Sophorolipid highly-productive mutant strain

10590428 ยท 2020-03-17

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided is a microorganism having high sophorolipid production capability. Disclosed is a sophorolipid-producing yeast mutant strain, in which a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2 or an amino acid sequence having at least 90% identity therewith, has been deleted or deactivated.

Claims

1. A sophorolipid-producing yeast mutant strain, in which a gene encoding a polypeptide consisting of the amino acid sequence of SEQ ID NO:2 has been deleted, wherein the sophorolipid-producing yeast is a microorganism of the genus Starmerella.

2. The mutant strain according to claim 1, wherein the mutant strain's sophorolipid productivity is greater than that of the mutant strain's parent strain.

3. A method for producing a sophorolipid-producing mutant yeast strain, the method comprising deleting a gene encoding a polypeptide consisting of the amino acid sequence of SEQ ID NO:2 in the sophorolipid-producing yeast strain wherein the sophorolipid-producing yeast is a microorganism of the genus Starmerella.

4. A method for increasing the sophorolipid production capability of a parent sophorolipid-producing yeast strain, the method comprising deleting a gene encoding a polypeptide consisting of the amino acid sequence of SEQ ID NO:2 in the parent sophorolipid-producing yeast strain, thereby producing a mutant strain, wherein the sophorolipid production capability of the mutant strain is greater than that of the parent strain and wherein the sophorolipid-producing yeast strain is a microorganism of the genus Starmerella.

5. A method for producing a sophorolipid, the method comprising culturing the sophorolipid-producing yeast mutant strain of claim 1.

6. The method according to claim 5, wherein the culturing is in a medium that comprises at least one substrate selected from the group consisting of a C12-C20 fatty acid, an alkyl ester of a C12-C20 fatty acid, a C12-C20 alkane, a C12-C20 alkene, a C12-C20 alkyne, a C12-C20 alcohol, a triacylglycerol, a diacylglycerol, a monoacylglycerol, a fat and an oil wherein the triacylglycerol, diacylglycerol, monoacylglycerol, fat and oil comprise a C12-C20 fatty acid or alkyl ester thereof.

7. The method according to claim 6, wherein the concentration of the substrate in the culture medium at the time of initiation of the culturing is from 1 to 30% (w/v).

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 illustrates an increase of the sophorolipid production capability in a Starmerella bombicola mutant strain in which the gene set forth in SEQ ID NO: 1 has been deleted (seq1 strain). PE: ethyl palmitate, SL: sophorolipids. Error bar=standard deviation (n=2).

(2) FIG. 2 illustrates the amount of sophorolipid produced by seq1 strain under the conditions of different ethyl palmitate concentrations. PE: ethyl palmitate, SL: sophorolipids. Error bar=standard deviation (n=2).

(3) FIG. 3 illustrates the amount of sophorolipid produced by seq1 strain in Jar Fermentor culture.

DETAILED DESCRIPTION OF THE INVENTION

(4) The present invention relates to a yeast mutant strain capable of producing sophorolipids with high efficiency, and a method for producing a sophorolipid using the yeast mutant strain.

1. Definition

(5) According to the present specification, the identity of nucleotide sequences and amino acid sequences is calculated according to the Lipman-Pearson method (Science, 1985, 227:1435-1441). Specifically, the identity is calculated by performing an analysis using the homology analysis program (Search Homology) of genetic information processing software, Genetyx-Win (Ver. 5.1.1; Software Development), with the unit size to compare (ktup) being set to 2.

(6) According to the present specification, the phrase at least 80% identity in connection with nucleotide sequences and amino acid sequences means identity of 80% or higher, preferably 85% or, higher, more preferably 90% or higher, even more preferably 95% or higher, even more preferably 98% or higher, even more preferably 99% or higher.

(7) According to the present specification, sophorolipid-producing yeast refers to a yeast having an capability to produce sophorolipids. Examples of the sophorolipid-producing yeast include Ascomycetes such as the genus Staermerella, the genus Candida, and the genus Wickerhamiella, and preferred examples include Starmerella bombicola, Candida bogoriensis, Candida batistae, Candida apicola, and Wickerhamiella domericqiae. A more preferred example may be Starmerella bombicola.

(8) The polypeptide that is deleted or deactivated in the sophorolipid-producing yeast mutant strain of the present invention is a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2, or a polypeptide equivalent thereto. The polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2 has a Zinc Finger C2H2 type DNA-binding domain respectively at amino acid residues 101 to 123 and 129 to 152, and it is speculated that the polypeptide functions as a transcription factor. As a result of retrieval in the SGD (Saccharomyces Genome Database) and Swiss Prot databases, a protein having the highest homology with the polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2 was a protein having a zinc finger domain and a BTB domain, referred to as Xenopus tropicalis-derived ZBTBA; however, the coverage for the amino acid sequence set forth in SEQ ID NO:2 was 11.1%, while the sequence identity was low, such as 39%. The polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2 may be considered as a novel protein that has not been known hitherto.

(9) According to the present specification, the polypeptide equivalent to a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2 is a polypeptide consisting of an amino acid sequence having at least 80% identity with the amino acid sequence set forth in SEQ ID NO:2. Preferably, the polypeptide equivalent to a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 is a putative transcription factor protein, and more preferably a putative transcription factor protein having two Zinc Finger C2H2 type DNA-binding domains.

(10) According to the present specification, the gene encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2 is preferably a gene consisting of the nucleotide sequence set forth in SEQ ID NO: 1.

(11) According to the present specification, the gene equivalent to a gene encoding the polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2 is a gene consisting of a nucleotide sequence having at least 80% identity with the nucleotide sequence set forth in SEQ ID NO:1 and encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2 or a polypeptide equivalent thereto.

2. Sophorolipid-Producing Yeast Mutant Strain

(12) The inventors of the present invention found that a sophorolipid-producing yeast in which expression of a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2 has been suppressed or the peptide has been deactivated, increases its sophorolipid production capability.

(13) The present invention provides a yeast mutant strain having high sophorolipid production capability. According to the yeast mutant strain of the present invention, sophorolipids can be produced efficiently.

(14) The phorolipid-producing yeast mutant strain of the present invention is a mutant strain in which a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2, or a polypeptide equivalent thereto has been deleted or deactivated. Preferably, the sophorolipid-producing yeast mutant strain of the present invention is a mutant strain produced by deleting or deactivating a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2, or a polypeptide equivalent thereto, in a sophorolipid-producing yeast by artificial modification.

(15) Preferably, the yeast mutant strain of the present invention is a mutant strain in which expression of a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2, or a polypeptide equivalent thereto, is suppressed, as compared to the strain before mutation (parent strain). According to an embodiment, the mutant strain of the present invention may be a mutant strain in which the amount of an expressed polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2, or polypeptide equivalent thereto, has been decreased to 50% or less, preferably 40% or less, more preferably 30% or less, even more preferably 20% or less, even more preferably 10% or less, even more preferably 5% or less, as compared to the parent strain. The amount of an expressed protein or polypeptide can be measured by a conventionally used method for quantitatively determining expression of a protein, for example, by measurement of the amount of mRNA through quantitative PCR, a colorimetric determination method, a fluorescence method, Western blotting, ELISA, or radioimmunoassay, without being limited to these.

(16) Examples of means for deletion or deactivation of a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2, or a polypeptide equivalent thereto, include a method of deleting or deactivating genes encoding those polypeptides, a method of suppressing the translation of mRNA of the genes encoding those polypeptides, and a method of mutating the genes encoding those polypeptides to thereby lower the activity of the polypeptides. Therefore, according to an embodiment, the sophorolipid-producing yeast mutant strain of the present invention is a mutant strain in which a gene encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2, or a gene equivalent thereto, has been deleted or deactivated.

(17) Examples of means for deleting or deactivating a gene of a yeast cell include introduction of mutation (deletion, insertion, substitution, or addition) to one or more nucleotides on the nucleotide sequence of the target gene, substitution or insertion of another nucleotide sequence into the nucleotide sequence, or deletion of a portion or the entirety of the nucleotide sequence. Alternatively, similar introduction of mutation, or similar substitution, insertion or deletion of a nucleotide sequence may also be carried out with regard to control regions such as a promoter region of the target gene. For example, the target gene can be deactivated by lowering or eliminating the promoter activity by means of introduction of mutation to a promoter that controls expression of the target gene, or substitution with a promoter of lower expression. Genetic mutation that lowers the activity of a polypeptide can be carried out by, for example, introduction of mutation as described above. The suppression of translation of mRNA can be carried out by, for example, RNA interference using siRNA.

(18) Regarding a specific technique for the introduction of mutation or the substitution, insertion or deletion of a nucleotide sequence, a method for genetic modification of a microorganism that is known in the pertinent art can be used. Examples of the method include, but are not limited to, ultraviolet irradiation, introduction of a site-specific mutation, and homologous recombination method using the SOE-PCR method (splicing by overlap extension PCR; Gene, 1989, 77:61-68).

(19) After the introduction of mutation, or substitution, insertion or deletion of a nucleotide sequence, a genetic analysis is carried out or the amount of an expressed polypeptide encoded by the target gene or the activity thereof is evaluated, and cells having the desired mutation are selected, to thereby obtain the mutant strain of the present invention.

(20) Alternatively, in a case where the means for deleting or deactivating a gene or a control region is the homologous recombination method using SOE-PCR, a mutant strain having the target gene or the control region deleted therefrom can be obtained by incorporating a drug resistance marker gene into a DNA fragment for gene deletion that substitutes the target gene DNA, culturing, on a medium including a drug, cells into which a DNA fragment for deletion has been introduced, and isolating growing colonies. Furthermore, mutation may also be checked by carrying out the genetic analysis or evaluating the amount of the polypeptide expressed or activity of the polypeptide as described above. By following the procedure described above, the yeast mutant strain of the present invention in which a gene encoding a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2, or a gene equivalent thereto, has been deleted or deactivated can be obtained.

(21) Alternatively, the yeast mutant strain of the present invention in which a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: or a polypeptide equivalent thereto has been deleted or deactivated can be obtained by checking increase of the sophorolipid production capability in the yeast mutant strain produced by the procedure described above.

3. Increase of Sophorolipid Production Capability in Mutant Strain

(22) The sophorolipid-producing yeast mutant strain of the present invention that is produced by deleting or deactivating a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO: 2, or a polypeptide equivalent thereto, has increased sophorolipid production capability, as compared to the strain before mutation (parent strain). Therefore, an embodiment of the present invention may be a method for increasing the sophorolipid production capability of a sophorolipid-producing yeast, the method comprising deleting or deactivating a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2, or a polypeptide equivalent thereto, in a sophorolipid-producing yeast.

4. Production of Sophorolipids

(23) The sophorolipid-producing yeast mutant strain of the present invention has increased sophorolipid production capability. Furthermore, the sophorolipid-producing yeast mutant strain of the present invention can produce sophorolipids using, for example, hydrocarbon chains and fatty acids having various chain lengths as substrates. Therefore, when the sophorolipid-producing yeast mutant strain of the present invention is cultured together with a substrate having an appropriate chain length, the yeast mutant strain can of efficiently produce a sophorolipid including a constituent fatty acid having a desired chain length. Therefore, the present invention also provides a method for producing a sophorolipid, the method comprising culturing the sophorolipid-producing yeast mutant strain of the present invention.

(24) In the method for producing a sophorolipid of the present invention, the mutant strain of the present invention is cultured in a medium including substrates such as a fatty acid, a fatty acid alkyl ester, an alkane, an alkene, an alkyne, an alcohol, a triacylglycerol, a diacylglycerol, a monoacylglycerol, and a fat or oil. Sophorolipids are collected from the medium after culturing and are appropriately purified as necessary, and thereby sophorolipids can be produced.

(25) Regarding the medium used for the culture, any conventional medium containing a carbon source, a nitrogen source, an inorganic salt, and if necessary, organic trace nutrients such as amino acids and vitamins, can be used. The medium may be any of a synthetic medium and a natural medium.

(26) The carbon source and the nitrogen source included in the medium may be any type of material that can be utilized by the mutant strain to be cultured. Examples of the carbon source include saccharides such as glucose, glycerol, fructose, sucrose, maltose, mannose, galactose, starch hydrolysate, and malt; organic acids such as acetic acid and citric acid; and alcohols such as ethanol. These carbon sources can be used singly or in combination of two or more kinds thereof. Examples of the nitrogen source include ammonia; ammonium salts such as ammonium sulfate, ammonium carbonate, ammonium chloride, ammonium phosphate, and ammonium acetate; and nitrates.

(27) Examples of the inorganic salt include phosphates, magnesium salts, calcium salts, iron salts, and manganese salts. Examples of the organic trace nutrients include amino acids, vitamins, fatty acids, nucleic acids, and peptones, casamino acids, yeast extracts and soybean protein degradation products that contain the amino acids, vitamins, fatty acids, and nucleic acids. In a case where an auxotrophic mutant strain that requires, for example, amino acids for growth is used, it is preferable that the required nutrients are added as supplements.

(28) Preferred examples of the substrate that can be incorporated into the medium include C12-20 fatty acids and alkyl esters thereof, C12-20 alkanes, C12-20 alkenes, C12-20 alkynes, C12-20 alcohols; triacylglycerols, diacylglycerols and monoacylglycerols, each containing C12-20 fatty acids or alkyl esters thereof; and fats or oils containing C12-20 fatty acids or alkyl esters thereof. More preferred examples include C12-18 fatty acids and alkyl esters thereof, C12-18 alkanes, C12-18 alkenes, C12-18 alkynes, C12-18 alcohols; triacylglycerols, diacylglycerols and monoacylglycerols, each containing C12-C18 fatty acids or alkyl esters thereof; and fats or oils containing C12-C18 fatty acids or alkyl esters thereof. Even more preferred examples include C12-C18 fatty acids and alkyl esters thereof.

(29) More specific examples of the substrate, which are not limiter, include, as the C12-20 fatty acids, dodecanoic acid (lauric acid), tridecanoic acid, tetradecanoic acid (myristic acid), pentadecaonic acid (pentadecyl acid), hexadecanoic acid (palmitic acid), hexadecenoic acid, heptadecanoic acid (margaric acid), octadecanoic acid (stearic acid), octadecenoic acid, octadecadienoic acid, octadecatrienoic acid, nonadecanoic acid, eicosanoic acid, eicosadienoic acid, eicosatrienoic acid, and eicosatetraenoic acid; as the C12-20 alkanes, alkenes, alkynes and alcohols, dodecane, tridecane, tetradecane, pentadecane, hexadecane hexadecene, heptadecane, octadecane, octadecene, octadecyne, nonadecane, eicosane, eicosene, eicosyne, dodecanol, tridecanol, tetradecanol, pentadecanol, hexadecanol, hexadecenal, heptadecanol, octadecanol, octadecenol, octadecynol, nonadecanol, and eicosanol; and as the fats or oils containing C12-20 fatty acids or alkyl esters thereof, coconut oil, palm oil, palm kernel oil, olive oil, rapeseed oil, rice bran oil, soybean oil, castor oil, and mahua oil.

(30) Examples of the fatty acid alkyl esters include alkyl esters of the fatty acids mentioned above wherein the alkyl moiety has 1 to 4 carbon atoms, and preferred examples include methyl esters and ethyl esters.

(31) The substrates mentioned above can be used singly or in combination of two or more kinds thereof. Preferably, a fatty acid having any chain length between C12 and C18; an alkyl ester thereof; a triacylglycerol, a diacylglycerol, a monoacylglycerol, or fats or oils, each containing the fatty acid or an alkyl ester thereof, or an alkane, an alkene, an alkyne, or an alcohol, each having any chain length between C12 and 18, is used. More preferably, a fatty acid having any chain length between C12 and C18, or an alkyl ester thereof is used.

(32) The content of the substrate (at the time of initiation of culturing) that can be included in the medium is preferably 1% by mass or more, more preferably 3% by mass or more, even more preferably 5% by mass or more, and is preferably 30% by mass or less, more preferably 20% by mass or less, even more preferably 15% by mass or less. Alternatively, the content is preferably from 1% to 30% by mass, from 1% to 20% by mass, from 1% to 15% by mass, from 3% to 30% by mass, from 3% to 20% by mass, from 3% to 15% by mass, from 5% to 30% by mass, from 5% to 20% by mass, or from 5% to 15% by mass.

(33) The culture conditions may be any conditions in which sophorolipids are fermentatively produced by the mutant strain of the present invention. Culturing is preferably carried out under aerobic conditions, and general methods such as aerated and agitated culture and shaking culture can be applied. The culturing temperature is preferably from 20 C. to 33 C., more preferably from 25 C. to 30 C., even more preferably from 28 C. to 30 C. The initial pH (30 C.) of the medium is preferably from 2 to 7, more preferably from 3 to 6. The culturing time is preferably about from 24 hours to 200 hours, more preferably from 50 to 200 hours.

(34) In regard to the culture described above, sophorolipids may be produced fermentatively by culturing the mutant strain of the present invention under the conditions that enables proliferation of cells, and sophorolipids may also be produced fermentatively by culturing the mutant strain of the present invention in the state of a resting cell, that is, in a state in which growth and proliferation has been stopped.

(35) The method of collecting sophorolipids from the medium after culturing is not particularly limited, and collection may be performed according to any known collecting method. For example, the sophorolipids in the medium can be collected or purified by performing, for example, solvent extraction using, for example, ethyl acetate, fractional precipitation, liquid-liquid partition, column chromatography, high performance liquid chromatography, singly or in appropriate combination.

5. Exemplary Embodiments

(36) As exemplary embodiments of the present invention, for example, the following substances, production methods, use, and methods will be further disclosed in the present specification. However, the present invention is not intended to be limited to these embodiments.

(37) [1] A sophorolipid-producing yeast mutant strain, in which a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2 or an amino acid sequence having at least 80% identity with that sequence has been deleted or deactivated.

(38) [2] The mutant strain according to [1], wherein the polypeptide consisting of an amino acid sequence having at least 80% identity with the amino acid sequence set forth in SEQ ID NO:2 is preferably a putative transcription factor protein.

(39) [3] The mutant strain according to [1] or [2], preferably, in which a gene encoding the polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2, or a gene equivalent thereto has been deleted or deactivated.

(40) [4] The mutant strain according to [3], wherein preferably,

(41) the gene encoding the polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2 is a gene consisting of the nucleotide sequence set forth in SEQ ID NO:1, and the equivalent gene is a gene consisting of the nucleotide sequence having at least 80% identity with the nucleotide sequence set forth in SEQ ID NO:1 and encoding a polypeptide consisting of an amino acid sequence having at least 80% identity with the amino acid sequence set forth in SEQ ID NO:2.

(42) [5] The mutant strain according to any one of [1] to [4], wherein the amount of the expressed polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2 or an amino acid sequence having at least 80% identity with that sequence, has been decreased to preferably 50% or less, more preferably 40% or less, even more preferably 30% or less, even more preferably 20% or less, even more preferably 10% or less, even more preferably 5% or less, as compared to the parent strain.

(43) [6] The mutant strain according to any one of [1] to [5], wherein the at least 80% identity is identity of preferably 85% or higher, more preferably 90% or higher, even more preferably 95% or higher, even more preferably 98% or higher, even more preferably 99% or higher.

(44) [7] The mutant strain according to any one of [1] to [6], wherein

(45) the sophorolipid-producing yeast is preferably a microorganism of the genus Starmerella, more preferably Starmerella bombicola.

(46) [8] The mutant strain according to any one of [1] to [7], wherein the mutant strain has increased sophorolipid productivity, as compared to the strain before mutation.

(47) [9] A method for producing a sophorolipid-producing yeast mutant strain, the method comprising deleting or deactivating a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2 or an amino acid sequence having at least 80% identity with that sequence, in a sophorolipid-producing yeast.

(48) [10] A method for increasing sophorolipid production capability of a sophorolipid-producing yeast, the method comprising deleting or deactivating a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2 or an amino acid sequence having at least 80% identity with that sequence, in a sophorolipid-producing yeast.

(49) [11] The method according to [9] or [10], wherein the polypeptide consisting of an amino acid sequence having at least 80% identity with the amino acid sequence set forth in SEQ ID NO:2 is preferably a putative transcription factor protein.

(50) [12] The method according to any one of [9] to [11], preferably comprising deleting or deactivating a gene encoding the polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2, or a gene equivalent thereto.

(51) [13] The method according to [12], wherein preferably,

(52) the gene encoding the polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2 is a gene consisting of the nucleotide sequence set forth in SEQ ID NO:1, and

(53) the equivalent gene is a gene consisting of a nucleotide sequence having at least 80% identity with the nucleotide sequence set forth in SEQ ID NO:1 and encoding a polypeptide consisting of an amino acid sequence having at least 80% identity with the amino acid sequence set forth in SEQ ID NO:2.

(54) [14] The method according to any one of [9] and [11] to [13], wherein the sophorolipid-producing yeast mutant strain is a strain in which the amount of the expressed polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2 or an amino acid sequence having at least 80% identity with that sequence, has been decreased to preferably 50% or less, more preferably 40% or less, even more preferably 30% or less, even more preferably 20% or less, even more preferably 10% or less, even more preferably 5% or less, as compared to the parent strain.

(55) [15] The method according to any one of [9] to [14], wherein the at least 80% identity is identity of preferably 85% or higher, more preferably 90% or higher, even more preferably 95% or higher, even more preferably 98% or higher, even more preferably 99% or higher.

(56) [16] The method according to any one of [9] to [15], wherein

(57) the sophorolipid-producing yeast is preferably a microorganism of the genus Starmerella, more preferably Starmerella bombicola.

(58) [17] The method according to any one of [9] and [11] to [16], wherein the sophorolipid-producing yeast mutant strain is a mutant strain having increased sophorolipid productivity.

(59) [18] A method for producing a sophoroliplid, the method comprising culturing the sophorolipid-producing yeast mutant strain according to any one of [1] to [8].

(60) [19] The method according to [18], wherein a medium for the culturing preferably comprises the following substrate:

(61) at least one substrate selected from the group consisting of C12-C20 fatty acids and alkyl esters thereof, C12-C20 alkanes, C12-C20 alkenes, C12-C20 alkynes, C12-C20 alcohols, triacylglycerols, diacylglycerols and monoacylglycerols, each comprising C12-C20 fatty acids or alkyl esters thereof, and fats or oils comprising C12-C20 fatty acids or alkyl esters thereof;

(62) at least one substrate selected from the group consisting of C12-C18 fatty acids and alkyl esters thereof, C12-C18 alkanes, C12-C18 alkenes, C12-C18 alkynes, C12-C18 alcohols, triacylglycerols, diacylglycerols and monoacylglycerols, each comprising C12-C18 fatty acids or alkyl esters thereof, and fats or oils comprising C12-C18 fatty acids or alkyl esters thereof; or

(63) at least one substrate selected from the group consisting of C12-18 fatty acids and alkyl esters thereof.

(64) [20] The method according to [19], wherein the content of the substrate in the medium is:

(65) preferably 1% by mass or more, more preferably 3% by mass or more, even more preferably 5% by mass or more, and is preferably 30% by mass or less, more preferably 20% by mass or less, even more preferably 15% by mass or less, or

(66) preferably from 1% to 30% by mass, from 1% to 20% by mass, from 1% to 15% by mass, from 3% to 30% by mass, from 3% to 20% by mass, from 3% to 15% by mass, from 5% to 30% by mass, from 5% to 20% by mass, or from 5% to 15% by mass.

(67) [21] The method according to anyone of [18] to [20], wherein the method further comprises collecting sophorolipids from the medium after the culturing.

EXAMPLES

(68) Hereinafter, the present invention will be more specifically described by way of Examples.

Example 1 Production of Gene-Deleted Mutant Strain

(69) (1) Establishment of Fragment for Gene Deletion

(70) A mutant strain in which a gene consisting of the nucleotide sequence set forth in SEQ ID NO:1 had been deleted was produced by a homologous recombination method using SOE-PCR.

(71) A hygromycin-resistant gene (SEQ ID NO:3) was used for the selection of transformant. A hygromycin-resistant gene fragment was produced by PCR using plasmid loxP-PGK-gb2-hygro-loxP (Gene Bridges) having a hygromycin-resistant gene as a template, and using primers of SEQ ID NO:8 and SEQ ID NO:9. Fragments of a promoter and a terminator of URA3 gene were produced by PCR using the genome of Starmerella bombicola as a template, and using primers of SEQ ID NO:10 and SEQ ID NO:11, and primers of SEQ ID NO:12 and SEQ ID NO:13, respectively. The hygromycin-resistant gene fragment was ligated to the promoter fragment and the terminator fragment of URA3 gene by SOE-PCR.

(72) A fragment for deleting the gene set forth in SEQ ID NO:1 was produced. Using the genome of Starmerella bombicola as a template, a fragment in the upstream region of the gene set forth in SEQ ID NO:1 was produced by PCR using primers of SEQ ID NO:4 and SEQ ID NO:5, and a fragment in the downstream region was produced by PCR using primers of SEQ ID NO:6 and SEQ ID NO:7. Furthermore, a hygromycin-resistant gene fragment including a promoter fragment and a terminator was produced by PCR using the SOE-PCR product as a template and using primers of SEQ ID NO:10 and SEQ ID NO:13. Three fragments, namely, the upstream region fragment and the downstream region fragment thus obtained, and the hygromycin-resistant gene fragment, were ligated by SOE-PCR. The fragment thus obtained was used as a fragment for deletion of the gene set forth in SEQ ID NO:1.

(73) TABLE-US-00001 TABLE1 SEQID NO. Primername Sequence(5.fwdarw.3) 4 seq1upFw TCCAATTTCTAAGGCGCAAGCGACGCTTCT 5 seq1upRv GTTGCGAGCTGTTTCGAAAATCAATTGGTAAGAGGGAACGCGTAGCGAAG 6 seq1doFw TGTATAGTGACGATGATGAAATTGTTGTCCGAATGCTCTGCGACGGCTCC 7 seq1doRv CAACCCAACGCCTTGACAAGCTTTCCAAAT 8 Hyg-fw CACTACTGTAGAGAAATAATATGAAAAAGCCTGAACTCAC 9 Hyg-re GAAGGAACTGTTTGAGAAAATTATGAACAAACGACCCAAC 10 pURA3-fw TTTTCGAAACAGCTCGCAACGATC 11 pUra3-re GTGAGTTCAGGCTTTTTCATATTATTTCTCTACAGTAGTG 12 tURA3-fw GTTGGGTCGTTTGTTCATAATTTTCTCAAACAGTTCCTTC 13 tURA3-re TTCATCATCGTCACTATACACATC

(74) (2) Production of Gene Deletion Strain

(75) One platinum loop of Starmerella bombicola was inoculated into a 100-mL type test tube containing 5 mL of YPD Broth, and the cells were cultured for 48 hours at 30 C. and 250 rpm. The culture fluid thus obtained was inoculated in an amount of 1% (v/v) into a Sakaguchi flask containing 50 mL of YPD medium, and the cells were cultured at 30 C. and 120 rpm until an OD600 value of 1 to 2 was obtained. The proliferated cells were centrifuged for 5 minutes at 3,000 rpm and 4 C. to collect the cells, and then the cells were washed twice with 20 mL of sterilized water that had been chilled on ice. The cells were suspended in 1 mL of an ice-cooled 1 M sorbitol solution, and the suspension was centrifuged for 5 minutes at 5,000 rpm and 4 C. The supernatant was discarded, subsequently 400 L of a 1 M sorbitol solution was added to the residue, the mixture was placed on ice, and the mixture was suspended by pipetting. This yeast suspension was dispensed into 50 L each, and 1 g of a DNA solution for transformation (including the fragment for deletion of the gene set forth in SEQ ID NO:1) was added to the yeast suspension. The mixture was transferred into an ice-cooled chamber having a 0.2 cm gap. Subsequently, a pulse of 25 F, 350, and 2.5 kV was applied to the mixture using a GENE PULSER II (Bio-Rad). An ice-cooled 1 M sorbitol-containing YPD Broth was added to the mixture to which a pulse had been applied, the mixture was transferred into a tube having a capacity of 1.5 mL, and the mixture was shaken for 2 hours at 30 C. Subsequently, the mixture was centrifuged for 5 minutes at 5,000 rpm and 4 C., to thereby collect the cells. The cells thus collected were resuspended in 200 L of a 1 M sorbitol solution, 100 L each of the suspension was smeared on a selective medium, and the cells were cultured for about one week at 30 C. For the selective medium, an agar medium containing 1% (w/v) of an yeast extract, 2% (w/v) of peptone, 2% (w/v) of glucose, and 500 ppm of hygromycin was used. Colonies that had grown were subjected to colony PCR, it was confirmed that the sequence length amplified from the region of the deletion target gene was changed, and thus a mutant strain in which the gene set forth in SEQ ID NO:1 had been deleted (seq1 strain) was obtained.

Example 2 Sophorolipid Productivity of Seq1 Strain

(76) (1) Culture of Mutant Strain

(77) 5 mL of a medium containing 1% (w/v) of a yeast extract that had been sterilized in advance, 2% (w/v) of peptone, and 2% (w/v) of glucose was introduced into a large-sized test tube, and one platinum loop of any one of the seq1 strain obtained in Example 1 and its parent strain was inoculated into the medium. The cells were subjected to shaking culture for 48 hours at 30 C. and 250 rpm, and this was used as a seed culture fluid. The seed culture fluid was inoculated at a concentration of 1% (v/v) into 5 mL of a mixed medium containing 2% (w/v) of a yeast extract, 5% (w/v) of ethyl palmitate, and 12.5% (w/v) of glucose, and shaking culture was carried out for 96 hours at 30 C. and 250 rpm.

(78) (2) Evaluation of Sophorolipid Productivity

(79) After completion of the culturing, ethyl palmitate (PE) and sophorolipids (SL) in the culture fluid were extracted, and the amounts thereof were measured. For the extraction of PE, first, the entire amount of the culture fluid in the large-sized test tube cultured in section (1) was transferred into a Falcon tube (Greiner), subsequently 4 mL of hexane was added to the large-sized test tube and stirred by vortexing for 5 seconds, and the entire amount was transferred to the same Falcon tube. The liquids were thoroughly mixed by vortexing for 5 seconds, and subsequently the liquid was centrifuged for 5 minutes at 3,000 rpm and 25 C. The entire amount of the hexane fraction of the supernatant was collected into a glass tube using a Pasteur pipette. Hexane extraction as described above was repeated once for the remaining liquid, and thereby the entire amount of PE was extracted. For the extraction of SL, 6 mL of ethyl acetate was added to the large-sized test tube that had been used for the culturing in section (1), the mixture was vortexed for 5 seconds, and the entire amount was collected into a Falcon tube. Subsequently, the liquid was centrifuged for 5 minutes at 3,000 rpm and 25 C., and the entire amount of the ethyl acetate fraction of the supernatant was collected into a fresh glass tube using a Pasteur pipette.

(80) Hexane or ethyl acetate was volatilized from the hexane fraction or the ethyl acetate fraction thus collected, by spraying nitrogen gas, and thus dissolved PE or SL was extracted. The difference between the weight of the glass tube containing PE or SL thus extracted, and the weight of the glass tube before collection, was calculated as the amount of PE or the amount of SL in the culture fluid.

(81) The result is presented in FIG. 1. Furthermore, the relative value of sophorolipid productivity of the seq1 strain in the case of designating the sophorolipid productivity of the parent strain as 100%, is presented in Table 2. The seq1 strain showed increased sophorolipid productivity, as compared to the parent strain.

(82) TABLE-US-00002 TABLE 2 Relative amount of SL produced Parent strain 100% seq1 strain 170%

Example 3 Sophorolipid Productivity of Seq1 Strain Under Conditions of Different Ethyl Palmitate Concentrations

(83) seq1 strain and its parent strain were cultured by a procedure similar to that of Example 2, and the amounts of ethyl palmitate and sophorolipids in the culture fluid were measured. However, the amount of ethyl palmitate in the mixed medium was adjusted to 0, 1, 5, or 10% (w/v).

(84) The result is presented in FIG. 2. The relative values of sophorolipid productivity of seq1 strain in the case of designating the sophorolipid productivity of the parent strain at various ethyl palmitate concentrations as 100%, are presented in Table 3. The seq1 strain showed increased sophorolipid productivity, as compared to the parent strain, regardless of the concentration of ethyl palmitate that served as a substrate for sophorolipids. Furthermore, the seq1 strain showed higher sophorolipid productivity than the parent strain, even in a medium without any ethyl palmitate added thereto.

(85) TABLE-US-00003 TABLE 3 PE0% PE1% PE5% PE10% Parent strain 100% 100% 100% 100% seq1 strain 151% 182% 178% 180%

Example 4 Sophorolipid Productivity of Seq1 Strain in Jar Fermentor Culture

(86) A medium containing 2% (w/v) of a yeast extract that had been sterilized in advance and 1% (w/v) of glucose was introduced into a 30-mL Sakaguchi flask, and one platinum loop of seq1 strain obtained in Example 1 or the parent strain was inoculated into the medium. Reciprocal shaking culture was carried out for 48 hours at 30 C. and 120 rpm, and this was used as a seed culture fluid. 1,200 mL of a mixed medium containing 2% (w/v) of an yeast extract, 5% (w/v) of ethyl palmitate, 12.5% (w/v) of glucose, and 0.1% (w/v) of urea was introduced into a 2-L Jar Fermentor incubator, and the seed culture fluid was inoculated into this mixed medium at a concentration of 1% (v/v). Culturing was carried out for 168 hours at 30 C. and 800 rpm. After 96 hours of culturing, 5% (w/v) of ethyl palmitate and 10% (w/v) of glucose were fed into the incubator.

(87) The culture fluid was sampled at a suitable time, and the amounts of ethyl palmitate (PE) and sophorolipids (SL) in the culture fluid were measured. For the measurement of the amount of PE or SL, about 5 mL of the culture fluid was collected into a Falcon tube (Greiner), and then the entire amount of PE or SL was collected in a glass tube by a procedure similar to that of Example 2. The amount of PE or SL per kg of the culture fluid was calculated from the difference between the weights of the glass tube before and after the collection.

(88) The result is presented in FIG. 3. Furthermore, the relative value of sophorolipid productivity of seq1 strain at the 168.sup.th hour of culturing in the case of designating the sophorolipid productivity of the parent strain for the same culturing time as 100%, is presented in Table 4. The seq1 strain showed increased sophorolipid productivity, as compared to the parent strain, even in the case of culturing in a large quantity using a Jar Fermentor.

(89) TABLE-US-00004 TABLE 4 Relative amount of SL produced (at 168.sup.th hour) Parent strain 100% seq1 strain 139%