of oil and fat.
Example 4. Discovery of Gene Fragments Related to DHA and EPA Synthesis
[0123] I. Fermentation of Polyunsaturated Fatty Acids by Schizoochytrium limacinum HS01
[0124] 1. The Schizoochytrium limacinum HS01 monoclone was inoculated into a shake flask (specification: 10 mL) containing 2 mL shake-flask medium, and cultured at 22-28 C., 150-250 rpm/min for 24-48 h, to obtain a primary seed broth.
[0125] 2. The primary seed broth was taken and inoculated into a shake flask (with a shake flask specification of 1 L) containing 250 mL shake-flask medium with an inoculum amount of 3-10% (v/v), and cultured at 22-28 C., 150-250 rpm/min for 24-48 h, to obtain a secondary seed broth.
[0126] 3. The secondary seed broth was taken and inoculated into a fermenter (with a fermenter specification of 5 L) containing 3 L seed medium with an inoculum amount of 3-10% (v/v) and cultured at 22-28 C. for 24-48 h (the dissolved oxygen was 10-80%), to obtain a fermented primary seed broth.
[0127] 4. The fermented primary seed broth was taken and inoculated into a fermenter containing 50 L fermentation medium with an inoculum amount of 3-10% (v/v) (the fermenter specification was 100 L; the initial biomass after inoculation was 1.010.sup.8-2.510.sup.8 cfu/mL), and cultured at 22-28 C. for 72-120 h (the dissolved oxygen was 5-80%), to obtain a fermentation broth.
[0128] 5. According to the method of step 5 of step I in Example 1, the oil and fat of the fermentation broth was extracted, and then the DHA content was detected according to the GB 26400-2011 national food safety standard, and the DPA content was detected according to the GB28404-2012 national food safety standard, the EPA content was detected according to GB5009.168-2016 national food safety standard and the composition and content of fatty acids was detected according to the method of AOAC996.06.
[0129] The experimental results are shown in Table 4. The results showed that DHA accounted for 45.0%-60.0% of oil and fat, DPA accounted for 9.0%-17.0% of oil and fat, and EPA accounted for 0.2%-1.0% of oil and fat.
TABLE-US-00004 TABLE 4 Name Composition (%) Lauric acid 0-1.0 Myristic acid 0.5-1.0 Palmitic acid 22-32 Stearic acid 1.0-2.5 Dohomo--linolenic acid 0.1-0.3 Arachidonic acid 0-0.8 EPA 0.2-1.0 DPA 9.0-17.0 DHA 45.0-60.0
II. Fermentation of Polyunsaturated Fatty Acids by MYA-1381
[0130] According to the method of step I, the Schizoochytrium limacinum HS01 was replaced with MYA-1381, and the other steps were unchanged. The results showed that DHA accounted for 12%-23% of oil and fat, DPA accounted for 20%-39% of oil and fat, and EPA accounted for 0.5%-3% of oil and fat.
[0131] Based on the above results, Schizoochytrium limacinum HS01 is a high-yield strain for the synthesis of DHA and EPA, and MYA-1381 is a low-yield strain for the synthesis of DHA and EPA.
III. Discovery of Gene Fragments Related to DHA and EPA Synthesis
[0132] The genomic DNA of Schizoochytrium limacinum HS01 and MYA-1381 was respectively extracted using yeast genome extraction kit, and then whole genome sequencing was performed by Novogene using PacBio RS II and Illumina HiSeq 4000.
[0133] The results showed that compared with MYA-1381, Schizoochytrium limacinum HS01 contained six unique gene fragments, which were named gene fragment 1, gene fragment 2, gene fragment 3, gene fragment 4, gene fragment 5 and gene fragment 6, respectively. Their nucleotide sequences were sequentially as shown in SEQ ID NO: 3-SEQ ID NO: 8 in the Sequence Listing.
[0134] The nucleotide sequence of positions 1044-3050 from the 5 end of SEQ ID NO: 3 in the Sequence Listing encodes protein 1, and the amino acid sequence of the protein 1 is as shown in SEQ ID NO: 9 in the Sequence Listing. The nucleotide sequences of positions 1068-2737 and positions 3254-5162 from the 5 end of SEQ ID NO: 4 in the Sequence Listing encode protein 2, and the amino acid sequence of the protein 2 is as shown in SEQ ID NO: 10 in the Sequence Listing. The nucleotide sequence of positions 1094-3415 from the 5 end of SEQ ID NO: 5 in the Sequence Listing encodes protein 3, and the amino acid sequence of the protein 3 is as shown in SEQ ID NO: 11 in the Sequence Listing. The nucleotide sequences of positions 1049-5044, positions 7004-7234 and positions 7700-10399 from the 5 end of SEQ ID NO: 6 in the Sequence Listing encode protein 4, and the amino acid sequence of the protein 4 is as shown in SEQ ID NO: 12 in the Sequence Listing. The nucleotide sequence of positions 1473-6488 from the 5 end of SEQ ID NO: 7 in the Sequence Listing encodes protein 5, and the amino acid sequence of the protein 5 is as shown in SEQ ID NO: 13 in the Sequence Listing. The nucleotide sequences of positions 953-991 and positions 1063-1090 from the 5 end of SEQ ID NO: 8 in the Sequence Listing encode protein 6, and the amino acid sequence of the protein 6 is as shown in SEQ ID NO: 14 in the Sequence Listing.
Example 5. Amplification of the Six Gene Fragments and Synthesis of their Corresponding Primers
[0135] 1. The genomic DNA of Schizoochytrium limacinum HS01 was extracted using the yeast genome extraction kit. Using the genomic DNA as a template, high-fidelity TransStart FastPfu DNA polymerase and primer pairs (primer pair HS01-1, primer pair HS01-2, primer pair HS01-3, primer pair HS01-4, primer pair HS01-5, primer pair HS01-6) were used to carry out PCR amplification, to obtain PCR amplification products.
[0136] The nucleotide sequences of the upstream primer and the downstream primer constituting each primer pair are shown in Table 5.
[0137] Reaction procedure: 98 C. 2 min; 98 C. 30 s, 56 C. 30 s, 72 C. 3 min, 30 cycles; 72 C. 5 min.
TABLE-US-00005 TABLE5 Nameof Nameof Nucleotide primerpair primer sequence(5-3) Primerpair HS01-1-F CACATTCGCTACAAA HS01-1 ACGCCGCAGTTTCTA HS01-1-R CGCAAACTATTTGCT AACCTATTTATCGTA Primerpair HS01-2-F CTGCTGCTACTTCAA HS01-2 CATCACTTTGCTCGT HS01-2-R ACTGTAAGTTTATTA AATTGGTCGAGGATG Primerpair HS01-3-F ACCGTGGGCCAAGCT HS01-3 GGCCGCCCCAAGACG HS01-3-R CTTATCTTTGAGGGT AAGAAGGTCTGGTAT Primerpair HS01-4-F CATTGATTGATTGCA HS01-4 GATGATCTTGGGCAA HS01-4-R CTTTCGCCGTTAGAG AAAAAACCCAAACGA Primerpair HS01-5-F TATTGCTATTACTTG HS01-5 AATTTGAATTTGAAT HS01-5-R CAGCAACTTTCACTC GCCCATTCAATCAAT Primerpair HS01-6-F CCACATAATTTGAAA HS01-6 GAAACATTGACCACG HS01-6-R GTGCACCGTTCTTAT GCATATTTTAAAATC
[0138] 2. After completing step 1, the PCR amplification products were recovered using an agarose gel DNA recovery kit.
[0139] 3. After completing step 2, the recovered PCR amplification products were ligated to the pEASY-Blunt vectors to obtain recombinant plasmids.
[0140] 4. After completing step 3, the recombinant plasmids were sequenced.
[0141] The sequencing results showed that the nucleotide sequence of the PCR amplification product amplified by primer pair HS01-1 was as shown in SEQ ID NO: 3 in the Sequence Listing (i.e., the gene fragment 1), the nucleotide sequence of the PCR amplification product amplified by primer pair HS01-2 was as shown in SEQ ID NO: 4 in the Sequence Listing (i.e., the gene fragment 2), the nucleotide sequence of the PCR amplification product amplified by primer pair HS01-3 was as shown in SEQ ID NO: 5 in the Sequence Listing (i.e., the gene fragment 3), the nucleotide sequence of the PCR amplification product amplified by primer pair HS01-4 was as shown in SEQ ID NO: 6 in the Sequence Listing (i.e., the gene fragment 4), the nucleotide sequence of the PCR amplification product amplified by primer pair HS01-5 was as shown in SEQ ID NO: 7 in the Sequence Listing (i.e., the gene fragment 5), the nucleotide sequence of the PCR amplification product amplified by primer pair HS01-6 was as shown in SEQ ID NO: 8 in the Sequence Listing (i.e., the gene fragment 6). Therefore, the six gene fragments can be amplified using the primers in Table 2.
Example 6. Application of the Six Gene Fragments in the Production of DHA and EPA
[0142] In this example, the nucleotide sequences of the primers involved are shown in Table 6.
TABLE-US-00006 TABLE6 Nameof primer Nucleotidesequence(5-3) HS01-1-UF CACATTCGCTACAAAACGCCGCAGTTTCTA HS01-1-UR ACGGTAGAGCGCTTTTGAAGCTGGGGTGGG GTGCGAGGAAGTTGCGTATCCCAGGCTCTC HS01-1-DF GGTAAGGAGGATATTCTCGAGACTAGTCTG ACGCTCCCATCAATCTTTGGACACTACGAC HS01-1-DR CGCAAACTATTTGCTAACCTATTTATCGTA HS01-2-UF CTGCTGCTACTTCAACATCACTTTGCTCGT HS01-2-UR ACGGTAGAGCGCTTTTGAAGCTGGGGTGGG TTGCGATGAATAGCAAACCCCAGAAGTGTG HS01-2-DF GGTAAGGAGGATATTCTCGAGACTAGTCTG GCGAATCCGAGACTCCTTTAAATAGCCAAG HS01-2-DR ACTGTAAGTTTATTAAATTGGTCGAGGATG HS01-3-UF ACCGTGGGCCAAGCTGGCCGCCCCAAGACG HS01-3-UR ACGGTAGAGCGCTTTTGAAGCTGGGGTGGG GTGTGAGGCCACTTGTATCAACAGAGGTAA HS01-3-DF GGTAAGGAGGATATTCTCGAGACTAGTCTG TACAATTGAAGAGCCATTGGATAAGTTCGA HS01-3-DR CTTATCTTTGAGGGTAAGAAGGTCTGGTAT HS01-4-UF CATTGATTGATTGCAGATGATCTTGGGCAA HS01-4-UR ACGGTAGAGCGCTTTTGAAGCTGGGGTGGG CCTACAAGGTGTGTTGGTTCGGAAGTTGGT HS01-4-DF GGTAAGGAGGATATTCTCGAGACTAGTCTG ATTACAACCACAACTTTCTATAAATAGTGC HS01-4-DR CTTTCGCCGTTAGAGAAAAAACCCAAACGA HS01-5-UF TATTGCTATTACTTGAATTTGAATTTGAAT HS01-5-UR ACGGTAGAGCGCTTTTGAAGCTGGGGTGGG GTATGATATGTTATGTACTCGAGGAATGTA HS01-5-DF GGTAAGGAGGATATTCTCGAGACTAGTCTG ATCAAAGAAATTAAAAAGAAAACAAACATT HS01-5-DR CAGCAACTTTCACTCGCCCATTCAATCAAT HS01-6-UF CCACATAATTTGAAAGAAACATTGACCACG HS01-6-UR ACGGTAGAGCGCTTTTGAAGCTGGGGTGGG AAATATTCAATCGAAATAAATGCACTGTTT HS01-6-DF GGTAAGGAGGATATTCTCGAGACTAGTCTG CCTGATCATCCTTTCGTTACTTCTCAACTC HS01-6-DR GTGCACCGTTCTTATGCATATTTTAAAATC Zeo-F CCCACCCCAGCTTCAAAAGCGCTCTACCGT Zeo-R CAGACTAGTCTCGAGAATATCCTCCTTACC
A. The Acquisition of GS-C06 Strain
I. Preparation of Target Fragment HS01-1-Zeo
[0143] 1. The recombinant plasmid pUC57-LZ was synthesized by GenScript. The recombinant plasmid pUC57-LZ was obtained by ligating the nucleotide sequence as shown in SEQ ID NO: 15 in the Sequence Listing with the pUC57 vector. In SEQ ID NO: 15 in the Sequence Listing, positions 25-58 from the 5 end is Lox66 sequence, positions 626-997 is zeocin resistance gene, and positions 2293-2326 is Lox71 sequence.
[0144] 2. The genomic DNA of Schizoochytrium limacinum HS01 was extracted using the yeast genome extraction kit.
[0145] 3. Using the genomic DNA of Schizoochytrium limacinum HS01 as a template, HS01-1-UF and HS01-1-UR were used as primers to carry out PCR amplification. PCR amplification product of about 3100 bp was obtained, and the PCR amplification product was upstream homologous fragment AU of HS01-1.
[0146] 4. Using the genomic DNA of Schizoochytrium limacinum HS01 as a template, HS01-1-DF and HS01-1-DR were used as primers to carry out PCR amplification. A PCR amplification product of about 1000 bp was obtained, and the PCR amplification product was downstream homologous fragment AD of HS01-1.
[0147] 5. Using the recombinant plasmid pUC57-LZ synthesized in step 1 as a template, Zeo-F and Zeo-R were used as primers to carry out PCR amplification. A PCR amplification product of about 2350 bp was obtained (nucleotide sequence is as shown in SEQ ID NO: 15 in the Sequence Listing), and the PCR amplification product was a Zeo fragment.
[0148] 6. Using the upstream homologous fragment AU of HS01-1, the downstream homologous fragment AD of HS01-1 and the Zeo fragment as templates, HS01-1-UF and HS01-1-DR were used as primers to conduct overlap amplification. A PCR amplification product of about 6450 bp was obtained. The PCR amplification product was recovered using the agarose gel DNA recovery kit to obtain a target fragment HS01-1-Zeo.
II. The Acquisition of the Pre-Treated MYA-1381
[0149] 1. A sterile pre-cooled polypropylene tube (specification: 50 mL) was taken, and 10 mL of MYA-1381 solution (concentration: 110.sup.8 cfu/mL) was added and centrifuged at 4 C., 5000 r/min for 10 min, the supernatant was discarded and the cells were collected.
[0150] 2. After completing step 1, the following steps were repeated twice: the polypropylene tube was taken, 10 mL pre-cooled sterile water was added to clean the cells, the resulting mixture was centrifuged at 4 C., 4472 g for 10 min, and the cells were collected.
[0151] 3. After completing step 2, the polypropylene tube was taken, resuspended by adding 10 mL pre-cooled 1 mol/L sorbitol aqueous solution and centrifuged at 4 C., 5000 r/min for 10 min, and the cells were collected.
[0152] 4. After completing step 3, the polypropylene tube was taken, resuspended by adding 10 mL pre-cooled 1 mol/L sorbitol aqueous solution to obtain pretreated MYA-1381.
III. Electrotransformation
[0153] 1. 30 l, pretreated MYA-1381 was taken and 1 g target fragment HS01-1-Zeo was added to it. The resulting mixture was mixed gently, allowed to stand for 5 min in an ice bath, and then transferred to an ice-cold gene pulser cuvette for electric shock (electric shock parameters: 0.75 KV, 50 F).
[0154] 2. After completing step 1, the gene pulser cuvette was taken and 1 mL seed medium was added to it. The resulting mixture was cultured at 30 C., 200 r/min for 1 h, then centrifuged at 10 C., 5000 r/min for 10 min. The cells and a small amount of supernatant were mixed and spread evenly on the resistant plate, cultured upside down at 30 C. for 48 h to obtain quasi-transformant.
[0155] Resistant plate: Zeocin was added to the screening solid medium of about 55C to a concentration of 200 g/mL, and then poured into a petri dish, and the solid plate was obtained after cooling.
IV. The Acquisition and Identification of Positive Transformants
[0156] The genomic DNA of the quasi-transformant was extracted by the yeast genome extraction kit. Using the genomic DNA as a template, HS01-1-F and HS01-1-R were used as primers to conduct the PCR amplification to obtain PCR amplification product.
[0157] If the size of the PCR amplification product of a quasi-transformant was 4100 bp (or its nucleotide sequence was as shown in SEQ ID NO: 3 in the Sequence Listing), the quasi-transformant was a positive transformant.
V. The Acquisition of GS-C01.
[0158] The plasmid pSH65 (product of Biovector Inc.; this plasmid contains Cre enzyme) was introduced into the positive transformant, and then the Zeo gene was eliminated according to the procedure of the instructions of plasmid pSH65 to obtain transformant GS-C01.
[0159] According to above steps I to V, HS01-1-UF was replaced with HS01-2-UF, HS01-1-UR was replaced with HS01-2-UR, HS01-1-DF was replaced with HS01-2-DF, HS01-1-DR was replaced with HS01-2-DR, HS01-1-F was replaced with HS01-2-F, HS01-1-R was replaced with HS01-2-R, MYA-1381 was replaced with transformant GS-C01, and the other steps were unchanged, to obtain transformant GS-C02.
[0160] According to above steps I to V, HS01-1-UF was replaced with HS01-3-UF, HS01-1-UR was replaced with HS01-3-UR, HS01-1-DF was replaced with HS01-3-DF, HS01-1-DR was replaced with HS01-3-DR, HS01-1-F was replaced with HS01-3-F, HS01-1-R was replaced with HS01-3-R, MYA-1381 was replaced with transformant GS-C02, and the other steps were unchanged, to obtain transformant GS-C03.
[0161] According to above steps I to V, HS01-1-UF was replaced with HS01-4-UF, HS01-1-UR was replaced with HS01-4-UR, HS01-1-DF was replaced with HS01-4-DF, HS01-1-DR was replaced with HS01-4-DR, HS01-1-F was replaced with HS01-4-F, HS01-1-R was replaced with HS01-4-R, MYA-1381 was replaced with transformant GS-C03, and the other steps were unchanged, to obtain transformant GS-C04.
[0162] According to above steps I to V, HS01-1-UF was replaced with HS01-5-UF, HS01-1-UR was replaced with HS01-5-UR, HS01-1-DF was replaced with HS01-5-DF, HS01-1-DR was replaced with HS01-5-DR, HS01-1-F was replaced with HS01-5-F, HS01-1-R was replaced with HS01-5-R, MYA-1381 was replaced with transformant GS-C04, and the other steps were unchanged, to obtain transformant GS-C05.
[0163] According to above steps I to V, HS01-1-UF was replaced with HS01-6-UF, HS01-1-UR was replaced with HS01-6-UR, HS01-1-DF was replaced with HS01-6-DF, HS01-1-DR was replaced with HS01-6-DR, HS01-1-F was replaced with HS01-6-F, HS01-1-R was replaced with HS01-6-R, MYA-1381 was replaced with transformant GS-C05, and the other steps were unchanged, to obtain transformant GS-C06.
[0164] The transformant GS-C06 was the GS-C06 strain.
B. Application of the Six Gene Fragments in the Production of DHA and EPA
[0165] The strain to be tested was Schizoochytrium limacinum HS01, MYA-1381 or GS-C06 strain.
[0166] 1. The monoclone of the strain to be tested was inoculated into a shake flask (specification: 10 mL) containing 2 mL shake-flask medium, and cultured at 22-28 C., 150-250 rpm/min for 24-48 h, to obtain a primary seed broth.
[0167] 2. The primary seed broth was taken and inoculated into a shake flask (with a shake flask specification of 500 mL) containing 50 mL shake-flask medium with an inoculum amount of 3-10% (v/v), and cultured at 22-28 C., 150-250 rpm/min for 24-48 h, to obtain a secondary seed broth.
[0168] 3. The secondary seed broth was taken and inoculated into a fermenter (fermenter specification: 1 L) containing 500 mL seed medium with an inoculum amount of 3-10% (v/v), and cultured at 22-28 C. for 24-48 h (the dissolved oxygen was 10-80%), to obtain a tertiary seed broth.
[0169] 4. The tertiary seed broth was taken and inoculated into a fermenter containing 5 L fermentation medium with an inoculum amount of 3-10% (v/v) (the fermenter specification was 100 L; the initial biomass after inoculation was 3.010.sup.8-0.510.sup.8 cfu/mL), and cultured at 22-28 C. for 72-120 h (the dissolved oxygen was 5-80%), to obtain a fermentation broth. The fermentation broth contained DHA, DPA and EPA.
[0170] 5. According to the method of step 5 of step I in Example 1, the oil and fat of the fermentation broth was extracted, and then the DHA content was detected according to the GB 5009. 168-2016 national food safety standard, and the DPA content was detected according to the GB28404-2012 national food safety standard, the EPA content was detected according to GB5009.168-2016 national food safety standard.
[0171] The experimental results are shown in Table 7. The results showed that transforming the six gene fragments obtained by the present invention into MYA-1381 can obtain a high-yield strain for the synthesis of DHA and EPA (i.e., GS-C06 strain). Therefore, the six gene fragments provided by the present invention, the proteins encoded by the six gene fragments, and the vector, cell or organism containing these six gene fragments have important application value in the production of DHA and EPA. By engineering the proteins encoded by these six gene segments in the starting strain, high-yield engineering strain of DHA and EPA can be constructed.
TABLE-US-00007 TABLE 7 Schizoochytrium GS-C06 MYA-1381 limacinum HS01 strain DHA content in oil and fat 12.38 45.02 30.50 (%) DPA content in oil and fat 25.26 12.74 17.50 (%) EPA content in oil and fat 0.50 1.30 0.71 (%)
INDUSTRIAL APPLICATION
[0172] The Schizoochytrium limacinum HS01 provided by the present invention has high production value for producing DHA and/or EPA. A high-yield strain for the synthesis of DHA and/or EPA can be obtained by transforming the six gene fragments obtained by the present invention into a low-yield strain for the synthesis of DHA and/or EPA. Therefore, the six gene fragments provided by the present invention, the proteins encoded by these six gene fragments, and the vector, cell or organism containing these six gene fragments have important application value in the production of DHA and/or EPA. By engineering the proteins encoded by these six gene fragments in a starting strain, a high-yield engineering strain of DHA and/or EPA can be constructed.