BIOSENSOR FOR ELECTROCHEMICAL DETECTION OF E.G. MALARIA BIOMARKERS
20240027451 · 2024-01-25
Inventors
- Dirk MAYER (Frechen, DE)
- Gabriela FIGUEROA MIRANDA (Juelich, DE)
- Michael PROEMPERS (Juelich, DE)
- Viviana RINCÓN MONTES (Aachen, DE)
- Andreas Offenhaeusser (Aachen, DE)
Cpc classification
G01N2469/10
PHYSICS
G01N33/5308
PHYSICS
G01N27/125
PHYSICS
International classification
G01N33/53
PHYSICS
G01N33/543
PHYSICS
Abstract
The present invention relates to biomarker sensors with a multielectrode array structure, kits containing them, methods for their production as well as corresponding uses and applications.
Claims
1.-15. (canceled)
16. A biomarker sensor, wherein the sensor has a multielectrode array structure which comprises a carrier substrate on which at least two separate electrode sets are arranged, each electrode set comprising one or more electrodes, and each electrode set being divided into, in the following order (i) an incubation zone in which at least one specific aptamer is bound to the one or more electrodes, (ii) a passivation zone in which a passivation layer covers the one or more electrodes, (iii) a contact zone in which the one or more electrodes are configured to be electrically contacted, incubation zones of individual electrode sets or incubation zones and a part of up to 95% of a length of passivation zones of the individual electrode sets being configured to be movable, in each case independently of those of the other electrode sets, and contact zones of the individual electrode sets together forming a common contact zone.
17. The biomarker sensor of claim 16, wherein the carrier substrate is a material selected from polyethylene terephthalate, polyethylene naphthalate, polydimethylsiloxane, polyimide, polyester, and agarose.
18. The biomarker sensor of claim 16, wherein the carrier substrate is a flexible material.
19. The biomarker sensor of claim 16, wherein the sensor comprises two, three or four separate electrode sets.
20. The biomarker sensor of claim 19, wherein the sensor sets comprise at least two electrodes each.
21. The biomarker sensor of claim 19, wherein the sensor sets comprise at least four electrodes each.
22. The biomarker sensor of claim 16, wherein the electrodes are made of noble metal or carbon.
23. The biomarker sensor of claim 16, wherein the at least one specific aptamer is selected from one or more of 2008s aptamer, 2106s aptamer, pL1 aptamer, and LDHp11 aptamer.
24. The biomarker sensor of claim 16, wherein the at least one specific aptamer is selected from one or more of C5 aptamer, C7 aptamer, C9 aptamer, C11 aptamer, C15 aptamer or I1 aptamer, IH1 aptamer, SG1 aptamer, HCS1 aptamer, and NG1 aptamer.
25. The biomarker sensor of claim 16, wherein different aptamers or aptamer mixtures are bound in each electrode set.
26. The biomarker sensor of claim 25, wherein the different aptamers or aptamer mixtures bound in each electrode set are (1) in a first electrode set 2008s aptamer and in a second electrode set 2106s aptamer and in a third electrode set pL1 aptamer and in a fourth electrode set LDHp11 aptamer or (2) in a first electrode set C7 aptamer and in a second electrode set CI1 aptamer or (3) in at least two electrode sets aptamers selected from one or more of C5 aptamer, C7 aptamer, C9 aptamer, C11 aptamer, C15 aptamer or I1 aptamer, IH1 aptamer, SG1 aptamer, HCS1 aptamer, and NG1 aptamer.
27. The biomarker sensor of claim 16, wherein the sensor further comprises: (i) collectively a reference electrode and a counter electrode, (ii) collectively one reference electrode, one counter electrode, and one resistance thermometer, (iii) one reference electrode and one counter electrode per electrode set, or (iv) one reference electrode and one counter electrode per electrode set and collectively one resistance thermometer.
28. A method for producing a biomarker sensor, wherein the method comprises (I) providing a carrier substrate, (II) applying a layer of electrode material to the carrier substrate, (III) structuring the electrode material resulting from (II) into individual electrodes, (IV) passivating a part of the electrode material located between ends thereof, (V) dividing the electrodes into a number of individual electrode sets, (VI) incubating one end of each electrode set in aptamer solution.
29. The method of claim 28, wherein application of a layer of the electrode material to the carrier substrate is carried out by physical vapor deposition.
30. The method of claim 28, wherein in (III) first a photoresist is applied to the electrode material, a mask with a desired patterning of metal structure is produced from the photoresist by exposure to light and development, unneeded material of an adhesion layer and of the electrode layer is subsequently removed by means of wet chemical etching, and thereafter the photoresist is removed again.
31. The method of claim 28, wherein the passivation in (IV) is carried out by stencil passivation, wherein first a stencil is placed on a surface of the electrodes, and then conductive leads of the electrodes are partially passivated by chemical vapor deposition.
32. The method of claim 28, wherein a subdivision in (V) is performed by cutting the carrier substrate in such a way that a total number of electrodes is evenly distributed among the resulting electrode sets.
33. A method for the determination of biomarkers in a body fluid, wherein the method comprises (i) providing the biomarker sensor of claim 16, (ii) applying a body fluid sample to the biomarker sensor, (iii) connecting the biomarker sensor to a measurement device for current voltage, resistance or frequency, (iv) detecting a measurement signal and outputting measurement values by the measurement device, (v) analyzing the output values, and (vi) optionally storing, displaying and/or transmitting analyzed results.
34. A biomarker sensor kit, wherein the kit comprises or consists of (A) at least one biomarker sensor according claim 16 without aptamers already being bound, (B) a preparation comprising at least one biomarker-specific aptamer, (C) optionally further analysis materials.
35. A method for the qualitative or quantitative determination of a disease-specific biomarker in a body fluid sample, wherein the method comprises using the biomarker sensor of claim 16 for determining the disease-specific biomarker.
Description
FIGURE DESCRIPTION
[0140]
[0141]
[0142]
[0143]
[0144]
[0145]
[0146]
[0147]
[0148]
[0149]
[0150]
[0151]
LIST OF REFERENCE SIGNS
[0152] In the figures, the same reference signs mean the same materials, substances, etc. [0153] 1 biomarker sensor with multielectrode array structure (flex-MEA) [0154] 2 conductor path [0155] 3 aptamer-covered electrode contact/electrode contact for aptamer covering [0156] 4 electrode separation area/cutting strip [0157] 5 counter electrode [0158] 6 reference electrode [0159] 7 resistance thermometer [0160] 8 alignment marks [0161] ES-1 electrode set 1 [0162] ES-2 electrode set 2 [0163] ES-3 electrode set 3 [0164] ES-4 electrode set 4 [0165] I incubation zone [0166] P passivation zone [0167] K contact zone
[0168] The present invention will now be explained in more detail with reference to the following non-limiting examples. The following non-limiting examples serve to illustrate the embodiments described therein. It will be known to the person skilled in the art that variations of these examples are possible within the scope of the present invention.
EXAMPLES
Example 1: Malaria
1. Preparation and Purification of Flexible Multielectrode Arrays Chips
[0169] Flexible multielectrode arrays (flex-MEA) were prepared in an ISO 1-3 clean room on a polyethylene terephthalate film (PET, DuPont Teijin Films Ltd.) of a thickness of 100 m and a diameter of 100 mm as a flexible substrate. Electrode beam assisted physical vapor deposition (PVD) was used to first deposit a 5 nm titanium adhesion layer and then thereon a layer of 50 nm gold (Au) on the flexible substrate for the preparation of the electrode. An etch mask for the patterns of the leads and the 16 electrodes (four electrodes each for four electrode sets) was prepared by standard photolithography with a positive photoresist using a mask aligner, applied to the gold surface and then the electrodes were patterned by a wet chemical etching process using a gold etchant (TechniEtch AC12, Microchemicals, Ulm, Germany). The exposed titanium layer was then removed by wet chemical etching using a titanium etchant (TechniEtch TC, Ulm, Germany). The etch mask was then removed by immersing the PET substrate comprising the patterned electrodes in AZ-100 remover in an ultrasonic bath for 10 minutes, followed by rinsing with isopropanol and deionised water. The flexible polymer chips obtained were 10.5 mm15.8 mm in size, with 16 individually addressable electrodes (see also
[0170] In addition, further flex-MEA designs comprising additionally an on-chip reference electrode 6 (RE), a counter electrode 5 (CE) and a resistance temperature detector 7 (RTD) have been prepared (see also
[0171] The passivation layer was prepared by means of stencil passivation using parylene C to form the passivation layer (protective layer over the electrode leads). A polymer stencil was made for this using a laser cutting machine. The stencil was then applied to the PET substrate with the structured electrode. Parylene C was then deposited by chemical vapor deposition (CVD) with the following parameters: vacuum pressure 20 mTorr, Set Point 25 mTorr and Vaporizor 160 C. Finally, the stencil was carefully peeled off the PET substrate.
[0172] For final cleaning before use, the new flex-MEA chips were each immersed for 5 minutes in acetone and isopropanol, followed by a rinsing with highly purified deionised water (from a Milli-Q system (18.2 megohm resistivity)) and drying in a nitrogen flow. The chemically cleaned electrodes were connected to a printed circuit board with a zero-force socket connection that allowed the connection to a potentiostat. Electrochemical cleaning of the flex-MEA chip was first performed by cyclic voltametry (CV) in 0.1 M NaOH in a potential range from 1.35 V to 0.35 V during 10 scans at 2 V s.sup.1 followed by scanning in 0.05 M H.sub.2SO.sub.4 in a potential range from 0 V to 1.5 V during 20 scans at 1 V s.sup.1. The electrochemical surface area (ESA) was determined by CV in 0.05 M H.sub.2SO.sub.4 in a potential range from 0 V to 1.5 V at 0.1 V s.sup.1.
2. Flex-MEA Multi-Target Aptasensor Biofunctionalization
[0173] The following concentrations were used for the single-stranded desoxyribonucleic acid (ssDNA) aptamers listed in Table 1: 0.5 M for 2008s, pL1 and 2106s and 0.03 M for LDHp11. All aptamers were incubated separately with 10 mM tris-(2-carboxyethyl)-phosphine hydrochloride (TCEP) solution for one hour at room temperature to release the disulfide protective bond and allow immobilisation on the electrodes via a thiol-gold self-assembling monolayer. The solutions were resuspended in 10 mM phosphate-buffered saline (PBS-NaCl 1 M, NaH.sub.2PO.sub.4 10 mM, Na.sub.2HPO.sub.4 10 mM, MgCl.sub.2 1 mM, pH 7.1) to a final volume of 1 mL after one hour. Four parallel strip-like sections were then cut into the flex-MEA using scissors, taking care to leave the electrodes and leads intact, which made possible the electrode incubation with the four different aptamer solutions for the final preparation of the multi-target aptasensor. The individual cut electrodes could be bent individually due to the flexible substrate, so that a respective immersion in the chosen incubation solution without risking the other electrode arrays being incubated as well was made possible. The electrodes were then incubated with their incubation zone individually overnight (16 hours) with the respective aptamer solution under exclusion of light.
TABLE-US-00001 TABLE1 Sequencesofthereceptoraptamersused forthemulti-targetflexMEAaptasensor Aptamer Sequence 2008s 5-HO(CH.sub.2).sub.6SS(CH.sub.2).sub.6O CTGGGCGGTAGAACCATAGTG ACCCAGCCGTCTAC-3 pL1 5-HO(CH.sub.2).sub.6SS(CH.sub.2).sub.6O GTTCGATTGGATTGTGCCGGA AGTGCTGGCTCGAAC-3 LDHp11 5-HO(CH.sub.2).sub.6SS(CH.sub.2).sub.6O CTACTGTTGATATGAGTGATA GGGCGGCGCGCTTATCTGTAT TGTG-3 2106s 5-HO(CH.sub.2).sub.6SS(CH.sub.2).sub.6O GCTTATCCGATGCAGACCCCT TCGGTCCTGCCCTC-3
3. Washing
[0174] The aptamer-modified flex-MEA chip was first rinsed with 25 mM Tris-HCl buffer (NaCl 0.1 M, tris(hydroxymethyl)aminomethane 25 mM, HCl 25 mM, pH 7.5) and then with deionised water (Milli-Q water) to remove non-specifically adsorbed molecules.
4. Blocking
[0175] The flex-MEA chip was incubated with a 5 mg/ml monofunctional methoxy polyethylene glycolthiol solution (PEG, 2 kDa) for 7 hours. The PEG served as a blocking molecule to prevent biofouling by other molecules present in the blood samples.
Washing
[0176] The flex-MEA aptasensor was washed with Tris buffer to remove excess not specifically adsorbed PEG molecules.
6. Analyte Detection
[0177] Blood samples containing the Plasmodium falciparum parasite were mixed 1:1 with lysis buffer (25 mM Tris-HCl buffer with 0.5% Triton X-100 (octylphenol ethoxylate), is used to break up the cells of the parasite). After 15 minutes incubation with the buffer, the resulting lysed parasitised blood was diluted in 25 mM Tris buffer 1:100 to a final volume of 2 ml. The aptasensor was incubated with this diluted sample for 45 minutes.
[0178] The output signals obtained from the different electrodes, which were each modified with a particular aptamer receptor, are shown in Table 2. The signal was considered as 0 or 1 if the measured current was below or above a certain threshold. The threshold was assumed to be 3 (3-sigma), where (sigma) is the standard deviation of the analyte-free measurement. Both the 2008s as well as the pL1 aptamer target PfLDH and PvLDH, resulting in highly redundant signals leading to a high reliability of the malaria test. The LDHp11 and 2106s aptamers, which selectively target PfLDH and HRP-2, respectively, allow discrimination between P. falciparum and P. vivax malaria parasites.
[0179] The output significance indicates whether the combination of the respective inputs is meaningful for the diagnosis or not.
TABLE-US-00002 TABLE 2 Input and output table for the different biomarker detections by sensors with respective aptamers (Inp in this and the following tables = abbreviation of Input) Inp 1 Inp 2 Inp 3 Output Aptamer (PfLDH) (PvLDH) (HRP-2) Output significance 2008s 0 0 0 0 clear 1 0 0 1 unclear 0 1 0 1 clear 1 1 0 1 unclear 0 0 1 1 unclear 1 0 1 1 clear 0 1 1 1 unclear 1 1 1 1 clear pL1 0 0 0 0 clear 1 0 0 1 unclear 0 1 0 1 clear 1 1 0 1 unclear 0 0 1 1 unclear 1 0 1 1 clear 0 1 1 1 unclear 1 1 1 1 clear LDHp11 0 0 0 0 clear 1 0 0 1 clear 0 1 0 0 clear 1 1 0 1 unclear 0 0 1 0 unclear 1 0 1 1 clear 0 1 1 0 unclear 1 1 1 1 unclear 2106s 0 0 0 0 clear 1 0 0 0 unclear 0 1 0 0 clear 1 1 0 0 unclear 0 0 1 1 unclear 1 0 1 1 clear 0 1 1 1 unclear 1 1 1 1 unclear
[0180] The output from the respective sensors resulted in a lot of ambiguous information (e.g., due to cross-sensitivities), so that in many scenarios it was impossible to target the infections if only the output from one sensor at a time was considered.
[0181] To set the outputs to clear and allow a selective and unambiguous detection of the biomarker and a corresponding diagnosis, logical operations were performed involving input and output tables (Tables 3, 5 and 7, see below). Thereby the different outputs of the electrodes were combined on one chip. For this, the outputs of the respective sensors (Table 2) were used as input for logic gates and corresponding truth tables were created for specific parasitic infection scenarios that were checked with the sensor (Tables 4, 6 and 8, see further below). The combinations of the different aptamer outputs and processing of these sensor outputs by logic gate operations allowed the unambiguous detection of malaria infections, the discrimination between different malaria parasites, the confirmation of the result by redundant sensor analysis, as well as the discarding of the probability of false positive results, as in Table 8. Furthermore, all electrodes of an electrode set were modified with the same aptamer receptor, and therefore the signals coming from the different electrodes were averaged. Averaging the gathered data in a parallel manner increased the reliability of the measurement information.
[0182] In the following, three partial examples T-1, T-2 and T-3, are presented for logical operations as they were performed, but other logical operations of different levels can also be performed.
Partial-Example T-1: Plasmodium falciparum
[0183]
TABLE-US-00003 TABLE 3 Input and output table for sensors modified with LDHp11 aptamer and 2106s aptamer for the detection of different combinations of biomarkers. The output is only 1 if both Plasmodium falciparum biomarkers (PfLDH + HRP-2) are detected. Co-infection with Plasmodium vivax is not excluded. Inp 1 Inp 2 Output LDHp11 2106s P. falciparum 0 0 0 0 PfLDH 1 0 0 PvLDH 0 0 0 PfLDH + PvLDH 1 0 0 HRP-2 0 1 0 PfLDH + HRP-2 1 1 1 PvLDH + HRP-2 0 1 0 PvLDH + PfLDH + HRP-2 1 1 1
TABLE-US-00004 TABLE 4 Truth table of the combination of LDHp11 and 2106s for P. falciparum infections using AND gates. Logic diagram: Output = Inp 1 Inp 2 Inp 1 Inp 2 Output LDHp11 2106s P. falciparum 0 0 0 1 0 0 0 1 0 1 1 1 [0184] 1: Represents an unambiguous positive response according to the addressed task (here: infection with Plasmodium falciparum). [0185] 0: Represents an equivocal test result due to cross-selectivity of the aptamer receptors or no infection.
Partial-Example T-2: Plasmodium vivax Infection Only
[0186]
TABLE-US-00005 TABLE 5 Input and output table for the combinations of detection of 2008s, LDHp11 and 2106s aptamers for P. vivax detection only. A co-infection with P. falciparum is excluded. Inp 1 Inp 2 Inp 3 Output 2008s LDHp11 2106s only P. vivax 0 0 0 0 0 PfLDH 1 1 0 0 PvLDH 1 0 0 1 PfLDH + PvLDH 1 1 0 0 HRP-2 1 0 1 0 PfLDH + HRP-2 1 1 1 0 PvLDH + HRP-2 1 0 1 0 PvLDH + PfLDH + HRP-2 1 1 1 0
TABLE-US-00006 TABLE 6 Truth table of the combination of 2008s, LDHp11 and 2106s only for P. vivax infection with NOT/NOR - NOT/NOR gate: logic diagram: output = Inp 1 + Inp 2 + Inp 3.
Partial-Example T-3: Confirmation of Detection by Redundant Sensor Signals
[0187]
TABLE-US-00007 TABLE 7 Input and output table for the combination of the detection of 2008s and pL1 aptamers for P. falciparum and P. vivax mixed infections using redundant signal to reject a false positive result. Output Inp 1 Inp 2 P. falciparum 2008s pL1 and P. vivax 0 0 0 0 PfLDH 1 1 1 PvLDH 1 1 1 PfLDH + PvLDH 1 1 1 HRP-2 1 1 1 PfLDH + HRP-2 1 1 1 PvLDH + HRP-2 1 1 1 PvLDH + PfLDH + HRP-2 1 1 1
TABLE-US-00008 TABLE 8 Truth table for the combination of 2008s and pL1-modified sensors for redundant confirmation of a P. falciparum and P. vivax co-infection detection using AND gates. Logic diagram: Output = Inp 1 Inp 2 Output P. falciparum Inp 1 2008s Inp 2 pL1 and P. vivax 0 0 0 1 0 0 0 1 0 1 1 1
7. Washing
[0188] The flex-MEA aptasensor was then rinsed with Tris buffer to remove unbound proteins.
8. Measurement of the Electrochemical Multi-Target Aptasensor Detection Signal
[0189] Differential pulse voltammetry (DPV) measurements were performed to determine the detection of PfLDH and HRP-2 aptasensors in the parasitised blood samples. DPV measurements were performed in 5 mM potassium ferri- and ferrocyanide ([Fe(CN).sub.6].sup.3/4) in 25 mM Tris buffer solution using a multichannel potentiostat with a three-electrode system. For this a platinum wire was used as counter electrode (CE), an Ag/AgCl electrode as reference electrode (RE) and the flex-MEA multi-target aptasensor as working electrode (WE). The DPV measurements were performed in a potential range of 0 V to 0.7 V, with a step potential of 0.005 V, an amplitude modulation of 0.025 V, an equilibrium time of 2 seconds, a pulse width of 0.05 seconds and a measurement width of 0.025 seconds. The statistical analysis of the detection with the different electrodes and the different aptamers was carried out and evaluated using statistical analysis software (see also
[0190] With the biomarker sensors according to the invention, malaria infections could be reliably detected in blood samples with very high accuracy.
Example 2: SARS-CoV-2
[0191] In this example, the flexMEA sensors according to the invention were used for the detection of the spike protein of the SARS-CoV-2 virus. For this purpose, the C7 aptamer, which binds to the spike protein of the SARS-CoV-2 virus, was used as the aptamer.
[0192] The aptasensor was incubated with the spike protein for 30 minutes and then rinsed with Tris buffer (as described above). The electrochemical signal detection was performed with a potentiostat using differential pulse voltametry (DPV), wherein the DPV measurements took place particularly in redox species solution (5 mM [Fe(CN).sub.6].sup.3/4 in 25 mM Tris buffer).
[0193] After normalizing the peak currents which were obtained in the detection of the spike protein at different concentrations, a calibration curve corresponding to the C7 aptamer was obtained. It was possible to determine a detection limit of 100 ag/ml, a sensitivity of 8.8+0.9/decade and a dynamic detection range covering concentrations from 100 ag/ml to 100 ng/ml.
[0194] Accordingly, it was shown that this electrochemical biosensor showed an outstanding performance, and even exceeded the detection limits which were reported for other methods, for example for rapid (lateral flow) assays.
[0195] The sensor data obtained showed that the sensors according to the invention are excellently suited to detect the spike protein of the SARS-CoV-2 virus unambiguously and at low concentrations (see also
[0196] The following findings were obtained from/in the experiments carried out, i.e. corresponding work was carried out, but are formulated in the present tense due to their validity for future work.
[0197] In a multi-target determination, the flex-MEA sensor of the present invention can be used as a logic gate. Accordingly, the detected signals from each electrode of the biosensor serve as input signals (inputs) to the logic gate, the output of which corresponds to the result of the Boolean operation, whereby the positive (1) or negative (0) identification of the pathogen is indicated, or whereby the presence + positive (1) or absence negative (0) of the pathogen is indicated. Such a concept is illustrated in the following tables C-A and C-B with an example of a multitarget determination of different spike protein variants. Here, the biosensors function as exclusive-or gates (XOR gates) to distinguish between COVID-19 and its different variants, the spike protein and SARS-CoV-2 virus are the inputs to the gate. These logic gates facilitate an unambiguous determination of the infections with the possibility to distinguish between the different infecting viruses or to validate a possible co-infection with other pathogens, or to discard the possibility of a false positive result by averaging over several redundant sensor signals from the different electrodes.
[0198] Table C-A shows the three different aptamers and their corresponding spike targets. When the target is exposed to its aptamer receptor (InpX=1), the output receives status 1. When the target is not present (InpX=0), the output receives status 0. Considering all input combinations, multiple spike proteins may also be present, but this does not necessarily reflect a realistic situation that may be found in real samples. In this respect, the output significance indicates whether the combination of the different target inputs reflects a meaningful biomarker combination that clearly indicates an infection or no infection. In this case, the result is clear. Random combinations are taken as unclear. The presence of two different spike proteins which represent a co-infection (unlikely) are taken as unclear.
TABLE-US-00009 TABLE C-A Example of a discriminatory detection of a COVID-19 infection between different virus variants. Inp 2 Inp 3 Inp 1 (spike (spike (spike protein protein Output Aptamer protein) alpha) delta) Output significance C9 (alpha 0 0 0 0 clear variant) 1 0 0 0 clear 0 1 0 1 clear 1 1 0 1 unclear 0 0 1 0 clear 1 0 1 0 clear 0 1 1 1 unclear 1 1 1 1 unclear C7 (all 0 0 0 0 clear variants of 1 0 0 1 clear COVID-19) 0 1 0 1 clear 1 1 0 1 unclear 0 0 1 1 clear 1 0 1 1 unclear 0 1 1 1 unclear 1 1 1 1 unclear C5 (delta 0 0 0 0 clear variant) 1 0 0 0 clear 0 1 0 0 clear 1 1 0 0 clear 0 0 1 1 clear 1 0 1 1 unclear 0 1 1 1 unclear 1 1 1 1 unclear
[0199] In table C-B an example of a biosensor implementation from Table C-A, wherein the electrodes are used as XOR gates to discriminate between different variants of COVID-19 is shown. The different spike proteins of the SARS-CoV-2 variants are used as input signals to the gate. These logic gate facilitates an unambiguous determination of infections with the ability to distinguish between the different infecting viruses and rule out co-infections by processing the different redundant sensor signals coming from the different electrodes and discarding the possibility of a false positive output. Various other logic gates can be created from the possible combinations of aptamer-based biosensor signals coming from the same flexible chip and used for specific disease discrimination.
TABLE-US-00010 TABLE C-B XOR logic gate inputs and outputs for two sets of sensors which were modified differently with either C9 or C5 aptamers for the detection of different COVID-19 biomarkers. The output is only 1 if one of the biomarkers is detected. A co-infection is excluded just as an infection with the wild type. Output 1 is only obtained if the aptasensors give a signal above their respective detection threshold. Inp 1 C9 Inp 3 C5 Output COVID-19 0 0 0 0 spike protein 0 0 0 spike protein alpha 1 0 1 spike protein delta 0 1 1 spike protein alpha + 1 1 0 spike protein delta
TABLE-US-00011 TABLE C-C Truth table of an XOR logic gate, corresponding to Table C-B. Input 1 (Inp 1) is spike protein alpha and input 2 (Inp 2) is spike protein delta. Outputs for two sets of differently modified sensors, with either C9 or C5 aptamers, for the detection of different COVID-19 biomarkers. Logic diagram: Output = Inp1 Inp2 Inp 1 C9 Inp 2 C5 Output COVID-19 0 0 0 0 1 1 1 0 1 1 1 0 [0200] 1 indicates an umambiguous positive response to the task in question (here infection with Covid-19 alpha or Covid-19 delta). [0201] 0 indicates an unclear test result due to cross-selectivity of the aptamer receptors or no infection.
[0202] Such tables have accordingly been generated with other aptamers, in particular also with the C15 aptamer (which is relevant for the omicron variant of SARS-CoV2); but not shown again here due to sameness.
[0203] In another embodiment, different sets of sensors of the same flexible multielectrode chip have been modified with either C7 aptamer, which detects the spike protein of the SARS-CoV-2 virus, or with I1 aptamer, which detects the HA1 protein of the influenza virus, to specifically detect COVID-19 infections. The output is only 1 if the spike protein is detected. A 1 was obtained as output only when the C7 aptasensor gives a signal above its respective threshold, which is set by the detection limit threshold of the biosensor.
[0204] Corresponding sensors have also already been produced in which aptamers, namely the I1 aptamer, the SG1 aptamer, the C15 aptamer, were used which encompass further biomarkers: Haemagglutinin (HA1) protein of the influenza virus, the glycoprotein G of the HRS virus and the spike protein of the MERS-CoV and in particular also the Omicron variant of the SARS-CoV-2 virus.