Treatment of amyotrophic lateral sclerosis

Abstract

The invention relates to a method for the treatment of amyotrophic lateral sclerosis (ALS). Specifically, the invention implements the use of an antisense sequence adapted to affect alternative splicing in a human SOD1 pre-mRNA, thereby leading to the destruction of the skipped m RNA by the cell machinery.

Claims

1. An antisense oligonucleotide of 20 to 30 nucleotides in length targeting a human SOD1 pre-mRNA, wherein said antisense oligonucleotide comprises SEQ ID NO:1.

2. A nucleic acid molecule comprising: (i) a nucleic acid sequence of SEQ ID NO:1 and (ii) a nucleic acid sequence of SEQ ID NO:4.

3. An antisense oligonucleotide of 20 to 30 nucleotides in length targeting a human SOD1 pre-mRNA, wherein said antisense oligonucleotide comprises SEQ ID NO: 1 and wherein said antisense oligonucleotide is modified with a small nuclear RNA such as the U7 small nuclear RNA.

4. A vector comprising a nucleic acid that encodes an antisense oligonucleotide of 20 to 30 nucleotides in length targeting a human SOD1 pre-mRNA, wherein said antisense oligonucleotide comprises SEQ ID NO: 1.

5. The vector according to claim 4, which is a viral vector.

6. The vector according to claim 5, wherein said viral vector is an AAV vector, in particular an AAV9 or AAV10 vector.

7. A vector encoding at least one antisense oligonucleotide targeting a human SOD1 pre-mRNA, wherein said antisense oligonucleotide induces exon-skipping in said pre-mRNA, wherein said vector further comprises an expression cassette containing a nucleotide sequence encoding a human SOD1 protein, wherein said nucleotide sequence comprises SEQ ID NO:11 or SEQ ID NO:12, wherein the antisense oligonucleotide cannot induce exon-skipping in the pre-mRNA encoded by said nucleotide sequence.

8. A method for treating amyotrophic lateral sclerosis, comprising administering to a subject in need thereof an antisense oligonucleotide of 20 to 30 nucleotides in length targeting a human SOD1 pre-mRNA, wherein said antisense oligonucleotide comprises SEQ ID NO: 1.

9. The method of claim 8, wherein said antisense oligonucleotide is administered via the intravenous or intracerebroventricular routes.

10. A nucleic acid sequence comprising the sequence of SEQ ID NO:11 or 12.

11. An expression cassette comprising the nucleic acid sequence of claim 10.

12. A vector comprising the nucleic acid sequence of claim 10.

13. The vector according to claim 12, wherein said vector is a plasmid or a viral vector.

14. A host cell transformed with a vector according to claim 13.

15. The host cell according to claim 14, said cell being an eukaryotic or prokaryotic cell.

16. The host cell according to claim 14, being a mammalian, human or non-human cell.

17. The host cell according to claim 16, with the proviso that when the cell is a human cell, said cell is not a human embryonic stem cell.

18. The vector according to claim 7, wherein the antisense oligonucleotide comprises SEQ ID NO:1 or SEQ ID NO:4.

19. The vector according to claim 7, wherein the vector encodes an antisense oligonucleotide comprising SEQ ID NO:1 and an antisense oligonucleotide comprising SEQ ID NO:4.

20. A method for treating amyotrophic lateral sclerosis, comprising administering to a subject in need thereof the vector according to claim 4.

21. The method of claim 20, wherein said vector is administered via the intravenous or intracerebroventricular routes.

22. A method for treating amyotrophic lateral sclerosis, comprising administering to a subject in need thereof the vector according to claim 7.

23. The method of claim 22, wherein said vector is administered via the intravenous or intracerebroventricular routes.

24. The nucleic acid molecule according to claim 2, wherein said nucleic acid sequence is modified with a small nuclear RNA such as the U7 small nuclear RNA.

25. A method for treating amyotrophic lateral sclerosis, comprising administering to a subject in need thereof the nucleic acid molecule according to claim 2.

26. The method of claim 25, wherein said nucleic acid molecule is administered via the intravenous or intracerebroventricular routes.

27. A vector comprising the nucleic acid molecule according to claim 2.

28. The vector according to claim 27, which is a viral vector.

29. The vector according to claim 28, wherein said viral vector is an AAV vector, in particular an AAV9 or AAV10 vector.

30. A method for treating amyotrophic lateral sclerosis, comprising administering to a subject in need thereof the vector according to claim 27.

31. The method of claim 30, wherein said vector is administered via the intravenous or intracerebroventricular routes.

32. A composition comprising an antisense oligonucleotide comprising SEQ ID NO:1 and an antisense oligonucleotide comprising SEQ ID NO:4.

33. A method for treating amyotrophic lateral sclerosis, comprising administering to a subject in need thereof the composition according to claim 32.

34. The method of claim 33, wherein said composition is administered via the intravenous or intracerebroventricular routes.

Description

LEGEND TO THE FIGURES

(1) FIG. 1: Graphic Representation of potential ESE motif predicted by ESEfinder in exon 2hSOD1. Threshold values are default defined by the software. SRF1 (SF2/ASF): 1.956; SRF1 (IgM-BRCA1): 1.867; SRF2 (SC35): 2.382; SRF5 (SRp40): 2.67; SRF6 (SRp55): 2.676. SEQ ID NO:10, nucleotides 73-169, is shown.

(2) FIG. 2: RT-PCR on AON transfected 293T cells.

(3) FIG. 3: Sequencing of the skipped form. SEQ ID NO:10, nucleotides 31-73 and 171-212, is shown.

(4) FIG. 4: Full length hSOD1 mRNA expression in transfected cells. Percentage of hSOD1 reduction of each AON, compared to untreated cells: AON1: 85%; AON2: 55%; AON3: 75%; AON4: 81%. Data are means+/SEM (n=3). **P<0.01, ***P<0.005, determined by Student's t-test compared to untreated cells.

(5) FIG. 5: RT-PCR on spinal cord (SC) extracts from SOD1.sup.G93A mice injected directly into the spinal cord (SC) with 4.710.sup.12 vg/kg of AAV10-U7-hSOD1 or AAV10-U7-CTR.

(6) FIG. 6: Q-RT-PCR on full length hSOD1 mRNA in SC extracts from SOD1.sup.G93A mice injected directly into the SC. Two mice were injected with 4.710.sup.12 vg/kg of AAV10-U7-CTR: n.2 and n.5; three mice were injected with the same dose of AAV10-U7-hSOD1: n.6, n.8 and n.9.

(7) FIG. 7: (a) Western-blot analysis of hSOD1 protein expression in SOD1.sup.G93A mice injected into the SC with 4.710.sup.12 vg/kg of AAV10-U7-hSOD1 (n=3) and the same dose of AAV10-U7-CTR (n=3). Alpha-Tubulin was used as loading control (b) Densitometric analysis of the protein levels. Data are means+/SEM (n=3). **P<0.01, determined by Student's t-test compared to AAV10-U7-CTR infected spinal cord.

(8) FIG. 8: Representative photograph of SOD1.sup.G93A mice injected at birth into the lateral ventricle (ICV) and the temporal vein (IV), with 610 vg/kg of AAV10-U7-hSOD1. An age related (191-days old) wild-type (WT) mouse is showed as control.

(9) FIG. 9: (a) Schematic representation of an erase-replace AAV vector simultaneously expressing the U7-hSOD1 antisense oligonucleotide (under control of the U7 promoter), and the Flag-hSOD1opt or the hSOD1opt-Flag (under control of the PGK promoter): AAV-U7-hSOD1-Flag-hSOD1opt or AAV-U7-hSOD1-hSOD1opt-Flag

(10) (b) Representative cultured HEK-293T cells treated by GFP-immunofluorescence 48 hours after transfection with the AAV-U7-hSOD1-GFP control vector (right). The left panel represents a phase contrast image of the cells. (c). Western-blot analysis of the Flag tag in HEK-293 cells 48 hours after transfection with the AAV-U7-CTR-Flag-hSOD1opt, the AAV-U7-hSOD1-Flag-hSOD1opt, or the control AAV-U7-hSOD1-GFP control vector, and in untransfected cells. Actin was used as loading control.

EXAMPLES

Example 1: hSOD1 Silencing and Survival Improvement in ALS Mice

(11) Materials and Methods

(12) Mice Strains (Animals), In Vivo Electroporation and Adeno Associated Virus Vectors (AAV)

(13) Animal care followed the European guidelines for the care and use of experimental animals. High copy SOD1.sup.G93A mice, B6SJL-Tg (SOD1*G93A)1Gur/J (JACKSON no. SN 2726) were purchased from Jackson Laboratories (Bar Harbor, Me.).

(14) Cells

(15) HEK-293T cells were cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin at 37 C. in 5% CO2. 2-O-methyl phosphorothioate (2OMePS) AONs were purchased from Eurogentec and re-suspended in H2O RNAse free water at a final concentration of 1 g/l. 5 g of each AON were transfected with Oligofectamine (Invitrogen) following the manufacturer's Instructions. 48 hours after transfection cells were harvested for RNA extraction.

(16) RNA Extraction, Reverse Transcription, RT-PCR and qRT-PCR

(17) Total RNA was extracted from cells or from freshly frozen spinal cords with the RNA extraction kit NucleoSpin RNA II (Macherey-Nagel), as per the manufacturer's protocol. cDNA was synthesized from 1 g of total RNA using oligo (dT) and random hexamer primers, according to the iScript cDNA Synthesis kit protocol (Biorad). To investigate the presence of exon 2 in the human SOD1 mRNA, RT-PCR analysis was performed from 200 ng of cDNA, using the following primers:

(18) Primer Fw1, matching the human SOD1 exon 1: 5-CTAGCGAGTTATGGCGAC-3 (SEQ ID NO:5); Primer Rev 4/5, matching the human SOD1 (exon 4-exon 5 boundary): 5-GCCAATGATGCAATGGTCTC-3 (SEQ ID NO:6).

(19) Taqman Real-time PCR (Q-RT-PCR) was performed using DNA Engine Opticon 2 System (Biorad). 100 ng of cDNA were amplified in 10 l of Taqman Universal PCR Master Mix 2X (Life technologies), with 1 l of human SOD1 FAM TaqMan Gene expression assay (Hs00533490 m1, Life technologies) and 1 l of human GAPDH VIC Taqman Gene expression assay (Hs03929097_g1, Life technologies) or for in vivo analysis mouse Ipo8 (Mm01255158_m1, Life Technologies) as endogenous control. Reactions were incubated 1 min at 60 C., 10 min at 95 C., followed by 39 cycles of 15 min at 95 C. and 1 min at 60 C. The number of hSOD1 copies was calculated using the delta Ct/delta Ct method. Analyses were performed with DNA Engine Opticon 2 System (Biorad).

(20) Vectors

(21) The DNA sequences corresponding to the two most performing AONs were cloned into the pAAVsc_U7DTex23 (kindly provided by GENETHON, Evry, France), using PCR-mediated mutagenesis, as already described (Goyenvalle et al., 2004). The viral particles, scAAV serotype 10, have been produced using the tri-transfection method, as previously described in Dominguez et al. (Dominguez et al., 2011). Vector titers were determined by Q-RT-PCR on ITRs; titers were expressed as viral genome (vg)/ml.

(22) Injections

(23) For injection into the spinal cord of adult mice, 50-days old mice were used. Mice were anesthetized with an intraperitoneal injection of a ketamine/xylazine mixture (100 mg/kg Ketamine, 16 mg/kg Xylazine; 0.1 ml per 10 grams of body weight). Injections were performed as reported in Raoul et al. 2005 (Raoul et al., 2005). Total volume of 10 l (5 l per site) containing 9.510e10 vg (4.710e12 vg/Kg) of each vector was injected in each mouse.

(24) For injection into newborn mice, postnatal day 1 pups were utilized. Injections were performed by combining intracerebroventricular (ICV) and intravenous (IV) injections (as described in Barkats, Voit. Patent WO2013190059 (A1)2013-12-27). Total volume of 80 l containing 7.610e11 vg (610e14 vg/kg) have been injected in each mice. 10 l of viral solution were injected directly into the lateral ventricles and 70 l were delivered into the frontotemporal vein.

(25) Western Blot Analysis

(26) Freshly frozen spinal cords were homogenized and protein lysate were prepared using the lysis buffer (150 mM NaCl, 50 mM Tris-HCl, 0.5% sodium deoxycholate, 1% NP40, 1% SDS) supplied with protease inhibitors cocktail (Complete Mini, Roche Diagnostics). Protein extracts were quantified by DC protein assay (BioRad). 30 g were separated on 12% polyacrylamide gel (Criterion XT 10% bis-Tris, Biorad) and analyzed by Western blot with the following antibodies: anti--tubulin (T5168, Sigma Aldrich); anti-human SOD1 (sc-8636, Santa Cruz Biotechnology). Peroxidase-conjugated antisera to mouse and rabbit Igs were purchased from Amersham Pharmacia Biotech. Western blots were developed using the SuperSignal West Dura kit (Thermoscientific). Densitometric analysis was performed using Image J software.

(27) Results

(28) 1) AON Design

(29) To induce exon skipping in the human SOD1 gene, we designed RNA-AONs to interfere with the acceptor splice site (SA) or with exon splicing enhancer (ESE) sequences of the human SOD1 pre-mRNA. The human SOD1 gene is composed of 5 exons and we planned to induce the skipping of exon 2. Indeed, skipping exon 2 from the SOD1 pre-mRNA induces a frameshift which produces a truncated cDNA resulting in a premature stop codon (TGA) in exon 4. To optimize skipping of exon 2, we designed AON sequences targeting the SA sequence in intron1 andsince it has been reported that targeting ESE sequences may represent an advantage over SA (Goyenvalle et al., 2004), we also designed AONs targeting exon 2 ESE sequences. ESEs are exon-internal sequences that facilitate splicing by binding Ser-Arg-rich (SR) proteins (Cartegni et al., 2002). To determine these sequences we used the ESEfinder software which predicts binding sites for the four most abundant SR proteins (SF2/ASF, SC35, SRp40, and SRp55). In FIG. 1 are shown potential ESE sequences in exon 2.

(30) Once the putative target sequences were identified, we designed 4 AONs to specifically skip the human SOD1 exon2, following the specific rules published by Aartsma-Rus et al. (Aartsma-Rus et al., 2009). Accordingly, each AON (Table 1) was designed to be 20-nucleotides long, we selected AONs with the highest Tm and we evaluated the free energy of the predicted secondary structure of both AONs and the targeted exon, using the RNAstructure 5.3 software. We also selected a scrambled AONs sequence as negative control (AON-CTR). Sequence control: 5 GCUCAUUCGCUUUCAUUCUU 3(SEQ ID NO:7).

(31) 2) In Vitro Selection of the AONs

(32) We selected the optimal AONs on the basis of their efficacy to reduce hSOD1 mRNA levels after transfection in HEK-293T cells. To optimize cell transfection, we used chemically modified 2-O-methyl phosphorothioate (2OMePS) AONs (Eurogentec), as this modification confers considerable resistance to nuclease and RNase H degradation (Aartsma-Rus et al., 2009). As control we used the scrambled fluorescently (FAM)-labeled AON which has been also used as control of the transfection efficiency in each experiment. After RT-PCR analysis we observed the PCR product corresponding to the human SOD1 mRNA full length (355 bp) in all the samples. In SOD1-AONs transfected cells we observed an additional 258 bp product, corresponding to the skipped Exon 2 form (FIG. 2). After sequencing the PCR products, we confirmed exon2 skipping in the human SOD1-mRNA corresponding to the small 258 bp band (FIG. 3), with the production of a premature stop codon in exon 4. We concluded that the selected AONs were able to induce human SOD1 exon 2 skipping.

(33) To identify the most effective sequence in terms of human SOD1 mRNA levels reduction, the expression of the full length SOD1 mRNA has been quantified by Real Time PCR using the Taqman method. (FIG. 4)

(34) AON1 and AON4 showed the highest efficiency in terms of human SOD1 mRNA reduction (85% and 81% respectively). Accordingly we selected these two AONs to be cloned together in fusion with the U7snRNA sequence into the scAAV backbone. The sequence added to the U7 promoter is: CCCACACCTTCACTGGTCCACCATGCAGGCCTTCAGTCAG (SEQ ID NO:8)

(35) The complete sequence, U7+ Antisense is:

(36) TABLE-US-00002 (SEQIDNO:9) TAACAACATAGGAGCTGTGATTGGCTGTTTTCAGCCAATCAGCACTGACT CATTTGCATAGCCTTTACAAGCGGTCACAAACTCAAGAAACGAGCGGTTT TAATAGTCTTTTAGAATATTGTTTATCGAACCGAATAAGGAACTGTGCTT TGTGATTCACATATCAGTGGAGGGGTGTGGAAATGGCACCTTGATCTCAC CCTCATCGAAAGTGGAGTTGATGTCCTTCCCTGGCTCGCTACAGACGCAC TTCCGCAAGCCCACACCTTCACTGGTCCACCATGCAGGCCTTCAGTCAGA ATTTTTGGAGCAGGTTTTCTGACTTCGGTCGGAAAACCCCTCCCAATTTC ACTGGTCTACAATGAAAGCAAAACAGTTCTCTTCCCCGCTCCCCGGTGTG TGAGAGGGGCTTTGATCCTTCTCTGGTTTCCTAGGAAACGCGTATGTG.

(37) 3) scAAV10-U7-hSOD1 Production

(38) U7snRNA is normally involved in histone pre-mRNA 3-end processing, but can be converted into a versatile tool for splicing modulation by a small change in the binding site for Sm/Lsm proteins (U7 smOpt) (Schumperli and Pillai, 2004). The antisense sequence, embedded into a snRNP particle, is therefore protected from degradation and accumulates in the nucleus where splicing occurs. To deliver AONs in SOD1.sup.G93A mice, we have used the U7 cassette described by D. Schumperli (Schumperli and Pillai, 2004). It consists of the natural U7-promoter (position 267 to +1), the U7 smOpt snRNA and the downstream sequence down to position 116. This cassette has been placed between the inverted terminal repeats (ITR) of a scAAV backbone and the 18 nt natural sequence complementary to histone pre-mRNAs in U7smOpt has been replaced by the two selected 20-nt AONs sequences (and a control sequence, CTR; described in Pietri-Rouxel, 2009 et al.), and we produced the corresponding viral particles (namely AAV10-U7-CTR and AAV10-U7-hSOD1).

(39) 4) In Vivo hSOD1 Exon Skipping in SOD1.sup.G93A Mice

(40) To analyze their efficacy in reducing hSOD1 RNA levels, the AAV10-U7-CTL and AAV10-U7-hSOD1 were directly injected into the spinal cord of 50 day-old mice SOD.sup.G93A mice (n=3 for the AAV10-U7-hSOD1 and n=2 for the AAV10-U7-CTR. Four weeks post-injection, the spinal cords were removed and SOD mRNAs were analyzed for exon 2 skipping using RT-PCR (FIG. 5). Human SOD1 expression was also assessed by Real time PCR analysis as described in the previous in vitro experiments (FIG. 6). As expected, the Ex2 skipped form was observed only in the spinal cords from the AAV10-U7-hSOD1 injected animals (FIG. 5), with more than 80% reduction of the full length hSOD1 mRNA (FIG. 6).

(41) Similar to the RNA analyses, the effect of Ex2 skipping was further analyzed at the protein level one month after injection of the control and the U7-hSOD1 AAV vectors into the spinal cord of SOD.sup.G93A mice (n=3 in each group). The western blot analysis showed a 70% reduction of the hSOD1 protein in the spinal cord of in the 3 AAV10-U7-hSOD1 injected mice compared to the controls (FIG. 7).

(42) The potential therapeutic effect of the AAV10-U7-hSOD1 vector was then investigated in ALS mice by a combined intravenous (IV) and intra-cerebroventricular (ICV) injections in presymptomatic SOD.sup.G93A mice in order to achieve both central and systemic hSOD1 reduction (injections at P1; n=4 with 610e14 vg/kg of AAV10-U7-hSOD1 and n=3 with the same dose of AAV10-U7-CTR).

(43) The survival of the four AAV10-U7-hSOD1 injected mice was significantly increased compared to control injected mice, the mean survival being of 260 days, versus 128 days in the non-injected controls (FIG. 7). This survival extent (up to 134%) is the highest reported to date in SOD1-linked ALS mice, suggesting the originality and superiority of our molecular approach.

(44) Conclusion

(45) This study is a translational project aimed at identifying strongly effective gene therapy treatments for familial ALS. Co-delivery of scAAV10 in the bloodstream and the CNS (Co-IV/ICV) is a powerful approach for widespread spinal cord and whole body gene delivery. The combination of Co-IV/ICV AAV10 gene transfer with the efficient exon-skipping strategy allows a strong silencing of hSOD1 and mediates the highest survival extent reported to date in ALS rodents. As a comparison, the Cleveland/ISIS clinical trial using brain infusion of ASOs is based on 9.1% extension in rat survival (Smith et al., 2006), and 38% increased survival has been recently published by the Kaspar's team using AAV9-shRNA (Foust et al., 2013).

(46) These preliminary results opens new realistic venues for even further increase in ALS mouse survival, and could be directly translated to clinical development in the next future.

(47) The results presented in example 1 showed that AAV10-U7-hSOD1 injection provided a considerable therapeutic benefit in SOD1.sup.G93A mice by silencing hSOD1.

Example 2: Erase-Replace Strategy

(48) The therapeutic benefit of AAV10-U7-hSOD1 delivery could be improved by further expression of the wild-type hSOD1 protein. Indeed, AAV10-U7-hSOD1 delivery, which does not target specifically the mutated form of the human SOD1 mRNA, could also induce silencing of the endogenous wild-type SOD1 protein, thereby triggering potential side-effects. Silencing of the endogenous wild-type SOD1 by AAV10-U7-hSOD1 could be compensated by introducing into this vector a wild-type SOD1 sequence comprising silent mutations in order to avoid exon skipping.

(49) The following section presents data in this regard.

(50) Materials and Methods

(51) Vectors

(52) The DNA sequences encoding for the hSOD1opt with the flag tag at the N terminal or the C terminal, were synthetized by Gene Art (Life technologies) and initially cloned by enzymatic digestion into an empty pAAV vector available in our laboratory carrying the phophoglycerate kinase (PGK) promoter, a chimeric 0 globin intron, a unique restriction site Nhe I, and the termination signal of the Simian Virus 40 (SV40). The cassette containing the hSOD1opt under the control of the PGK promoter was cloned by PCR into the pAAV-U7-SOD1 vector or the pAAV-U7-CTR, before the U7 promoter and in two directions. With the same method the PGK-GFP, amplified from a plasmid available in the laboratory, was inserted in each pAAV-U7, as control.

(53) Vector nomenclature is provided in the following table:

(54) TABLE-US-00003 Vector name Description Vectors for erase/replace strategy pAAV-U7-hSOD1-Flag- AAV-U7-hSDO1 co-expressing the PGK- hSOD1opt hSOD1opt with Flag at the N-Terminal end pAAV-U7-hSOD1- AAV-U7-hSOD1 co-expressing the PGK- hSOD1opt-Flag hSOD1opt with Flag at the C-Terminal end Control vectors pAAV-U7-CTR-Flag- AAV-U7-CTR co-expressing the PGK- hSOD1opt hSOD1opt with Flag at the N-Terminal vector pAAV-U7-CTR- AAV-U7-CTR co-expressingthe PGK- hSOD1opt-Flag hSOD1opt with Flag at the C-Terminal pAAV-U7-hSOD1-GFP AAV-U7-hSDO1 co-expressing the PGK-GFP pAAV-U7-hSOD1-GFP AAV-U7-CTR co-expressing the PGK-GFP

(55) Cells

(56) 2 g of each plasmids were transfected with the Lipofectamine and Plus Reagent (Life technologies) in OPTIMEM (Life technologies) medium without FBS (according to manufacturer's instructions). After 3 hours at 37 C. in 5% CO2, transfection was stopped with the addition of DMEM with 10% FBS.

(57) Western Blot Analysis

(58) Cells were harvested 48 h after transfection; protein lysates were prepared as described in example 1. Western blot was performed with the following antibodies: anti-Flag M2 (Sigma) and anti-actin (Sigma). Peroxidase-conjugated antisera to mouse and rabbit Igs were purchased from Amersham Pharmacia Biotech. Western blots were developed using the SuperSignal West Dura kit (Thermoscientific).

(59) Results

(60) To obtain both the suppression of the toxic mutated hSOD1 and the expression of a functional hSOD1 protein, we conceived an erase-replace strategy, in which the silencing pAAV-U7-hSOD1 vector was provided with an exogenous hSOD1 cDNA for wild-type SOD1 expression. The wild-type hSOD1-coding sequence (hSOD1 opt) was designed to carry a maximum number of mismatches with the antisense sequence in order to be refractory to the U7-antisense action (GeneArt, Life technologies). To allow the identification of the exogenous hSOD1protein, a Flag-tag peptide was fused to the cDNA. Since the C- or N-terminal position of the Flag could have effects on hSOD1opt expression and/or function this one was added either at the N-terminal (Flag-hSOD1opt) or at the C-terminal end (hSOD1opt-Flag) of the protein. The sequence was placed under the control of the phosphoglycerate kinase (PGK) promoter, in the same direction as the U7 promoter or in the opposite direction. The final therapeutic AAV vectors, AAV-U7-hSOD1-Flag-hSOD1opt and AAV-U7-hSOD1-Flag are shown in FIG. 9. A sequence encoding the green fluorescent protein (GFP), placed under the control of the PGK promoter, was also inserted into the pAAV-U7 vectors as control (pAAV-U7-hSOD1-GFP).

(61) To investigate whether these new AAV-U7 silencing vectors could simultaneously induce hSOD1 expression, human embryonic kidney (HEK-293T) cells were first transfected with pAAV-U7-hSOD1-GFP and GFP expression was investigated 48 hours later by live imaging with an epifluorescence microscope (FIG. 9b). The GFP fluorescence results indicated that the two vectors carrying both the U7 molecule (U7-SOD1 or U7-CTR) and the GFP expression cassette were efficient for protein production. Furthermore, the expression of the hSOD1opt, was assessed by western blot analysis for the flag tag in cell lysates 48 h after transfection (FIG. 9c), revealing the efficient synthesis of the tagged hSOD1opt protein.

(62) Collectively, these data showed that AONs inducing exon-skipping in a mutated form of the hSOD1 mRNA may be designed to strongly decrease hSOD1 protein levels, and that concomitant expression of exogenous hSOD1 protein can be carried out using an optimized coding sequence.

REFERENCES

(63) Aartsma-Rus, A., van Vliet, L., Hirschi, M., Janson, A. A., Heemskerk, H., de Winter, C. L., de Kimpe, S., van Deutekom, J. C., t Hoen, P. A., and van Ommen, G. J. (2009). Guidelines for antisense oligonucleotide design and insight into splice-modulating mechanisms. Mol Ther 17, 548-553. Betts, C., Saleh, A. F., Arzumanov, A. A., Hammond, S. M., Godfrey, C., Coursindel, T., Gait, M. J., and Wood, M. J. (2012). Pip6-PMO, A New Generation of Peptide-oligonucleotide Conjugates With Improved Cardiac Exon Skipping Activity for DMD Treatment. Molecular therapy Nucleic acids 1, e38. Boudreau, R. L., Rodriguez-Lebron, E., and Davidson, B. L. (2011). RNAi medicine for the brain: progresses and challenges. Hum Mol Genet 20, R21-27. Cartegni, L., Chew, S. L., and Krainer, A. R. (2002). Listening to silence and understanding nonsense: exonic mutations that affect splicing. Nat Rev Genet 3, 285-298. Cazzella, V., Martone, J., Pinnaro, C., Santini, T., Twayana, S. S., Sthandier, O., D'Amico, A., Ricotti, V., Bertini, E., Muntoni, F., et al. (2012). Exon 45 skipping through U1-snRNA antisense molecules recovers the Dys-nNOS pathway and muscle differentiation in human DMD myoblasts. Mol Ther 20, 2134-2142. Chan, J. H., Lim, S., and Wong, W. S. (2006). Antisense oligonucleotides: from design to therapeutic application. Clinical and experimental pharmacology & physiology 33, 533-540. Crooke, S. T. (2004). Antisense strategies. Current molecular medicine 4, 465-487. De Angelis, F. G., Sthandier, O., Berarducci, B., Toso, S., Galluzzi, G., Ricci, E., Cossu, G., and Bozzoni, I. (2002). Chimeric snRNA molecules carrying antisense sequences against the splice junctions of exon 51 of the dystrophin pre-mRNA induce exon skipping and restoration of a dystrophin synthesis in Delta 48-50 DMD cells. Proc Natl Acad Sci USA 99, 9456-9461. Dominguez, E., Marais, T., Chatauret, N., Benkhelifa-Ziyyat, S., Duque, S., Ravassard, P., Carcenac, R., Astord, S., Pereira de Moura, A., Voit, T., et al. (2011). Intravenous scAAV9 delivery of a codon-optimized SMN1 sequence rescues SMA mice. Hum Mol Genet 20, 681-693. Dorn, G., Patel, S., Wotherspoon, G., Hemmings-Mieszczak, M., Barclay, J., Natt, F. J., Martin, P., Bevan, S., Fox, A., Ganju, P., et al. (2004). siRNA relieves chronic neuropathic pain. Nucleic Acids Res 32, e49. Duque, S., Joussemet, B., Riviere, C., Marais, T., Dubreil, L., Douar, A. M., Fyfe, J., Moullier, P., Colle, M. A., and Barkats, M. (2009). Intravenous administration of self-complementary AAV9 enables transgene delivery to adult motor neurons. Mol Ther 17, 1187-1196. Foust, K. D., Salazar, D. L., Likhite, S., Ferraiuolo, L., Ditsworth, D., Ilieva, H., Meyer, K., Schmelzer, L., Braun, L., Cleveland, D. W., et al. (2013). Therapeutic AAV9-mediated Suppression of Mutant SOD1 Slows Disease Progression and Extends Survival in Models of Inherited ALS. Mol Ther. Gao, G., Vandenberghe, L. H., Alvira, M. R., Lu, Y., Calcedo, R., Zhou, X., and Wilson, J. M. (2004). Clades of Adeno-associated viruses are widely disseminated in human tissues. J Virol 78, 6381-6388. Gao, G. P., Alvira, M. R., Wang, L., Calcedo, R., Johnston, J., and Wilson, J. M. (2002). Novel adeno-associated viruses from rhesus monkeys as vectors for human gene therapy. Proc Natl Acad Sci USA 99, 11854-11859. Goyenvalle, A., Vulin, A., Fougerousse, F., Leturcq, F., Kaplan, J. C., Garcia, L., and Danos, O. (2004). Rescue of dystrophic muscle through U7 snRNA-mediated exon skipping. Science 306, 1796-1799. Gurney, M. E., Pu, H., Chiu, A. Y., Dal Canto, M. C., Polchow, C. Y., Alexander, D. D., Caliendo, J., Hentati, A., Kwon, Y. W., Deng, H. X., et al. (1994). Motor neuron degeneration in mice that express a human Cu,Zn superoxide dismutase mutation. Science 264, 1772-1775. Hu, C., Busuttil, R. W., and Lipshutz, G. S. (2010). RH10 provides superior transgene expression in mice when compared with natural AAV serotypes for neonatal gene therapy. The journal of gene medicine 12, 766-778. Ilieva, H., Polymenidou, M., and Cleveland, D. W. (2009). Non-cell autonomous toxicity in neurodegenerative disorders: ALS and beyond. J Cell Bio1187, 761-772. Kumar, P., Wu, H., McBride, J. L., Jung, K. E., Kim, M. H., Davidson, B. L., Lee, S. K., Shankar, P., and Manjunath, N. (2007). Transvascular delivery of small interfering RNA to the central nervous system. Nature 448, 39-43. Lundberg, M., Wikstrom, S., and Johansson, M. (2003). Cell surface adherence and endocytosis of protein transduction domains. Mol Ther 8, 143-150. Malhotra, M., Tomaro-Duchesneau, C., Saha, S., Kahouli, I., and Prakash, S. (2013). Development and characterization of chitosan-PEG-TAT nanoparticles for the intracellular delivery of siRNA. International journal of nanomedicine 8, 2041-2052. McCarty, D. M., Monahan, P. E., and Samulski, R. J. (2001). Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis. Gene Ther 8, 1248-1254. Miller, T. M., Pestronk, A., David, W., Rothstein, J., Simpson, E., Appel, S. H., Andres, P. L., Mahoney, K., Allred, P., Alexander, K., et al. (2013). An antisense oligonucleotide against SOD1 delivered intrathecally for patients with SOD1 familial amyotrophic lateral sclerosis: a phase 1, randomised, first-in-man study. Lancet neurology 12, 435-442. Pietri-Rouxel F., Gentil C, Vassilopoulos S, Baas D, Mouisel E, Ferry A, Vignaud A, Hour& C, Marty I, Schaeffer L, Voit T, Garcia L. et al. (2009) DHPR alphal S subunit controls skeletal muscle mass and morphogenesis. EMBO J 29, 643-654. Ralph, G. S., Radcliffe, P. A., Day, D. M., Carthy, J. M., Leroux, M. A., Lee, D. C., Wong, L. F., Bilsland, L. G., Greensmith, L., Kingsman, S. M., et al. (2005). Silencing mutant SOD1 using RNAi protects against neurodegeneration and extends survival in an ALS model. Nat Med 11, 429-433. Raoul, C., Abbas-Terki, T., Bensadoun, J. C., Guillot, S., Haase, G., Szulc, J., Henderson, C. E., and Aebischer, P. (2005). Lentiviral-mediated silencing of SOD1 through RNA interference retards disease onset and progression in a mouse model of ALS. Nat Med 11, 423-428. Reed, R., and Maniatis, T. (1988). The role of the mammalian branchpoint sequence in pre-mRNA splicing. Genes & development 2, 1268-1276. Rosen, D. R., Siddique, T., Patterson, D., Figlewicz, D. A., Sapp, P., Hentati, A., Donaldson, D., Goto, J., O'Regan, J. P., Deng, H. X., et al. (1993). Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature 362, 59-62. Schumperli, D., and Pillai, R. S. (2004). The special Sm core structure of the U7 snRNP: far-reaching significance of a small nuclear ribonucleoprotein. Cell Mol Life Sci 61, 2560-2570. Smith, R. A., Miller, T. M., Yamanaka, K., Monia, B. P., Condon, T. P., Hung, G., Lobsiger, C. S., Ward, C. M., McAlonis-Downes, M., Wei, H., et al. (2006). Antisense oligonucleotide therapy for neurodegenerative disease. J Clin Invest 116, 2290-2296. Wang, H., Yang, B., Qiu, L., Yang, C., Kramer, J., Su, Q., Guo, Y., Brown, R. H., Jr., Gao, G., and Xu, Z. (2013). Widespread spinal cord transduction by intrathecal injection of rAAV delivers efficacious RNAi therapy for amyotrophic lateral sclerosis. Hum Mol Genet. Ward, A. J., Norrbom, M., Chun, S., Bennett, C. F., and Rigo, F. (2014). Nonsense-mediated decay as a terminating mechanism for antisense oligonucleotides. Nucleic Acids Res 42, 5871-5879. Yamada, T., Das Gupta, T. K., and Beattie, C. W. (2013). p 28, an anionic cell-penetrating peptide, increases the activity of wild type and mutated p53 without altering its conformation. Molecular pharmaceutics 10, 3375-3383. Yang, B., Li, S., Wang, H., Guo, Y., Gessler, D. J., Cao, C., Su, Q., Kramer, J., Zhong, L., Seher Ahmed, S., et al. (2014). Global CNS Transduction of Adult Mice by Intravenously Delivered rAAVrh.8 and rAAVrh.10 and Nonhuman Primates by rAAVrh.10. Mol Ther. Zhang, H., Yang, B., Mu, X., Ahmed, S. S., Su, Q., He, R., Wang, H., Mueller, C., Sena-Esteves, M., Brown, R., et al. (2011). Several rAAV vectors efficiently cross the blood-brain barrier and transduce neurons and astrocytes in the neonatal mouse central nervous system. Mol Ther 19, 1440-1448.