IMMUNOMODULATORY CLINICAL BIOMARKER PROFILES AND USES THEREOF
20240027460 ยท 2024-01-25
Assignee
- Seattle Children's Hospital d/b/a Seattle Children's Research Institute (Seattle, WA, US)
- Battelle Memorial Institute (Richland, WA)
Inventors
- Heather Gustafson (Seattle, WA, US)
- Rebecca Gardner (Seattle, WA, US)
- Bobbie-Jo M. Webb-Robertson (Seattle, WA, US)
- Katelyn BURLEIGH (Seattle, WA, US)
Cpc classification
G01N33/6863
PHYSICS
International classification
Abstract
The present disclosure relates to biomarker profiles and their use to predict a subject's response to an immunomodulatory treatment. Biomarkers in these profiles include cytokines and other proteins associated with the interleukin 1 family and the type 1 interferon family. Particular biomarkers include interleukin (IL)-2, soluble IL-2 receptor alpha (sIL-2RA), IL-5, IL-6, IL-9, IL-10, IL-18, IL-18 binding protein (IL-18BP), IL-18 receptor 1 (IL-18R1), IL-18 receptor accessory protein (IL-18RAP), IL-22, C-type lectin-like receptor (CD161), CD56, interferon gamma (IFN), granulocyte macrophage colony stimulating factor (GM-CSF), serum amyloid A (SAA), and C-reactive protein (CRP). Particular biomarkers also include populations of cells including CD161+ cells and CD56+dim cells. The biomarker profiles can be used to predict a subject's responsiveness to an immunomodulatory treatment (e.g., immunotherapy) before or after an immunomodulatory treatment has initiated and to direct treatment to yield responsive and non-toxic outcomes to the immunomodulatory treatment.
Claims
1. A method of selecting a therapeutic agent to administer to a subject, comprising obtaining a biological sample derived from a subject; measuring a level of at least one biomarker selected from the group consisting of interleukin (IL)-18; IL-18 binding protein (IL-18BP), interferon gamma (IFN), and CD161+ cells to generate a test biomarker profile; comparing the test biomarker profile to a reference biomarker profile comprising the level(s) of the same biomarker(s); and identifying the subject as having or predicting that the subject will have a toxic response and/or non-response to an immunomodulatory treatment when the test biomarker profile comprises increased levels of the at least one biomarker as compared to the reference biomarker profile; and selecting a therapeutic agent to administer to the subject.
2. The method of claim 1, wherein the reference biomarker profile is from a subject or a population of subjects having a functional response to the immunomodulatory treatment with limited or no neurotoxicity (NTX).
3. The method of claim 1, wherein the biological sample comprises a blood sample and/or a cell sample.
4. The method of claim 1, wherein the biological sample is obtained before the immunomodulatory treatment has initiated, and wherein the at least one biomarker is selected from IL-18BP and/or CD161+ cells.
5. The method of claim 1, wherein the biological sample is obtained 1 day, 3 days, and/or 7 days after the immunomodulatory treatment has initiated, and wherein the at least one biomarker is selected from the group consisting of IL-18, IL-18BP, and IFN.
6. The method of claim 1, wherein the immunomodulatory treatment comprises administration of chimeric antigen receptor (CAR) T cell immunotherapy and the therapeutic agent comprises: an anti-CD161 antibody, an anti-IL-18 antibody, an anti-IFN antibody, an IL-18BP, or a combination thereof.
7. The method of claim 1, wherein the immunomodulatory treatment comprises administration of chimeric antigen receptor (CAR) T cell immunotherapy, and wherein the method further comprises removing CD161+ cells from an apheresis product obtained from the subject prior to the immunomodulatory treatment to produce an apheresis product reduced in CD161+ cells.
8. The method of claim 7, wherein the method further comprises contacting the apheresis product obtained from the subject with an anti-CD161 antibody.
9. A method for generating a test biomarker profile comprising: obtaining a biological sample derived from a subject; measuring a level of (A) at least one biomarker selected from the group consisting of interleukin (IL)-18; IL-18 binding protein (IL-18BP); IL-18 receptor 1 (IL-18R1); IL-18 receptor accessory protein (IL-18RAP); IL-2; soluble IL-2 receptor alpha (sIL-2RA); IL-5; IL-6; IL-9; IL-10; IL-22; interferon gamma (IFN); granulocyte macrophage colony stimulating factor (GM-CSF); serum amyloid A (SAA); and C-reactive protein (CRP); and/or (B) at least one biomarker cell population selected from CD161+ cells, CD56+ dim cells, or a combination thereof; thereby generating a test biomarker profile comprising levels of the at least one biomarker and/or the at least one biomarker cell population.
10. The method of claim 9, wherein the CD161+ cells further comprise CD161+ CD3+ T cells; CD161+ CD4+ T cells; CD161+ CD4+ CD45RA-T cells; CD161+ CD8+ T cells; CD161+ CD8+CD45RA+ T cells; CD161+ CD56+ natural killer (NK) cells; CD161+ mucosal associated invariant T (MAIT) cells; CD161+ GM-CSF+ NK cells; CD161+ GM-CSF+ MAIT cells; CD161+ GM-CSF+ T cells; CD161+ IFN+ NK cells; CD161+ IFN+ MAIT cells; CD161+ IFN+ T cells; CD161+ IFN+ NKT cells; or a combination thereof.
11. The method of claim 9, wherein the CD56+ dim cells are circulating NK cells.
12. The method of claim 9, wherein the subject has not undergone an immunomodulatory treatment, is undergoing an immunomodulatory treatment, or has completed an immunomodulatory treatment.
13. The method of claim 9, wherein the biological sample comprises a blood sample and/or a cell sample.
14. The method of claim 13, wherein the blood sample is serum or plasma.
15. The method of claim 13, wherein the cell sample is a peripheral blood mononuclear (PBMC) sample.
16. The method of claim 9, further comprising comparing the test biomarker profile to a reference biomarker profile comprising the level(s) of the same biomarker(s); and identifying the subject as having or predicting that the subject will have a toxic response and/or non-response to an immunomodulatory treatment when the test biomarker profile comprises increased levels of the at least one biomarker of (A) and/or an increased level of the at least one biomarker cell population of (B) as compared to the reference biomarker profile.
17. The method of claim 16, wherein the reference biomarker profile is from a subject or a population of subjects having a functional response to the immunomodulatory treatment with limited or no neurotoxicity (NTX).
18. The method of claim 16, wherein the at least one biomarker cell population of (B) is CD161+ cells, and wherein the level of the CD161+ cells of the test biomarker profile is increased 2-fold to 10-fold as compared to the level of CD161+ cells of the reference biomarker profile.
19. The method of claim 16, wherein the at least one biomarker cell population of (B) is CD161+ cells, and wherein the level of the CD161+ cells of the test biomarker profile is 10% to 30% of total live cells in the sample.
20. The method of claim 16, wherein the level of the at least one biomarker of (A) is increased 1.1-fold to 10-fold as compared to the level of the same at least one biomarker of the reference biomarker profile.
21. The method of claim 16, wherein the subject has not undergone the immunomodulatory treatment.
22. The method of claim 21, further comprising excluding the subject from a clinical trial.
23. The method of claim 16, wherein the subject is undergoing the immunomodulatory treatment.
24. The method of claim 23, further comprising terminating the immunomodulatory treatment and initiating a different immunomodulatory treatment.
25. The method of claim 16, wherein the subject has completed the immunomodulatory treatment.
26. The method of claim 25, further comprising initiating a different immunomodulatory treatment.
27. The method of claim 16, wherein the immunomodulatory treatment comprises administering to the subject chimeric antigen receptor (CAR) T cell immunotherapy, therapeutic agents to deplete regulatory T cells, recombinant cytokines, immune checkpoint inhibitors, monoclonal antibodies, bispecific antibodies, dual-affinity retargeting antibodies, immune-mobilizing monoclonal T cell receptors against cancer, vaccines, or a combination thereof.
28. The method of claim 16, wherein the at least one biomarker cell population of (B) is CD161+ cells, wherein the immunomodulatory treatment comprises administration of chimeric antigen receptor (CAR) T cell immunotherapy, and wherein the method further comprises removing CD161+ cells from an apheresis product obtained from the subject prior to the immunomodulatory treatment to produce an apheresis product reduced in CD161+ cells.
29. The method of claim 28, wherein the method further comprises contacting the apheresis product obtained from the subject with an anti-CD161 antibody.
30. The method of claim 16, further comprising administering a therapeutic agent prior to initiating the immunomodulatory treatment in the subject and/or when the subject is undergoing the immunomodulatory treatment to drive the toxic and/or non-response to a functional response.
31. The method of claim 30, wherein the immunomodulatory treatment comprises chimeric antigen receptor (CAR) T cell immunotherapy and the therapeutic agent comprises: an anti-CD161 antibody, an anti-IL-18 antibody, an anti-IFN antibody, an IL-18BP, or a combination thereof.
32. The method of claim 30, wherein the administering occurs at time points up to 7 days after initiation of the immunomodulatory treatment.
33. The method of claim 30, wherein the therapeutic agent comprises: recombinant cytokines; epigenetic blockade regulators; nanoparticles conjugated with immunomodulatory agents; antibodies; fusion proteins; small molecules; corticosteroids; or a combination thereof.
34. The method of claim 33, wherein the recombinant cytokines are selected from IL-2, IFN-, IL-15, IL-21, IL-12, IL-10, GM-CSF, or a combination thereof.
35. The method of claim 33, wherein the epigenetic blockade regulators are selected from azacytidine, 5-aza-2-deoxycytidine, suberoylanilide hydroxamic acid, romidepsin, belinostat, panobinostat, chidamide, or a combination thereof.
36. The method of claim 33, wherein the antibodies are selected from an anti-CD154 antibody, emapalumab, alemtuzumab, tocilizumab, siltuximab, clazakizumab, anti-thymocyte globulin, adalimumab, certolizumab, golimumab, infliximab, lenzilumab, basiliximab, daclizumab, ixekizumab, secukinumab, natalizumab, vedolizumab, rituximab, ustekinumab, or a combination thereof.
37. The method of claim 33, wherein the fusion proteins are abatacept and/or etanercept.
38. The method of claim 33, wherein the small molecules are selected from aspirin, ibuprofen, cyclosporine A, tacrolimus, dasatinib, sirolimus, everolimus, mycophenolate mofetil, leflunomide, anakinra, cyclophosphamide, ruxolitinib, itacitinib, ibrutinib, or a combination thereof.
39. The method of claim 33, wherein the corticosteroids are selected from dexamethasone, prednisone, budesonide, prednisolone, methylprednisolone, or a combination thereof.
40. The method of claim 16, further comprising monitoring the subject for a response to the immunomodulatory treatment, wherein the monitoring comprises repeating the measuring while the subject is undergoing the immunomodulatory treatment, thereby monitoring the response the subject has to the immunomodulatory treatment.
41. The method of claim 9, wherein the measuring is performed prior to the subject undergoing an immunomodulatory treatment, while the subject is undergoing an immunomodulatory treatment, or after the subject has undergone an immunomodulatory treatment; and comprises measuring at least one biomarker selected from the group consisting of IL-18, IL-18BP, sIL-2RA, IL-10, IL-22, and IFN.
42. The method of claim 10, wherein the measuring is performed prior to the subject undergoing an immunomodulatory treatment; and comprises measuring (A) at least one biomarker selected from the group consisting of IL-18, IL-18BP, IL-10, sIL-2RA, IL-22, and IFN; and/or (B) at least one biomarker cell population selected from the group consisting of: CD56+ dim cells; CD161+ CD3+ T cells; CD161+ CD4+ T cells; CD161+ CD4+ CD45RA-T cells; CD161+CD8+ T cells; CD161+ CD8+ CD45RA+ T cells; CD161+ CD56+ NK cells; CD161+ MAIT cells; CD161+ GM-CSF+ NK cells; CD161+ GM-CSF+ MAIT cells; CD161+ GM-CSF+ T cells; CD161+ IFN+ NK cells; CD161+ IFN+ MAIT cells; CD161+ IFN+ T cells; and CD161+ IFN+ NKT cells.
43. The method of claim 9, wherein the measuring is performed 1 day after an immunomodulatory treatment has initiated and comprises measuring at least one biomarker selected from the group consisting of IL-10, IFN, GM-CSF, and SAA.
44. The method of claim 9, wherein the measuring is performed 3 days after an immunomodulatory treatment has initiated and comprises measuring at least one biomarker selected from the group consisting of IL-10, IFN, GM-CSF, and CRP.
45. The method of claim 6, wherein the measuring is performed 3 days after an immunomodulatory treatment has initiated and comprises measuring at least one biomarker selected from the group consisting of sIL-2RA, IL-5, IL-10, and GM-CSF.
46. The method of claim 9, wherein the measuring is performed 7 days after an immunomodulatory treatment has initiated and comprises measuring at least one biomarker selected from the group consisting of IL-18, IL-18BP, and IFN.
47. The method of claim 9, wherein the measuring is performed 7 days after an immunomodulatory treatment has initiated and comprises measuring at least one biomarker selected from the group consisting of IL-18, IL-18BP, and IL-22.
48. The method of claim 9, wherein the measuring comprises using immunoassay or flow cytometry.
49. A method of screening a subject for exclusion from a clinical trial, comprising obtaining a biological sample derived from a subject; measuring a level of (A) at least one biomarker selected from the group consisting of interleukin (IL)-18; IL-18 binding protein (IL-18BP); IL-18 receptor 1 (IL-18R1); IL-18 receptor accessory protein (IL-18RAP); IL-2; soluble IL-2 receptor alpha (sIL-2RA); IL-5; IL-6; IL-9; IL-10; IL-22; interferon gamma (IFN); granulocyte macrophage colony stimulating factor (GM-CSF); serum amyloid A (SAA); and C-reactive protein (CRP); and/or (B) at least one biomarker cell population selected from CD161+ cells, CD56+ dim cells, or a combination thereof; to generate a test biomarker profile; comparing the test biomarker profile to a reference biomarker profile comprising the level(s) of the same biomarker(s); identifying the subject as having or predicting that the subject will have a toxic response and/or non-response to an immunomodulatory treatment when the test biomarker profile comprises an increased level of the at least one biomarker of (A) and/or an increased level of the at least one biomarker cell population of (B) as compared to the reference biomarker profile, thereby screening a subject for exclusion from a clinical trial.
50. The method of claim 49, wherein the reference biomarker profile is from a subject or a population of subjects having a functional response to the immunomodulatory treatment with limited or no neurotoxicity (NTX).
51. The method of claim 49, wherein the CD161+ cells further comprise CD161+ CD3+ T cells; CD161+ CD4+ T cells; CD161+ CD4+ CD45RA-T cells; CD161+ CD8+ T cells; CD161+ CD8+CD45RA+ T cells; CD161+ CD56+ natural killer (NK) cells; CD161+ mucosal associated invariant T (MAIT) cells; CD161+ GM-CSF+ NK cells; CD161+ GM-CSF+ MAIT cells; CD161+ GM-CSF+ T cells; CD161+ IFN+ NK cells; CD161+ IFN+ MAIT cells; CD161+ IFN+ T cells; CD161+ IFN+ NKT cells; or a combination thereof.
52. The method of claim 49, wherein the CD56+ dim cells are circulating NK cells.
53. The method of claim 49, wherein the subject has not undergone an immunomodulatory treatment, is undergoing an immunomodulatory treatment, or has completed an immunomodulatory treatment.
54. The method of claim 49, wherein the biological sample comprises a blood sample and/or a cell sample.
55. The method of claim 54, wherein the blood sample is serum or plasma.
56. The method of claim 54, wherein the cell sample is a peripheral blood mononuclear (PBMC) sample.
57. The method of claim 49, wherein the at least one biomarker cell population of (B) is CD161+ cells, and wherein the level of the CD161+ cells of the test biomarker profile is increased 2-fold to 10-fold as compared to the level of CD161+ cells of the reference biomarker profile.
58. The method of claim 49, wherein the at least one biomarker cell population of (B) is CD161+ cells, and wherein the level of the CD161+ cells of the test biomarker profile is 10% to 30% of total live cells in the sample.
59. The method of claim 49, wherein the levels of the at least one biomarker of (A) are increased 1.1-fold to 10-fold as compared to the level of the same at least one biomarker of the reference biomarker profile.
60. A method of selecting a therapeutic agent to administer to a subject, comprising measuring a level of (A) at least one biomarker selected from the group consisting of interleukin (IL)-18; IL-18 binding protein (IL-18BP); IL-18 receptor 1 (IL-18R1); IL-18 receptor accessory protein (IL-18RAP); IL-2; soluble IL-2 receptor alpha (sIL-2RA); IL-5; IL-6; IL-9; IL-10; IL-22; interferon gamma (IFN); granulocyte macrophage colony stimulating factor (GM-CSF); serum amyloid A (SAA); and C-reactive protein (CRP); and/or (B) at least one biomarker cell population selected from CD161+ cells, CD56+ dim cells, or a combination thereof; to generate a test biomarker profile; comparing the test biomarker profile to a reference biomarker profile comprising the level(s) of the same biomarker(s); identifying the subject as having or predicting that the subject will have a toxic response and/or non-response to an immunomodulatory treatment when the test biomarker profile comprises increased levels of the at least one biomarker of (A) and/or an increased level of the at least one biomarker cell population of (B) as compared to the reference biomarker profile, and selecting a therapeutic agent to administer to the subject.
61. The method of claim 60, wherein the subject has not undergone an immunomodulatory treatment, is undergoing an immunomodulatory treatment, or has completed an immunomodulatory treatment.
62. The method of claim 60, wherein the biological sample comprises a blood sample and/or a cell sample.
63. The method of claim 62, wherein the blood sample is serum or plasma.
64. The method of claim 62, wherein the cell sample is a peripheral blood mononuclear (PBMC) sample.
65. The method of claim 60, wherein the immunomodulatory treatment comprises administering to the subject chimeric antigen receptor (CAR) T cell immunotherapy, therapeutic agents to deplete regulatory T cells, recombinant cytokines, immune checkpoint inhibitors, monoclonal antibodies, bispecific antibodies, dual-affinity retargeting antibodies, immune-mobilizing monoclonal T cell receptors against cancer, vaccines, or a combination thereof.
66. The method of claim 60, wherein the at least one biomarker cell population of (B) is CD161+ cells, wherein the immunomodulatory treatment comprises administration of chimeric antigen receptor (CAR) T cell immunotherapy, and wherein the method further comprises removing CD161+ cells from an apheresis product obtained from the subject prior to the immunomodulatory treatment to produce an apheresis product reduced in CD161+ cells.
67. The method of claim 66, wherein the method further comprises contacting the apheresis product obtained from the subject with an anti-CD161 antibody.
68. The method of claim 60, wherein the immunomodulatory treatment comprises chimeric antigen receptor (CAR) T cell immunotherapy and the therapeutic agent comprises: an anti-CD161 antibody, an anti-IL-18 antibody, an anti-IFN antibody, an IL-18BP, or a combination thereof.
69. The method of claim 60, further comprising administering a therapeutic agent prior to initiating the immunomodulatory treatment in the subject and/or when the subject is undergoing the immunomodulatory treatment.
70. The method of claim 69, wherein the administering occurs at time points up to 7 days after initiation of the immunomodulatory treatment.
71. The method of claim 60, wherein the therapeutic agent comprises: recombinant cytokines; epigenetic blockade regulators; nanoparticles conjugated with immunomodulatory agents; antibodies; fusion proteins; small molecules; corticosteroids; or a combination thereof.
72. The method of claim 71, wherein the recombinant cytokines are selected from IL-2, IFN-, IL-15, IL-21, IL-12, IL-10, GM-CSF, or a combination thereof.
73. The method of claim 71, wherein the epigenetic blockade regulators are selected from azacytidine, 5-aza-2-deoxycytidine, suberoylanilide hydroxamic acid, romidepsin, belinostat, panobinostat, chidamide, or a combination thereof.
74. The method of claim 71, wherein the antibodies are selected from an anti-CD154 antibody, emapalumab, alemtuzumab, tocilizumab, siltuximab, clazakizumab, anti-thymocyte globulin, adalimumab, certolizumab, golimumab, infliximab, lenzilumab, basiliximab, daclizumab, ixekizumab, secukinumab, natalizumab, vedolizumab, rituximab, ustekinumab, or a combination thereof.
75. The method of claim 71, wherein the fusion proteins are abatacept and/or etanercept.
76. The method of claim 71, wherein the small molecules are selected from aspirin, ibuprofen, cyclosporine A, tacrolimus, dasatinib, sirolimus, everolimus, mycophenolate mofetil, leflunomide, anakinra, cyclophosphamide, ruxolitinib, itacitinib, ibrutinib, or a combination thereof.
77. The method of claim 71, wherein the corticosteroids are selected from dexamethasone, prednisone, budesonide, prednisolone, methylprednisolone, or a combination thereof.
78. A method of identifying a subject as having or predicting that a subject will have a toxic response and/or non-response to an immunomodulatory treatment comprising obtaining a biological sample derived from a subject; measuring a level of (A) at least one biomarker selected from the group consisting of interleukin (IL)-18; IL-18 binding protein (IL-18BP); IL-18 receptor 1 (IL-18R1); IL-18 receptor accessory protein (IL-18RAP); IL-2; soluble IL-2 receptor alpha (sIL-2RA); IL-5; IL-6; IL-9; IL-10; IL-22; interferon gamma (IFN); granulocyte macrophage colony stimulating factor (GM-CSF); serum amyloid A (SAA); and C-reactive protein (CRP); and/or (B) at least one biomarker cell population selected from CD161+ cells, CD56+ dim cells, or a combination thereof; comparing the test biomarker profile to a reference biomarker profile comprising the level(s) of the same measured biomarker(s); and identifying the subject as having or predicting that the subject will have a toxic response and/or non-response to an immunomodulatory treatment when the test biomarker profile comprises an increased level of the at least one biomarker of (A) and/or an increased level of the at least one biomarker cell population of (B) as compared to a reference biomarker profile.
79. A kit comprising at least two biomarker binding agents, wherein the at least two biomarker binding agents bind biomarkers selected from the group consisting of interleukin (IL)-18; IL-18 binding protein (IL-18BP); IL-18 receptor 1 (IL-18R1); IL-18 receptor accessory protein (IL-18RAP); IL-2; soluble IL-2 receptor alpha (sIL-2RA); IL-5; IL-6; IL-9; IL-10; IL-22; interferon gamma (IFN); granulocyte macrophage colony stimulating factor (GM-CSF); serum amyloid A (SAA); and C-reactive protein (CRP); C-type lectin-like receptor (CD161)+ cells; CD56+ dim cells; or a combination thereof.
80. The kit of claim 79, wherein the at least two biomarker binding agents bind to biomarkers selected from the group consisting of IL-18, IL-18BP, sIL-2RA, IL-10, IL-22, IFN, and CD161+ cells.
81. The kit of claim 79, wherein the biomarker binding agents are proteins, antibodies, aptamers, mimotopes, or oligonucleotides.
82. The kit of claim 79, further comprising a detectable label.
83. The kit of claim 82, wherein the detectable label is a radioactive isotope, enzyme reporter, colorimetric label, fluorescent label, chemiluminescent label, colored particles, gold nanoparticles, colloids, magnetic bead, or biotin.
84. The kit of claim 79, wherein the kit comprises reagents to perform amplification of nucleic acids, an immunoassay, an immunohistochemical staining, flow cytometry, an enzyme-based colorimetric assay, and/or a protein activity assay.
85. An array comprising at least two biomarkers selected from the group consisting of interleukin (IL)-18; IL-18 binding protein (IL-18BP); IL-18 receptor 1 (IL-18R1); IL-18 receptor accessory protein (IL-18RAP); IL-2; soluble IL-2 receptor alpha (sIL-2RA); IL-5; IL-6; IL-9; IL-10; IL-22; interferon gamma (IFN); granulocyte macrophage colony stimulating factor (GM-CSF); serum amyloid A (SAA); and C-reactive protein (CRP).
86. The array of claim 85, wherein the at least two biomarkers comprise IL-18, IL-18BP, sIL-2RA, IL-10, IL-22, and IFN.
87. An array comprising at least two biomarker cell populations comprising CD161+ cells and/or CD56+ dim cells.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0015] Some of the drawings submitted herein may be better understood in color. Applicant considers the color versions of the drawings as part of the original submission and reserve the right to present color images of the drawings in later proceedings.
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
DETAILED DESCRIPTION
[0040] Chimeric antigen receptor (CAR) T cells as immunotherapies have revolutionized the treatment of childhood leukemia, inducing up to 80% remission rates in relapsed/refractory B-acute lymphoblastic leukemia (ALL). Of the patients who enter remission, close to 50% will eventually relapse (Ruella & Maus. Computational and structural biotechnology journal 14, 357-362 (2016)). In close to 20-30% of patients, the therapy induces adverse side effects such as neurotoxicity (NTX) and cytokine release syndrome (CRS) (Hay et al. Blood 130, 2295-2306 (2017)). These side effects can be devastating, leading to long-term neurological damage and in some cases death (Hay et al. Blood 130, 2295-2306 (2017)). As CAR therapies proliferate widely into standard clinical practice it will be necessary to predict and mitigate non-response, toxicity and relapse.
[0041] The reason for the variability of response, incidence and severity of CAR T toxicity between trials and products is poorly understood. CRS typically manifests during expansion of CAR Ts (3-10 days post-CAR) and NTX (7-14 days post-CAR) typically follows. While risk of CRS/NTX and non-response increases with antigen load and/or dose, these only partially explain toxicity and response. This, coupled with overlap in clinical presentations, raises the possibility of a common pathophysiology with hemophagocytic lymphohistiocytosis (HLH). HLH is characterized by defective lymphocyte cytotoxicity with increased cytokine production (simulated in CAR T through increased dosing and/or increased antigen exposure) coupled with uncontrolled M (myeloid) activation.
[0042] M characteristics have arisen both within the scientific literature and the clinic as strong predictive models for clinical outcomes, including response and toxicity in CAR T (Biswas & Mantovani. Seminars in immunopathology 35, 585-600 (2013); Bonnardel & Guilliams. Current opinion in immunology 50, 64-74 (2018); Murray & Wynn. Nature reviews. Immunology 11, 723-737 (2011)). Clinically, IL-6, a monocytic specific cytokine, although unproven to be causative for CRS, is able to alleviate adverse events caused by this toxicity. Physicians now dose tocilizumab (ant-IL-6 therapy) during presentation of adverse symptoms post-CAR to mitigate poor outcomes. Currently, over 90% of patients treated with CAR T present with CRS (defined by a high fever), suggesting that CRS is required for therapeutic efficacy (Gardner et al. Blood 129, 3322-3331 (2017)). However, IL-6 blockade does not alter severe neurological outcomes or tumor burden (Maude et al. Cancer J 20, 119-122 (2014)). The first humanized mouse models that could begin recapitulating both the NTX observed in human populations following CAR-T therapy were published in 2018 (Norelli et al. Nature medicine 24, 739-748 (2018)). NTX was shown to be caused by traditionally MCD-associated cytokine release, specifically IL-1. Anakinra, an IL-1 receptor antagonist, ablates NTX in these models (Norelli et al. Nature medicine 24, 739-748 (2018)). Currently, there are a wide variety of open clinical trials to test the success of Anakinra in treating NTX post-CAR. However, despite wide acceptance that this molecule could be responsible for NTX outcomes, no reported prospective or retrospective studies have been able to identify this molecule in the serum or cerebral spinal fluid of patients. While IL-1 is present in clinical presentation of macrophage activation syndrome (MAS) and HLH, it is rarely linked to causative outcomes. In contrast, interleukin (IL)-18, an IL-1 family member, has been directly linked both clinically to symptom severity and lethality and in mouse models is linked to causal mechanisms. In primary HLH, IL-18BP (an IL-18 antagonist) is approved clinically. This molecule is now reported in multiple CD22 CAR trials as being elevated in the serum of severe toxicity patients presenting with classical HLH-like symptoms, albeit it's clear the timeline of presentation of these symptoms is very different from CD19 therapy (Shah et al. Journal of clinical oncology: official journal of the American Society of Clinical Oncology 38, 1938-1950 (2020)). Yet, this result suggests that agents that regulate signaling or processing of the IL-18 at early timepoints could be more efficacious than targeting either IL-6 or IL-1. Regardless, myeloid associated cytokines appear to have a role in toxicity associated outcomes in CAR T.
[0043] IL-18 has long been implicated in tumor regression and progression, where it appears to both be responsible for poor therapeutic outcomes and successful treatment strategies. For example, IL-18 has been used in pre-clinical models to promote both CAR T efficacy and checkpoint blockade but serves as predictor clinically of poor survival in the context of a wide variety of tumors. The dichotomy of this molecule is likely linked to its ability to toggle the immune system within the context of disease. Importantly, while IL-18 is likely secreted and regulated (by the secreted antagonist IL-18BP) from the innate immune system to signal to the adaptive immune system, it requires a co-stimulatory molecule to induce expression of the IL-18 receptor. For example, in the presence of IL-12, IL-18 induces a robust cytotoxic immune response characterized robustly in pathogenesis and likely anti-tumor response. However, in the absence of IL-12 but presence of IL-2, IL-18 induces allergy and uncontrolled inflammation in mouse models. It is within the context of these co-stimulatory molecules that the functional differences of IL-18 in promoting and reducing tumorigenesis likely lies. These results at least highlight the important role of monocytic specific cytokines in regulating responsive CAR outcomes. It is possible that a basal level of cytokine excretion from MOs is necessary for overall therapeutic benefit, but highly amplified cytokine responses can be lethal or result in non-responsiveness. Without being bound by any one hypothesis, levels of cytokine secretion could be predicted by the inflammatory status of a patient prior to immunotherapy.
[0044] Without being bound by any one hypothesis, the pre-inflammatory status of a patient's MO populations, defined by potential of the M to produce proinflammatory cytokines at early time points post-CAR, could predict therapeutic response and toxicity in patients undergoing an immunomodulatory treatment, such as pediatric ALL CAR T populations (
[0045] Studies on CAR patients thus far have focused on the T cell and have reduced the role of patient specific immune characteristics on CAR outcomes. Further, the role of monocytic cytokine kinetic/compositional profiles in immunotherapy outcomes have not been studied and there remains a lack of understanding of how these profiles either promote or inhibit efficacy of immunotherapy.
[0046] The present disclosure describes the generation of monocytic kinetic and compositional profiles. Retrospective machine learning was performed on 30 patients off the pediatric and young adult leukemia adoptive therapy trial (PLAT-02, NCT02028455) at days 1, 3, and 7 post-CAR. Using unbiased classifications, two distinct groups of patients were identified: a patient population that included initial non-responsive CAR T patients, patients with severe NTX and overall low survival (median survival 16.84 months, classified as Group 2); and another group that maintained high survival (median survival undefined, classified as Group 1) with varying degrees of CRS severity and mild/no NTX (
[0047] Cytokines include proteins, peptides, and glycoproteins that are secreted by specific cells of the immune system. Cytokines can serve as signaling molecules in regulation of immunity, inflammation, and hematopoiesis. Immune responses can be mediated by two types of helper T cells. T helper type 1 (Th1) lymphocytes stimulate Type 1 immunity, characterized by intense phagocytic activity. Th1 cells secrete cytokines IL-2, interferon- (IFN), and lymphotoxin-. Conversely, Th2 cells stimulate type 2 immunity, characterized by high antibody titers. Th2 cells secrete cytokines IL-4, IL-5, IL-9, IL-10, and IL-13. However, Th1 and Th2 cell functions are not clearly divided, as Th1 cells can stimulate antibody production, and Th2 cells can actively suppress phagocytosis. Generally, type 1 immunity is protective against infections, and type 2 responses help resolve cell-mediated inflammation. Th17 cells are distinct from Th1 and Th2 and include CD4+ T cells that produce the pro-inflammatory cytokine IL-17. Th17 cells function in host defense against infection; however, excessive Th17 cell activity may play a role in immune-mediated diseases, tumorigenesis, and transplant rejection.
[0048] Myeloid or myelogenous cells include white blood cells (leukocytes) that arise from a progenitor cell for granulocytes, monocytes, erythrocytes, or platelets. In particular embodiments, myeloid cells include granulocytes, monocytes, macrophages, and dendritic cells. Monocytes function in phagocytosis, antigen presentation, and cytokine production. Human blood has at least three types of monocytes: a classical monocyte characterized by high expression of the CD14 cell surface receptor (CD14++CD16); a non-classical monocyte characterized by low expression of CD14 and co-expression of the CD16 receptor (CD14+CD16++); and an intermediate monocyte with high expression of CD14 and low expression of CD16 (CD14++CD16+). In particular embodiments, the cell surface marker 6-Sulfo LacNAc (slan) can differentiate between non-classical and intermediate monocytes. In particular embodiments, the non-classical (CD14+CD16++) monocytes produce high amounts of pro-inflammatory cytokines like tumor necrosis factor (TNF) and IL-12 after stimulation with microbial products.
[0049] Macrophages are a type of white blood cell that functions in host defense against infection and injury in a process called phagocytosis. The macrophages engulf and digest biological entities that do not have molecular markers identifying them as part of the healthy host, such as cellular debris, foreign substances, microbes, and cancer cells. Macrophages function to retain homeostasis and achieve a balance of pro-inflammatory and immunosuppressive environments. Pro-inflammatory macrophages function in phagocytosis and promote an immune response, while pro-growth macrophages function in angiogenesis and immunosuppression. Macrophage activation may be predictive of inflammation and cancer survival (Buscher et al. (2017) Nature Communications 8:16041).
[0050] A T cell is a white blood cell that originates from hematopoietic stem cells in the bone marrow but matures in the thymus. Most T cells have a T-cell receptor (TCR) composed of two separate peptide chains (the - and -TCR chains). T cells represent a small subset of T cells that possess a distinct T cell receptor (TCR) made up of one -chain and one -chain. CD3 is expressed on all mature T cells. T cells can further be classified into cytotoxic T cells (CD8+ T cells, also referred to as CTLs) and helper T cells (CD4+ T cells). Cytotoxic T cells destroy virally infected cells and tumor cells and are also implicated in transplant rejection. These cells recognize their targets by binding to antigen associated with major histocompatibility complex (MHC) class I, which is present on the surface of nearly every cell of the body. T cells have different maturation stages. In particular embodiments, nave T cells express CD45RA (CD45RA+). After antigenic exposure, nave T cells can convert to memory T cells. In particular embodiments, memory T cells express CD45RO (CD45RO+) and do not express CD45RA (CD45RA).
[0051] Natural killer (NK) cells share a common progenitor with T and B cells but play a role in the innate immune system by rapidly responding to a wide variety of pathological challenges including infectious pathogens and tumor cells. NK cells are activated in response to inflammatory mediators such as interferons or cytokines. Once activated to destroy a target cell, NK cells can release cytotoxic granules including perforin and granzymes to lyse the target cell. NK cells also express a variety of activating and inhibitory receptors, as well as co-stimulatory receptors, to recognize and respond to inflamed or infected tissues. These receptors bind cellular stress ligands, which can lead to NK cell responses. Importantly, some of these receptors prevent activation of NK cells, so that NK cells do not target healthy tissue. In particular embodiments, NK cells can include CD3+ NK cells, CD4+ NK cells, and/or CD8+ NK cells. In particular embodiments, NK cells are CD56+. In particular embodiments, the majority of circulating NK cells are CD56+ dim.
[0052] Natural killer T (NKT) cells are lymphocytes that express both a TCR, a feature of adaptive immunity, and surface receptors for NK cells, which form part of the innate immune response. NKT cells play diverse roles in immune responses, including the surveillance for tumors, the maintenance of self-tolerance, and the regulation of autoimmune diseases. In particular embodiments, NKT cells can include CD3+ NKT cells, CD4+ NKT cells, and/or CD8+ NKT cells. In particular embodiments, NKT cells are CD3+CD56+. A major population of NKT cells, called iNKT cells, expresses an invariant TCR -chain. iNKT cells recognize lipids presented by CD1d molecules and protect a host against microbial pathogens, including bacteria, fungi, parasites and viruses.
[0053] The following aspects of the disclosure are now described in more detail: (I) Biomarkers; (II) Responses to an immunomodulatory treatment; (III) Biological Samples; (IV) Assays for detection and quantification of biomarkers; (V) Reference levels and reference biomarker profiles; (VI) Methods of Use; (VII) Kits; (VIII) Exemplary Embodiments; (IX) Examples; (X) Variants; and (XI) Closing Paragraphs.
[0054] (I) Biomarkers. A biomarker can include any biological compound, such as a protein and a fragment thereof, a peptide, a polypeptide, a proteoglycan, a glycoprotein, a lipoprotein, a carbohydrate, a lipid, a nucleic acid, an organic or inorganic chemical, a natural polymer, or a small molecule that is present in a biological sample and that may be isolated from, or measured in, the biological sample. A biomarker can include a cell type, a cell expressing one or more specific molecules (e.g. a cell surface molecule and/or a molecule produced inside the cell), a cell population, or a cell population expressing one or more specific molecules (e.g. a cell surface molecule and/or a molecule produced inside a cell of a cell population). Furthermore, a biomarker can be the entire intact molecule, or it can be a portion thereof that may be partially functional or recognized, for example, by an antibody or other specific binding protein. A biomarker is considered to be informative if a measurable aspect of the biomarker is associated with a given state of a subject, such as responsiveness to an immunomodulatory treatment. Such a measurable aspect may include, for example, the presence, absence, or concentration of the biomarker in the biological sample from the subject and/or its presence as part of a profile of biomarkers. Such a measurable aspect of a biomarker can be referred to as a feature. In particular embodiments, a feature can include a concentration, amount, or level of a biomarker. A feature may also be a ratio of two or more measurable aspects of biomarkers, which biomarkers may or may not be of known identity, for example. A biomarker profile includes at least one such feature, where the feature can be, for example, a nucleic acid or a protein. A biomarker profile may also include at least two, three, four, five, 10, 20, 30, or more features. In particular embodiments, a biomarker profile includes the concentrations, amounts, or levels of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more biomarker(s). In particular embodiments, a biomarker profile includes the amount, size, or level of at least one cell population. In particular embodiments, a biomarker profile includes the concentrations, amounts, or levels of one or more biomarkers and the amount, size, or level of at least one cell population. In particular embodiments, a biomarker profile includes at least one measurable aspect of at least one internal standard.
[0055] The terms nucleic acid, nucleotide sequence, and polynucleotide are interchangeable. All refer to a polymeric form of nucleotides. The nucleotides may be deoxyribonucleotides (DNA) or ribonucleotides (RNA), or analogs thereof, and they may be of any length.
[0056] In particular embodiments, biomarkers to predict a subject's responsiveness to an immunomodulatory treatment can include cytokines and proteins associated with the interleukin (IL)-1 (IL-1) family. The IL-1 family of cytokines and proteins function in inflammatory and non-specific host defense responses (innate immunity) and in response to foreign antigens (acquired immunity). Receptors of the IL-1 family have a cytosolic Toll interleukin-1 receptor (TIR) domain that is highly homologous to that of the Toll-like receptors (TLRs). Both the TLR and IL-1 families nonspecifically augment antigen recognition and activate lymphocyte function. Cytokines and associated proteins in the IL-1 family include: IL-1, IL-1, IL-33, IL-1 receptor antagonist, IL-18, IL-37, IL-36 receptor antagonist (IL-36Ra), IL-36, IL36, IL-36, and IL-38. An exemplary IL-1 sequence includes UniProt ID P01584. An exemplary IL-1a sequence includes UniProt ID P01583. An exemplary IL-33 sequence includes UniProt ID O95760. An exemplary IL-1 receptor antagonist sequence includes UniProt ID P18510. An exemplary IL-37 sequence includes UniProt ID Q9NZH6. An exemplary IL-36Ra sequence includes UniProt ID Q9UBH0. An exemplary IL-36 sequence includes UniProt ID Q9UHA7. An exemplary IL-36 sequence includes UniProt ID Q9NZH7. An exemplary IL-36R sequence includes UniProt ID Q9NZH8. An exemplary IL-38 sequence includes UniProt ID Q8WWZ1.
[0057] In particular embodiments, a biomarker of the present disclosure includes interleukin-18 (IL-18). An exemplary IL-18 sequence includes UniProt ID Q14116-1, which includes a pro-peptide (SEQ ID NO: 9, encoded by SEQ ID NO: 46). IL-18 is synthesized as an inactive pre-cursor, and the pro-peptide of IL-18 (amino acids 1-36 of SEQ ID NO: 9) is cleaved by a caspase to yield an active mature IL-18 included in SEQ ID NO: 10, encoded by SEQ ID NO: 47. IL-18 is a proinflammatory cytokine primarily involved in polarized Th1 cell and NK cell immune responses. IL-18 forms a ternary complex with IL-18 receptor 1 (IL18R1) and IL-18 receptor accessory protein (IL18RAP), which activates NF-kappa-B, triggering synthesis of inflammatory mediators. IL-18 acts with IL-12 to induce IFN synthesis from Th1 cells and NK cells.
[0058] In particular embodiments, a biomarker of the present disclosure includes interleukin-18 binding protein (IL-18BP). An exemplary IL-18BP sequence includes UniProt ID 095998-2, which includes a signal peptide (SEQ ID NO: 11, encoded by SEQ ID NO: 48). In particular embodiments, IL-18BP lacks a signal peptide (SEQ ID NO: 12, encoded by SEQ ID NO: 49). IL-18BP binds to IL-18 and inhibits its activity. In particular embodiments, IL-18BP functions as an inhibitor of the early Th1 cytokine response.
[0059] In particular embodiments, a biomarker of the present disclosure includes IL-18 receptor 1 (IL-18R1). An exemplary IL-18R1 sequence includes UniProt ID Q13478, which includes a signal peptide (SEQ ID NO: 13, encoded by SEQ ID NO: 50). In particular embodiments, IL-18R1 lacks a signal peptide (SEQ ID NO: 14, encoded by SEQ ID NO: 51). IL-18R1 is part of the IL18 receptor complex and binds the proinflammatory cytokine IL18. IL-18R1 plays a role in IL18-mediated IFN synthesis from Th1 cells. It contributes to IL18-induced cytokine production.
[0060] In particular embodiments, a biomarker of the present disclosure includes IL-18 receptor accessory protein (IL-18RAP). An exemplary IL-18RAP sequence includes UniProt ID 095256-1, which includes a signal peptide (SEQ ID NO: 15, encoded by SEQ ID NO: 52). In particular embodiments, IL-18RAP lacks a signal peptide (SEQ ID NO: 16, encoded by SEQ ID NO: 53). Although IL-18RAP is part of the IL18 receptor complex, it does not mediate IL18-binding; rather, it is involved in IL18-dependent signal transduction, leading to NF-kappa-B and JNK activation. In particular embodiments, it may function in IL18-mediated IFN synthesis from Th1 cells.
[0061] In particular embodiments, a biomarker of the present disclosure includes IL-1 receptor-like 1 (IL-1RL1/ST2). An exemplary ST2 sequence includes UniProt ID Q01638. ST2 is a receptor for interleukin-33 (IL-33). In particular embodiments, signaling involves association of the coreceptor IL1RAP. The stimulation of ST2 recruits proteins of a signaling platform including myeloid differentiation primary response 88 (MYD88), IL-1 receptor-associated kinase (IRAK) 1, IRAK4, and TNF receptor-associated factor 6 (TRAF6), followed by phosphorylation of mitogen activated protein kinase (MAPK) 3/ERK1 and/or MAPK1/ERK2, MAPK14, and MAPK8. In particular embodiments, ST2 is involved in helper T-cell function.
[0062] In particular embodiments, biomarkers to predict a subject's responsiveness to an immunomodulatory treatment can include a type 1 IFN. Interferons function in antiviral, antiproliferative, and immunomodulatory effects in a host response to viral or bacterial infection. The different types of interferons are classified according to genetic, structural, and functional characteristics, along with their cell surface receptors. The type 1 IFN family includes 13-14 subtypes of IFN-, IFN-, IFN-, IFN-, IFN-, IFN-, IFN-, and IFN-. IFN- and IFN- are used as standard treatments for chronic hepatitis B and C virus infections. IFN- controls mucosal immunity against viral and bacterial infections, and IFN-T has been shown to inhibit HIV infection. See Li et al. 2018 Cell Physiol Biochem 51:2377-2396 for a description of Type I interferons. Exemplary IFN- sequences include: UniProt ID P05014 (interferon alpha-4); UniProt ID P01570 (interferon alpha-14); UniProt ID P01563 (interferon alpha-2); UniProt ID P01562 (interferon alpha-1/13); UniProt ID P32881 (interferon alpha-8); UniProt ID P05015 (interferon alpha-16); UniProt ID P01571 (interferon alpha-17); UniProt ID P01567 (interferon alpha-7); and UniProt ID P01568 (interferon alpha-21). An exemplary IFN- sequence includes UniProt ID P01574. An exemplary IFN- sequence includes UniProt ID Q86WN2. An exemplary IFN-K sequence includes UniProt ID Q9P0W0. An exemplary IFN-w sequence includes UniProt ID P05000. An exemplary IFN-6 is described in Lefevre et al. 1998 Biochimie 80(8-9):779-788. An exemplary mouse IFN-(sequence includes UniProt ID Q8BQT1 and a human IFN-(is described in Oritani and Tomiyama 2004 Int J Hematol 80(4):325-331. Exemplary IFN-T sequences include: UniProt ID P56831 (Bos Taurus interferon tau-3); UniProt ID P15696 (Bos taurus interferon tau-1); UniProt ID P56830 (Bos Taurus interferon tau-2); UniProt ID P56829 (Ovis aries interferon tau-2); UniProt ID Q29429 (Ovis aries interferon tau-6); UniProt ID P28169 (Ovis aries interferon tau-11); UniProt ID P56832 (Ovis aries interferon tau-3); UniProt ID P56828 (Ovis aries interferon tau-1); UniProt ID Q08053 (Ovis aries interferon tau-10); UniProt ID Q28595 (Ovis aries interferon tau-5); UniProt ID Q08072 (Ovis aries interferon tau-8); UniProt ID Q08071 (Ovis aries interferon tau-7); and UniProt ID Q08070 (Ovis aries interferon tau-9); and UniProt ID Q28594 (Ovis aries interferon tau-4).
[0063] In particular embodiments, a biomarker of the present disclosure includes IL-2. An exemplary IL-2 sequence includes UniProt ID P60568, which includes a signal peptide (SEQ ID NO: 17, encoded by SEQ ID NO: 54). In particular embodiments, IL-2 lacks a signal peptide (SEQ ID NO: 18, encoded by SEQ ID NO: 55). IL-2 is a member of the IL-2 cytokine subfamily which also includes IL-4, IL-7, IL-9, IL-15, IL-21, erythropoietin, and thrombopoietin, The cytokine is secreted by activated CD4+ and CD8+T lymphocytes in response to antigenic or mitogenic stimulation. In particular embodiments, IL-2 stimulates B-cells, monocytes, lymphokine-activated killer cells, NK cells, and glioma cells. IL-2 functions in proliferation of T and B lymphocytes, regulates CD4+ T cell differentiation and function, and plays a role in the effector and memory responses of CD8+ T cells. The receptor of IL-2, IL-2R, is a heterotrimeric protein complex composed of an IL-2 receptor alpha (IL-2RA) chain, an IL-2 receptor beta (IL-2RB) chain, and a common gamma chain (IL-2RG) gamma chain. The IL-2RG is also shared by receptors for IL-4 and IL-7.
[0064] In particular embodiments, a biomarker of the present disclosure includes soluble IL-2 receptor alpha (sIL-2RA or CD25). An exemplary IL-2RA sequence includes UniProt ID P01589-1, which includes a signal peptide (SEQ ID NO: 19, encoded by SEQ ID NO: 56). In particular embodiments, IL-2RA lacks a signal peptide (SEQ ID NO: 20, encoded by SEQ ID NO: 57). IL-2RA, along with IL-2RB and IL-2RG, make up the high-affinity IL-2 receptor. Homodimeric IL-2RA yield a low-affinity receptor, while homodimeric IL-2RB yield a medium-affinity receptor. The receptor is involved in the regulation of immune tolerance by controlling the activity of regulatory T cells (TREGs). TREGs suppress the activation and expansion of autoreactive T-cells. IL-2RA expression increases rapidly after T-cell activation. Normally an integral-membrane protein, soluble IL-2RA results from extracellular proteolysis and can be measured in serum as a 45 kDa soluble form. sIL-2RA levels have been found to be elevated in patients with different types of carcinomas.
[0065] In particular embodiments, a biomarker of the present disclosure includes IL-12. In particular embodiments, IL-12 includes IL-12A (subunit alpha) and/or IL-12B (subunit beta). An exemplary IL-12A sequence includes NCBI Reference Sequence NP_000873.2, which includes a signal peptide (SEQ ID NO: 21, encoded by SEQ ID NO: 58). In particular embodiments, IL-2RA lacks a signal peptide (SEQ ID NO: 22, encoded by SEQ ID NO: 59). An exemplary IL-12B sequence includes UniProt ID P29460-1, which includes a signal peptide (SEQ ID NO: 23, encoded by SEQ ID NO: 60). In particular embodiments, IL-2RA lacks a signal peptide (SEQ ID NO: 24, encoded by SEQ ID NO: 61). IL-12 is a disulfide-linked heterodimer composed of a 35-kD alpha subunit and a 40-kD beta subunit. IL-12 can act as a growth factor for activated T and NK cells, enhance the lytic activity of NK/lymphokine-activated killer cells, and stimulate the production of IFN by resting peripheral blood mononuclear cells (PBMC). In particular embodiments, IL-12 is a cytokine that induces development of Th1 and/or Th2 cells. In particular embodiments, IL-12 is important for sustaining a sufficient number of memory/effector Th1 cells to mediate long-term protection to an intracellular pathogen. In particular embodiments, the responses of lymphocytes to IL-12 may be mediated by the activator of transcription protein STAT4.
[0066] In particular embodiments, a biomarker of the present disclosure includes IL-4. An exemplary IL-4 sequence includes UniProt ID P05112. IL-4 participates in at least several B-cell activation processes such as induction of expression of class II MHC molecules on resting B cells. It is a co-stimulator of DNA synthesis. It enhances both secretion and cell surface expression of IgE and IgG1. IL-4 also controls the expression of the low affinity Fc receptor for IgE (CD23) on both lymphocytes and monocytes.
[0067] In particular embodiments, a biomarker of the present disclosure includes IL-5. An exemplary IL-5 sequence includes UniProt ID P05113-1, which includes a signal peptide (SEQ ID NO: 25, encoded by SEQ ID NO: 62). In particular embodiments, IL-5 lacks a signal peptide (SEQ ID NO: 26, encoded by SEQ ID NO: 63). IL-5 is a disulfide-linked homodimer. It promotes the growth, differentiation, and activation of eosinophils, white blood cells that protect against parasites and infection. IL-5 induces terminal differentiation of late-developing B-cells to immunoglobulin secreting cells. IL-5 binds a heterodimeric receptor, whose beta subunit is shared with the receptors for IL-3 and granulocyte macrophage colony stimulating factor (GM-CSF).
[0068] In particular embodiments, a biomarker of the present disclosure includes IL-6. An exemplary IL-6 sequence includes UniProt ID P05231-1, which includes a signal peptide (SEQ ID NO: 27, encoded by SEQ ID NO: 64). In particular embodiments, IL-6 lacks a signal peptide (SEQ ID NO: 28, encoded by SEQ ID NO: 65). IL-6 has many biological functions in immunity, tissue regeneration, and metabolism. It binds to IL-6 receptor (IL-6R). It contributes to host defense during infection and tissue injury; however, excessive IL-6 synthesis is involved in disease pathology. In the innate immune response, IL-6 is produced by myeloid cells, such as macrophages and dendritic cells. In the adaptive immune response, it is involved in the differentiation of B cells into immunoglobulin-secreting cells. IL-6 is secreted into the serum and induces a transcriptional inflammatory response through IL-6 receptor alpha.
[0069] In particular embodiments, a biomarker of the present disclosure includes IL-9. An exemplary IL-9 sequence includes UniProt ID P15248-1, which includes a signal peptide (SEQ ID NO: 29, encoded by SEQ ID NO: 66). In particular embodiments, IL-9 lacks a signal peptide (SEQ ID NO: 30, encoded by SEQ ID NO: 67). IL-9 regulates a variety of hematopoietic cells, stimulates cell proliferation, and prevents apoptosis. Signal transducer and activator (STAT) proteins are activated when IL-9 binds to the IL-9 receptor (IL-9R). In particular embodiments, IL-9 may play a role in the pathogenesis of bronchial hyperresponsiveness in asthma.
[0070] In particular embodiments, a biomarker of the present disclosure includes IL-10. An exemplary IL-10 sequence includes UniProt ID P22301-1, which includes a signal peptide (SEQ ID NO: 31, encoded by SEQ ID NO: 68). In particular embodiments, IL-10 lacks a signal peptide (SEQ ID NO: 32, encoded by SEQ ID NO: 69). IL-10 has anti-inflammatory functions, including limiting excessive tissue disruption caused by inflammation. The binding of IL10 to a hetero-tetrameric receptor including IL10RA and IL10RB leads to JAK/STAT signaling and expression of anti-inflammatory mediators. IL-10 inhibits release of pro-inflammatory cytokines (e.g., GM-CSF, granulocyte colony-stimulating factor (G-CSF), IL-1, IL-1, IL-6, IL-8 and TNF-) from antigen-presenting cells (APCs) such as macrophages and monocytes. In particular embodiments, IL-10 can interfere with antigen presentation by reducing the expression of MHC class II and co-stimulatory molecules, thereby inhibiting T cell activation. In particular embodiments, IL-10 can regulate macrophage inflammatory response by reprogramming metabolic pathways including mTOR signaling.
[0071] In particular embodiments, a biomarker of the present disclosure includes IL-17B. An exemplary IL-17B sequence includes UniProt ID Q9UHF5. IL-17B stimulates the release of TNF and IL-1 from the monocytic cell line THP-1.
[0072] In particular embodiments, a biomarker of the present disclosure includes IL-17E/IL-25. An exemplary IL-17E/IL-25 sequence includes UniProt ID Q9H293. IL-17E is a proinflammatory cytokine favoring Th2-type immune responses. It induces activation of NF-kappa- and stimulates production of the proinflammatory chemokine IL-8.
[0073] In particular embodiments, a biomarker of the present disclosure includes IL-22. An exemplary IL-22 sequence includes UniProt ID Q9GZX6-1, which includes a signal peptide (SEQ ID NO: 33, encoded by SEQ ID NO: 70). In particular embodiments, IL-22 lacks a signal peptide (SEQ ID NO: 34, encoded by SEQ ID NO: 71). IL-22 binds to a heterodimeric cell surface receptor including IL-10R2 and IL-22R1 subunits. IL-22 is produced by immune cells including T cells, T cells, NKT, ILC3, neutrophils, and macrophages. IL-22 can stimulate cell survival, cell proliferation, and synthesis of anti-microbials in non-hematopoietic cells and thus functions in wound healing and protection against microbes. In particular embodiments, IL-22 contributes to the inflammatory response in vivo through signal transduction via IL-10R2 and IL-22R1. In particular embodiments, IL-22 function can be regulated by IL-22BP, a soluble binding protein and/or cytokine IL-17A.
[0074] In particular embodiments, a biomarker of the present disclosure includes Intercellular Adhesion Molecule 1 (ICAM1). An exemplary ICAM1 sequence includes UniProt ID P05362. ICAM proteins are ligands for the leukocyte adhesion protein LFA-1 (integrin alpha-L/beta-2). During leukocyte trans-endothelial migration, ICAM1 engagement promotes the assembly of endothelial apical cups through Rho guanine nucleotide exchange factor 26 (ARHGEF26)/SGEF and RhoG GTPase (RHOG) activation.
[0075] In particular embodiments, a biomarker of the present disclosure includes Tumor Necrosis Factor alpha (TNF). An exemplary TNF sequence includes UniProt ID P01375. TNF binds to TNFRSF1A/TNFR1 and TNFRSF1B/TNFBR. It is mainly secreted by macrophages and can induce cell death of certain tumor cell lines. It stimulates IL-1 secretion. In particular embodiments, TNF can stimulate cell proliferation and induce cell differentiation. In particular embodiments, it impairs regulatory T-cell function. It functions in angiogenesis by inducing vascular endothelial growth factor (VEGF) production synergistically with IL-1B and IL6.
[0076] In particular embodiments, a biomarker of the present disclosure includes Interferon gamma (IFN). An exemplary IFN sequence includes UniProt ID P01579-1, which includes a signal peptide (SEQ ID NO: 35, encoded by SEQ ID NO: 72). In particular embodiments, IFN lacks a signal peptide (SEQ ID NO: 36, encoded by SEQ ID NO: 73). IFN is a member of the type II interferon class. IFN is produced by lymphocytes activated by specific antigens or mitogens. Active IFN is a homodimer that functions by binding to the IFN receptor to trigger a cellular response to viral and microbial infections. IFN is a potent activator of macrophages, has antiproliferative effects on transformed cells, and can potentiate the antiviral and antitumor effects of the type I interferons.
[0077] In particular embodiments, a biomarker of the present disclosure includes Thymic Stromal Lymphopoietin (TSLP). An exemplary TSLP sequence includes UniProt ID Q969D9. TSLP induces the release of T-cell-attracting chemokines from monocytes. In particular embodiments, it enhances the maturation of CD11c.sup.+ dendritic cells. It can induce allergic inflammation by directly activating mast cells.
[0078] In particular embodiments, a biomarker of the present disclosure includes Vascular Cell Adhesion Molecule 1 (VCAM1). An exemplary VCAM1 sequence includes UniProt ID P19320. VCAM1 functions in in cell-cell recognition. In particular embodiments, VCAM1 functions in leukocyte-endothelial cell adhesion. It interacts with integrin alpha-4/beta-1 (ITGA4/ITGB1) on leukocytes and mediates both adhesion and signal transduction.
[0079] In particular embodiments, a biomarker of the present disclosure includes Transforming Growth Factor beta (TGF). An exemplary TGF sequence includes UniProt ID P01137. TGF includes a regulatory Latency-associated peptide (LAP) and an active subunit (TGF chain). TGF is a multifunctional protein that regulates the growth and differentiation of various cell types and plays a role in many processes, including normal development, immune function, microglia function and responses to neurodegeneration.
[0080] In particular embodiments, a biomarker of the present disclosure includes Cytotoxic T-Lymphocyte Associated Protein 4 (CTLA4). An exemplary CTLA4 sequence includes UniProt ID P16410. CTLA4 is an inhibitory receptor that negatively regulates T-cell responses. CTLA4 has a high affinity for its natural B7 family ligands, CD80 and CD86.
[0081] In particular embodiments, a biomarker of the present disclosure includes Granulocyte Macrophage Colony Stimulating Factor (GM-CSF), also known as colony stimulating factor 2 (CSF2). An exemplary GM-CSF sequence includes UniProt ID P04141-1, which includes a signal peptide (SEQ ID NO: 37, encoded by SEQ ID NO: 74). In particular embodiments, GM-CSF lacks a signal peptide (SEQ ID NO: 38, encoded by SEQ ID NO: 75). Active GM-CSF is found extracellularly as a homodimer. GM-CSF stimulates the growth and differentiation of hematopoietic precursor cells from various lineages, including granulocytes, macrophages, eosinophils and erythrocytes. In particular embodiments, GM-CSF promotes tissue inflammation.
[0082] In particular embodiments, a biomarker of the present disclosure includes serum amyloid A (SAA). An exemplary SAA sequence includes UniProt ID P0DJI8-1, which includes a signal peptide (SEQ ID NO: 39, encoded by SEQ ID NO: 76). In particular embodiments, SAA lacks a signal peptide (SEQ ID NO: 40, encoded by SEQ ID NO: 77). SAA is an acute phase protein that recycles and reuses cholesterol in the cell membranes of new cells produced in response to damaged tissue repair and inflammation. In particular embodiments, SAA is a biomarker of inflammation caused by tissue injury or other traumas. In particular embodiments, the concentration of SAA in human blood can increase 1000-fold or more during inflammation. SAA features in AA amyloidosis, a disorder characterized by the extracellular tissue deposition of fibrils that are composed of intact and/or fragments of SAA. The N-terminal portion of the mature SAA protein has antimicrobial activity against S. aureus and E. coli.
[0083] In particular embodiments, a biomarker of the present disclosure includes C-reactive protein (CRP). An exemplary CRP sequence includes UniProt ID P02741-1, which includes a signal peptide (SEQ ID NO: 41, encoded by SEQ ID NO: 78). In particular embodiments, CRP lacks a signal peptide (SEQ ID NO: 42, encoded by SEQ ID NO: 79). CRP belongs to the pentraxin family which also includes serum amyloid P component protein and pentraxin 3. CRP is made in the liver and its levels increase in the blood in response to inflammation. CRP circulates in blood as a pentamer and is a non-soluble monomer in tissues. CRP functions in host defense, including promoting agglutination, bacterial capsular swelling, phagocytosis, and complement fixation. In particular embodiments, CRP functions through its calcium-dependent binding to phosphorylcholine. CRP is able to interact with DNA and histones and may scavenge nuclear material released from damaged circulating cells.
[0084] In particular embodiments, a biomarker of the present disclosure includes C-type lectin-like receptor CD161 (also known as KLRB1). An exemplary CD161 sequence includes UniProt ID Q12918-1 (SEQ ID NO: 43, encoded by SEQ ID NO: 80). CD161 is a type II membrane protein having an extracellular domain with several motifs characteristic of C-type lectins, a transmembrane domain, and a cytoplasmic domain. CD161 is expressed by: a majority of NK cells, natural killer T (NKT) cells, T cells, and cells of the gut and liver. CD161 is an early marker expressed by an NK cell as it matures from a CD34+ hematopoietic stem cell precursor. Lectin-like transcript-1 (LLT-1, or osteoclast inhibitory lectin (CLEC2D)) is the ligand of CD161. In particular embodiments, a biomarker of the present disclosure includes CD161+ cells or a population of cells that are CD161+. In particular embodiments, CD161 is expressed by CD3+ T cells. In particular embodiments, CD161 is expressed by CD8+ T cells. In particular embodiments, CD161 is expressed by CD4+ T cells. In particular embodiments, CD161 is expressed by CD56+ cells. In particular embodiments, CD161 is expressed by mucosal invariant T (MAIT) cells. MAIT cells are enriched at mucosal sites and express a semi-invariant TCR that recognizes biosynthetic derivatives of riboflavin synthesis presented by the non-classical class Ib molecule major histocompatibility complex (MHC)-related 1 (MR1). Though enriched at mucosal sites, MAIT cells are present in peripheral blood and part of airway T cells and liver T cells. MAIT cells function in defense against pathogens (e.g., bacterial, viral) and in tissue repair. In particular embodiments, MAIT cells can function in an MR1-TCR independent manner associated with an antiviral response and can be activated by cytokines including IL-7, IL-12, IL-15, IL-18, and type I IFNs.
[0085] In particular embodiments, a biomarker of the present disclosure includes CD56 (also known as neural cell adhesion molecule 1, NCAM1). An exemplary CD56 sequence includes UniProt ID P13591-2, which includes a signal peptide (SEQ ID NO: 44, encoded by SEQ ID NO: 81). In particular embodiments, CD56 lacks a signal peptide (SEQ ID NO: 45, encoded by SEQ ID NO: 82). CD56 is a homophilic binding glycoprotein expressed on the surface of neurons, glia, and skeletal muscle. In particular, the expression of CD56 is associated with NK cells. In addition to being a marker of neural lineage commitment, CD56 expression is also found in the hematopoietic system and is involved in expansion of T lymphocytes, B lymphocytes, and NK cells. CD56 has been detected on lymphoid cells, including gamma delta () T cells and activated CD8+ T cells, as well as on dendritic cells. CD56 has been implicated as having a role in cell-cell adhesion, neurite outgrowth, synaptic plasticity, and learning and memory. In particular embodiments, CD56 functions in signal transduction by interacting with fibroblast growth factor receptors, N-cadherin, and other components of the extracellular matrix and by triggering signaling cascades involving FYN-focal adhesion kinase (FAK), mitogen-activated protein kinase (MAPK), and phosphatidylinositol 3-kinase (PI3K).
[0086] In particular embodiments, a biomarker of the present disclosure includes CD56+ dim cells or a population of cells that are CD56+ dim. Circulating NK cells (peripheral blood NK cells) may include CD56+ bright NK cells and CD56+ dim NK cells. CD56+ dim NK cells are more cytotoxic and express higher levels of Ig-like NK receptors and FC receptor III (CD16) than CD56+ bright NK cells. By contrast, CD56+ bright cells are immunoregulatory, less mature, and produce abundant cytokines following activation of monocytes, but have low cytotoxicity and are CD16dim or CD16. In particular embodiments, 90% of circulating NK cells are CD56+ dim CD16+ bright and 10% of circulating NK cells are CD56+ bright and CD16/dim. CD56+ dim and CD56+ bright cell populations, which reflect low and high cell surface density of CD56, respectively, may be distinguished by flow activated cell sorting (FACS) using an anti-CD56 antibody as described by Caligiuri et al. The Journal of experimental medicine. 1990; 171(5):1509-1526 and Cooper et al. Blood 2001; 97:3146-3151. In particular embodiments, CD56+ dim cells have fluorescence of <3000 while CD56+ bright cells have fluorescence of 3000, as measured by flow cytometry with a Brilliant Violet 650 (BioLegend) fluorophore labeled antibody that binds CD56 (see
[0087] (II) Responses to an immunomodulatory treatment. Biomarker profiles of the present disclosure can be used to predict the type of response a subject will have to an immunomodulatory treatment. In particular embodiments, an immunomodulatory treatment includes all therapeutic interventions directed to modulating an immune response. In particular embodiments, an immunomodulatory treatment includes immune effector cells. Immune effector cells include cells from the human body that have transformed into a form capable of modulating or effecting an immune response. The immune effector cells may be produced ex vivo (e.g., by genetically modifying T cells to express chimeric antigen receptors) and infused into a patient or may be produced in vivo following administration of an immunotherapy (e.g., immunotherapy with dendritic cells to stimulate endogenous T cells in the body). In particular embodiments, an immunomodulatory treatment includes immunotherapy, which treats a disease by activating or suppressing the immune system. In particular embodiments, immunotherapy includes therapies that use chimeric antigen receptor (CAR) modified T cells, therapeutic agents to deplete regulatory T cells, recombinant cytokines, immune checkpoint inhibitors, monoclonal antibodies, bispecific antibodies, dual-affinity retargeting antibodies (DART), immune-mobilizing monoclonal T cell receptors against cancer (ImmTAC), and vaccines. In particular embodiments, an immune response can be stimulated or increased to fight infections or cancer. In particular embodiments, an immune response can be suppressed or decreased in autoimmune diseases, allergic reactions, and organ transplantation with similar immunotherapies as used to fight cancer. For example, CAR T cells can target autoantigens to suppress autoimmunity, and activity of pathogenic cells that drive autoimmunity may be suppressed by immune checkpoint inhibitors. These immunotherapies, whether to activate the immune system or suppress it, may cause CRS and/or NTX.
[0088] CAR T cell therapy involves isolating T cells from a patient and genetically engineering the isolated T cells to express a CAR, a receptor that has been designed to recognize and bind to a specific molecule, or antigen, on tumor cells. The binding of the CAR to an antigen on a tumor cell triggers killing of the tumor cell. The CAR-modified T cells may be expanded in the lab before infusion back into the patient. Once inside the patient, the CAR-modified T cells may further divide in the patient, recognize and bind the particular antigen on tumor cells, and kill the tumor cells. Approved CAR T cell therapies include tisagenlecleucel (Kymriah; Novartis) to treat pediatric and young adult B-cell acute lymphoblastic leukemia (ALL); axicabtagene ciloleucel (Yescarta; Kite Pharma, Gilead Sciences Inc.) and lisocabtagene maraleucel (Breyanzi; Bristol Myers Squibb) to treat large B cell lymphoma; and brexucabtagene autoleucel (Tecartus; Kite Pharma, Gilead Sciences Inc.) to treat mantle cell lymphoma and adult ALL. All use CD19-targeted CAR T cells. Other antigens are being targeted in development of CAR T cell therapies, including CD22, CD123, and BCMA.
[0089] Regulatory T cells (Treg cells) are immunosuppressive and may be an obstacle to initiating or enhancing an anti-tumor immune response. In particular embodiments, a therapeutic agent to deplete Treg cells may be an immunotherapy to fight cancer. Therapeutic agents may include low-dose cyclophosphamide (CTX), a common chemotherapeutic agent that targets rapidly dividing cells, as Treg cells have a higher rate of proliferation. In particular embodiments, anti-cancer agents including tyrosine kinase inhibitors sunitinib, sorafenib, and imatinib may reduce the levels of intra-tumoral Treg cells. Other agents to target Treg cells include daclizumab (CD25 blocking antibody) and denileukin diftitox (Ontak, IL-2-diphtheria toxin conjugate protein). A large number of receptors are upregulated on Treg cells in the tumor microenvironment including ICOS, OX40, GITR, TIGIT, PD-1, and CTLA-4, and these receptors may be targeted by, for example, antibodies to deplete Treg cells.
[0090] Recombinant cytokines may be used in cancer immunotherapy due to their anti-proliferative or pro-apoptotic effects against tumor cells or due to their ability to stimulate the cytotoxic function of immune cells. Examples of recombinant cytokines that are approved immunotherapies include: IL-2 to treat advanced renal cell carcinoma and metastatic melanoma; and IFN- to treat hairy cell leukemia, follicular non-Hodgkin lymphoma, melanoma, and AIDS-related Kaposi's sarcoma. IL-2 promotes expansion of NK cells and T lymphocytes, while IFN- has potent anti-angiogenic activity. Other cytokines being studied for immunotherapy include IL-15, IL-21, IL-12, IL-10, and GM-CSF.
[0091] Immune checkpoint proteins are useful to control overactive immune responses as part of the immune system. However, in the context of tumor cells, immune checkpoint proteins, which are found on the surface of T cells, can impede the function of T cells such that the T cells are not able to destroy tumor cells. Immune checkpoint inhibitors have been developed that target immune checkpoint proteins so that the immune checkpoint proteins are not able to bind their cognate ligands on tumor cells, allowing T cells to perform their cytotoxic functions against tumors. Approved immune checkpoint inhibitors include monoclonal antibodies: nivolumab (Opdivo) and pembrolizumab (Keytruda) that target the immune checkpoint protein PD-1; atezolizumab (Tecentriq) and durvalumab (Imfinzi) that target the ligand for PD-1, PD-L1; and ipilimumab (Yervoy) that targets the immune checkpoint protein CTLA-4.
[0092] Monoclonal antibodies and bispecific antibodies may serve as immunotherapy in cancer by marking cancer cells for destruction by the immune system or by bringing immune cells close to their tumor cell targets for tumor cell killing. For example, the monoclonal antibody rituximab binds to CD20 on cells and triggers cell death. Rituximab is used to treat autoimmune diseases and certain types of cancer. Monoclonal antibody therapies include the monoclonal antibodies developed against immune checkpoint proteins. Bispecific antibodies for immunotherapy include antibodies that bind to an immune cell and to a tumor-associated antigen to re-direct the immune cell to a tumor. An example is blinatumomab (Blincyto), which binds to both CD19 on the surface of leukemia cells, and CD3 on the surface of T cells. Bispecific antibodies also include tumor-targeted immunomodulators and dual immunomodulators that are being developed for immunotherapy. Tumor-targeted immunomodulators bind to a tumor-associated antigen and to a costimulatory molecule like CD40 or 4-1BB to direct potent costimulation to tumor-infiltrating cells. Dual immunomodulators bind to two distinct immunomodulatory targets to provoke a more powerful response against tumor cells (e.g., a bispecific that binds both PD-1 and CTLA-4). A DART (Dual-affinity Re-targeting Antibody) is another example of a bispecific antibody. A DART includes two engineered variable fragments (Fv) that allow greater flexibility of the variable heavy and variable light portions to improve binding to a target.
[0093] An ImmTAC (Immune Mobilizing Monoclonal TCRs Against Cancer) includes a bispecific biologic that combines an engineered TCR that recognizes a tumor cell with immune activating complexes. In particular embodiments, an ImmTAC includes a fusion protein of an engineered, soluble, affinity-enhanced monoclonal T cell receptor (to recognize MHC-presented tumor antigens) and a humanized anti-CD3 single chain antibody fragment (to re-direct non-tumor-specific T cells to a tumor) (Bossi et al. Cancer Immunol Immunother. 2014; 63(5):437-448; Boudousquie et al. Immunology. 2017; 152(3):425-438). An ImmTAC, tebentafusp, is being developed against uveal melanoma (Immunocore Limited, Oxfordshire, UK).
[0094] Cancer vaccines help a patient's immune system recognize and eliminate cancer cells. Vaccines can include molecules (e.g. proteins, peptides, nucleic acids), cells, or parts of cells, that when introduced into a patient, increases the patient's immune response against cancer cells. Some cancers are caused by viral infections, so some vaccines have been developed to prevent viral infection. Preventive cancer vaccines include: human papillomavirus (HPV) vaccines that prevent infection from 2, 4, or 9 types of HPV, which can lead to cervical, head, and neck cancers; and a hepatitis B (HBV) vaccine that protects against development of HBV-related liver cancer. In embodiments, therapeutic cancer vaccines that treat existing cancers have been developed. These include: sipuleucel-T for advanced prostate cancer (activated dendritic cells and prostatic acid phosphatase antigen); talimogene laherparepvec (TVEC) for metastatic melanoma (genetically modified oncolytic type I herpes simplex virus); and Bacillus Calmette-Guerin (BCG) for early stage bladder cancer (a weakened bacteria).
[0095] Individuals undergoing an immunomodulatory treatment can have an aberrant or semi-functional response to the immunomodulatory treatment. In particular embodiments, an aberrant or semi-functional response to an immunomodulatory treatment includes having non-response (i.e. dysfunctional response) to the immunomodulatory treatment. In particular embodiments, a subject may be characterized as having a non-response to an immunomodulatory treatment when the subject does not have a complete response to an immunomodulatory treatment or briefly had a complete response to an immunomodulatory treatment but the disease has returned even in the presence of the agent of an immunomodulatory treatment (e.g., cancer relapse even in presence of CAR T cells in CAR T cell immunotherapy). Non-responses can include aspects of immune cell function, the particular target tissue that is undergoing an immunomodulatory treatment, the microenvironment in which an immunomodulatory treatment occurs, or a combination thereof. In particular embodiments, a non-response to CAR T cell therapy can include: no or reduced proliferation of CAR-modified cells (e.g., T or NK cells) and limited cytokine production; pro-inflammatory cytokine production prior to, during, and/or post CAR T cell therapy; CAR T cell exhaustion; impaired CAR T cell expansion; impaired CAR T cell cytotoxicity; target antigen loss from a tumor; diminished antigen expression; lineage switch; gene mutations in tumors; failed infiltration of CAR T cells; and CAR T cell rejection. T cell exhaustion refers to a state of dysfunction characterized by a progressive loss of effector function due to chronic antigen stimulation and/or increased expression of inhibitory receptors, usually in cancer and chronic infections. In particular embodiments, enhanced expression of regulators of aerobic glycolysis and/or CAR T cell differentiation (e.g., IL-6/STAT3 signaling) is associated with non-response to CAR T cell therapy. In particular embodiments, differentiated effector/memory T cells have decreased proliferation capacity when stimulated by antigen.
[0096] CRS can occur after treatment with immunotherapy. In particular embodiments, CRS is characterized by a large, rapid release of cytokines into the blood from immune cells affected by the immunotherapy. In particular embodiments, CRS may be more broadly defined as a supraphysiologic response following any immune therapy that results in the activation or engagement of endogenous or infused T cells and/or other immune effector cells. Symptoms can be progressive, includes fever at the onset, and may include hypotension, capillary leak (hypoxia), and end organ dysfunction (Lee et al. (2019) Biol Blood Marrow Transplant. 25:625-638). Fever is a hallmark of CRS. In particular embodiments, other CRS symptoms may include: tachypnea, dyspnea, tachycardia, headache, hypotension, hypoxia, rash, nausea, myalgias, malaise, capillary leak, and/or multiorgan dysfunction. Published grading systems for CRS include: Common Terminology Criteria for Adverse Events (CTCAE) version 4.03 (National Cancer Institute, available at World Wide Web at evs.nci.nih.gov/ftpl/CTCAE/CTCAE_4.03/CTCAE_4.03_2010-06-14_QuickReference_8.511.pdf.); CTCAE version 5.0 (National Cancer Institute, available at ctep.cancer.gov/protocol Development/electronic_applications/docs/CTCAE_v5_Quick_Reference_8.511.pdf); Lee criteria (Lee et al. (2014) Blood 124:188-195); Penn criteria (Porter et al. (2018) J Hematol Oncol 11:35); MSKCC criteria (Park et al. (2018) N Engl J Med 378:449-459); CARTOX criteria (Neelapu et al. (2018) Nat Rev Clin Oncol. 15:47-62); and American Society for Transplantation and Cellular Therapy (ASTCT) consensus grading (Lee et al. (2019) Biol Blood Marrow Transplant. 25:625-638).
[0097] For example, under the CTCAE version 5.0 grading system, the four grades of CRS include the following descriptions: Grade 1, fever with or without constitutional symptoms; Grade 2, hypotension responding to fluids and/or hypoxia responding to <40% FiO.sub.2 (inspired oxygen); Grade 3, hypotension managed with one pressor and/or hypoxia requiring 40% FiO.sub.2; and Grade 4, life-threatening consequences and/or urgent intervention indicated. In particular embodiments, severe CRS includes the need for vasopressors or inotropes, and/or includes respiratory failure.
[0098] In particular embodiments, an aberrant or semi-functional response to an immunomodulatory treatment includes having a toxic response to an immunomodulatory treatment. In particular embodiments, subjects who have a toxic response have neurological toxicities (neurotoxicities (NTX), or immune effector cell-associated neurotoxicity syndrome (ICANS)). NTX can affect the peripheral and central nervous system and include aphasia, dysgraphia, obtundation, stupor, lethargy, delirium, confusion, hallucinations, tremor, seizures, cerebral edema, coma, global encephalopathy, polyneuropathy, myositis, myasthenia gravis, demyelinating polyradiculopathy, myelitis, and encephalitis. In particular embodiments, NTX may occur during or after CRS symptoms but rarely before CRS. In particular embodiments, NTX may be characterized by a pathologic process involving the central nervous system following any immune therapy that results in the activation or engagement of endogenous or infused T cells and/or other immune effector cells (Lee et al. (2019) Biol Blood Marrow Transplant. 25:625-638). In particular embodiments, symptoms may be progressive and include aphasia, altered level of consciousness, impairment of cognitive skills, motor weakness, seizures, and cerebral edema. Published NTX grading systems include: CTCAE version 5.0, National Cancer Institute, available at ctep.cancer.gov/protocol Development/electronic_applications/docs/CTCAE_v5_Quick_Reference_8.511.pdf; CARTOX criteria (Neelapu et al. (2018) Nat Rev Clin Oncol. 15:47-62); and ASTCT consensus grading (Lee et al. (2019) Biol Blood Marrow Transplant. 25:625-638).
[0099] For example, under the CTCAE version 5.0 grading system, the four grades of NTX include the following descriptions for various adverse events: Grade 1, mild symptoms for encephalopathy, brief partial seizure and no loss of consciousness for seizure, awareness of receptive or expressive characteristics and/or not impairing ability to communicate for dysphasia, mild symptoms for tremor, mild pain for headache, mild disorientation for confusion, and decreased level of alertness for depressed level of consciousness; Grade 2, moderate symptoms and/or limiting instrumental activities of daily living (ADL) for encephalopathy, brief generalized seizure for seizure, moderate receptive or expressive characteristics and/or impairing ability to communicate spontaneously for dysphasia, moderate symptoms and/or limiting instrumental ADL for tremor, moderate pain and/or limiting instrumental ADL for headache, moderate disorientation and/or limiting instrumental ADL for confusion, and sedation, slow response to stimuli, and/or limiting instrumental ADL for depressed level of consciousness; Grade 3, severe symptoms and/or limiting self-care ADL for encephalopathy, new-onset seizures (partial or generalized) and/or multiple seizures despite medical intervention for seizure, severe receptive or expressive characteristics and/or impairing ability to read, write, and communicate intelligibly for dysphasia, severe symptoms and/or limiting self-care ADL for tremor, severe pain and/or limiting self-care ADL for headache, severe disorientation and/or limiting self-care ADL for confusion, difficult to arouse for depressed level of consciousness, and new onset and/or worsening from baseline for cerebral edema; Grade 4, life-threatening consequences and/or urgent intervention indicated for encephalopathy, life-threatening consequences for seizure, life-threatening consequences and/or urgent intervention indicated for confusion, life-threatening consequences and/or urgent intervention indicated for depressed level of consciousness, and life-threatening consequences and/or urgent intervention indicated for cerebral edema. In particular embodiments, severe NTX may be defined by grade 3/4 NTX exclusive of headache as defined by a grading system. In particular embodiments, limited NTX may include Grade 1 NTX as defined by a grading system. In particular embodiments, mild NTX may include any grade seizure as defined by a grading system.
[0100] Guidelines for grading and management of CRS and NTX are discussed in, for example, Thompson (2018) Natl Compr Canc Netw. 16(suppl 5):594-596; Neelapu et al. (2018) Nat Rev Clin Oncol. 15:47-62; Lee et al. (2014) Blood 124:188-195; and Lee et al. (2019) Biol Blood Marrow Transplant. 25:625-638.
[0101] In particular embodiments, a biomarker profile can predict a toxic response and/or a non-response to an immunomodulatory treatment by a subject. In particular embodiments, a toxic response and/or a non-response to an immunomodulatory treatment by a subject includes decreased overall survival, as compared to a reference. In particular embodiments, subjects who have a toxic response have NTX. In particular embodiments, a toxic response and/or a non-response to an immunomodulatory treatment by a subject includes CRS. In particular embodiments, a toxic response and/or a non-response to an immunomodulatory treatment by a subject includes decreased days to CRS onset, as compared to a reference. In particular embodiments, subjects who are non-responsive to an immunomodulatory treatment have a dysfunctional response. In particular embodiments, a subject who has a dysfunctional response to an immunomodulatory treatment either does not have or briefly had a functional response but had returned to disease while still having the therapeutic from the immunomodulatory treatment, with no or mild toxicity. In particular embodiments, a toxic response and/or a non-response to an immunomodulatory treatment by a subject includes increased levels of pro-inflammatory cytokines prior to an immunomodulatory treatment and continued increased levels of pro-inflammatory cytokines during or after an immunomodulatory treatment, as compared to a reference. In particular embodiments, a toxic and/or non-response to an immunomodulatory treatment by a subject includes no increase in levels of pro-inflammatory cytokines prior to an immunomodulatory treatment and increased levels of pro-inflammatory cytokines during or after an immunomodulatory treatment, as compared to a reference. In particular embodiments, a toxic and/or non-response to an immunomodulatory treatment by a subject includes active IL-18 signaling and/or IFN production, as compared to a reference. In particular embodiments, a reference includes a subject or population of subjects who have a functional response to an immunomodulatory treatment with limited or no NTX.
[0102] In particular embodiments, a toxic response and/or non-response to an immunomodulatory treatment by a subject includes: an increased level of IL-18; an increased level of IL-18BP; an increased level of IL-18R1; an increased level of IL-18RAP; an increased level of sIL-2RA; an increased level of IL-2; an increased level of IL-5; an increased level of IL-6; an increased level of IL-9; an increased level of IL-10; an increased level of IL-22; an increased level of IFN; an increased level of GM-CSF; an increased level of SAA; an increased level of CRP; an increased level of CD161+ cells; an increased level of CD56+ dim cells; or a combination thereof, as measured in a test sample from the subject as compared to the same biomarkers of a reference biomarker profile. In particular embodiments, CD161+ cells include: CD161+CD3+ T cells; CD161+CD4+ T cells; CD161+CD4+CD45RA-T cells; CD161+CD8+ T cells; CD161+CD8+CD45RA+ T cells; CD161+CD56+ NK cells; CD161+ MAIT cells; CD161+GM-CSF+NK cells; CD161+GM-CSF+ MAIT cells; CD161+GM-CSF+ T cells; CD161+ IFN+NK cells; CD161+ IFN+ MAIT cells; CD161+ IFN+ T cells; CD161+ IFN+ NKT cells; or a combination thereof. In particular embodiments, the CD56+ dim cells are circulating NK cells.
[0103] In particular embodiments, a subject is identified as having a toxic response and/or non-response to an immunomodulatory treatment when the level of at least one biomarker selected from IL-18, IL-18BP, IL-18R1, IL-18RAP, sIL-2RA, IL-2, IL-5, IL-6, IL-9, IL-10, IL-22, IFN, GM-CSF, SAA, CRP, CD161+ cells, CD56+ dim cells, or a combination thereof, as measured in a test sample from the subject, is increased as compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is identified as having a toxic response and/or non-response to an immunomodulatory treatment when the levels of at least two, of at least three, of at least four, of at least five, of at least six, of at least seven, of at least eight, of at least nine, of at least ten, of at least eleven, of at least twelve, of at least thirteen, of at least fourteen, of at least fifteen, or of at least sixteen, biomarkers including IL-18, IL-18BP, IL-18R1, IL-18RAP, sIL-2RA, IL-2, IL-5, IL-6, IL-9, IL-10, IL-22, IFN, GM-CSF, SAA, CRP, CD161+ cells, and CD56+ dim cells, as measured in a test sample from the subject, are increased as compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is identified as having a toxic response and/or non-response to an immunomodulatory treatment when the level(s) of one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, or seventeen biomarkers including IL-18, IL-18BP, IL-18R1, IL-18RAP, sIL-2RA, IL-2, IL-5, IL-6, IL-9, IL-10, IL-22, IFN, GM-CSF, SAA, CRP, CD161+ cells, and CD56+ dim cells, as measured in a test sample from the subject, is/are increased as compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is identified as having a toxic response and/or non-response to an immunomodulatory treatment when the levels of all biomarkers including IL-18, IL-18BP, IL-18R1, IL-18RAP, sIL-2RA, IL-2, IL-5, IL-6, IL-9, IL-10, IL-22, IFN, GM-CSF, SAA, CRP, CD161+ cells, and CD56+ dim cells, as measured in a test sample from the subject, are increased as compared to the levels of the same biomarkers of a reference biomarker profile.
[0104] In particular embodiments, a subject is identified as having a toxic response and/or non-response to an immunomodulatory treatment when the level of at least one biomarker selected from IL-18, IL-18BP, sIL-2RA, IL-10, IL-22, IFN, CD161+ cells, or a combination thereof, as measured in a test sample from the subject, is increased as compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is identified as having a toxic response and/or non-response to an immunomodulatory treatment when the levels of at least two, of at least three, of at least four, of at least five, or of at least six, biomarkers including IL-18, IL-18BP, sIL-2RA, IL-10, IL-22, IFN, CD161+ cells, as measured in a test sample from the subject, are increased as compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is identified as having a toxic response and/or non-response to an immunomodulatory treatment when the level(s) of one, two, three, four, five, six, or seven biomarkers including IL-18, IL-18BP, sIL-2RA, IL-10, IL-22, IFN, CD161+ cells, as measured in a test sample from the subject, is/are increased as compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is identified as having a toxic response and/or non-response to an immunomodulatory treatment when the levels of all biomarkers including IL-18, IL-18BP, sIL-2RA, IL-10, IL-22, IFN, CD161+ cells, as measured in a test sample from the subject, are increased as compared to the levels of the same biomarkers of a reference biomarker profile.
[0105] In particular embodiments, a subject is identified as having a toxic response and/or non-response to an immunomodulatory treatment when the level of at least one biomarker selected from IL-10, IFN, GM-CSF, SAA, or a combination thereof, as measured in a test sample from the subject, is increased as compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is identified as having a toxic response and/or non-response to an immunomodulatory treatment when the level of at least one biomarker selected from IL-10, IFN, GM-CSF, CRP, or a combination thereof, as measured in a test sample from the subject, is increased as compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is identified as having a toxic response and/or non-response to an immunomodulatory treatment when the level of at least one biomarker selected from sIL-2RA, IL-5, IL-10, GM-CSF, or a combination thereof, as measured in a test sample from the subject, is increased as compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is identified as having a toxic response and/or non-response to an immunomodulatory treatment when the level of at least one biomarker selected from IL-18, IL-18BP, IFN, or a combination thereof, as measured in a test sample from the subject, is increased as compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is identified as having a toxic response and/or non-response to an immunomodulatory treatment when the level of at least one biomarker selected from IL-18, IL-18BP, IL-22, or a combination thereof, as measured in a test sample from the subject, is increased as compared to the levels of the same biomarkers of a reference biomarker profile.
[0106] The biomarkers disclosed herein can be used to identify or predict a subject's response to an immunomodulatory treatment before initiation of the immunomodulatory treatment (pre-immunomodulatory treatment). In particular embodiments, pre-immunomodulatory treatment includes a time before apheresis is performed on a subject to extract the subject's T cells for genetic modification to express a CAR. This would be valuable so that the most appropriate immunotherapy can be selected for a subject, or allow removal of detrimental cell populations from a subject's cells destined to be developed into CAR T cells (e.g., removal of CD161+ cells as described herein).
[0107] In particular embodiments, a subject is identified as having or predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the level of at least one biomarker selected from IL-18, IL-18BP, IL-18R1, IL-18RAP, sIL-2RA, IL-2, IL-5, IL-6, IL-9, IL-10, IL-22, IFN, GM-CSF, SAA, CRP, CD161+ cells, and CD56+ dim cells, or a combination thereof, as measured in a test sample obtained from the subject pre-immunomodulatory treatment, is increased as compared to the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is identified as having a toxic response and/or non-response to an immunomodulatory treatment when the levels of at least two, of at least three, of at least four, of at least five, of at least six, of at least seven, of at least eight, of at least nine, of at least ten, of at least eleven, of at least twelve, of at least thirteen, of at least fourteen, of at least fifteen, or of at least sixteen, biomarkers including IL-18, IL-18BP, IL-18R1, IL-18RAP, sIL-2RA, IL-2, IL-5, IL-6, IL-9, IL-10, IL-22, IFN, GM-CSF, SAA, CRP, CD161+ cells, and CD56+ dim cells, as measured in a test sample obtained from the subject pre-immunomodulatory treatment, are increased as compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is identified as having a toxic response and/or non-response to an immunomodulatory treatment when the level(s) of one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, or seventeen biomarkers including IL-18, IL-18BP, IL-18R1, IL-18RAP, sIL-2RA, IL-2, IL-5, IL-6, IL-9, IL-10, IL-22, IFN, GM-CSF, SAA, CRP, CD161+ cells, and CD56+ dim cells, as measured in a test sample obtained from the subject pre-immunomodulatory treatment, is/are increased as compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is identified as having a toxic response and/or non-response to an immunomodulatory treatment when the levels of all biomarkers including IL-18, IL-18BP, IL-18R1, IL-18RAP, sIL-2RA, IL-2, IL-5, IL-6, IL-9, IL-10, IL-22, IFN, GM-CSF, SAA, CRP, CD161+ cells, and CD56+ dim cells, as measured in a test sample obtained from the subject pre-immunomodulatory treatment, are increased as compared to the levels of the same biomarkers of a reference biomarker profile.
[0108] In particular embodiments, a subject is identified as having or predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the level of at least one biomarker selected from IL-18, IL-18BP, IL-10, IL-22, sIL-2RA, IFN, CD161+ cells, CD56+ dim cells, or a combination thereof, as measured in a test sample obtained from the subject pre-immunomodulatory treatment, is increased as compared to the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the levels of at least two, of at least three, of at least four, of at least five, of at least six, or of at least seven, biomarkers including IL-18, IL-18BP, IL-10, IL-22, sIL-2RA, IFN, CD161+ cells, and CD56+ dim cells, as measured in a test sample obtained from the subject pre-immunomodulatory treatment, are increased as compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is predicted pre-immunomodulatory treatment to have a toxic response and/or non-response to an immunomodulatory treatment when the level(s) of one, two, three, four, five, six, seven, or eight biomarkers including IL-18, IL-18BP, IL-10, IL-22, sIL-2RA, IFN, CD161+ cells, and CD56+ dim cells, as measured in a test sample obtained from the subject pre-immunomodulatory treatment, is/are increased as compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is predicted pre-immunomodulatory treatment to have a toxic response and/or non-response to an immunomodulatory treatment when the levels of all biomarkers including IL-18, IL-18BP, IL-10, IL-22, sIL-2RA, IFN, CD161+ cells, and CD56+ dim cells, as measured in a test sample obtained from the subject pre-immunomodulatory treatment, are increased as compared to the levels of the same biomarkers of a reference biomarker profile.
[0109] In particular embodiments, the CD161+ cells include: CD161+CD3+ T cells; CD161+CD4+ T cells; CD161+CD4+CD45RA-T cells; CD161+CD8+ T cells; CD161+CD8+CD45RA+ T cells; CD161+CD56+ NK cells; CD161+ MAIT cells; CD161+GM-CSF+NK cells; CD161+GM-CSF+ MAIT cells; CD161+GM-CSF+ T cells; CD161+ IFN+NK cells; CD161+ IFN+ MAIT cells; CD161+ IFN+ T cells; CD161+ IFN+ NKT cells; or a combination thereof. Importantly, an increase in the level of CD161+ cells can be detected in a subject who has or is predicted to have a toxic response and/or non-response in a pre-apheresis blood sample drawn from the subject. Pre-apheresis includes a time that occurs before a decision is made on whether to perform apheresis to obtain a subject's T cells to modify for CAR T cell therapy. Therefore, in particular embodiments, an increase in the level of CD161+ may be a prognostic diagnostic for doctors to decide to exclude a subject from a CAR T cell therapy clinical trial. In particular embodiments, an increase in the level of CD161+ may be a prognostic diagnostic for doctors to decide to remove CD161+ cells from an apheresis product obtained from a subject prior to CAR T cell therapy as a treatment to drive a potential toxic response and/or nonresponse to a functional response.
[0110] Apheresis is a process that uses an apparatus to remove whole blood from a subject, separate out components of the blood for particular uses, and return the remaining components to the subject. In particular embodiments, in autologous CAR T cell therapy, a subject's T cells are obtained by apheresis, genetically modified to express a CAR, and the CAR-modified T cells are then infused into the subject for immunotherapy. In particular embodiments, an apheresis product includes T cells. In particular embodiments, an apheresis product includes mononuclear cells.
[0111] In particular embodiments, an increase in the level of CD161+ cells includes a 2-fold increase to a 10-fold increase, or a 4-fold increase to a 10-fold increase as compared to the level of CD161+ cells of a reference biomarker profile. In particular embodiments, an increase in the level of CD161+ cells includes a 2-fold, a 2.5-fold, a 3-fold, a 3.5-fold, a 4-fold, a 4.5-fold, a 5-fold, a 5.5-fold, a 6-fold, a 6.5-fold, a 7-fold, a 7.5-fold, an 8-fold, an 8.5-fold, a 9-fold, a 9.5-fold, a 10-fold, or more increase as compared to the level of CD161+ cells of a reference biomarker profile. In particular embodiments, the percentage of CD161+ cells in a test sample from a subject who has a toxic response and/or non-response to an immunomodulatory treatment includes 10% to 30% or 10% to 20% of total live cells in the test sample. In particular embodiments, the percentage of CD161+ cells in a test sample from a subject who has a toxic response and/or non-response to an immunomodulatory treatment includes 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, or more of total live cells in the test sample. In particular embodiments, the test sample includes PBMC cells. In particular embodiments, live cells can be determined using a viability dye in an assay such as LIVE/DEAD Fixable Blue Dead Cell Stain kit from ThermoFisher (Waltham, MA). The dye in the assay reacts with free amines both in the cell interior and on the cell surface of cells with compromised membranes, yielding intense fluorescent staining, while the dye's reactivity is restricted to the cell-surface amines in viable cells, resulting in less intense fluorescence. In particular embodiments, the difference in intensity is typically greater than 50-fold between live and dead cells, allowing for easy discrimination.
[0112] In particular embodiments, the CD56+ dim cells are circulating NK cells.
[0113] In particular embodiments, an increase in the level of CD56+ dim cells includes a 2-fold increase to a 10-fold increase, or a 4-fold increase to a 10-fold increase as compared to the level of CD56+ dim cells of a reference biomarker profile. In particular embodiments, an increase in the level of CD56+ dim cells includes 2-fold, a 2.5-fold, a 3-fold, a 3.5-fold, a 4-fold, a 4.5-fold, a 5-fold, a 5.5-fold, a 6-fold, a 6.5-fold, a 7-fold, a 7.5-fold, an 8-fold, an 8.5-fold, a 9-fold, a 9.5-fold, a 10-fold, or more increase as compared to the level of CD56+ dim cells of a reference biomarker profile. In particular embodiments, the test sample includes PBMC cells.
[0114] Biomarkers disclosed herein can be used to identify or predict a subject's response to an immunomodulatory treatment once the immunomodulatory treatment has initiated. In particular embodiments, biomarkers disclosed herein can be used to predict a subject's response to an immunomodulatory treatment once the immunomodulatory treatment has initiated but before any adverse symptoms of CRS and/or NTX are evident. This would be valuable so that a decision can be made early after an immunotherapy has started on whether the immunotherapy should be continued, adjusted (e.g., dosage), terminated, or terminated and another immunotherapy initiated, depending on the levels of biomarkers useful for predicting a subject's response after an immunomodulatory treatment has initiated as described herein. In particular embodiments, mean onset of NTX is 8 days after CAR T cell therapy has initiated, so being able to predict a subject's response before this time would allow early intervention points if the CAR T cell therapy needs to be adjusted, changed, or terminated. In particular embodiments, biomarkers disclosed herein can be used to predict a subject's response to an immunomodulatory treatment 1 day after an immunomodulatory treatment has initiated, 3 days after an immunomodulatory treatment has initiated, and/or 7 days after an immunomodulatory treatment has initiated. In particular embodiments, biomarkers disclosed herein can be used to predict a subject's response to an immunomodulatory treatment 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, or more after an immunomodulatory treatment has initiated.
[0115] In particular embodiments, a subject is identified as having or predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the level of at least one biomarker selected from IL-18, IL-18BP, IL-18R1, IL-18RAP, sIL-2RA, IL-2, IL-5, IL-6, IL-9, IL-10, IL-22, IFN, GM-CSF, SAA, CRP, or a combination thereof, as measured in a test sample obtained from the subject after an immunomodulatory treatment has initiated, is increased as compared to the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is identified as having a toxic response and/or non-response to an immunomodulatory treatment when the levels of at least two, of at least three, of at least four, of at least five, of at least six, of at least seven, of at least eight, of at least nine, of at least ten, of at least eleven, of at least twelve, of at least thirteen, or of at least fourteen, biomarkers including IL-18, IL-18BP, IL-18R1, IL-18RAP, sIL-2RA, IL-2, IL-5, IL-6, IL-9, IL-10, IL-22, IFN, GM-CSF, SAA, and CRP, as measured in a test sample obtained from the subject after an immunomodulatory treatment has initiated, are increased as compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is identified as having a toxic response and/or non-response to an immunomodulatory treatment when the level(s) of one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or fifteen biomarkers including IL-18, IL-18BP, IL-18R1, IL-18RAP, sIL-2RA, IL-2, IL-5, IL-6, IL-9, IL-10, IL-22, IFN, GM-CSF, SAA, and CRP, as measured in a test sample obtained from the subject after an immunomodulatory treatment has initiated, is/are increased as compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is identified as having a toxic response and/or non-response to an immunomodulatory treatment when the levels of all biomarkers including IL-18, IL-18BP, IL-18R1, IL-18RAP, sIL-2RA, IL-2, IL-5, IL-6, IL-9, IL-10, IL-22, IFN, GM-CSF, SAA, and CRP, as measured in a test sample obtained from the subject after an immunomodulatory treatment has initiated, are increased as compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, a test sample is obtained from a subject 1 day, 3 days, or 7 days after an immunomodulatory treatment has initiated.
[0116] In particular embodiments, a subject is identified as having or predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the level of at least one biomarker selected from IL-18, IL-18BP, IL-5, IL-10, IL-22, sIL-2RA, IFN, GM-CSF, SAA, CRP, or a combination thereof, as measured in a test sample obtained from the subject after an immunomodulatory treatment has initiated, is increased as compared to the level(s) of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the levels of at least two, of at least three, of at least four, of at least five, of at least six, of at least seven, of at least eight, or of at least nine, biomarkers including IL-18, IL-18BP, IL-5, IL-10, IL-22, sIL-2RA, IFN, GM-CSF, SAA, and CRP, as measured in a test sample obtained from the subject after an immunomodulatory treatment has initiated, are increased as compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the level(s) of one, two, three, four, five, six, seven, eight, nine, or ten biomarkers including IL-18, IL-18BP, IL-5, IL-10, IL-22, sIL-2RA, IFN, GM-CSF, SAA, and CRP, as measured in a test sample obtained from the subject after an immunomodulatory treatment has initiated, is/are increased as compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the levels of all biomarkers including IL-18, IL-18BP, IL-5, IL-10, IL-22, sIL-2RA, IFN, GM-CSF, SAA, and CRP, as measured in a test sample obtained from the subject after an immunomodulatory treatment has initiated, are increased as compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, a test sample is obtained from a subject 1 day, 3 days, or 7 days after an immunomodulatory treatment has initiated.
[0117] In particular embodiments, a subject is identified as having or predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the level of at least one biomarker selected from IL-10, SAA, GM-CSF, IFN, or a combination thereof, as measured in a test sample obtained from the subject 1 day after an immunomodulatory treatment has initiated, is increased as compared to the level(s) of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the levels of at least two or of at least three biomarkers including IL-10, SAA, GM-CSF, and IFN, as measured in a test sample obtained from the subject 1 day after an immunomodulatory treatment has initiated, are increased as compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the level(s) of one, two, three, or four biomarkers including IL-10, SAA, GM-CSF, and IFN, as measured in a test sample obtained from the subject 1 day after an immunomodulatory treatment has initiated, is/are increased as compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the levels of all biomarkers including IL-10, SAA, GM-CSF, and IFN, as measured in a test sample obtained from the subject 1 day after an immunomodulatory treatment has initiated, are increased as compared to the levels of the same biomarkers of a reference biomarker profile.
[0118] In particular embodiments, a subject is identified as having or predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the level of at least one biomarker selected from IL-10, CRP, IFN, GM-CSF, or a combination thereof, as measured in a test sample obtained from the subject 3 days after an immunomodulatory treatment has initiated, is increased as compared to the level(s) of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the levels of at least two or of at least three biomarkers including IL-10, CRP, IFN, and GM-CSF, as measured in a test sample obtained from the subject 3 days after an immunomodulatory treatment has initiated, are increased as compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the level(s) of one, two, three, or four biomarkers including IL-10, CRP, IFN, and GM-CSF, as measured in a test sample obtained from the subject 3 days after an immunomodulatory treatment has initiated, is/are increased as compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the levels of all biomarkers including IL-10, CRP, IFN, and GM-CSF, as measured in a test sample obtained from the subject 3 days after an immunomodulatory treatment has initiated, are increased as compared to the levels of the same biomarkers of a reference biomarker profile.
[0119] In particular embodiments, the subject is identified as having or predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the level of at least one biomarker selected from IL-10, IL-5, sIL-2RA, GM-CSF, or a combination thereof, as measured in a test sample obtained from the subject 3 days after an immunomodulatory treatment has initiated, is increased as compared to the level(s) of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the levels of at least two or of at least three biomarkers including IL-10, IL-5, sIL-2RA, and GM-CSF, as measured in a test sample obtained from the subject 3 days after an immunomodulatory treatment has initiated, are increased as compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the level(s) of one, two, three, or four biomarkers including IL-10, IL-5, sIL-2RA, and GM-CSF, as measured in a test sample obtained from the subject 3 days after an immunomodulatory treatment has initiated, is/are increased as compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the levels of all biomarkers including IL-10, IL-5, sIL-2RA, and GM-CSF, as measured in a test sample obtained from the subject 3 days after an immunomodulatory treatment has initiated, are increased as compared to the levels of the same biomarkers of a reference biomarker profile.
[0120] In particular embodiments, a subject is identified as having or predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the level of at least one biomarker selected from IL-18, IL-18BP, IFN, or a combination thereof, as measured in a test sample obtained from the subject 7 days after an immunomodulatory treatment has initiated, is increased as compared to the level(s) of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the levels of at least two biomarkers including IL-18, IL-18BP, and IFN, as measured in a test sample obtained from the subject 7 days after an immunomodulatory treatment has initiated, are increased as compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the level(s) of one, two, or three biomarkers including IL-18, IL-18BP, and IFN, as measured in a test sample obtained from the subject 7 days after an immunomodulatory treatment has initiated, is/are increased as compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the levels of all biomarkers including IL-18, IL-18BP, and IFN, as measured in a test sample obtained from the subject 7 days after an immunomodulatory treatment has initiated, are increased as compared to the levels of the same biomarkers of a reference biomarker profile.
[0121] In particular embodiments, a subject is predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the level of at least one biomarker selected from IL-18, IL-18BP, IL-22, or a combination thereof, as measured in a test sample obtained from the subject 7 days after an immunomodulatory treatment has initiated, is increased as compared to the level(s) of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the levels of at least two biomarkers including IL-18, IL-18BP, and IL-22, as measured in a test sample obtained from the subject 7 days after an immunomodulatory treatment has initiated, are increased as compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the level(s) of one, two, or three biomarkers including IL-18, IL-18BP, and IL-22, as measured in a test sample obtained from the subject 7 days after an immunomodulatory treatment has initiated, is/are increased as compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, a subject is predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the levels of all biomarkers including IL-18, IL-18BP, and IL-22, as measured in a test sample obtained from the subject 7 days after an immunomodulatory treatment has initiated, are increased as compared to the levels of the same biomarkers of a reference biomarker profile.
[0122] In particular embodiments, a reference biomarker profile includes levels of the same biomarkers as measured in a test sample and is from a subject or a population of subjects who have a functional response to an immunomodulatory treatment with limited or no NTX. In particular embodiments, a reference biomarker profile includes levels of the same biomarkers as measured in a test sample and is from a healthy subject or a population of healthy subjects. In particular embodiments, a reference biomarker profile includes levels of the same biomarkers measured at the same time points pre-immunomodulatory treatment or after an immunomodulatory treatment has initiated as the test sample, and is from a subject or a population of subjects who have a functional response to an immunomodulatory treatment with limited or no NTX.
[0123] In particular embodiments, an increase in the level of any one of biomarkers including IL-18, IL-18BP, IL-18R1, IL-18RAP, sIL-2RA, IL-2, IL-5, IL-6, IL-9, IL-10, IL-22, IFN, GM-CSF, SAA, and CRP includes a 1.1-fold increase to a 20-fold increase, or a 2-fold increase to a 20-fold increase as compared to the level of the same biomarker of a reference biomarker profile. In particular embodiments, an increase in the level of any one of biomarkers including IL-18, IL-18BP, IL-18R1, IL-18RAP, sIL-2RA, IL-2, IL-5, IL-6, IL-9, IL-10, IL-22, IFN, GM-CSF, SAA, and CRP includes a 1.1-fold, a 1.2-fold, a 1.3-fold, a 1.4-fold, a 1.5-fold, a 1.6-fold, a 1.7-fold, a 1.8-fold, a 1.9-fold, a 2-fold, a 2.5-fold, a 3-fold, a 3.5-fold, a 4-fold, a 4.5-fold, a 5-fold, a 5.5-fold, a 6-fold, a 6.5-fold, a 7-fold, a 7.5-fold, an 8-fold, an 8.5-fold, a 9-fold, a 9.5-fold, a 10-fold, a 15-fold, a 20-fold, or more increase as compared to the level of the same biomarker of a reference biomarker profile. In particular embodiments, the level of IFN is increased 2-fold to 100-fold or 5-fold to 100-fold as compared to the IFN level of a reference biomarker profile. In particular embodiments, the level of IFN in a test sample is increased 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, or more as compared to the IFN level of a reference biomarker profile.
[0124] In particular embodiments, a biomarker profile can predict a functional response to an immunomodulatory treatment by a subject. In particular embodiments, a functional response to an immunomodulatory treatment by a subject includes increased overall survival, as compared to a reference. In particular embodiments, a functional response to an immunomodulatory treatment includes moderate levels of pro-inflammatory cytokines (e.g., IL-18 and IL-12) to allow T cells to produce IFN and polarize to Th1 cells. In particular embodiments, a functional response to an immunomodulatory treatment has limited or no NTX. In particular embodiments, a functional response to an immunomodulatory treatment by a subject includes CRS grades 1-4. In particular embodiments, a subject who has a functional response to an immunomodulatory treatment has an increase in Th22 cells as compared to a reference. Th22 cells are specialized T helper cells that secrete IL-22 and lack IL-4, IL-17, and IFN. Th22 cells function to protect epithelial barrier organs and modulate inflamed and/or injured tissue. In particular embodiments, the reference includes a subject or population of subjects who have a toxic response and/or non-response to an immunomodulatory treatment.
[0125] (III) Biological samples. Sample or biological sample refers to a biological material isolated from or derived from a subject. The biological sample may contain any biological material suitable for detecting a mRNA, polypeptide or other marker of a physiologic or pathologic process in a subject, and may include fluid, tissue, cellular and/or non-cellular material obtained from the individual. In particular embodiments, a biological sample may include blood, serum, cells, plasma, cerebral spinal fluid, and urine. In particular embodiments, a biological sample may include serum. Serum from blood is a light yellow, clear liquid that remains after blood has clotted. Serum may be obtained by centrifuging clotted blood. Serum does not include an anti-coagulant. In particular embodiments, a biological sample may include plasma. Plasma is a light yellow, clear liquid that remains when blood clotting is prevented and can be obtained by centrifuging whole blood containing an anti-coagulant. In particular embodiments, a biological sample can be obtained prior to an immunomodulatory treatment (pre-immunomodulatory treatment). In particular embodiments, a biological sample obtained pre-immunomodulatory treatment includes a pre-apheresis blood sample. A pre-apheresis blood sample is obtained at a time before a decision is made to perform apheresis on a subject. In particular embodiments, a pre-apheresis blood sample is obtained at a time before a decision is made to perform apheresis to obtain a subject's T cells to modify for CAR T cell therapy. In particular embodiments, a pre-apheresis blood sample includes a cell sample. In particular embodiments, a pre-apheresis blood sample includes a PBMC sample. In particular embodiments, a pre-apheresis blood sample includes a blood sample. In particular embodiments, a biological sample can be obtained 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, or more after an immunomodulatory treatment has initiated. In particular embodiments, a biological sample can be obtained after an immunomodulatory treatment has completed (post an immunomodulatory treatment). In particular embodiments, a biological sample isolated from or derived from a subject to measure levels of biomarkers and/or biomarker cell populations is referred to as a test sample. In particular embodiments, levels of biomarkers including IL-18, IL-18BP, IL-18R1, IL-18RAP, sIL-2RA, IL-2, IL-5, IL-6, IL-9, IL-10, IL-22, IFN, GM-CSF, SAA, and CRP may be measured in a blood sample. In particular embodiments, the blood sample is a serum sample. In particular embodiments, the blood sample is a plasma sample.
[0126] In particular embodiments, a biological sample is derived from a subject or source. Particular embodiments of derived from refer to a biological sample being obtained from a subject or other source and including any modification to the sample, addition to the sample, or removal from the sample, as long as biomarkers of the present disclosure can be measured from the sample using the systems and methods of the present disclosure.
[0127] In particular embodiments, a biological sample may include cells. In particular embodiments, samples used in the methods of the present disclosure include peripheral blood mononuclear cells (PBMCs). PBMCs come from peripheral blood and originate from hematopoietic stem cells (HSCs) that reside in the bone marrow. A PBMC is a blood cell with a round nucleus and can include many types of cells including monocytes, lymphocytes (including T cells, B cells, and NK cells), dendritic cells, and stem cells. PBMC can be isolated by any technique known in the art, including density centrifugation (e.g., with Ficoll-Paque). Density gradient centrifugation separates cells by cell density. In particular embodiments, whole blood or buffy coat layer may be layered over or under a density medium without mixing of the two layers followed by centrifugation. In particular embodiments, the PBMC appears as a thin white layer at the interface between the plasma and the density gradient medium. In particular embodiments, Vacutainer blood draw tubes containing Ficoll-Hypaque and a gel plug that separates the Ficoll solution from the blood to be drawn can be used (cell preparation tubes CPT, BD Biosciences, San Jose, CA; Puleo et al. (2017) Bio-protocol 7(2): e2103). In particular embodiments, SepMate tubes (STEMCELL Technologies, Vancouver, CA) designed with an insert to keep the density gradient medium and the sample from mixing prior to centrifugation can be used. (Kerfoot et al., Proteomics Clin Appl, 2012. 6(7-8):394-402; Grievink et al., Biopreserv Biobank. 2016 October; 14(5):410-415; Corkum et al. (2015) BMC Immunol. 16:48; Jia et al. (2018) Biopreserv Biobank 16(2):82-91). In particular embodiments, PBMC can be isolated by leukapheresis. A leukapheresis machine is an automated device that takes whole blood from a donor and separates out the target PBMC fraction using high-speed centrifugation while returning the remaining portion of the blood, including plasma, red blood cells, and granulocytes, back to the donor. In particular embodiments, isolated PBMCs can be solubilized with 0.1% Triton X-100 in 50 mM ammonium bicarbonate. In particular embodiments, the level of a biomarker cell population including CD161+ and CD56+ dim cells may be measured in a PBMC sample.
[0128] In particular embodiments, a control sample includes a sample from a healthy subject or a population of healthy subjects. A healthy subject may include a subject who is not in need of immunotherapy and has no known diseases. In particular embodiments, a control sample includes a sample from a subject or a population of subjects who has/have a functional response to an immunomodulatory treatment with limited or no NTX. In particular embodiments, a control sample includes a sample from a subject or a population of subjects who has/have a functional response to an immunomodulatory treatment with limited or no NTX.
[0129] (IV) Assays for detection and quantification of biomarkers. Up- or down-regulation of biomarkers, as indicated elsewhere herein for particular biomarkers, can be assessed by comparing a measured value (from a test or subject sample) to a relevant reference level. For example, the quantity of one or more biomarkers can be indicated as a value. The value can be expressed numerically and result from assaying a sample, and can be derived, e.g., by measuring level(s) of the biomarker(s) in the sample by an assay performed in a laboratory, by measuring the ratio or ratios of the levels of two or more of the biomarkers, or from a dataset obtained from a provider such as a laboratory, or from a dataset stored on a server. A biomarker profile includes the level(s) of one or more measured biomarker(s). The biomarkers disclosed herein can be a protein biomarker, a nucleic acid biomarker (e.g., gene encoding the protein biomarker), a small molecule, one or more cell types, and/or one or more cell populations.
[0130] In the broadest sense, the value may be qualitative or quantitative. As such, where detection is qualitative, the systems and methods provide a reading or evaluation, e.g., assessment, of whether or not the biomarker is present in the sample being assayed. In yet other embodiments, the systems and methods provide a quantitative detection of whether the biomarker is present in the sample being assayed, i.e., an evaluation or assessment of the actual amount or relative abundance of the biomarker in the sample being assayed. In such embodiments, the quantitative detection may be absolute or, if the method is a method of detecting two or more different biomarkers in a sample, relative. As such, the term quantifying when used in the context of quantifying a biomarker in a sample can refer to absolute or to relative quantification. Absolute quantification can be accomplished by inclusion of known concentration(s) of one or more control biomarkers and referencing, e.g., normalizing, the detected level of the biomarker with the known control biomarkers (e.g., through generation of a standard curve). Alternatively, relative quantification can be accomplished by comparison of detected levels or amounts between two or more different biomarkers to provide a relative quantification of each of the two or more biomarkers, e.g., relative to each other. The actual measurement of values of the biomarkers can be determined using any method known in the art. In some embodiments, a biomarker is detected by contacting a sample with reagents (e.g., antibodies or nucleic acids), generating complexes of reagent and biomarker(s), and detecting the complexes.
[0131] The reagent can include a probe. A probe is a molecule that binds a target, either directly or indirectly. The target can be a biomarker, a fragment of a biomarker, or any molecule that is to be detected, In particular embodiments, the probe includes a nucleic acid or a protein. As an example, a protein probe can be an antibody. An antibody can be a whole antibody or a binding fragment of an antibody. A probe can be labeled with a detectable label Examples of detectable labels include fluorescent chromophores, chemiluminescent emitters, dyes, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, enzyme subunits, metal ions, and radioactive isotopes.
[0132] Protein detection includes detection of full-length proteins, mature proteins, pre-proteins, polypeptides, isoforms, mutant forms, post-translationally modified proteins and variants thereof, and can be detected in any suitable manner.
[0133] Those skilled in the art will be familiar with numerous specific immunoassay formats and variations thereof which can be used to carry out the methods disclosed herein. See, e.g., E. Maggio, Enzyme-Immunoassay (1980), CRC Press, Inc., Boca Raton, Fla; and U.S. Pat. Nos. 4,727,022; 4,659,678; 4,376,110; 4,275,149; 4,233,402; and 4,230,797.
[0134] Antibodies can be conjugated or immobilized to a solid support suitable for a diagnostic assay (e.g., beads such as protein A or protein G agarose, microspheres, plates, slides or wells formed from materials such as latex or polystyrene) in accordance with known techniques, such as passive binding. Antibodies can be conjugated to detectable labels or groups such as radioisotopes (e.g., .sup.35S, .sup.125I, .sup.131I), enzyme labels (e.g., horseradish peroxidase, alkaline phosphatase), and fluorescent labels (e.g., fluorescein, Alexa, green fluorescent protein, rhodamine) in accordance with known techniques.
[0135] Examples of suitable immunoassays include immunoblotting, immunoprecipitation, immunofluorescence, chemiluminescence, electro-chemiluminescence (ECL), and/or enzyme-linked immunosorbent assays (ELISA). In particular embodiments, cytokines can be measured by ELISAs. In particular embodiments, cytokines can be measured by enzyme-linked immunospot (ELISpot) to detect cytokine-secreting cells at the single-cell level. Cytokine antibody arrays have been developed for multiplex analysis of cytokines in a single microplate. Multiplex arrays to profile multiple biomarkers simultaneously may include Meso Scale Discovery custom U-PLEX, Angiogenesis V-PLEX Panel 1 (K15190D-1), and Vascular Injury V-PLEX Panel 2 (K15198D-1) (Meso Scale Discovery (MSD), Rockville, MD). A U-PLEX assay, for example, may provide a 10-spot U-PLEX plate and unique linkers to create custom multiplex panels to detect any combination of biomarkers. Users provide their own biotinylated capture reagents that recognize analytes of interest. In U-PLEX assays, biotinylated capture reagents (e.g., antibodies, peptides, proteins, nucleic acids) are coupled to U-PLEX Linkers. The U-PLEX Linkers then self-assemble onto unique spots on the U-PLEX plate. After analytes (e.g., cytokines) in the sample bind to the capture reagents, detection antibodies conjugated with labels (e.g., electro-chemiluminescent MSD GOLD SULFO-TAG) bind to the analytes to complete the sandwich immunoassay. Once the sandwich immunoassay is complete, the plate is placed into an appropriate instrument to measure the amount of analyte present in the sample by detecting the label. For example, an instrument to detect an electro-chemiluminescent MSD GOLD SULFO-TAG applies a voltage to the plate electrodes to cause the captured labels to emit light. The instrument can measure the intensity of the emitted light, which is proportional to the amount of analyte present in the sample, providing a quantitative measure of each analyte in the sample. Angiogenesis V-PLEX Panel 1 assay allows measurement of levels of VEGF-A, VEGF-C, VEGF-D, Tie-2, Flt-1, PIGF, and FGF in a sample. Vascular Injury V-PLEX Panel 2 assay allows measurement of levels of SAA, CRP, VCAM-1, and ICAM-1.
[0136] In particular embodiments, biomarker levels can be assessed by flow cytometry or high performance liquid electrophoresis. In particular embodiments, flow cytometry can be used for intracellular cytokine detection. In particular embodiments, flow cytometry can be used to measure the level of a cell type or population of cells expressing one or more biomarkers, including: CD161+ CD3+ T cells; CD161+ CD4+ T cells; CD161+ CD4+ CD45RA-T cells; CD161+ CD8+ T cells; CD161+ CD8+ CD45RA+ T cells; CD161+ CD56+ NK cells; CD161+ MAIT cells; CD161+ GM-CSF+ NK cells; CD161+ GM-CSF+ MAIT cells; CD161+ GM-CSF+ T cells; CD161+ IFN+ NK cells; CD161+ IFN+ MAIT cells; CD161+ IFN+ T cells; CD161+ IFN+ NKT cells; or a combination thereof.
[0137] Antibodies that can be used to detect biomarkers of the present disclosure are available commercially. In particular embodiments, antibodies to detect IL-18 include: rabbit monoclonal clone 11 (ThermoFisher Scientific, #MA5-30764); rabbit polyclonal (LifeSpan BioSciences, #LS-C313397); and mouse monoclonal clone 5C6F8 (Proteintech Group Inc., #60070-1-Ig). In particular embodiments, antibodies to detect IL-18BP include: goat polyclonal (R&D Systems, #AF119); mouse monoclonal clone 136007 (R&D Systems, #MAB1191); and mouse monoclonal clone MM0379-10G36 (Santa Cruz Biotechnology, #sc-517545). In particular embodiments, antibodies to detect IL-18R1 include: clone H44 (BioLegend, #313810); mouse monoclonal clone 2B7E6 (ThermoFisher, #MA5-38474); and rabbit polyclonal (Novus Biologicals, #NBP1-85782). In particular embodiments, antibodies to detect IL-18RAP include: clone FAB118R (R&D Systems, #FAB118R-100); rabbit polyclonal (LifeSpan BioSciences, #LS-C165182); and rabbit polyclonal (Abnova Corporation, #H00008807-W01P). In particular embodiments, antibodies to detect sIL-2RA include: mouse monoclonal clone SB-647 (ProSci, #38-230); mouse monoclonal clone TC-758 (Creative Diagnostics, #CABT-B8954); and mouse monoclonal clone YNRhIL2R (Prospec Protein Specialists, #ANT-104). In particular embodiments, antibodies to detect IL-2 include: rat monoclonal clone MQ1-17H12 (ThermoFisher, #25-7029-42); rabbit polyclonal (GeneTex, #GTX101138); and mouse monoclonal (LifeSpan BioSciences, #LS-C104534). In particular embodiments, antibodies to detect IL-5 include: rat monoclonal clone TRFK5 (BioLegend, #504303); rabbit polyclonal (ThermoFisher, #PA5-96761); and mouse monoclonal clone 9906 (R&D Systems, #MAB-605). In particular embodiments, antibodies to detect IL-6 include: mouse monoclonal clone 5|L6 (ThermoFisher, #M620); mouse monoclonal clone 6708 (R&D Systems, #MAB206); and rabbit polyclonal (Millipore Sigma, #12143). In particular embodiments, antibodies to detect IL-9 include: rabbit monoclonal clone 1043G (R&D Systems, #MAB2091); mouse monoclonal clone MH9D1 (ThermoFisher, #12-7098-42); and mouse monoclonal clone MH9A4 (BioLegend, #507603). In particular embodiments, antibodies to detect IL-10 include: rabbit monoclonal clone 2050B (R&D Systems, #MAB9210); rat monoclonal clone JES3-9D7 (ThermoFisher, #53-7108-42); and rabbit polyclonal (Abcam, #ab34843). In particular embodiments, antibodies to detect IL-22 include: clone 2G12A41 (BioLegend, #366711); mouse monoclonal clone 22URTI (ThermoFisher, #25-7229-42); and mouse monoclonal clone 142928 (R&D Systems, #1C7821). In particular embodiments, antibodies to detect IFN include: mouse monoclonal clone B27 (BioLegend, #506516); mouse monoclonal clone 4SB3 (ThermoFisher, #53-7319-42); and mouse monoclonal clone 25723 (R&D Systems, #MAB2851). In particular embodiments, antibodies to detect GM-CSF include: clone BVD2-21C11 (BioLegend, #502305); mouse monoclonal clone 6804 (R&D Systems, #MAB615); and rabbit monoclonal clone EPR23689-17 (Abcam, #ab227031). In particular embodiments, antibodies to detect SAA include: mouse monoclonal clone mcl (ThermoFisher, #MA5-11729); mouse monoclonal clone Reu86.1 (Novus Biologicals, #NB600-1418); and mouse monoclonal (LifeSpan BioSciences, #LS-B2130). In particular embodiments, antibodies to detect CRP include: mouse monoclonal clone 232007 (R&D Systems, #MAB17071); mouse monoclonal clone 987313 (Novus Biologicals, #MAB17073); and mouse monoclonal clone 3F10A11 (Proteintech Group Inc., #66250-1-Ig). In particular embodiments, antibodies to detect CD161 include: mouse monoclonal clone HP-3G10 (BioLegend, #339922); mouse monoclonal clone 191B8 (Miltenyi Biotec, #130-113-591); and mouse monoclonal clone B199.2 (Bio-Rad, #MCA1855). In particular embodiments, antibodies to detect CD56 include: clone HCD56 (BioLegend, #318344); clone NCAM16.2 (BD Biosciences, #564057); and rabbit monoclonal clone 3H15L12 (ThermoFisher, #701379).
[0138] In particular embodiments, biomarker levels can be assessed by nanoparticle-modified aptamers. Aptamer pairs can bind to a target biomarker to form a sandwich complex fixed onto a microplate. In particular embodiments, the nanoparticle is a gold nanoparticle whose signal can be amplified by silver-enhancement technology and a microplate reader can measure absorbance.
[0139] Up- or down-regulation of genes encoding biomarkers of the disclosure also can be detected using, for example, cDNA arrays, cDNA fragment fingerprinting, cDNA sequencing, clone hybridization, differential display, differential screening, fluorescence resonance energy transfer (FRET) detection, liquid microarrays, PCR, RT-PCR, quantitative real-time RT-PCR analysis with TaqMan assays, molecular beacons, microelectric arrays, oligonucleotide arrays, polynucleotide arrays, serial analysis of gene expression (SAGE), and/or subtractive hybridization. In particular embodiments, nucleic acid sequences that correspond to nucleic acids encoding biomarkers can be used to construct primers and probes for detecting and/or measuring biomarker nucleic acids.
[0140] As an example, Northern hybridization analysis using probes which specifically recognize one or more biomarker nucleic acid sequences can be used to determine gene expression. Alternatively, expression can be measured using RT-PCR; e.g., polynucleotide primers specific for the differentially expressed biomarker mRNA sequences are used to reverse-transcribe the mRNA into complementary DNA, which is then amplified in PCR and can be visualized and quantified. Biomarker RNA can also be quantified using, for example, other target amplification methods, such as transcription mediated amplification (TMA), strand displacement amplification (SDA), and nucleic acid sequence based amplification (NASBA), or signal amplification methods (e.g., bDNA), and the like. Ribonuclease protection assays can also be used, using probes that specifically recognize one or more biomarker mRNA sequences, to quantify gene expression.
[0141] Further hybridization technologies that may be used are described in, for example, U.S. Pat. Nos. 5,143,854; 5,288,644; 5,324,633; 5,432,049; 5,470,710; 5,492,806; 5,503,980; 5,510,270; 5,525,464; 5,547,839; 5,580,732; 5,661,028; and 5,800,992 as well as WO 95/21265; WO 96/31622; WO 97/10365; WO 97/27317; EP 373 203; and EP 785 280.
[0142] Proteins and nucleic acids can be conjugated to or immobilized on chips, such as microarray chips. See, for example, U.S. Pat. Nos. 5,143,854; 6,087,112; 5,215,882; 5,707,807; 5,807,522; 5,958,342; 5,994,076; 6,004,755; 6,048,695; 6,060,240; 6,090,556; and 6,040,138. Microarray refers to a solid carrier or support that has a plurality of molecules bound to its surface at defined locations. The solid carrier or support can be made of any material. As an example, the material can be hard, such as metal, glass, plastic, silicon, ceramics, and textured and porous materials; or soft materials, such as gels, rubbers, polymers, and other non-rigid materials. The material can also be nylon membranes, epoxy-glass and borofluorate-glass. The solid carrier or support can be flat but need not be and can include any type of shape such as spherical shapes (e.g., beads or microspheres). The solid carrier or support can have a flat surface as in slides and micro-titer plates having one or more wells. In particular embodiments, an array or microarray can include small molecules.
[0143] Binding to proteins or nucleic acids on microarrays can be detected by scanning the microarray with a variety of laser or CCD-based scanners, and extracting features with software packages, for example, Imagene (Biodiscovery, Hawthorne, CA), Feature Extraction Software (Agilent), Scanalyze (Eisen, M. 1999. SCANALYZE User Manual; Stanford Univ., Stanford, Calif. Ver 2.32.), or GenePix (Axon Instruments).
[0144] In particular embodiments, levels, amounts, or ratios of biomarkers of the present disclosure can be measured by mass spectrometry. Mass spectrometry (MS) refers to an analytical technique to identify compounds by their mass. MS technology generally includes (1) ionizing the compounds to form charged compounds; and (2) detecting the molecular weight of the charged compound and calculating a mass-to-charge ratio (m/z). The compound may be ionized and detected by any suitable means. A mass spectrometer generally includes an ionizer and an ion detector. See, e.g., U.S. Pat. Nos. 6,204,500; 6,107,623; 6,268,144; 6,124,137; Wright et al., Prostate Cancer and Prostatic Diseases 2:264-76 (1999); and Merchant and Weinberger, Electrophoresis 21:1164-67 (2000).
[0145] Embodiments disclosed herein can be used with high throughput screening (HTS). Typically, HTS refers to a format that performs at least 100 assays, at least 500 assays, at least 1000 assays, at least 5000 assays, at least 10,000 assays, or more per day. When enumerating assays, either the number of samples or the number of protein, nucleic acid, or other biomarkers assayed can be considered.
[0146] Generally HTS methods involve a logical or physical array of either the subject samples, or the protein or nucleic acid biomarkers, or both. Appropriate array formats include both liquid and solid phase arrays. For example, assays employing liquid phase arrays, e.g., for hybridization of nucleic acids, binding of antibodies or other receptors to ligand, etc., can be performed in multi-well or microtiter plates. Microtiter plates with 96, 384, or 1536 wells are widely available, and even higher numbers of wells, e.g., 3456 and 9600 can be used. In general, the choice of microtiter plates is determined by the methods and equipment, e.g., robotic handling and loading systems, used for sample preparation and analysis.
[0147] HTS assays and screening systems are commercially available from, for example, Zymark Corp. (Hopkinton, MA); Air Technical Industries (Mentor, OH); Beckman Instruments, Inc. (Fullerton, CA); Precision Systems, Inc. (Natick, MA), etc. These systems typically automate entire procedures including all sample and reagent pipetting, liquid dispensing, timed incubations, and final readings of the microplate in detector(s) appropriate for the assay. These configurable systems provide HTS as well as a high degree of flexibility and customization. The manufacturers of such systems provide detailed protocols for the various methods of HTS.
[0148] Methods disclosed herein can include assessing cell proliferation. Cell proliferation can be determined using assays including: staining of living cells with a fluorescent dye and measuring cell division by flow cytometry; measuring DNA synthesis during S phase of the cell cycle using nucleotide analogs (e.g., 5-bromo-2-deoxyuridine, BrdU); measuring lactate dehydrogenase activity in metabolic cell proliferation assays; detecting proliferation markers present in proliferating cells but not in non-proliferating cells (e.g., detecting Ki-67 with an antibody); and measuring ATP concentration, as there is a linear relationship between cell number and ATP concentration (e.g., bioluminescence-based detection of ATP using luciferase enzyme). A cellular test for monocyte activation has been described (Ivanova et al. J Immunol Res. 2016; 2016:4789279).
[0149] (V) Reference levels and reference biomarker profiles. A dataset as used herein is a set of numerical values resulting from evaluation of a sample (or population of samples) under a desired condition. The values of the dataset can be obtained, for example, by experimentally obtaining measures from a sample and constructing a dataset from these measurements. In particular embodiments, a dataset includes a biomarker profile including level(s) of one or more biomarker(s). As is understood by one of ordinary skill in the art, the reference level can be based on e.g., any mathematical or statistical formula useful and known in the art for arriving at a meaningful aggregate reference level from a collection of individual datapoints; e.g., mean, median, median of the mean, etc. Alternatively, a reference level or dataset to create a reference level can be obtained from a service provider such as a laboratory, or from a database or a server on which the dataset has been stored. In certain embodiments of the present disclosure, a dataset of values is determined by measuring biomarkers from a population known to have a functional response to an immunomodulatory treatment with limited or no NTX which can provide a quantitative measure of responsiveness to an immunomodulatory treatment in a subject.
[0150] Reference levels or reference biomarker profiles can be obtained from one or more relevant datasets. A reference level or reference biomarker profile from a dataset can be derived from previous measures derived from a population. A population is any grouping of subjects or samples of like specified characteristics. The grouping could be according to, for example, clinical parameters, clinical assessments, therapeutic regimens, disease status, severity of condition, etc.
[0151] Reference levels or reference biomarker profiles can include normal or control levels or profiles, defined according to, e.g., discrimination limits or risk defining thresholds, in order to define cut-off points and/or abnormal values or profiles for responsiveness to an immunomodulatory treatment. In particular embodiments, the reference level is the level of one or more biomarkers or combined biomarker indices typically found in a subject or a population of subjects who is/are healthy and is/are not undergoing immunotherapy. In particular embodiments, the reference level is from a subject or a population of subjects who has/have a functional response to an immunomodulatory treatment with limited or no NTX. Other terms for reference levels include functional, index, baseline, standard, healthy, uninfected, normal, etc. Alternatively, the reference level can be a database of biomarker profiles from previously tested subjects who have a functional response to an immunomodulatory treatment with limited or no NTX over a clinically relevant time period, such as pre-immunomodulatory treatment, or 1 day, 3 days, and 7 days after an immunomodulatory treatment has initiated. Reference levels can also be derived from, e.g., a control subject or a control population of subjects whose response to an immunomodulatory treatment is known. In particular embodiments, the reference value or reference biomarker profile can be derived from: a subject or a population of subjects who is/are healthy and not undergoing immunotherapy; a subject or a population of subjects who is/are non-responsive to an immunomodulatory treatment; a subject or a population of subjects who has/have an overactive or toxic response to an immunomodulatory treatment; or a subject or a population of subjects who was/were non-responsive and/or had a toxic response to an immunomodulatory treatment but had been administered a treatment (intervention) to drive the non-response and/or toxic response to a functional response. In particular embodiments, a reference level or reference biomarker profile is an average of biomarker levels (corresponding to the same biomarkers in a test biomarker profile) from a population of subjects who have a functional response, do not respond, or have a toxic response to an immunomodulatory treatment. A reference level can also be derived from disease activity algorithms or computed indices from population studies.
[0152] The profile of biomarkers obtained from an individual, i.e., the test biomarker profile, can be compared to a reference biomarker profile. The reference biomarker profile can be generated from one individual or a population of two or more individuals. The population, for example, may include three, four, five, ten, 15, 20, 30, 40, 50 or more individuals. Furthermore, the reference biomarker profile and the individual's (test) biomarker profile that are compared in the methods of the present disclosure may be generated from the same individual, provided that the test and reference profiles are generated from biological samples taken at different time points and compared to one another. For example, a sample may be obtained from an individual at the start of a study period. A reference biomarker profile taken from that sample may then be compared to biomarker profiles generated from subsequent samples from the same individual. Such a comparison may be used, for example, to determine if the individual's response to an immunomodulatory treatment becomes more functional and/or less toxic over time.
[0153] The methods of the present disclosure include comparing an individual's biomarker profile with a reference biomarker profile. A comparison includes any means to discern at least one difference in the individual's and the reference biomarker profiles. Thus, a comparison may include a visual inspection of biomarker expression levels, and a comparison may include arithmetical or statistical comparisons of biomarker expression values in a biomarker profile. Such statistical comparisons include, but are not limited to, applying a decision rule. If the biomarker profiles include at least one internal standard, the comparison to discern a difference in the biomarker profiles may also include features of these internal standards, such that features of the biomarker are correlated to features of the internal standards. The comparison can predict the type of response a subject has to an immunomodulatory treatment or the comparison can indicate whether an intervention has changed the type of response a subject has to an immunomodulatory treatment. Conclusions can be drawn based on whether a test biomarker profile is statistically significantly different or not statistically significantly different from a reference biomarker profile. A measure is not statistically significantly different if the difference is within a level that would be expected to occur based on chance alone. In contrast, a statistically significant difference is one that is greater than what would be expected to occur by chance alone. Statistical significance or lack thereof can be determined by any of various methods well-known in the art. Examples of commonly used measures of statistical significance include the t-test and the p-value. The p-value represents the probability of obtaining a given result equivalent to a particular datapoint, where the datapoint is the result of random chance alone. A result is often considered significant (not random chance) at a p-value less than or equal to 0.05.
[0154] In particular embodiments, significantly elevated (or significantly up-regulated or significantly increased) refers to an increase of more than 10%, more than 20%, more than 30%, more than 40%, more than 50%, more than 60%, more than 70%, more than 80%, more than 90%, more than 100%, more than 150%, more than 200%, or more, compared to a reference level. In particular embodiments, significantly downregulated or significantly decreased refers to a decrease of more than 10%, more than 20%, more than 30%, more than 40%, more than 50%, more than 60%, more than 70%, more than 80%, more than 90%, or more, compared to a reference level.
[0155] In particular embodiments, values obtained about the biomarkers and/or other dataset components can be subjected to an analytic process with chosen parameters. The parameters of the analytic process may be those disclosed herein or those derived using guidelines described herein. The analytic process used to generate a result may be any type of process capable of providing a result useful for classifying a sample, for example, comparison of the obtained value with a reference level, a linear algorithm, a quadratic algorithm, a decision tree algorithm, or a voting algorithm. The analytic process may set a threshold for determining the probability that a sample belongs to a given class. The probability preferably is at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or higher.
[0156] Interpretation functions, refers to the transformation of a set of observed data into a meaningful determination of particular interest; e.g., an interpretation function may be a predictive model that is created by utilizing one or more statistical algorithms to transform a dataset of observed biomarker data into a meaningful determination of a subject's responsiveness to an immunomodulatory treatment.
[0157] In particular embodiments, values of the measured biomarkers in a biomarker profile can be calculated into a score. Each value can be weighted evenly within an algorithm generating a score, or the values for particular biomarkers can be weighted more heavily in reaching the score. For example, biomarkers with higher sensitivity and/or specificity can be weighted more heavily than biomarkers with lower sensitivity and/or specificity to determine scores. Biomarkers may also be grouped into classes, and each class given a weighted score. For example, biomarker values for predicting a subject who will have a toxic and/or non-response to an immunomodulatory treatment may be grouped into classes and weighted as follows (from highest weight to lowest weight): Class 1: IL-18, IL-18BP, sIL-2RA, IFN, IL-10, IL-22, IL-5, GM-CSF, CD161+ cells, and CD56+ dim cells; and Class 2: IL-18R1, IL-18RAP, IL-2, IL-6, IL-9, CRP, SAA.
[0158] In particular embodiments, weighting scores involves converting the measurement of one biomarker that is identified and quantified in a test sample into one of many potential scores. A receiver operating characteristic (ROC) curve can be used to standardize the scoring between different biomarkers by enabling the use of a weighted score based on the inverse of a false positive % or false negative % defined from the ROC curve. The weighted score can be calculated by multiplying the AUC by a factor for a biomarker and then dividing by the false positive % or false negative % based on a ROC curve. The weighted score can be calculated using the formula:
Weighted Score=(AUC.sub.xfactor)/(1% specificity.sub.x)
wherein x is the biomarker; the, factor, is a real number (such as 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 and so on) throughout a particular set of biomarkers; and the specificity is a chosen value that does not exceed 95%. Multiplication of a factor for the particular set of primary biomarkers allows the user to scale the weighted score.
[0159] (VI) Methods of Use. Particular embodiments disclosed herein include obtaining a sample (e.g., blood, a sample including cells) derived from a subject; and measuring a level of at least one biomarker disclosed herein to generate a biomarker profile. In particular embodiments, the level of the at least one biomarker disclosed herein is measured using immunoassay, flow cytometry, or a combination thereof. In particular embodiments, methods disclosed herein include obtaining a biological sample derived from a subject; measuring a level of at least one biomarker disclosed herein to generate a test biomarker profile; comparing the test biomarker profile to a reference biomarker profile including the same measured biomarkers; and identifying the subject as having a toxic response or non-response to an immunomodulatory treatment when the level of the at least one measured biomarker is increased compared to the levels of the same biomarkers of a reference biomarker profile. In particular embodiments, the at least one biomarker is selected from interleukin (IL)-18, IL-18 binding protein (IL-18BP), IL-18 receptor 1 (IL-18R1), IL-18 receptor accessory protein (IL-18RAP), IL-2, soluble IL-2 receptor alpha (sIL-2RA), IL-5, IL-6, IL-9, IL-10, IL-22, Interferon gamma (IFN), Granulocyte Macrophage Colony Stimulating Factor (GM-CSF), serum amyloid A (SAA), C-reactive protein (CRP), CD161+ cells, CD56+ dim cells, or a combination thereof. In particular embodiments, the at least one biomarker is selected from IL-18, IL-18BP, sIL-2RA, IL-10, IL-22, IFN, CD161+ cells, or a combination thereof.
[0160] The biomarkers disclosed herein can be used to predict a subject's response to an immunomodulatory treatment before initiation of the immunomodulatory treatment (pre-immunomodulatory treatment). In particular embodiments, pre-immunomodulatory treatment includes a time before a decision is made to perform apheresis to obtain a subject's T cells to modify for CAR T cell therapy. In particular embodiments, a biological sample obtained from a subject pre-immunomodulatory treatment includes a pre-apheresis blood sample. In particular embodiments, a subject is identified as having or predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the level of CD161+ cells, as measured in a test sample obtained from the subject pre-immunomodulatory treatment, is increased as compared to a level of CD161+ cells of a reference biomarker profile. In particular embodiments, a subject is identified as having or predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the level of at least one biomarker selected from IL-18, IL-18BP, IL-18R1, IL-18RAP, sIL-2RA, IL-2, IL-5, IL-6, IL-9, IL-10, IL-22, IFN, GM-CSF, SAA, CRP, CD161+ cells, CD56+ dim cells, or a combination thereof, as measured in a test sample obtained from the subject pre-immunomodulatory treatment, is increased as compared to the same biomarkers of a reference biomarker profile. In particular embodiments, the subject is identified as having or predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the level of the at least one biomarker selected from IL-18, IL-10, sIL-2RA, IFN, CD161+ cells, CD56+ dim cells, or a combination thereof, as measured in a test sample obtained from the subject pre-immunomodulatory treatment, is increased as compared to the same biomarkers of a reference biomarker profile. In particular embodiments, the CD161+ cells include: CD161+ CD3+ T cells; CD161+ CD4+ T cells; CD161+ CD4+ CD45RA-T cells; CD161+ CD8+ T cells; CD161+ CD8+ CD45RA+ T cells; CD161+ CD56+ NK cells; CD161+ MAIT cells; CD161+GM-CSF+ NK cells; CD161+ GM-CSF+ MAIT cells; CD161+ GM-CSF+ T cells; CD161+ IFN+NK cells; CD161+ IFN+ MAIT cells; CD161+ IFN+ T cells; or a combination thereof.
[0161] The biomarkers disclosed herein can be used to identify or predict a subject's response to an immunomodulatory treatment once an immunomodulatory treatment has initiated. In particular embodiments, biomarkers disclosed herein can be used to identify or predict a subject's response to an immunomodulatory treatment once an immunomodulatory treatment has initiated but before any adverse symptoms of CRS and/or NTX are evident. In particular embodiments, biomarkers disclosed herein can be used to predict a subject's response to an immunomodulatory treatment 1 day after an immunomodulatory treatment has initiated, 3 days after an immunomodulatory treatment has initiated, and/or 7 days after an immunomodulatory treatment has initiated.
[0162] In particular embodiments, the subject is identified as having or predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the level of at least one biomarker selected from IL-18, IL-18BP, IL-18R1, IL-18RAP, IL-2, IL-5, IL-6, IL-9, IL-10, IL-22, sIL-2RA, IFN, GM-CSF, SAA, CRP, or a combination thereof, as measured in a test sample obtained from the subject after an immunomodulatory treatment has initiated, is increased as compared to the level(s) of the same biomarkers of a reference biomarker profile. In particular embodiments, the subject is identified as having or predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the level of the at least one biomarker selected from IL-10, SAA, GM-CSF, IFN, or a combination thereof, as measured in a test sample obtained from the subject 1 day after an immunomodulatory treatment has initiated, is increased as compared to the level(s) of the same biomarkers of a reference biomarker profile. In particular embodiments, the subject is identified as having or predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the level of the at least one biomarker selected from IL-10, CRP, IFN, GM-CSF, or a combination thereof, as measured in a test sample obtained from the subject 3 days after an immunomodulatory treatment has initiated, is increased as compared to the level(s) of the same biomarkers of a reference biomarker profile. In particular embodiments, the subject is identified as having or predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the level of the at least one biomarker selected from IL-10, IL-5, sIL-2RA, GM-CSF, or a combination thereof, as measured in a test sample obtained from the subject 3 days after an immunomodulatory treatment has initiated, is increased as compared to the level(s) of the same biomarkers of a reference biomarker profile. In particular embodiments, the subject is identified as having or predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the level of the at least one biomarker selected from IL-18, IL-18BP, IFN, or a combination thereof, as measured in a test sample obtained from the subject 7 days after an immunomodulatory treatment has initiated, is increased as compared to the level(s) of the same biomarkers of a reference biomarker profile. In particular embodiments, the subject is identified as having or predicted to have a toxic response and/or non-response to an immunomodulatory treatment when the level of the at least one biomarker selected from IL-18, IL-18BP, IL-22, or a combination thereof, as measured in a test sample obtained from the subject 7 days after an immunomodulatory treatment has initiated, is increased as compared to the level(s) of the same biomarkers of a reference biomarker profile.
[0163] In particular embodiments, the reference biomarker profile is from a subject or a population of subjects having a functional response to an immunomodulatory treatment with limited or no NTX. In particular embodiments, the reference biomarker profile is from a healthy subject or a population of healthy subjects. In particular embodiments, a reference biomarker profile includes levels of the same biomarkers as measured in a test sample and is from a subject or a population of subjects who have a functional response to an immunomodulatory treatment with limited or no NTX. In particular embodiments, a reference biomarker profile includes levels of the same biomarkers as measured in a test sample and is from a healthy subject or a population of healthy subjects. In particular embodiments, a reference biomarker profile includes levels of the same biomarkers measured at the same time points pre-immunomodulatory treatment or after an immunomodulatory treatment has initiated as the test sample, and is from a subject or a population of subjects who have a functional response to an immunomodulatory treatment with limited or no NTX.
[0164] In particular embodiments, the subject whose biomarker levels are being measured has not undergone an immunomodulatory treatment, is undergoing an immunomodulatory treatment, or has completed an immunomodulatory treatment. In particular embodiments, an immunomodulatory treatment includes immunotherapy. In particular embodiments, the immunotherapy includes a therapy that uses chimeric antigen receptor (CAR) modified T cells, therapeutic agents to deplete regulatory T cells, recombinant cytokines, immune checkpoint inhibitors, monoclonal antibodies, bispecific antibodies, dual-affinity retargeting antibodies (DART), immune-mobilizing monoclonal T cell receptors against cancer (ImmTAC), vaccines, or combinations thereof.
[0165] In particular embodiments, the method further includes accepting the subject into or excluding the subject from a clinical trial when the subject has not undergone an immunomodulatory treatment. In particular embodiments, an increase in the level of CD161+ cells, as measured in a sample pre-immunomodulatory treatment (e.g. in a pre-apheresis blood sample), predicts that a subject will have a toxic response and/or nonresponse to CAR T cell therapy and that the subject should therefore be excluded from a clinical trial involving CAR T cell therapy. In particular embodiments, the method further includes terminating the existing immunomodulatory treatment and initiating another type of immunomodulatory treatment when the subject is undergoing the existing immunomodulatory treatment. In particular embodiments, the method further includes initiating another type of immunomodulatory treatment after a subject has completed an existing immunomodulatory treatment. For example, if a subject is identified as a non-responder to CAR T cell therapy, the CAR T cell therapy can be terminated an another type of immunomodulatory treatment can be initiated, such as recombinant cytokines, monoclonal antibodies, immune checkpoint inhibitors, bispecific antibodies, dual-affinity retargeting antibodies (DART), immune-mobilizing monoclonal T cell receptors against cancer (ImmTAC), or vaccines.
[0166] In particular embodiments, methods of the disclosure further includes: selecting a therapeutic agent to administer to a subject, including measuring a level of at least one biomarker selected from the group consisting of interleukin (IL)-18; IL-18 binding protein (IL-18BP), interferon gamma (IFN), and CD161+ cells to generate a test biomarker profile; comparing the test biomarker profile to a reference biomarker profile including the level(s) of the same biomarker(s); and identifying the subject as having or predicting that the subject will have a toxic response and/or non-response to an immunomodulatory treatment when the test biomarker profile includes increased levels of the at least one biomarker as compared to the reference biomarker profile; and selecting a therapeutic agent to administer to the subject. In particular embodiments, the reference biomarker profile is from a subject or a population of subjects having a functional response to the immunomodulatory treatment with limited or no neurotoxicity (NTX). In particular embodiments, the biological sample includes a blood sample and/or a cell sample. In particular embodiments, the biological sample is obtained before the immunomodulatory treatment has initiated, and wherein the at least one biomarker is selected from IL-18BP and/or CD161+ cells. In particular embodiments, the biological sample is obtained 1 day, 3 days, and/or 7 days after the immunomodulatory treatment has initiated, and wherein the at least one biomarker is selected from the group consisting of IL-18, IL-18BP, and IFN. In particular embodiments, the immunomodulatory treatment includes administration of chimeric antigen receptor (CAR) T cell immunotherapy and the therapeutic agent includes: an anti-CD161 antibody, an anti-IL-18 antibody, an anti-IFN antibody, an IL-18BP, or a combination thereof. In particular embodiments, the immunomodulatory treatment includes administration of chimeric antigen receptor (CAR) T cell immunotherapy, and wherein the method further includes removing CD161+ cells from an apheresis product obtained from the subject prior to the immunomodulatory treatment to produce an apheresis product reduced in CD161+ cells. In particular embodiments, the method further includes contacting the apheresis product obtained from the subject with an anti-CD161 antibody.
[0167] In particular embodiments, methods of the disclosure further includes selecting a therapeutic agent to administer to a subject, including measuring a level of CD161+ cells in a biological sample obtained from a subject; comparing the level of CD161+ cells to a level of CD161+ cells of a control sample; identifying the subject as having or predicting that the subject will have a toxic response and/or non-response to an immunomodulatory treatment when the level of CD161+ cells in the biological sample is increased as compared to the level of CD161+ cells in the control sample; and selecting a therapeutic agent to administer to the subject. In particular embodiments, the subject has not undergone an immunomodulatory treatment. In particular embodiments, the biological sample includes a cell sample. In particular embodiments, the cell sample is a PBMC sample. In particular embodiments, the immunomodulatory treatment includes chimeric antigen receptor (CAR) T cell immunotherapy and the therapeutic agent includes an anti-CD161 antibody.
[0168] In particular embodiments, a control sample is from a healthy subject or a population of healthy subjects. In particular embodiments, a control sample is from a subject or a population of subjects who has/have a functional response to the immunomodulatory treatment with limited or no NTX.
[0169] In particular embodiments, methods of the disclosure further includes treating subjects who have a toxic response and/or non-response to an immunomodulatory treatment with an anti-CD161 antibody. Commercially available anti-CD161 antibodies include: mouse anti-human CD161 clone HP-3G10 (BioLegend, San Diego, CA); mouse anti-human CD161 clone DX12 (BD Biosciences, San Jose, CA), and mouse anti-human CD161 clone B199.2 (Life Span BioSciences, Seattle, WA). In particular embodiments, an immunomodulatory treatment includes CAR T cell immunotherapy. In particular embodiments, treatment can occur before initiation of the immunomodulatory treatment, during the immunomodulatory treatment, or after the immunomodulatory treatment has been completed. In particular embodiments, an increase in the level of CD161+, as measured in a sample pre-immunomodulatory treatment (e.g. in a pre-apheresis blood sample) predicts that a subject will have a toxic response and/or nonresponse to CAR T cell therapy. Therefore, removing CD161+ cells from an apheresis product obtained from a subject prior to CAR T cell therapy may be a treatment to drive a potential toxic response and/or nonresponse to a functional response. In particular embodiments, treatment can occur at time points up to 7 days after initiation of the immunomodulatory treatment.
[0170] In particular embodiments, methods of the disclosure further includes treating subjects who have a toxic response and/or non-response to an immunomodulatory treatment with an anti-IL-18 antibody. Commercially available anti-IL-18 antibodies include: mouse anti-human IL-18 clone 50008-2 (Life Span BioSciences, Seattle, WA); rat anti-human IL-18 clone 159-12B (R&D Systems, Minneapolis, MN); and rat anti-human IL-18 (BioLegend, San Diego, CA). In particular embodiments, an immunomodulatory treatment includes CAR T cell immunotherapy. In particular embodiments, treatment can occur before initiation of the immunomodulatory treatment, during the immunomodulatory treatment, or after the immunomodulatory treatment has been completed. In particular embodiments, treatment can occur at time points up to 7 days after initiation of the immunomodulatory treatment.
[0171] In particular embodiments, methods of the disclosure further includes treating subjects who have a toxic response and/or non-response to an immunomodulatory treatment with an anti-IFN antibody. An anti-IFN monoclonal antibody, emapalumab (Gamifant) is available to treat hemophagocytic lymphohistiocytosis. Commercially available anti-IL-IFN antibodies include: polyclonal rabbit anti-human IFN (LS-B7487, Life Span BioSciences, Seattle, WA); polyclonal rabbit anti-human IFN (RP1002, BosterBio, Pleasanton, CA); and polyclonal rabbit anti-human IFN (MBS821883, MyBioSource.com, San Diego, CA). In particular embodiments, an immunomodulatory treatment includes CAR T cell immunotherapy. In particular embodiments, treatment can occur before initiation of the immunomodulatory treatment, during the immunomodulatory treatment, or after the immunomodulatory treatment has been completed. In particular embodiments, treatment can occur at time points up to 7 days after initiation of the immunomodulatory treatment.
[0172] In particular embodiments, methods of the disclosure further includes treating subjects who have a toxic response and/or non-response to an immunomodulatory treatment with an IL-18BP. In particular embodiments, the IL-18BP is a recombinant human IL-18BP. In particular embodiments, the recombinant human IL-18BP can be obtained commercially, for example, from R&D Systems, Minneapolis, MN (Cat No. 119-BP). In particular embodiments, the recombinant human IL-18BP includes Tadekinig alfa (AB2 Bio Ltd., Lausanne, Switzerland). In particular embodiments, an immunomodulatory treatment includes CAR T cell immunotherapy. In particular embodiments, treatment can occur before initiation of the immunomodulatory treatment, during the immunomodulatory treatment, or after the immunomodulatory treatment has been completed. In particular embodiments, treatment can occur at time points up to 7 days after initiation of the immunomodulatory treatment.
[0173] In particular embodiments, methods of the disclosure further includes providing to a subject who will undergo CAR T cell immunotherapy a CAR T cell product that will promote a functional response from the subject. In particular embodiments, the CAR T cell product is produced by genetically modifying T cells that were obtained from the subject prior to genetically modifying the T cells to express a CAR. In particular embodiments, the CAR T cell product that promotes a functional response is depleted of CD161+ cells. In particular embodiments, depletion of CD161+ cells from a CAR T cell product can include contacting the CAR T cell product with an anti-CD161 antibody. Exemplary anti-CD161 antibodies are described herein.
[0174] In particular embodiments, non-responders can be treated with recombinant cytokines (e.g., IL-2, IFN-, IL-15, IL-21, IL-12, IL-10, and GM-CSF), epigenetic blockade regulators (e.g., DNA methyltransferase inhibitors (e.g., azacytidine, 5-aza-2-deoxycytidine), histone deacetylase inhibitors (e.g., suberoylanilide hydroxamic acid, romidepsin, belinostat, panobinostat, chidamide), inhibitors of demethylation of cells), probiotics and prebiotics to re-train or diversify gut microbiota, and/or nanoparticles conjugated with immunomodulatory agents to fine-tune the target microenvironment. Immunomodulatory agents that can be conjugated to nanoparticles include: tecemotide; RNAs targeting tumour-associated antigens MAGE-A3, NY-ESO-1, tyrosinase, and TPTE (Lipo-MERIT); human leukocyte antigen (HLA)-A2 restricted peptides (DPX-0907); survivin (DPX-Survivac); cholesteryl hydrophobized pullulan complexed with the cancer-testis antigen NY-ESO-1 protein (CHP-NY-ESO-1); recombinant human TNF (CYT-6091); IL-2 (Oncoquest-L); adjuvant (AS15, ISCOMATRIX, JVRS-100); agent that targets dendritic cells (Lipovaxin MM); melanocyte differentiation antigen (Melan-A VLPs); viruses or viral antigens (Epaxal, Inflexal V); mycobacterial cordfactor (CAF01); and viral glycoproteins (e.g., Rpg120/HIV-1SF2).
[0175] In particular embodiments, the method further includes administering a therapeutic agent when the subject is undergoing the immunomodulatory treatment or has completed an immunomodulatory treatment to decrease a toxic response to immunotherapy. For example, if a subject is identified as having a toxic and/or non-response to an immunomodulatory treatment, a therapeutic agent can be administered to drive the aberrant response to a functional response, including: agents that interfere with antigen presentation (e.g., cyclooxygenase inhibitors (e.g., aspirin, ibuprofen), anti-CD154, CTLA4-Ig (abatacept)), agents that interfere with T-cell activation (e.g., calcineurin inhibitors, including cyclosporine A and tacrolimus; dasatinib); agents that interfere with T-cell proliferation (e.g., sirolimus, mycophenolate mofetil, leflunomide); agents that deplete T cells (e.g., alemtuzumab (anti-CD52 monoclonal antibody)), anti-thymocyte globulin (ATG), IL-1R-based inhibitors (e.g., anakinra, cyclophosphamide); an anti-IFN monoclonal antibody (e.g., emapalumab); or corticosteroids (e.g., dexamethasone, prednisone, budesonide, prednisolone, methylprednisolone). In particular embodiments, CRS associated with a toxic response to an immunomodulatory treatment can be treated with broad spectrum antibiotics, anti-histamines, antipyretics, and/or fluids. In particular embodiments, CRS associated with a toxic response to an immunomodulatory treatment can be treated with immunosuppressive drugs including: an anti-IL-6 receptor monoclonal antibody (e.g., tocilizumab); an anti-IL-6 monoclonal antibody (e.g., siltuximab, clazakizumab); an anti-TNF therapeutic (e.g., soluble TNF receptor etanercept, adalimumab, certolizumab, golimumab, infliximab); an anti-GM-CSF antibody (e.g., lenzilumab); an IL-1 receptor antagonist (e.g., anakinra); a monoclonal antibody targeting IL-2RA (basiliximab, daclizumab); a monoclonal antibody targeting anti-IL17A (ixekizumab, secukinumab); a monoclonal antibody targeting a cell adhesion molecule a4 integrin (natalizumab, vedolizumab); a monoclonal antibody targeting CD20 (rituximab); a monoclonal antibody targeting IL-12 and IL-23 (ustekinumab); small molecule inhibitors of the JAK/STAT pathway (e.g., ruxolitinib, itacitinib); Bruton's tyrosine kinase (BTK) or IL-2 inducible T cell kinase inhibitor (e.g., ibrutinib (Ruella et al. (2016) Leukemia 31:246)); mTOR inhibitors (sirolimus, everolimus); and/or steroids. In particular embodiments, CRS associated with a toxic response to an immunomodulatory treatment can be treated with cytokine adsorption (Frimmel et al. (2014) Liver Transpl. 20(12):1523-1524; Greil et al. (2017) J Clin Immunol. 37:273-276). In particular embodiments, NTX associated with a toxic response to an immunomodulatory treatment can be treated with: corticosteroids (e.g., dexamethasone, prednisone, budesonide, prednisolone, methylprednisolone); an IL-1 receptor antagonist (e.g., anakinra); an anti-GM-CSF antibody (e.g., lenzilumab); a suppressor of T cell activation (e.g., dasatinib, inhibitor of T cell receptor signaling kinases); and/or defibrotide (an FDA approved drug for the treatment of hepatic veno-occlusive disease (Richardson et al. (2016) Blood 127:1656-1665)).
[0176] In particular embodiments, identifying a subject as having a toxic response and/or non-response to an immunomodulatory treatment includes marking a biological sample appropriately so that the subject (from whom the marked biological sample was derived) receives or does not receive a selected, appropriate treatment or disease management procedure or protocol. The marking can include physically marking a container that the biological sample resides in with appropriate information or entering such appropriate information about the biological sample into a computer.
[0177] In particular embodiments, a biological sample can be assessed 1 time, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times and every remaining integer up to 100 times or more.
[0178] Particular embodiments include monitoring a response a subject will have to an immunomodulatory treatment including measuring a level of at least one biomarker described herein over a period of time. In particular embodiments, the subject will undergo, is undergoing, or has undergone an immunomodulatory treatment. In particular embodiments, a subject is selected for screening for responsiveness to an immunomodulatory treatment according to the systems and methods disclosed herein because they have been identified as a subject that would benefit from monitoring for response to an immunomodulatory treatment. Patients who could benefit from monitoring for response to an immunomodulatory treatment can include those who have an underlying immunodeficiency or those with an overactive immune system.
[0179] In particular embodiments, biological samples can be obtained and assessed from a subject weekly, monthly, every 2 months, every 3 months, every 4 months, every 5 months, every 6 months, every 7 months, every 8 months, every 9 months, every 10 months, or every 11 months, yearly, or at longer spaced periods, to monitor the subject's response to an immunomodulatory treatment.
[0180] In particular embodiments, stable measures are measures evaluated in relation to a previous comparison in the same patient and denote a stable biomarker level that has not changed significantly (as determined by a statistical measure known in the art such as a t-test or p-value, e.g., p value >0.05) since the last measurement. In particular embodiments, stable measures are measures evaluated in relation to a previous comparison in the same patient and denote a biomarker level that has not changed significantly (as determined by a statistical measure known in the art such as a t-test or p-value, e.g., p value >0.05) since an aggregated or averaged group of previous measurements (e.g., the last 3, 4, or 5 measurements).
[0181] Unchanged measures are measures evaluated in relation to a previous comparison in the same patient and denote a failure to achieve a statistically significant change (e.g., as determined by a statistical measure known in the art such as a t-test or p-value, e.g., p value >0.05) in a score towards or away from a reference level in the particular subject. In particular embodiments, unchanged measures are measures that have not changed in relation to a previous measurement in the same patient or since an aggregated or averaged group of previous measurements in the patient (e.g., the last 3, 4, or 5 measurements).
[0182] In particular embodiments, a subject is undergoing or has undergone immunotherapy to treat cancer. Cancer, as used herein, refers to the abnormal growth or division of cells. Generally, the growth and/or life span of a cancer cell exceeds, and is not coordinated with, that of the normal cells and tissues around it. Cancers may be benign, pre-malignant or malignant. Cancer occurs in a variety of cells and tissues, including the oral cavity (e.g., mouth, tongue, pharynx), digestive system (e.g., esophagus, stomach, small intestine, colon, rectum, liver, bile duct, gall bladder, pancreas), respiratory system (e.g., larynx, lung, bronchus), bones, joints, skin (e.g., basal cell, squamous cell, meningioma), breast, genital system, (e.g., uterus, ovary, prostate, testis), urinary system (e.g., bladder, kidney, ureter), eye, nervous system (e.g., brain, spinal cord), endocrine system (e.g., thyroid), and hematopoietic system (e.g., lymphoma, myeloma, leukemia, acute lymphocytic leukemia, chronic lymphocytic leukemia, acute myeloid leukemia, chronic myeloid leukemia, etc.). In particular embodiments, the cancer is pediatric acute lymphoblastic leukemia (ALL).
[0183] In particular embodiments, a subject is undergoing or has undergone immunotherapy to treat an infectious disease. Infectious diseases refer to diseases that are caused by infectious agents including bacteria, fungi, protozoa, and viruses. Viral diseases that can be treated include those caused by hepatitis type A, hepatitis type B, hepatitis type C, influenza, varicella, adenovirus, herpes simplex type I (HSV-I), herpes simplex type II (HSV-II), rinderpest, rhinovirus, echovirus, rotavirus, coronavirus, respiratory syncytial virus, papilloma virus, papova virus, cytomegalovirus, echinovirus, arbovirus, huntavirus, coxsackie virus, mumps virus, measles virus, rubella virus, polio virus, small pox, Epstein Barr virus, human immunodeficiency virus type I (HIV-I), human immunodeficiency virus type II (HIV-II), and agents of viral diseases such as viral meningitis, encephalitis, dengue or small pox.
[0184] Bacterial diseases that can be treated include mycobacteria rickettsia, mycoplasma, neisseria, S. pneumonia, Borrelia burgdorferi (Lyme disease), Bacillus antracis (anthrax), tetanus, streptococcus, staphylococcus, mycobacterium, pertussis, cholera, plague, diptheria, chlamydia, S. aureus and legionella.
[0185] Protozoan diseases caused by protozoa that can be treated include leishmania, kokzidioa, trypanosoma schistosoma or malaria. Parasitic diseases caused by parasites that can be treated, protected against, and/or managed in accordance with the methods described herein include, but are not limited to, chlamydia and rickettsia.
[0186] In particular embodiments, a subject is undergoing or has undergone immunotherapy to treat an autoimmune disease. Autoimmune diseases include alopecia areata, ankylosing spondylitis, antiphospholipid syndrome, autoimmune Addison's disease, autoimmune hemolytic anemia, autoimmune hepatitis, Behcet's disease, bullous pemphigoid, cardiomyopathy, dermatitis herpetiformis, chronic fatigue immune dysfunction syndrome (CFIDS), chronic inflammatory demyelinating polyneuropathy, Churg-Strauss syndrome, cicatricial pemphigoid, CREST syndrome, cold agglutinin disease, Crohn's disease, discoid lupus, essential mixed cryoglobulinemia, fibromyalgia fibromyositis, Graves' disease, Guillain-Barre, Hashimoto's thyroiditis, hypothyroidism, idiopathic pulmonary fibrosis, idiopathic thrombocytopenia purpura (ITP), IgA nephropathy, insulin dependent diabetes, irritable bowel disease (IBD), juvenile arthritis, lichen planus, lupus, Meniere's disease, mixed connective tissue disease, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, pernicious anemia, polyarteritis nodosa, polychondritis, polyglandular syndromes, polymyalgia rheumatica, polymyositis and dermatomyositis, primary agammaglobulinemia, primary biliary cirrhosis, psoriasis, Raynaud's phenomenon, Reiter's syndrome, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma, Sjgren's syndrome, stiff-person syndrome, Takayasu arteritis, temporal arteritis/giant cell arteritis, ulcerative colitis, uveitis, vasculitis, vitiligo, Wegener's granulomatosis, and myasthenia gravis.
[0187] Methods disclosed herein include treating subjects (e.g., humans, veterinary animals (dogs, cats, reptiles, birds) livestock (e.g., horses, cattle, goats, pigs, chickens) and research animals (e.g., monkeys, rats, mice, fish) with compositions disclosed herein. In particular embodiments, a subject includes a child. Treating subjects includes delivering therapeutically effective amounts. Therapeutically effective amounts include those that provide effective amounts, prophylactic treatments and/or therapeutic treatments.
[0188] An effective amount is the amount of a therapeutic agent necessary to result in a desired physiological change in the subject. Effective amounts are often administered for research purposes. Effective amounts disclosed herein can cause a statistically-significant effect in an animal model or in vitro assay relevant to the assessment of the effectiveness of the therapeutic agent in promoting response to an immunotherapy or in suppressing a toxic response to an immunotherapy.
[0189] A prophylactic treatment includes a treatment administered to a subject who does not display signs or symptoms of an aberrant immune response to immunotherapy or displays only early signs or symptoms of an aberrant immune response such that treatment is administered for the purpose of diminishing or decreasing the risk of developing an aberrant immune response to immunotherapy. Thus, a prophylactic treatment functions as a preventative treatment against an aberrant immune response to immunotherapy. In particular embodiments, prophylactic treatments reduce, delay, or prevent the worsening of an aberrant immune response to immunotherapy. In particular embodiments, an aberrant immune response to immunotherapy includes a toxic response and/or nonresponse.
[0190] A therapeutic treatment includes a treatment administered to a subject who displays symptoms or signs of an aberrant immune response to immunotherapy and is administered to the subject for the purpose of diminishing or eliminating those signs or symptoms of an aberrant immune response to immunotherapy. The therapeutic treatment can reduce, control, or eliminate aberrant immune response to immunotherapy and/or reduce control or eliminate side effects of the aberrant immune response to immunotherapy. In particular embodiments, an aberrant immune response to immunotherapy includes a toxic response and/or nonresponse.
[0191] Function as an effective amount, prophylactic treatment or therapeutic treatment are not mutually exclusive, and in particular embodiments, administered dosages may accomplish more than one treatment type.
[0192] In particular embodiments, therapeutically effective amounts promote a response to an immunotherapy. In particular embodiments, therapeutically effective amounts suppress a toxic response to an immunotherapy.
[0193] For administration, therapeutically effective amounts (also referred to herein as doses) can be initially estimated based on results from in vitro assays and/or animal model studies. Such information can be used to more accurately determine useful doses in subjects of interest. The actual dose amount administered to a particular subject can be determined by a physician, veterinarian or researcher taking into account parameters such as physical and physiological factors including target, body weight, severity of condition, type of response to immunotherapy, previous or concurrent immunotherapy, idiopathy of the subject and route of administration.
[0194] Useful doses can range from 0.1 to 5 g/kg or from 0.5 to 1 g/kg. In other non-limiting examples, a dose can include 1 g/kg, 15 g/kg, 30 g/kg, 50 g/kg, 55 g/kg, 70 g/kg, 90 g/kg, 150 g/kg, 350 g/kg, 500 g/kg, 750 g/kg, 1000 g/kg, 0.1 to 5 mg/kg or from 0.5 to 1 mg/kg. In other non-limiting examples, a dose can include 1 mg/kg, 10 mg/kg, 30 mg/kg, 50 mg/kg, 70 mg/kg, 100 mg/kg, 300 mg/kg, 500 mg/kg, 700 mg/kg, 1000 mg/kg or more.
[0195] Therapeutically effective amounts can be achieved by administering single or multiple doses during the course of a treatment regimen (e.g., daily, every other day, every 3 days, every 4 days, every 5 days, every 6 days, weekly, every 2 weeks, every 3 weeks, monthly, every 2 months, every 3 months, every 4 months, every 5 months, every 6 months, every 7 months, every 8 months, every 9 months, every 10 months, every 11 months or yearly).
[0196] (VII) Kits. The systems and methods disclosed herein include kits. Disclosed kits include material(s) and reagent(s) necessary to assay a sample obtained from a subject for the level of one or more biomarkers disclosed herein. The materials and reagents can include those necessary to assay the biomarkers disclosed herein according to any method described herein and/or known to one of ordinary skill in the art. The biomarkers to assay for include: interleukin (IL)-18; IL-18 binding protein (IL-18BP); IL-18 receptor 1 (IL-18R1); IL-18 receptor accessory protein (IL-18RAP); IL-2; soluble IL-2 receptor alpha (sIL-2RA); IL-5; IL-6; IL-9; IL-10; IL-22; Interferon gamma (IFN); Granulocyte Macrophage Colony Stimulating Factor (GM-CSF); serum amyloid A (SAA); C-reactive protein (CRP); CD161+ cells; CD56+ dim cells; CD161+ CD3+ T cells; CD161+ CD4+ T cells; CD161+ CD4+ CD45RA-T cells; CD161+ CD8+ T cells; CD161+CD8+ CD45RA+ T cells; CD161+ CD56+ NK cells; CD161+ MAIT cells; CD161+ GM-CSF+ NK cells; CD161+ GM-CSF+ MAIT cells; CD161+ GM-CSF+ T cells; CD161+ IFN+ NK cells; CD161+ IFN+ MAIT cells; CD161+ IFN+ T cells; CD161+ IFN+ NKT cells; or a combination thereof.
[0197] Particular embodiments include materials and reagents necessary to assay for up- or down-regulation of a biomarker protein in a sample. In particular embodiments, the kits include antibodies, aptamers, epitopes, or mimotopes to bind biomarker proteins. Other embodiments additionally or alternatively include oligonucleotides that specifically assay for one or more biomarker nucleic acids based on homology and/or complementarity with biomarker nucleic acids. The oligonucleotide sequences may correspond to fragments of the biomarker nucleic acids. For example, the oligonucleotides can be more than 200, 175, 150, 100, 50, 25, 10, or fewer than 10 nucleotides in length. Collectively, any molecule (e.g., antibody, aptamer, epitope, mimotope, oligonucleotide) that forms a complex with a biomarker is referred to as a biomarker binding agent herein. In particular embodiments, the kits include biomarker binding agents that bind the following: IL-18; IL-18BP; IL-18R1; IL-18RAP; CD161; CD56; IL-2; sIL-2RA; IL-5; IL-6; IL-9; IL-10; IL-22; IFN; GM-CSF; SAA; and CRP.
[0198] Embodiments of kits can contain in separate containers biomarker binding agents either bound to a matrix or packaged separately with reagents for binding to a solid phase. In particular embodiments, the solid phase is, for example, a porous strip, array, or microtiter plate. In particular embodiments, measurement or detection regions of the solid phase can include a plurality of sites containing biomarker binding agents. In particular embodiments, the solid phase can also contain sites for negative and/or positive controls. Alternatively, control sites can be located on a separate solid phase from the solid phase including the biomarker binding agents. Optionally, the different detection sites can contain different amounts of biomarker binding agents, e.g., a higher amount in the first detection site and lesser amounts in subsequent sites. Upon the addition of test sample, the number of sites displaying a detectable signal provides a quantitative indication of the amount of biomarker present in the sample. The detection sites can be configured in any suitably detectable size and shape and can be, e.g., in the shape of a bar or dot spanning the width (or a portion thereof) of a solid phase.
[0199] In some embodiments the solid phase can be a chip. See, e.g., U.S. Pat. No. 5,744,305. In some embodiments the matrix can be a solution array; e.g., xMAP (Luminex, Austin, Tex.), Cyvera (Illumina, San Diego, Calif.), RayBio Antibody Arrays (RayBiotech, Inc., Norcross, Ga.), CellCard (Vitra Bioscience, Mountain View, Calif.) and Quantum Dots' Mosaic (Invitrogen, Carlsbad, Calif.).
[0200] Additional embodiments can include control formulations (positive and/or negative), and/or one or more detectable labels including a radioactive isotope, an enzyme reporter, a colorimetric label, a chemiluminescent label, a colored particles, gold nanoparticles, colloids, magnetic beads, or biotin among others. Examples of detectable labels include fluorescein, green fluorescent protein, rhodamine, cyanine dyes, dialkylcarbocyanine dyes, Alexa dyes, luciferase, and horseradish peroxidase. Instructions for carrying out an assay to detect one or more biomarkers, including, optionally, instructions for generating a score, can be included in the kit; e.g., written, tape, VCR, or CD-ROM.
[0201] In particular embodiments, the kits include materials and reagents necessary to conduct an immunoassay (e.g., ELISA). In particular embodiments, the kits include materials and reagents necessary to conduct amplification assays (e.g., PCR). In particular embodiments, the kits include materials and reagents necessary to perform immunohistochemical staining, flow cytometry, an enzyme-based colorimetric assay, and/or a protein activity assay. In particular embodiments, materials and reagents expressly exclude equipment (e.g., plate readers). In particular embodiments, kits can exclude materials and reagents commonly found in laboratory settings (pipettes; test tubes; buffer solutions, distilled H.sub.2O).
(VIII) Exemplary Embodiments
[0202] 1. A method of selecting a therapeutic agent to administer to a subject, including obtaining a biological sample derived from a subject; [0203] measuring a level of at least one biomarker selected from the group consisting of interleukin (IL)-18; IL-18 binding protein (IL-18BP), interferon gamma (IFN), and CD161+ cells to generate a test biomarker profile; [0204] comparing the test biomarker profile to a reference biomarker profile including the level(s) of the same biomarker(s); and [0205] identifying the subject as having or predicting that the subject will have a toxic response and/or non-response to an immunomodulatory treatment when the test biomarker profile includes increased levels of the at least one biomarker as compared to the reference biomarker profile; and [0206] selecting a therapeutic agent to administer to the subject. [0207] 2. The method of embodiment 1, wherein the reference biomarker profile is from a subject or a population of subjects having a functional response to the immunomodulatory treatment with limited or no neurotoxicity (NTX). [0208] 3. The method of embodiment 1 or 2, wherein the biological sample includes a blood sample and/or a cell sample. [0209] 4. The method of any of embodiments 1-3, wherein the biological sample is obtained before the immunomodulatory treatment has initiated, and wherein the at least one biomarker is selected from IL-18BP and/or CD161+ cells. [0210] 5. The method of any of embodiments 1-3, wherein the biological sample is obtained 1 day, 3 days, and/or 7 days after the immunomodulatory treatment has initiated, and wherein the at least one biomarker is selected from the group consisting of IL-18, IL-18BP, and IFN. [0211] 6. The method of any of embodiments 1-5, wherein the immunomodulatory treatment includes administration of chimeric antigen receptor (CAR) T cell immunotherapy and the therapeutic agent includes: an anti-CD161 antibody, an anti-IL-18 antibody, an anti-IFN antibody, an IL-18BP, or a combination thereof. [0212] 7. The method of any of embodiments 1-6, wherein the immunomodulatory treatment includes administration of chimeric antigen receptor (CAR) T cell immunotherapy, and wherein the method further includes removing CD161+ cells from an apheresis product obtained from the subject prior to the immunomodulatory treatment to produce an apheresis product reduced in CD161+ cells. [0213] 8. The method of embodiment 7, wherein the method further includes contacting the apheresis product obtained from the subject with an anti-CD161 antibody. [0214] 9. A method for generating a test biomarker profile including: [0215] obtaining a biological sample derived from a subject; [0216] measuring a level of [0217] (A) at least one biomarker selected from the group consisting of interleukin (IL)-18; IL-18 binding protein (IL-18BP); IL-18 receptor 1 (IL-18R1); IL-18 receptor accessory protein (IL-18RAP); IL-2; soluble IL-2 receptor alpha (sIL-2RA); IL-5; IL-6; IL-9; IL-10; IL-22; interferon gamma (IFN); granulocyte macrophage colony stimulating factor (GM-CSF); serum amyloid A (SAA); and C-reactive protein (CRP); and/or [0218] (B) at least one biomarker cell population selected from CD161+ cells, CD56+ dim cells, or a combination thereof; [0219] thereby generating a test biomarker profile including levels of the at least one biomarker and/or the at least one biomarker cell population. [0220] 10. The method of embodiment 9, wherein the CD161+ cells further include CD161+ CD3+ T cells; CD161+ CD4+ T cells; CD161+ CD4+ CD45RA-T cells; CD161+ CD8+ T cells; CD161+CD8+ CD45RA+ T cells; CD161+ CD56+ natural killer (NK) cells; CD161+ mucosal associated invariant T (MAIT) cells; CD161+ GM-CSF+ NK cells; CD161+ GM-CSF+ MAIT cells; CD161+GM-CSF+ T cells; CD161+ IFN+ NK cells; CD161+ IFN+ MAIT cells; CD161+ IFN+ T cells; CD161+ IFN+ NKT cells; or a combination thereof. [0221] 11. The method of embodiment 9 or 10, wherein the CD56+ dim cells are circulating NK cells. [0222] 12. The method of any of embodiments 9-11, wherein the subject has not undergone an immunomodulatory treatment, is undergoing an immunomodulatory treatment, or has completed an immunomodulatory treatment. [0223] 13. The method of any of embodiments 9-12, wherein the biological sample includes a blood sample and/or a cell sample. [0224] 14. The method of embodiment 13, wherein the blood sample is serum or plasma. [0225] 15. The method of embodiment 13, wherein the cell sample is a peripheral blood mononuclear (PBMC) sample. [0226] 16. The method of any of embodiments 9-15, further including [0227] comparing the test biomarker profile to a reference biomarker profile including the level(s) of the same biomarker(s); and [0228] identifying the subject as having or predicting that the subject will have a toxic response and/or non-response to an immunomodulatory treatment when the test biomarker profile includes increased levels of the at least one biomarker of (A) and/or an increased level of the at least one biomarker cell population of (B) as compared to the reference biomarker profile. [0229] 17. The method of embodiment 16, wherein the reference biomarker profile is from a subject or a population of subjects having a functional response to the immunomodulatory treatment with limited or no neurotoxicity (NTX). [0230] 18. The method of any of embodiments 9-17, wherein the at least one biomarker cell population of (B) is CD161+ cells, and wherein the level of the CD161+ cells of the test biomarker profile is increased 2-fold to 10-fold as compared to the level of CD161+ cells of the reference biomarker profile. [0231] 19. The method of any of embodiments 9-18, wherein the at least one biomarker cell population of (B) is CD161+ cells, and wherein the level of the CD161+ cells of the test biomarker profile is 10% to 30% of total live cells in the sample. [0232] 20. The method of any of embodiments 9-19, wherein the level of the at least one biomarker of (A) is increased 1.1-fold to 10-fold as compared to the level of the same at least one biomarker of the reference biomarker profile. [0233] 21. The method of any of embodiments 9-20, wherein the subject has not undergone the immunomodulatory treatment. [0234] 22. The method of embodiment 21, further including excluding the subject from a clinical trial. [0235] 23. The method of any of embodiments 9-20, wherein the subject is undergoing the immunomodulatory treatment. [0236] 24. The method of embodiment 23, further including terminating the immunomodulatory treatment and initiating a different immunomodulatory treatment. [0237] 25. The method of any of embodiments 9-20, wherein the subject has completed the immunomodulatory treatment. [0238] 26. The method of embodiment 25, further including initiating a different immunomodulatory treatment. [0239] 27. The method of any of embodiments 9-26, wherein the immunomodulatory treatment includes administering to the subject chimeric antigen receptor (CAR) T cell immunotherapy, therapeutic agents to deplete regulatory T cells, recombinant cytokines, immune checkpoint inhibitors, monoclonal antibodies, bispecific antibodies, dual-affinity retargeting antibodies, immune-mobilizing monoclonal T cell receptors against cancer, vaccines, or a combination thereof. [0240] 28. The method of any of embodiments 9-27, wherein the at least one biomarker cell population of (B) is CD161+ cells, wherein the immunomodulatory treatment includes administration of chimeric antigen receptor (CAR) T cell immunotherapy, and wherein the method further includes removing CD161+ cells from an apheresis product obtained from the subject prior to administration of the CAR T cell immunotherapy to produce an apheresis product reduced in CD161+ cells. [0241] 29. The method of embodiment 28, wherein the method further includes contacting the apheresis product obtained from the subject with an anti-CD161 antibody. [0242] 30. The method of any of embodiments 9-29, further including administering a therapeutic agent prior to initiating the immunomodulatory treatment in the subject and/or when the subject is undergoing the immunomodulatory treatment to drive the toxic and/or non-response to a functional response. [0243] 31. The method of embodiment 30, wherein the immunomodulatory treatment includes chimeric antigen receptor (CAR) T cell immunotherapy and the therapeutic agent includes: an anti-CD161 antibody, an anti-IL-18 antibody, an anti-IFN antibody, an IL-18BP, or a combination thereof. [0244] 32. The method of embodiment 30 or 31, wherein the administering occurs at time points up to 7 days after initiation of the immunomodulatory treatment. [0245] 33. The method of any of embodiments 30-32, wherein the therapeutic agent includes: recombinant cytokines; epigenetic blockade regulators; nanoparticles conjugated with immunomodulatory agents; antibodies; fusion proteins; small molecules; corticosteroids; or a combination thereof. [0246] 34. The method of embodiment 33, wherein the recombinant cytokines are selected from IL-2, IFN-, IL-15, IL-21, IL-12, IL-10, GM-CSF, or a combination thereof. [0247] 35. The method of embodiment 33, wherein the epigenetic blockade regulators are selected from azacytidine, 5-aza-2-deoxycytidine, suberoylanilide hydroxamic acid, romidepsin, belinostat, panobinostat, chidamide, or a combination thereof. [0248] 36. The method of embodiment 33, wherein the antibodies are selected from an anti-CD154 antibody, emapalumab, alemtuzumab, tocilizumab, siltuximab, clazakizumab, anti-thymocyte globulin, adalimumab, certolizumab, golimumab, infliximab, lenzilumab, basiliximab, daclizumab, ixekizumab, secukinumab, natalizumab, vedolizumab, rituximab, ustekinumab, or a combination thereof. [0249] 37. The method of embodiment 33, wherein the fusion proteins are abatacept and/or etanercept. [0250] 38. The method of embodiment 33, wherein the small molecules are selected from aspirin, ibuprofen, cyclosporine A, tacrolimus, dasatinib, sirolimus, everolimus, mycophenolate mofetil, leflunomide, anakinra, cyclophosphamide, ruxolitinib, itacitinib, ibrutinib, or a combination thereof. [0251] 39. The method of embodiment 33, wherein the corticosteroids are selected from dexamethasone, prednisone, budesonide, prednisolone, methylprednisolone, or a combination thereof. [0252] 40. The method of any of embodiments 9-39, further including monitoring the subject for a response to the immunomodulatory treatment, wherein the monitoring includes repeating the measuring while the subject is undergoing the immunomodulatory treatment, thereby monitoring the response the subject has to the immunomodulatory treatment. [0253] 41. The method of any of embodiments 9-40, wherein the measuring [0254] is performed prior to the subject undergoing an immunomodulatory treatment, while the subject is undergoing an immunomodulatory treatment, or after the subject has undergone an immunomodulatory treatment; and includes measuring at least one biomarker selected from the group consisting of IL-18, IL-18BP, sIL-2RA, IL-10, IL-22, and IFN. [0255] 42. The method of any of embodiments 9-41, wherein the measuring is performed prior to the subject undergoing an immunomodulatory treatment, while the subject is undergoing an immunomodulatory treatment, or after the subject has undergone an immunomodulatory treatment; and includes measuring at least one biomarker selected from the group consisting of IL-18, IL-18BP, and IFN. [0256] 43. The method of any of embodiments 10-42, wherein the measuring [0257] is performed prior to the subject undergoing an immunomodulatory treatment; and [0258] includes measuring [0259] (A) at least one biomarker selected from the group consisting of IL-18, IL-18BP, IL-10, sIL-2RA, IL-22, and IFN; and/or [0260] (B) at least one biomarker cell population selected from the group consisting of: CD56+ dim cells; CD161+CD3+ T cells; CD161+CD4+ T cells; CD161+CD4+CD45RA-T cells; CD161+CD8+ T cells; CD161+CD8+CD45RA+ T cells; CD161+CD56+ NK cells; CD161+ MAIT cells; CD161+GM-CSF+NK cells; CD161+GM-CSF+ MAIT cells; CD161+GM-CSF+ T cells; CD161+ IFN+NK cells; CD161+ IFN+ MAIT cells; CD161+ IFN+ T cells; and CD161+ IFN+ NKT cells. [0261] 44. The method of embodiment 43, wherein the at least one biomarker includes IL-18BP. [0262] 45. The method of any of embodiments 9-42, wherein the measuring is performed 1 day after an immunomodulatory treatment has initiated and includes measuring at least one biomarker selected from the group consisting of IL-10, IFN, GM-CSF, and SAA. [0263] 46. The method of any of embodiments 9-42, wherein the measuring is performed 3 days after an immunomodulatory treatment has initiated and includes measuring at least one biomarker selected from the group consisting of IL-10, IFN, GM-CSF, and CRP. [0264] 47. The method of any of embodiments 9-42, wherein the measuring is performed 3 days after an immunomodulatory treatment has initiated and includes measuring at least one biomarker selected from the group consisting of sIL-2RA, IL-5, IL-10, and GM-CSF. [0265] 48. The method of any of embodiments 9-42, wherein the measuring is performed 7 days after an immunomodulatory treatment has initiated and includes measuring at least one biomarker selected from the group consisting of IL-18, IL-18BP, and IFN. [0266] 49. The method of any of embodiments 9-42, wherein the measuring is performed 7 days after an immunomodulatory treatment has initiated and includes measuring at least one biomarker selected from the group consisting of IL-18, IL-18BP, and IL-22. [0267] 50. The method of any of embodiments 9-49, wherein the measuring includes using immunoassay or flow cytometry. [0268] 51. A method of screening a subject for exclusion from a clinical trial, including [0269] obtaining a biological sample derived from a subject; [0270] measuring a level of [0271] (A) at least one biomarker selected from the group consisting of interleukin (IL)-18; IL-18 binding protein (IL-18BP); IL-18 receptor 1 (IL-18R1); IL-18 receptor accessory protein (IL-18RAP); IL-2; soluble IL-2 receptor alpha (sIL-2RA); IL-5; IL-6; IL-9; IL-10; IL-22; interferon gamma (IFN); granulocyte macrophage colony stimulating factor (GM-CSF); serum amyloid A (SAA); and C-reactive protein (CRP); and/or [0272] (B) at least one biomarker cell population selected from CD161+ cells, CD56+ dim cells, or a combination thereof; to generate a test biomarker profile; [0273] comparing the test biomarker profile to a reference biomarker profile including the level(s) of the same biomarker(s); [0274] identifying the subject as having or predicting that the subject will have a toxic response and/or non-response to an immunomodulatory treatment when the test biomarker profile includes an increased level of the at least one biomarker of (A) and/or an increased level of the at least one biomarker cell population of (B) as compared to the reference biomarker profile, thereby screening a subject for exclusion from a clinical trial. [0275] 52. The method of embodiment 51, wherein the reference biomarker profile is from a subject or a population of subjects having a functional response to the immunomodulatory treatment with limited or no neurotoxicity (NTX). [0276] 53. The method of embodiment 51 or 52, wherein the CD161+ cells further include CD161+ CD3+ T cells; CD161+ CD4+ T cells; CD161+ CD4+ CD45RA-T cells; CD161+ CD8+ T cells; CD161+CD8+ CD45RA+ T cells; CD161+ CD56+ natural killer (NK) cells; CD161+ mucosal associated invariant T (MAIT) cells; CD161+ GM-CSF+ NK cells; CD161+ GM-CSF+ MAIT cells; CD161+GM-CSF+ T cells; CD161+ IFN+ NK cells; CD161+ IFN+ MAIT cells; CD161+ IFN+ T cells; CD161+ IFN+ NKT cells; or a combination thereof. [0277] 54. The method of any of embodiments 51-53, wherein the at least one biomarker includes IL-18BP and the at least one biomarker cell population includes CD161+ cells. [0278] 55. The method of any of embodiments 51-54, wherein the CD56+ dim cells are circulating NK cells. [0279] 56. The method of any of embodiments 51-55, wherein the subject has not undergone an immunomodulatory treatment, is undergoing an immunomodulatory treatment, or has completed an immunomodulatory treatment. [0280] 57. The method of any of embodiments 51-56, wherein the biological sample includes a blood sample and/or a cell sample. [0281] 58. The method of embodiment 57, wherein the blood sample is serum or plasma. [0282] 59. The method of embodiment 57, wherein the cell sample is a peripheral blood mononuclear (PBMC) sample. [0283] 60. The method of any of embodiments 51-59, wherein the at least one biomarker cell population of (B) is CD161+ cells, and wherein the level of the CD161+ cells of the test biomarker profile is increased 2-fold to 10-fold as compared to the level of CD161+ cells of the reference biomarker profile. [0284] 61. The method of any of embodiments 51-60, wherein the at least one biomarker cell population of (B) is CD161+ cells, and wherein the level of the CD161+ cells of the test biomarker profile is 10% to 30% of total live cells in the sample. [0285] 62. The method of any of embodiments 51-61, wherein the level of the at least one biomarker of (A) is increased 1.1-fold to 10-fold as compared to the level of the same at least one biomarker of the reference biomarker profile. [0286] 63. A method of selecting a therapeutic agent to administer to a subject, including measuring a level of [0287] (A) at least one biomarker selected from the group consisting of interleukin (IL)-18; IL-18 binding protein (IL-18BP); IL-18 receptor 1 (IL-18R1); IL-18 receptor accessory protein (IL-18RAP); IL-2; soluble IL-2 receptor alpha (sIL-2RA); IL-5; IL-6; IL-9; IL-10; IL-22; interferon gamma (IFN); granulocyte macrophage colony stimulating factor (GM-CSF); serum amyloid A (SAA); and C-reactive protein (CRP); and/or [0288] (B) at least one biomarker cell population selected from CD161+ cells, CD56+ dim cells, [0289] or a combination thereof; to generate a test biomarker profile; [0290] comparing the test biomarker profile to a reference biomarker profile including the level(s) of the same biomarker(s); [0291] identifying the subject as having or predicting that the subject will have a toxic response and/or non-response to an immunomodulatory treatment when the test biomarker profile includes an increased level of the at least one biomarker of (A) and/or an increased level of the at least one biomarker cell population of (B) as compared to the reference biomarker profile, and [0292] selecting a therapeutic agent to administer to the subject. [0293] 64. The method of embodiment 63, wherein the subject has not undergone an immunomodulatory treatment, is undergoing an immunomodulatory treatment, or has completed an immunomodulatory treatment. [0294] 65. The method of embodiment 63 or 64, wherein the biological sample includes a blood sample and/or a cell sample. [0295] 66. The method of embodiment 65, wherein the blood sample is serum or plasma. [0296] 67. The method of embodiment 65, wherein the cell sample is a peripheral blood mononuclear (PBMC) sample. [0297] 68. The method of any of embodiments 63-67, wherein the biological sample is obtained before the immunomodulatory treatment has initiated, and wherein the at least one biomarker is includes IL-18BP and the at least one biomarker cell population includes CD161+ cells. [0298] 69. The method of any of embodiments 63-67, wherein the biological sample is obtained 1 day, 3 days, and/or 7 days after the immunomodulatory treatment has initiated, and wherein the at least one biomarker is selected from the group consisting of IL-18, IL-18BP, and IFN. [0299] 70. The method of any of embodiments 63-68, wherein the immunomodulatory treatment includes administering to the subject chimeric antigen receptor (CAR) T cell immunotherapy, therapeutic agents to deplete regulatory T cells, recombinant cytokines, immune checkpoint inhibitors, monoclonal antibodies, bispecific antibodies, dual-affinity retargeting antibodies, immune-mobilizing monoclonal T cell receptors against cancer, vaccines, or a combination thereof. [0300] 71. The method of any of embodiments 63-70, wherein the at least one biomarker cell population of (B) is CD161+ cells, wherein the immunomodulatory treatment includes administration of chimeric antigen receptor (CAR) T cell immunotherapy, and wherein the method further includes removing CD161+ cells from an apheresis product obtained from the subject prior to administration of the CAR T cell immunotherapy to produce an apheresis product reduced in CD161+ cells. [0301] 72. The method of embodiment 71, wherein the method further includes contacting the apheresis product obtained from the subject with an anti-CD161 antibody. [0302] 73. The method of any of embodiments 63-72, wherein the immunomodulatory treatment includes chimeric antigen receptor (CAR) T cell immunotherapy and the therapeutic agent includes: an anti-CD161 antibody, an anti-IL-18 antibody, an anti-IFN antibody, an IL-18BP, or a combination thereof. [0303] 74. The method of any of embodiments 63-73, further including administering a therapeutic agent prior to initiating the immunomodulatory treatment in the subject and/or when the subject is undergoing the immunomodulatory treatment. [0304] 75. The method of embodiment 74, wherein the administering occurs at time points up to 7 days after initiation of the immunomodulatory treatment. [0305] 76. The method of any of embodiments 63-75, wherein the therapeutic agent includes: recombinant cytokines; epigenetic blockade regulators; nanoparticles conjugated with immunomodulatory agents; antibodies; fusion proteins; small molecules; corticosteroids; or a combination thereof. [0306] 77. The method of embodiment 76, wherein the recombinant cytokines are selected from IL-2, IFN-, IL-15, IL-21, IL-12, IL-10, GM-CSF, or a combination thereof. [0307] 78. The method of embodiment 76, wherein the epigenetic blockade regulators are selected from azacytidine, 5-aza-2-deoxycytidine, suberoylanilide hydroxamic acid, romidepsin, belinostat, panobinostat, chidamide, or a combination thereof. [0308] 79. The method of embodiment 76, wherein the antibodies are selected from an anti-CD154 antibody, emapalumab, alemtuzumab, tocilizumab, siltuximab, clazakizumab, anti-thymocyte globulin, adalimumab, certolizumab, golimumab, infliximab, lenzilumab, basiliximab, daclizumab, ixekizumab, secukinumab, natalizumab, vedolizumab, rituximab, ustekinumab, or a combination thereof. [0309] 80. The method of embodiment 76, wherein the fusion proteins are abatacept and/or etanercept. [0310] 81. The method of embodiment 76, wherein the small molecules are selected from aspirin, ibuprofen, cyclosporine A, tacrolimus, dasatinib, sirolimus, everolimus, mycophenolate mofetil, leflunomide, anakinra, cyclophosphamide, ruxolitinib, itacitinib, ibrutinib, or a combination thereof. [0311] 82. The method of embodiment 76, wherein the corticosteroids are selected from dexamethasone, prednisone, budesonide, prednisolone, methylprednisolone, or a combination thereof. [0312] 83. A method of identifying a subject as having or predicting that a subject will have a toxic response and/or non-response to an immunomodulatory treatment including obtaining a biological sample derived from a subject; measuring a level of [0313] (A) at least one biomarker selected from the group consisting of interleukin (IL)-18; IL-18 binding protein (IL-18BP); IL-18 receptor 1 (IL-18R1); IL-18 receptor accessory protein (IL-18RAP); IL-2; soluble IL-2 receptor alpha (sIL-2RA); IL-5; IL-6; IL-9; IL-10; IL-22; interferon gamma (IFN); granulocyte macrophage colony stimulating factor (GM-CSF); serum amyloid A (SAA); and C-reactive protein (CRP); and/or [0314] (B) at least one biomarker cell population selected from CD161+ cells, CD56+ dim cells, or a combination thereof; [0315] comparing the test biomarker profile to a reference biomarker profile including the level(s) of the same measured biomarker(s); and [0316] identifying the subject as having or predicting that the subject will have a toxic response and/or non-response to an immunomodulatory treatment when the test biomarker profile includes an increased level of the at least one biomarker of (A) and/or an increased level of the at least one biomarker cell population of (B) as compared to a reference biomarker profile. [0317] 84. The method of embodiment 83, wherein the reference biomarker profile is from a subject or a population of subjects having a functional response to the immunomodulatory treatment with limited or no neurotoxicity (NTX). [0318] 85. The method of embodiment 83 or 84, wherein the at least one biomarker cell population of (B) is CD161+ cells, and wherein the level of the CD161+ cells of the test biomarker profile is increased 2-fold to 10-fold as compared to the level of CD161+ cells of the reference biomarker profile. [0319] 86. The method of any of embodiments 83-85, wherein the at least one biomarker cell population of (B) is CD161+ cells, and wherein the level of the CD161+ cells of the test biomarker profile is 10% to 30% of total live cells in the sample. [0320] 87. The method of any of embodiments 83-86, wherein the level of the at least one biomarker of (A) is increased 1.1-fold to 10-fold as compared to the level of the same at least one biomarker of the reference biomarker profile. [0321] 88. A kit including at least two biomarker binding agents, wherein the at least two biomarker binding agents bind biomarkers selected from the group consisting of interleukin (IL)-18; IL-18 binding protein (IL-18BP); IL-18 receptor 1 (IL-18R1); IL-18 receptor accessory protein (IL-18RAP); IL-2; soluble IL-2 receptor alpha (sIL-2RA); IL-5; IL-6; IL-9; IL-10; IL-22; interferon gamma (IFN); granulocyte macrophage colony stimulating factor (GM-CSF); serum amyloid A (SAA); and C-reactive protein (CRP); C-type lectin-like receptor (CD161)+ cells; CD56+ dim cells; or a combination thereof. [0322] 89. The kit of embodiment 88, wherein the at least two biomarker binding agents bind to biomarkers selected from the group consisting of IL-18, IL-18BP, sIL-2RA, IL-10, IL-22, IFN, and CD161+ cells. [0323] 90. The kit of embodiment 88 or 89, wherein the biomarker binding agents are proteins, antibodies, aptamers, mimotopes, or oligonucleotides. [0324] 91. The kit of any of embodiments 88-90, further including a detectable label. [0325] 92. The kit of embodiment 91, wherein the detectable label is a radioactive isotope, enzyme reporter, colorimetric label, fluorescent label, chemiluminescent label, colored particles, gold nanoparticles, colloids, magnetic bead, or biotin. [0326] 93. The kit of any of embodiments 88-92, wherein the kit includes reagents to perform amplification of nucleic acids, an immunoassay, an immunohistochemical staining, flow cytometry, an enzyme-based colorimetric assay, and/or a protein activity assay. [0327] 94. An array including at least two biomarkers selected from the group consisting of interleukin (IL)-18; IL-18 binding protein (IL-18BP); IL-18 receptor 1 (IL-18R1); IL-18 receptor accessory protein (IL-18RAP); IL-2; soluble IL-2 receptor alpha (sIL-2RA); IL-5; IL-6; IL-9; IL-10; IL-22; interferon gamma (IFN); granulocyte macrophage colony stimulating factor (GM-CSF); serum amyloid A (SAA); and C-reactive protein (CRP). [0328] 95. The array of embodiment 94, wherein the at least two biomarkers include IL-18, IL-18BP, sIL-2RA, IL-10, IL-22, and IFN. [0329] 96. An array including at least two biomarker cell populations including CD161+ cells and/or CD56+ dim cells.
(IX) Examples
[0330] Example 1. Studies were conducted to profile how cytokine composition and kinetics of monocytes both on a transcriptional and a protein level impact the spectrum of toxicity and response to immunotherapeutics (multi-trial biomarker validation). Tools, such as in vitro assays and protein engineering, can be developed and used to predict response and toxicity and derive mechanistic causality. Notably, these studies will lead to the development of a series of assays which can predict response rates, helping to identify subjects who may fail in immunotherapy trials, and mitigate life-threatening toxicity in subjects treated with CAR T-cells. Broadly, the mechanistic interrogation of macrophage activation states will lead to an understanding of how a subject's cytokine inflammatory status drives immune response and subsequently how that response drives tumor progression and therapeutic responses.
[0331] To understand the proinflammatory cytokine transcriptional program of the patient prior to CAR T, a number of assays were carried out. An Assay for Transposase Accessible Chromatin with high-throughput sequencing (ATAC-seq; Buenrostro et al. Curr Protoc Mol Biol. 2016; 109: 21.29.1-21.29.9) was performed to identify global program or open chromatin. Chromatin immunoprecipitation with high-throughput sequencing (ChIP-seq) was performed to identify transcription factors and/or methylation/acetylation marks. qPCR was used to validate hits obtained from ATAC-seq and ChIP-seq.
[0332] A population of randomized and blinded subset of pediatric patients were studied. Cytokine and epigenetic profiling from pediatric CAR T treated patients suggested that MP activation status as measured by open chromatin can predict CAR T toxicity and efficacy.
[0333] Machine learning models in CD19 CAR T treated patients showed evidence that an interferon gamma (IFN) (T-cell)-interleukin (IL)-18 myeloid (M) axis mediated post-CAR toxicity and response.
[0334] In severe toxicity patients (and non-responsive patients), there was elevated sIL-2RA and slightly elevated IL-2 levels. A dysfunctional IL-12 signaling cascade was also observed. In normal physiological conditions IL-18 co-signals with IL-12 to produce a robust IFN T-cell response.
[0335] Patient derived epigenetic data prior to CAR T therapy demonstrated openings within MP loci that mediate IL-18 activity/secretion, which could pre-dispose these patients to cytokine release syndrome/neurotoxicity (CRS/NTX) response. IL-18 binding protein (IL-18BP) is induced by IFN and, consistent with the IFN signature within the monocytes, high levels of IL-18BP were observed in the serum of dysfunctional patients. IL-18BP neutralizes IL-18, acting as an important negative regulator of inflammation, and has been shown to act as a checkpoint in immunotherapy (Zhou et al. Nature 2020, 583(7817):609-614). Importantly, the difference in IL-18BP levels between patient groups was so robust that the analysis demonstrated that only 10 non-responsive patients matched with 20 responders were needed to achieve >90% power. This initial pilot data demonstrated that functional responders with toxicity have impaired IL-18/IFN regulation (e.g. modified IL-12 signaling and upregulated IL-2 signaling) leading to aberrant uncontrolled activation.
[0336] Prophetic Example 1. Future studies will validate whether this hemophagocytic lymphohistiocytosis (HLH) pathway predicts toxicity across multiple immunotherapy trials through biomarker cytokine and chromatin validation assays. This work will further identify predictive early biomarkers that will be used to identify mechanisms/interventional strategies (e.g. cytokine blockade).
[0337] Example 2. It is well defined in HLH disorders that IL-18 signaling plays a causative role in aberrant T-cell function and signaling; however, IL-18 does not function alone. T-cells require stimulation from additional cytokines to induce the IL-18 receptor (IL-18R1), allowing response to IL-18. IL-12 is produced by macrophages in normal physiological conditions to license the T-cell response (Nakahira et al. Journal of immunology 2002, 168(3):1146-1153). If IL-12 signaling is absent, IL-2 signaling will cause an aberrant Th2 phenotype with high cytokine expression, as observed in severe toxicity patients (Rex et al. J Cell Commun Signal 2020, 14(2): 257-266). This modulation may be independent of CD25 signaling, which limits use of IL-2 in humanized animal models. Studies are ongoing to test a de novo mimic of IL-2 that lacks the CD25 signaling domain (Silva et al. Nature 2019, 565(7738):186-191). In pilot studies, IL-12 induced IL-18R1 expression in CAR T cells correlating with increased IFN secretion upon stimulation with antigen, while IL-2 decreased IL-18R1 mRNA and IFN production.
[0338] Example 3. Myeloid mediated signaling characteristics pre- and early post-CD19 CAR T cell infusion associate with clinical efficacy and toxicity outcomes. This study investigated whether a series of HLH myeloid associated cytokines, along with traditional CAR activated T and endothelial cell cytokines, both pre- and 7 days post-CAR therapy could predict non-response and severe NTX in acute lymphoblastic leukemia (ALL) CD19+ CAR T treated patients, with the goal of identifying a patient proinflammatory status characterized by a series of biomarkers that could be used clinically to help inform interventional and therapeutic mechanistic strategies.
[0339] Results. HLH Cytokines Predict CAR Outcomes at Early Time Points Pre-CAR. In HLH, the dangerous interplay between T cells and the myeloid compartment is driven by IFN and IL-18, with IL-18 inducing high levels of IFN (Nakanishi. Frontiers in immunology 9, 763 (2018)). Without being bound by any one hypothesis, the IFN (T-cell)-IL-18 (M) axis may mediate the continuum of post-CAR response and toxicity. In HLH disorders, IL-18 signaling plays a causative role in aberrant T-cell function and signaling; however, IL-18 does not function alone. T cells require stimulation from additional cytokines such as IL-12 to induce the IL-18 receptor (IL-18R1). IL-12 is produced by myeloid (M) in normal physiological conditions to license the T-cell response (Nakahira et al. Journal of immunology 168, 1146-1153 (2002)). If IL-12 signaling is absent, IL-2 signaling causes an aberrant Th2 phenotype with high cytokine expression, as classically observed in severe toxicity patients (Rex et al. J Cell Commun Signal 14, 257-266 (2020)). The study assessed whether the IFN (T-cell)-IL-18 (M) axis could group patients into specific sub-classifications post-CAR. IFN and IL-18 were included, along with co-stimulatory molecules (IL-12p70, IL-2, sIL-2RA, IL-10, etc.) of the IFN (T-cell)-IL-18 (M) axis, regulatory molecules (GM-CSF, IL-22, IL-18BP, etc.), as well as classical CAR T and severe NTX molecules (CRP, SAA, GM-CSF, IL-5, etc.) (a total of 22 were chosen, outlined in Materials and Methods).
[0340] Traditional clinical characteristics do not define clinical outcomes. The study focused on patients in phase 1 of the Pediatric Leukemia Adaptive Therapy-02 (PLAT02, NCT02028455) clinical trial. Forty-three elapsed/refractory pediatric B-ALL patients were enrolled at SCRI from 2012-2019 under PLAT02 and underwent CD19 (murine) directed CAR-T cell therapy. Construct, safety, and efficacy were previously reported (Gardner et al. Blood 129, 3322-3331 (2017); Finney et al. The Journal of clinical investigation 130). The study of the present Example focused on a retrospective cohort of 30 patients from PLAT02, with established clinical outcomes and matched serum (days 1, 3, 7) for unbiased classification and machine learning analysis. The study of the present Example also followed up with proposed mechanistic outcomes in a small cohort of 14 patients that had defined clinical outcomes, with stored day 1, day 10 and day 14, as well as pre-apheresis PBMC samples. Four patients were defined as dysfunctional (all included in both the larger and smaller cohort) which were relapsed patients who either did not have or briefly had complete response but had return CD19+ disease while still having CAR T cells. These patients had no or mild toxicity. Eleven (all included in the larger cohort and 5 patients include in the smaller cohort) patients were defined as having severe toxicity and were treatment responsive but had severe or mild NTX defined by any grade seizure, or grade 3/4 NTX exclusive of headache with varied degrees of CRS including severe CRS, defined as the need for vasopressors or inotropes, and/or respiratory failure. The remaining 15 patients (all included in the larger cohort, and 5 included in the smaller) were defined as functional and were responsive had a mixture of CRS severity including severe CRS but in the absence of NTX. A small cohort of 16 patients from the PLAT05 clinical trial (NCT03330691) were assessed to help support the machine learning findings. Importantly, no predictive clinical factors were determined in previous publications or in the current cohort analysis (
[0341] Unbiased patient classifications clustered patients into responsive and non-responsive (severe NTX and non-response) classifications with trends leading to overall survival. Patients were first binned into unbiased groups utilizing unsupervised patient clustering based on cytokine kinetics at day 1, 3 and 7 post-CAR (
[0342] Machine learning results demonstrated that IFN (T cell)-IL-18 (MO) mediates outcomes at early time points post-CAR. Machine learning was utilized to identify which cytokines were driving this unsupervised clustering (
[0343] Chronic interferon signaling can be predicted pre-CAR by a previously unidentified population of lymphocytes. Pre-CAR cytokine levels are indicative of chronic interferon and classical HLH signaling. The machine learning models that predicted chronic interferon signaling post-CAR could be indicative of chronic interferon signaling pre-CAR which would prime, or drive, increased myeloid activation post-CAR. Experiments were conducted to assess whether these HLH like cytokine signatures were present pre-CAR in a small cohort of 14 patients (12 cytokines outlined in Materials and Methods). Upregulation in IFN was observed, as well as interferon and classical HLH regulating cytokines that could have immunosuppressive functions (IL-18BP, sIL-2RA and IL-10) leading to the poor overall survival of Group 2 (
[0344] CD161+ cells are indicative of poor outcomes. Since chronic interferon and HLH-like predisposition was present in the Group 2 patient populations, flow cytometry experiments were conducted to assess whether lymphocyte populations pre-CAR indicative of chronic interferon signaling and responsive to IL-18 would be elevated. Increases in mucosal associated invariant T (MAIT) and natural killer (NK) cells that were CD161+ and in IFN signaling were observed (
[0345] CD161+ CD4+ cells are also elevated in a subset of healthy donors, and myeloid cells from these donors can be primed to induce HLH-like IL-18 signaling. Given the poor clinical outcomes associated with high levels of CD161+ cells, it was hypothesized that high levels of CD161 may be a marker for primed pro-inflammatory myeloid activation, independent of cancer. Such that high levels of CD4+ CD45RA CD161+ cells may increase myeloid activation in healthy human donors. Thus, it was reasoned that continued interferon signaling/priming could induce a Group 2 NTX toxicity phenotype, within healthy human donor monocytes that came from donors with high levels of CD4+ CD45RA CD161+ cells. Two CD161+ CD4+ high donors and two CD161+ CD4+ low donors were identified and CD14+ cells were isolated from these donors (
[0346] Healthy donor CAR T cell can be induced to increased IL-18 signaling capacity increase interferon output. CD161+ cells require not only IL-18 but IL-12 to functionally signal and produce increases in IFN. IL-12 increases the IL-18 heterodimeric receptor on the surface of lymphocytes triggering NF-B, enhancing interferon output. Consistent with this, increased IFN in healthy donor CAR T cells (
[0347] CD161+ IFN cells prime Group 2 patients pre-CAR to drive aberrant uncontrolled monocytic IL-18 signaling post-CAR. These signaling events trigger a reduction in overall survival by a currently unknown mechanism. The current data suggests that IFN (T-cell) and IL-18 (myeloid) axis, and CD161+ cells can be used clinically to predict poor clinical outcomes (survival, therapeutic response and NTX). Additionally, these models lend therapeutic intervention points pre-CAR and days 1-7 post-CAR, where interferon or IL-18 neutralization and/or removal of CD161+ cells may improve clinical outcomes.
[0348] Materials and Methods.
[0349] Clinical serum samples: The initial cohort of samples included 14 patients5 of Group 1 and 9 of Group 2at 5 timepoints post-CAR (Days 1-14) and one pre-CAR timepoint (Day 1). Cohort 2 included 16 additional patients10 of Group 1 and 6 of Group 2at 3 timepoints post-CAR (Days 1, 3, and 7). Seven of the 16 patients (2 of Group 1 and 5 of Group 2) were also assayed at Day 10.
[0350] Cytokine levels in clinical samples. MSD: All cytokines besides IL-18BP were assessed by Meso Scale Discovery's custom U-PLEX, Angiogenesis V-PLEX Panel 1 (K15190D-1), and Vascular Injury V-PLEX Panel 2 (K15198D-1) assays according to manufacturer's instructions. Samples were run in technical duplicate and interpolated against standards using a 4-parameter logistic curve fit. To facilitate cross-run comparison, healthy controls were run each time. Assays where the CV for these controls exceeded 30% were excluded from further analysis. Machine learning analysis does not tolerate zero values; therefore, values were included that were in detection range/above curve fit and non-detects were replaced with the value of the Lower Limit of Detection (LLOD) for the assay. Final values were reported in pg/ml.
[0351] IL-18BP ELISA: Serum IL-18BP levels were measured by ELISA (R&D, DY119) at a 1:40 dilution in reagent diluent according to manufacturer's instructions. Optical density was measured at 450 nm using a Victor3 instrument and corrected by subtraction with OD at 570 nm. Samples were run in technical duplicate and interpolated against standards using a 4-parameter logistic curve fit. Final values were reported in g/ml. Cohort 1 and 2 inter-run CV for healthy controls=12%. Cohort 1 D1-D14 and preT inter-run CV for spike controls=42%.
[0352] 22 assayed cytokines and kinetics for machine learning PLAT02 (30 patients): bFGF, CRP, Flt-1, GM-CSF, ICAM-1, IFN, IL-10, IL-17B, IL-18, IL-18BP, IL-1RA, IL-2, IL-22, IL-5, IL-6, IL-8, IL-9, IP-10, MCP-4, PIGF, SAA, sIL-2Ra, Tie-2, TNF-, VCAM-1, and VEGF-A.
[0353] 12 assayed cytokines pre-CAR for pre-interferon signaling in PLAT02 (14 patients): IFN, IL-10, IL-18, IL-18BP, sIL-2ra, IL-2, IL-5, IL-6, IL-12p70, IL-13, IL-4, and IL-15.
[0354] In vitro assays: Monocytes were isolated from healthy donor PBMCs using the Easysep CD14 positive selection kit II (StemCell Technologies, 17858) and plated at 100 k/well in a 96 well tissue-culture treated plate in 200 L/well complete RPMI. Stimulations were carried out by removing 150 L culture media and replacing with 150 L supplemented RPMI. Recombinant human IFN (R&D 285-IF-100) was used at 10 ng/ml. Ultrapure LPS (Thermo Fisher, NC0202558) was used at 200 ng/ml. Supernatants were harvested and stored at 80 C. prior to assessing IL-18BP (R&D, DY119) and IL-6 (Biolegend, 430504) levels by ELISA. To measure total IL-18 (R&D, DY318-05), cells were treated with nigericin (Sigma, N7143-10MG) at 10 M for 2 hours prior to harvesting supernatant.
[0355] To assess expression of the IL-18 receptor, CD4:CD8 CD19 CAR T cells from healthy donors were incubated in RPMI overnight with 1 ng/ml of IL-2 (Biolegend, 589104) or IL-12 (Biolegend, 573004) prior to harvest in Trizol for RNA processing. To assess IFN production, CD19 CAR T cells were seeded on a poly-I-ornithine (Sigma, P4957) treated plate, and pre-treated with 1 ng/ml of IL-2 or IL-12 for 4 hours prior to the addition of Raji target cells at 1:1 E:T as well as IL-18 at 10 ng/ml (Biolegend, 592104). Three days post incubation, supernatants were harvested for IFN ELISA (Biolegend, 430115) at a 1:1000 dilution.
[0356] RNA processing and qPCR. Cells were harvested in Trizol before purification via Direct-zol RNA miniprep (Zymo Research, R2061) per manufacturer's instructions with an additional dry spin after disposing of the final wash to prevent carryover. cDNA was generated using a high capacity RNA to cDNA kit (Fisher, 43-874-06). qPCR was performed using Applied Biosystems Power SYBR Green master mix (Fisher, 43-676-59) on the Bio-Rad CFX96 Real-Time system.
[0357] The following primers were used: Actin fwd: 5 GAGAAAATCTGGCACCACACC 3 (SEQ ID NO: 1); Actin rev: 5 GGATAGCACAGCCTGGATAGCAA 3 (SEQ ID NO: 2); IL-18R1 fwd: 5 GTGGAAGATCGCAGTAATATAGTTCCGG 3 (SEQ ID NO: 3); IL-18R1 rev: 5 CATTCAGCAAAGCAGAGCAGTTGA 3 (SEQ ID NO: 4); IL-18RAP fwd: 5 GATTCTGTAGATTCTCCCAGCG 3 (SEQ ID NO: 5); IL-18RAP rev: 5 CCTGAGTATCCCCTTCATTTCTGG 3 (SEQ ID NO: 6); CD161 fwd: 5 AAATGCAGTGTGGACATTCAA 3 (SEQ ID NO: 7); CD161 rev: 5 CTCGGAGTTGCTGCCAATA 3 (SEQ ID NO: 8); IL18RAP and actin primers from: World Wide Web at frontiersin.org/articles/10.3389/fgene0.2020.00645/full#supplementary-material. IL18R1 designed in Benchling. CD161: World Wide Web at ncbi.nlm.nih.gov/pmc/articles/PMC4760235/.
[0358] Flow phenotyping. Cryopreserved peripheral blood mononuclear cells (PBMCs) were thawed and counted: 110.sup.6 cells per stain. For the intracellular cytokine panel, PBMC were stimulated with phorbol myristate acetate (PMA) (500 ng/mL) and ionomycin (500 ng/mL) in the presence of Brefeldin A (2.5 g/mL) and Monensin (1 M) for 2 hours before surface staining, fix and permeabilization, and intracellular staining. For the IL-18RAP phenotyping panel, PBMC were stimulated with plate bound aCD3 (1 g/mL) and soluble aCD28 (2 g/mL) in the presence of Brefeldin A (2.5 g/mL) and Monensin (1 M) for 3 hours at 37 C. Following stimulation, cells were incubated with viability dye (LIVE/DEAD blue fixable stain kit, ThermoFisher) and Human TruStain FcX blocking solution (Biolegend) prior to staining with surface monoclonal antibodies, fix and permeabilization with a 1:1 ratio of FOXP3 Transcription Factor Fixation/Permeabilization Buffer (eBioscience) and IC Fixation Buffer (eBioscience), and then staining with intracellular antibodies. Instrument standardization was performed using 8 peak rainbow calibration beads (Spherotech, Lake Forest, IL) adjusting PMT voltages for consistent 7th peak mean fluorescent intensities. A technical control from one individual was run concomitantly on each acquisition day to control for reagents. All samples from each panel were thawed, stained, and assayed on the LSRFortessa on the same day to mediate any batch effects. Criteria for analysis exclusion were <25 events for frequency and <50 events for MFI reporting. An average of 200,000 live lymphocyte events were collected per sample on a BD Fortessa using Diva software and data were analysed using FlowJo software version 10.5.3 (Tree Star, Ashland, OR).
[0359] Panel 1Intracellular staining panel.
TABLE-US-00001 Vendor Catalog # Fluor Target Clone 1 BL 366711 FITC IL-22* 2G12A41 2 BL 300430 PerCP- CD3 UCHT1 Cy5.5 3 BD 564755 BV421 IL-21* 3A3-N2.1 4 BL 339922 BV510 CD161 HP-3G10 5 BL 304323 BV605 VLA-4 9F10 6 BL 318344 BV650 CD56 HCD56 7 BL 301837 BV711 CD14 M5E2 8 BD 563877 BV786 CD4 SK3 9 BL 501907 APC IL-13* JES10-5A2 10 BL 506516 AF700 IFN* B27 11 BL 512319 APC- IL-17A* B2168 Cy7 12 BL 502305 PE GM-CSF* BVD2-21C11 13 BD 562421 PE- FOXP3* 259D/C7 CF594 14 BL 363417 PE- LFA-1 M24 Cy7 15 BD 563795 BUV395 CD8 RPA-T8 16 Invitrogen L34962 BUV496 Live/Dead Blue 17 BD 564442 BUV737 CD45RA HI100 *Indicates antibody omitted for FMM control
[0360] Panel 2Exhaustion and functional panel
TABLE-US-00002 Vendor Catalog # Fluor Target Clone 1 BL 313810 FITC IL-18RA* H44 2 (Dump) BL 302230 PerCP-Cy5.5 CD19 HIB19 BL 302028 PerCP-Cy5.5 CD16 3G8 BD 564157 PerCP-Cy5.5 TCRgd B1 3 BL 329920 BV421 PD-1* EH12.2H7 4 BL 308120 BV510 Perforin* dG9 5 BL 359417 BV605 CCR4 L291H4 6 BD 564057 BV650 CD56 NCAM 16.2 7 BL 351328 BV711 CD127 A019D5 8 BD 563877 BV786 CD4 SK3 9 R&D FAB118R-100 AF647 IL-18RAP* FAB118R 10 BL 506516 AF700 IFNg B27 11 BL 3000426 APC-H7 CD3 UCHT1 12 BL 353705 PE CXCR3 G025H7 13 BD 562403 PE-CF594 CD25 M-A251 14 BD 372714 PE-Cy7 TIGIT A15153G 15 BD 563795 BUV395 CD8 RPA-T8 16 Invitrogen L34962 BUV496 Live/Dead Blue 17 BD 564442 BUV737 CD45RA HI100 *Indicates antibody omitted for FMM control
[0361] Unbiased principal component analysis: A Principal Component Analysis (PCA) was performed on the 30 subjects at time point Day 3; data was log 2 transformed and z-score transformed. This showed that two distinct classes could be observed as segregated on the first component and there were no obvious separations on the second component. The scree plot demonstrated that the majority of the variance in the samples were described in the first component, which largely separated based on those that were functional (n=15) versus those that were either dysfunctional or demonstrated toxicity (n=15). The Functional Group consisted of 7 males and 8 females and the Dysfunction/Toxicity group consisted of 8 males and 7 females. The average age of the two groups were 15.9 (1.3 to 25.4) and 11.1 (1.7 to 22.1), respectively. Both age distributions were normally distributed based on a Kolmogorov Smirnoff test (p-values >0.95 in both cases) and had equal variance based on a tow-sample F-test for equal variances (p-value of 0.88). A paired t-test comparing the ages showed some evidence that the age of the Dysfunction/Toxicity were less than that of the Functional group. This could be a component that could be factored into a predictive model.
[0362] Cytokine statistics: A Kolmogorov-Smirnoff test was run, this time on the data of the individual cytokines, to determine if the log 2 transformed data was normally distributed. All 23 of the cytokines failed to reject the null hypothesis at all three time points (p-values ranging from 0.08 to 0.99); thus, the cytokine data was analyzed using a parametric test.
[0363] A linear mixed effects model was used to analyze the data with fixed effects for Group (Functional versus Dysfunction/Toxicity), as well as an interaction between Group, adjusting for sex and age, and a random effect for subject. Given the discrete increments of day, it was treated as a categorical variable. A linear mixed effects model was also run at each time point (Day 1, Day 3, and Day 7) with a fixed effect for Group, sex and age.
[0364] Machine-learning: A Nave Bayes classifier was run for each time point using stratified n repeated k-fold cross-validation (CV) where n=100 and k is 3. As seen in
[0365] (X) Variants. Variants of the sequences disclosed and referenced herein are also included. Guidance in determining which amino acid residues can be substituted, inserted, or deleted without abolishing biological activity can be found using computer programs well known in the art, such as DNASTAR (Madison, Wisconsin) software. Preferably, amino acid changes in the protein variants are conservative amino acid changes, i.e., substitutions of similarly charged or uncharged amino acids. A conservative amino acid change involves substitution of one of a family of amino acids which are related in their side chains.
[0366] In a peptide or protein, suitable conservative substitutions of amino acids are known to those of skill in this art and generally can be made without altering a biological activity of a resulting molecule. Those of skill in this art recognize that, in general, single amino acid substitutions in non-essential regions of a polypeptide do not substantially alter biological activity (see, e.g., Watson et al. Molecular Biology of the Gene, 4th Edition, 1987, The Benjamin/Cummings Pub. Co., p. 224). Naturally occurring amino acids are generally divided into conservative substitution families as follows: Group 1: Alanine (Ala), Glycine (Gly), Serine (Ser), and Threonine (Thr); Group 2: (acidic): Aspartic acid (Asp), and Glutamic acid (Glu); Group 3: (acidic; also classified as polar, negatively charged residues and their amides): Asparagine (Asn), Glutamine (Gln), Asp, and Glu; Group 4: Gln and Asn; Group 5: (basic; also classified as polar, positively charged residues): Arginine (Arg), Lysine (Lys), and Histidine (His); Group 6 (large aliphatic, nonpolar residues): Isoleucine (lie), Leucine (Leu), Methionine (Met), Valine (Val) and Cysteine (Cys); Group 7 (uncharged polar): Tyrosine (Tyr), Gly, Asn, Gln, Cys, Ser, and Thr; Group 8 (large aromatic residues): Phenylalanine (Phe), Tryptophan (Trp), and Tyr; Group 9 (non-polar): Proline (Pro), Ala, Val, Leu, lie, Phe, Met, and Trp; Group 11 (aliphatic): Gly, Ala, Val, Leu, and lie; Group 10 (small aliphatic, nonpolar or slightly polar residues): Ala, Ser, Thr, Pro, and Gly; and Group 12 (sulfur-containing): Met and Cys. Additional information can be found in Creighton (1984) Proteins, W.H. Freeman and Company.
[0367] In making such changes, the hydropathic index of amino acids may be considered. The importance of the hydropathic amino acid index in conferring interactive biologic function on a protein is generally understood in the art (Kyte and Doolittle, 1982, J. Mol. Biol. 157(1), 105-32). Each amino acid has been assigned a hydropathic index on the basis of its hydrophobicity and charge characteristics (Kyte and Doolittle, 1982). These values are: Ile (+4.5); Val (+4.2); Leu (+3.8); Phe (+2.8); Cys (+2.5); Met (+1.9); Ala (+1.8); Gly (0.4); Thr (0.7); Ser (0.8); Trp (0.9); Tyr (1.3); Pro (1.6); His (3.2); Glutamate (3.5); Gln (3.5); aspartate (3.5); Asn (3.5); Lys (3.9); and Arg (4.5).
[0368] It is known in the art that certain amino acids may be substituted by other amino acids having a similar hydropathic index or score and still result in a protein with similar biological activity, i.e., still obtain a biological functionally equivalent protein. In making such changes, the substitution of amino acids whose hydropathic indices are within 2 is preferred, those within 1 are particularly preferred, and those within 0.5 are even more particularly preferred. It is also understood in the art that the substitution of like amino acids can be made effectively on the basis of hydrophilicity.
[0369] As detailed in U.S. Pat. No. 4,554,101, the following hydrophilicity values have been assigned to amino acid residues: Arg (+3.0); Lys (+3.0); aspartate (+3.01); glutamate (+3.01); Ser (+0.3); Asn (+0.2); Gln (+0.2); Gly (0); Thr (0.4); Pro (0.51); Ala (0.5); His (0.5); Cys (1.0); Met (1.3); Val (1.5); Leu (1.8); Ile (1.8); Tyr (2.3); Phe (2.5); Trp (3.4). It is understood that an amino acid can be substituted for another having a similar hydrophilicity value and still obtain a biologically equivalent, and in particular, an immunologically equivalent protein. In such changes, the substitution of amino acids whose hydrophilicity values are within 2 is preferred, those within 1 are particularly preferred, and those within 0.5 are even more particularly preferred.
[0370] As outlined above, amino acid substitutions may be based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like.
[0371] As indicated elsewhere, variants of gene sequences can include codon optimized variants, sequence polymorphisms, splice variants, and/or mutations that do not affect the function of an encoded product to a statistically significant degree.
[0372] Variants of the protein, nucleic acid, and gene sequences also include sequences with at least 70% sequence identity, 80% sequence identity, 85% sequence, 90% sequence identity, 95% sequence identity, 96% sequence identity, 97% sequence identity, 98% sequence identity, or 99% sequence identity to the protein, nucleic acid, or gene sequences disclosed herein.
[0373] % sequence identity refers to a relationship between two or more sequences, as determined by comparing the sequences. In the art, identity also means the degree of sequence relatedness between protein, nucleic acid, or gene sequences as determined by the match between strings of such sequences. Identity (often referred to as similarity) can be readily calculated by known methods, including (but not limited to) those described in: Computational Molecular Biology (Lesk, A. M., ed.) Oxford University Press, NY (1988); Biocomputing: Informatics and Genome Projects (Smith, D. W., ed.) Academic Press, NY (1994); Computer Analysis of Sequence Data, Part I (Griffin, A. M., and Griffin, H. G., eds.) Humana Press, N J (1994); Sequence Analysis in Molecular Biology (Von Heijne, G., ed.) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Oxford University Press, NY (1992). Preferred methods to determine identity are designed to give the best match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Sequence alignments and percent identity calculations may be performed using the Megalign program of the LASERGENE bioinformatics computing suite (DNASTAR, Inc., Madison, Wisconsin). Multiple alignment of the sequences can also be performed using the Clustal method of alignment (Higgins and Sharp CABIOS, 5, 151-153 (1989) with default parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Relevant programs also include the GCG suite of programs (Wisconsin Package Version 9.0, Genetics Computer Group (GCG), Madison, Wisconsin); BLASTP, BLASTN, BLASTX (Altschul, et al., J. Mol. Biol. 215:403-410 (1990); DNASTAR (DNASTAR, Inc., Madison, Wisconsin); and the FASTA program incorporating the Smith-Waterman algorithm (Pearson, Comput. Methods Genome Res., [Proc. Int. Symp.] (1994), Meeting Date 1992, 111-20. Editor(s): Suhai, Sandor. Publisher: Plenum, New York, N.Y. Within the context of this disclosure it will be understood that where sequence analysis software is used for analysis, the results of the analysis are based on the default values of the program referenced. As used herein default values will mean any set of values or parameters, which originally load with the software when first initialized.
[0374] Variants also include nucleic acid molecules that hybridizes under stringent hybridization conditions to a sequence disclosed herein and provide the same function as the reference sequence. Exemplary stringent hybridization conditions include an overnight incubation at 42 C. in a solution including 50% formamide, 5SSC (750 mM NaCl, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5Denhardt's solution, 10% dextran sulfate, and 20 g/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0.1SSC at 50 C. Changes in the stringency of hybridization and signal detection are primarily accomplished through the manipulation of formamide concentration (lower percentages of formamide result in lowered stringency); salt conditions, or temperature. For example, moderately high stringency conditions include an overnight incubation at 37 C. in a solution including 6SSPE (20SSPE=3M NaCl; 0.2M NaH.sub.2PO.sub.4; 0.02M EDTA, pH 7.4), 0.5% SDS, 30% formamide, 100 g/ml salmon sperm blocking DNA; followed by washes at 50 C. with 1SSPE, 0.1% SDS. In addition, to achieve even lower stringency, washes performed following stringent hybridization can be done at higher salt concentrations (e.g. 5SSC). Variations in the above conditions may be accomplished through the inclusion and/or substitution of alternate blocking reagents used to suppress background in hybridization experiments. Typical blocking reagents include Denhardt's reagent, BLOTTO, heparin, denatured salmon sperm DNA, and commercially available proprietary formulations. The inclusion of specific blocking reagents may require modification of the hybridization conditions described above, due to problems with compatibility.
[0375] (XI) Closing Paragraphs. Each embodiment disclosed herein can comprise, consist essentially of or consist of its particular stated element, step, ingredient or component. Thus, the terms include or including should be interpreted to recite: comprise, consist of, or consist essentially of. The transition term comprise or comprises means has, but is not limited to, and allows for the inclusion of unspecified elements, steps, ingredients, or components, even in major amounts. The transitional phrase consisting of excludes any element, step, ingredient or component not specified. The transition phrase consisting essentially of limits the scope of the embodiment to the specified elements, steps, ingredients or components and to those that do not materially affect the embodiment. A material effect would cause a statistically significant reduction in the ability of a biomarker profile disclosed herein to predict whether a subject undergoing an immunomodulatory treatment will be responsive, or will have a toxic response and/or nonresponse from the immunomodulatory treatment.
[0376] Unless otherwise indicated, all numbers expressing quantities of ingredients, properties such as molecular weight, reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term about. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. When further clarity is required, the term about has the meaning reasonably ascribed to it by a person skilled in the art when used in conjunction with a stated numerical value or range, i.e. denoting somewhat more or somewhat less than the stated value or range, to within a range of 20% of the stated value; 19% of the stated value; 18% of the stated value; 17% of the stated value; 16% of the stated value; 15% of the stated value; 14% of the stated value; 13% of the stated value; 12% of the stated value; 11% of the stated value; 10% of the stated value; 9% of the stated value; 8% of the stated value; 7% of the stated value; 6% of the stated value; 5% of the stated value; 4% of the stated value; 3% of the stated value; 2% of the stated value; or +1% of the stated value.
[0377] Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. Any numerical value, however, inherently contains certain errors necessarily resulting from the standard deviation found in their respective testing measurements.
[0378] The terms a, an, the and similar referents used in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. Recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., such as) provided herein is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the invention.
[0379] Groupings of alternative elements or embodiments of the invention disclosed herein are not to be construed as limitations. Each group member may be referred to and claimed individually or in any combination with other members of the group or other elements found herein. It is anticipated that one or more members of a group may be included in, or deleted from, a group for reasons of convenience and/or patentability. When any such inclusion or deletion occurs, the specification is deemed to contain the group as modified thus fulfilling the written description of all Markush groups used in the appended claims.
[0380] Certain embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Of course, variations on these described embodiments will become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventor expects skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.
[0381] Furthermore, numerous references have been made to patents, printed publications, journal articles and other written text throughout this specification (referenced materials herein). Each of the referenced materials are individually incorporated herein by reference in their entirety for their referenced teaching.
[0382] It is to be understood that the embodiments of the invention disclosed herein are illustrative of the principles of the present invention. Other modifications that may be employed are within the scope of the invention. Thus, by way of example, but not of limitation, alternative configurations of the present invention may be utilized in accordance with the teachings herein. Accordingly, the present invention is not limited to that precisely as shown and described.
[0383] The particulars shown herein are by way of example and for purposes of illustrative discussion of the preferred embodiments of the present invention only and are presented in the cause of providing what is believed to be the most useful and readily understood description of the principles and conceptual aspects of various embodiments of the invention. In this regard, no attempt is made to show structural details of the invention in more detail than is necessary for the fundamental understanding of the invention, the description taken with the drawings and/or examples making apparent to those skilled in the art how the several forms of the invention may be embodied in practice.
[0384] Definitions and explanations used in the present disclosure are meant and intended to be controlling in any future construction unless clearly and unambiguously modified in the following examples or when application of the meaning renders any construction meaningless or essentially meaningless. In cases where the construction of the term would render it meaningless or essentially meaningless, the definition should be taken from Webster's Dictionary, 3rd Edition or a dictionary known to those of ordinary skill in the art, such as the Oxford Dictionary of Biochemistry and Molecular Biology (Eds. Attwood T et al., Oxford University Press, Oxford, 2006).