CLICK-MODIFIED MRNA

Abstract

The present invention relates to alkyne- and/or azide-modified mRNA, processes for producing such modified mRNA, cells which are transfected to include the modified mRNA, pharmaceutical compositions containing the modified mRNA or cells including the modified mRNA, and to uses of such mRNA, cells or pharmaceutical compositions in mRNA based therapeutic and/or prophylactic applications.

Claims

1-25. (canceled)

26. A pharmaceutical composition comprising a modified messenger RNA (mRNA) comprising a 5′-cap structure, a 5′-untranslated region (5′-UTR), an open reading frame region (ORF), a 3′-untranslated region (3′-UTR) and a poly(A) tail region as an active agent, optionally in combination with a pharmaceutically acceptable adjuvant or excipient and/or contained in a pharmaceutically acceptable carrier, wherein the modified mRNA contains at least one of an alkyne- or azide modification in at least one nucleotide in a) the ORF, the 5′-UTR, and the 3′ UTR, b) the ORF, the 5′-UTR, the 3′-UTR, and the poly(A) tail region, or c) only the poly(A) tail region, wherein at least one of the following conditions applies: (i) the mRNA does not contain a chain-terminating alkyne- or azide-modification at the 3′-ribose position in the poly(A) tail region, (iI) at least one of the four standard types of nucleotides is present in modified form compared to the non-modified form in a ratio of 1:4 to 4:1; (iiI) the modified mRNA contains a functional molecule introduced via a click reaction of the modified mRNA with a correspondingly modified alkyne- or azide-functional molecule, which functional molecule is a tissue or cell specific targeting group or ligand, or (iv) in the ORF and UTRs at least one nucleotide is alkyne-modified and at least one nucleotide is azide-modified.

27. The pharmaceutical composition of claim 26, wherein at least one of the four standard types of nucleotides selected from AMP, CMP, GMP, and UMP in the modified mRNA is partly or completely modified.

28. The pharmaceutical composition of claim 26, characterized in that the modified mRNA contains otherwise modified natural or artificial nucleotides.

29. The pharmaceutical composition of claim 26, wherein the modified mRNA contains a detectable label introduced via a click reaction of the modified mRNA with a correspondingly modified alkyne- or azide-containing detectable label.

30. The pharmaceutical composition of claim 29, wherein the detectable label is a colored or fluorogenic molecule.

31. The pharmaceutical composition of claim 26, wherein the modified mRNA is complexed with a cationic or polycationic compound.

32. The pharmaceutical composition of claim 26, comprising a cell preparation, which is obtained by ex vivo transfection of corresponding human, animal or plant parent cells with the modified mRNA.

33. The pharmaceutical composition of claim 26, wherein the cells are cells of the human or animal immune system.

34. The pharmaceutical composition of claim 26 for use in mRNA based therapeutic and/or prophylactic applications.

35. The pharmaceutical composition for use according to claim 34, wherein the therapeutic and/or prophylactic application comprises targeted delivery in gene replacement therapy, targeted gene therapy in combination with specific endonucleases encoded by the mRNA, in vaccination, in cancer therapy, and for cell specific gene expression or gene editing for treatment of inherited diseases and genetic aberrations, or the use as an immunological adjuvant.

36. A modified messenger RNA (mRNA) comprising a 5′-cap structure, a 5′-untranslated region (5′-UTR), an open reading frame region (ORF), a 3′-untranslated region (3′-UTR) and a poly(A) tail region, characterized in that it contains at least one of an alkyne- or azide modification in at least one nucleotide in a) the ORF, the 5′-UTR, and the 3′ UTR, b) the ORF, the 5′-UTR, the 3′-UTR, and the poly(A) tail region, or c) only the poly(A) tail region, wherein at least one of the following conditions applies: (i) the mRNA does not contain a chain-terminating alkyne- or azide-modification at the 3′-ribose position in the poly(A) tail region, (iI) at least one of the four standard types of nucleotides is present in modified form compared to the non-modified form in a ratio of 1:4 to 4:1; (iiI) the modified mRNA contains a functional molecule introduced via a click reaction of the modified mRNA with a correspondingly modified alkyne- or azide-functional molecule, which functional molecule is a tissue or cell specific targeting group or ligand, or (iv) in the ORF and UTRs at least one nucleotide is alkyne-modified and at least one nucleotide is azide-modified.

37. The modified mRNA of claim 36, wherein at least one of the four standard types of nucleotides selected from AMP, CMP, GMP, and UMP in the modified mRNA is partly or completely modified.

38. The modified mRNA of claim 36, characterized in that it contains otherwise modified natural or artificial nucleotides.

39. The modified mRNA of claim 36, wherein the modified mRNA contains a detectable label introduced via a click reaction of the modified mRNA with a correspondingly modified alkyne- or azide-containing detectable label.

40. The modified mRNA according to claim 39, wherein the detectable label is a colored or fluorogenic molecule.

41. The modified mRNA of claim 36 for use in mRNA based therapeutic and/or prophylactic applications.

42. A kit for production and/or delivery of a modified mRNA of claim 36.

43. A cell preparation, which is obtained by ex vivo transfection of corresponding human, animal or plant cells with a modified mRNA of claim 36.

44. A method for stabilizing mRNA, comprising introducing an alkyne- and/or an azide-modification into said mRNA by including at least one of the four standard types of nucleotides selected from ATP, CTP, GTP and UTP in partly or completely alkyne- and/or azide-modified form during mRNA synthesis and/or in a poly(a) polymerase addition reaction to produce a modified mRNA of claim 36, and optionally one or more of a detectable label and a functional molecule are introduced via a click reaction of the modified mRNA with a correspondingly modified alkyne- or azide-containing detectable label or functional molecule.

45. An in vitro method for quantitatively or qualitatively determining delivery and transfection of a modified mRNA of claim 36 to target cells via fluorescence-activated cell scanning analysis, which modified mRNA contains one or more fluorogenic molecules introduced via a click reaction to the modified mRNA with a correspondingly modified alkyne- or azide-containing fluorogenic molecule and/or which modified mRNA encodes a fluorescent protein.

Description

BRIEF DESCRIPTION OF THE FIGURES

[0120] FIG. 1 shows a general scheme of modified mRNA production and application. Using e.g. 5-ethynyl UTP (EUTP) it is possible to insert alkyne groups available for click reaction with the 5′-UTR, 3′-UTR and the ORF. Selective labelling of the poly(A) tail is possible using e.g. 7-ethynyl 7-deaza ATP and a poly(A) polymerase.

[0121] FIG. 2 shows the general schematic production of alkyne-modified mRNA using e.g. T7 RNA polymerase and a nucleotide mixture including EUTP (structural formula).

[0122] FIG. 3 shows the results of transfection of non-alkyne (A), alkyne (B) and dye (C) modified mRNA coding for eGFP into HeLa cells.

[0123] FIG. 4 shows the general schematic production of alkyne-modified mRNA using e.g. poly(A) polymerase and the alkyne modified nucleotide EATP (structural formula).

[0124] FIG. 5 shows the results of transfection of Eterneon-red 645 modified mRNA (alkyne modification in poly(A) tail only) coding for eGFP into HeLa cells.

[0125] FIG. 6 shows a map and the complete sequence (from T7 promoter to poly(A) end) of the plasmid used in linearized form as DNA template during the T7 RNA polymerase reaction in the Examples. The sequence is also referred to as SEQ ID NO: 2.

[0126] FIG. 7 shows the result of experiments to prove incorporation of EATP into the poly(A) tail of an RNA as described in Example 3.

[0127] FIG. 8 shows a general scheme of the production of site-specific azide-modified mRNA (single azide at the end of the poly(A) tail only) using yeast poly(A) polymerase and the azide-modified nucleotide AzddATP as described in Example 4.

[0128] FIG. 9 shows a transfection of 3′-poly(A) tail Cy3 modified mRNA coding for eGFP into HeLa cells. After 24 h incubation at 37° C. green fluorescence of the eGFP was observed (eGFP filter). For the Cy3 labeled mRNA the localization of the mRNA was observed using Cy3 filter settings.

[0129] FIG. 10 shows a general scheme for production of double labeled azide/alkyne modified mRNA (internal alkyne groups using T7 RNA polymerase and EUTP, one terminal azide at 3′end using AzddATP and yeast poly(A) polymerase), as in Example 5.

[0130] FIG. 11 shows the transfection of internal Eterneon Red modified and 3′-poly(A) tail Cy3 modified mRNA coding for eGFP into HeLa cells. After 24 h incubation at 37° C. green fluorescence of the eGFP was observed (eGFP filter). For the Cy3 labeled mRNA the localization of the mRNA was observed using Cy3 filter settings, for the Eterneon Red labeled mRNA the localization of the mRNA was observed using Cy5 filter settings.

[0131] FIGS. 12 to 16 show the results of FACS analyses for untransfected HeLa cells (FIG. 12), HeLa cells transfected with non-modified mRNA encoding eGFP (FIG. 13), HeLa cells transfected with alkyne-modified mRNA encoding eGFP (FIG. 14) and Eterneon Red-/alkyne-modified mRNA encoding eGFP (FIGS. 15 and 16) and allow quantification of protein expression depending on modification and uptake of dye-labeled mRNA (FIGS. 15 and 16).

[0132] FIG. 17 shows a schematic representation of one embodiment of the invention: Bacterial cells are feeded with, e.g., 5-ethynyluridine and transformed with a plasmid containing the sequence necessary for the production of the mRNA. The newly synthetized mRNA containing EU is then purified by poly(T) resin and/or beads having poly(T) oligonucleotides attached.

[0133] The following examples further illustrate the invention:

EXAMPLES

Example 1

[0134] Alkyne-modified mRNA coding for the enhanced green fluorescent protein (eGFP) was produced by in vitro transcription (IVT) from a DNA template using T7 RNA polymerase and nucleotide mixtures. Here 5-ethynyl-uridine-5′-triphosphate (EUTP) was included in the nucleotide mixture to generate an alkyne-modified mRNA according to FIG. 2 for subsequent transfection into Henrietta Lacks' immortal cells (HeLa cells). The generated mRNA contains a 5′-cap, untranslated regions (UTR), the protein coding part (open reading frame, ORF) and a poly(A) tail.

[0135] mRNA Production

[0136] In a 50 μL reaction volume 20 units of T7 RNA polymerase, 1 μg of template DNA and several nucleotides were combined in transcription buffer (40 mM Tris-HCl, pH 7.9, 6 mM MgCl.sub.2, 4 mM spermidine, 10 mM DTT).

[0137] A) Final nucleotide concentrations for non-alkyne modified mRNA production were:

[0138] 1.0 mM GTP, 4.0 mM A.R.C.A. (P1-(5′-(3′-O-methyl)-7-methyl-guanosyl) P3-(5′-(guanosyl))triphosphate, Cap Analog), 1.25 mM CTP, 1.25 mM UTP, 1.25 mM ψUTP (pseudouridine triphosphate), 1.5 mM ATP.

[0139] B) Final nucleotide concentrations for alkyne modified mRNA production were:

[0140] 1.0 mM GTP, 4.0 mM A.R.C.A. (P1-(5′-(3′-O-methyl)-7-methyl-guanosyl) P3-(5′-(guanosyl))triphosphate, Cap Analog), 1.25 mM CTP, 1.25 mM EUTP (5-ethynyluridine triphosphate), 1.25 mM ψUTP (pseudouridine triphosphate), 1.5 mM ATP.

[0141] C) Final nucleotide concentrations for alkyne modified mRNA production and subsequent click labeling were:

[0142] 1.0 mM GTP, 4.0 mM A.R.C.A. (P1-(5′-(3′-O-methyl)-7-methyl-guanosyl) P3-(5′-(guanosyl))triphosphate, Cap Analog), 1.25 mM CTP, 0.625 mM EUTP (5-ethynyluridine triphosphate), 0.625 mM ψUTP (pseudouridine triphosphate), 0.625 mM UTP, 1.5 mM ATP.

[0143] The mixture was incubated for 2 hours at 37° C. and then 2 units of DNAse I were added and incubated for 15 minutes at 37° C. The mRNA was purified by a spin column method according to manufacturers' instruction for PCR products (PCR purification kit from Qiagen). This yielded 13.3 μg of mRNA for A, 12.3 μg B and 14.3 μg for C, which was directly used for transfection when no click labeling was needed (A and B). When click labeling was performed (C), 2 μg of RNA, 1 nmol Eterneon Red 645 Azide (baseclick GmbH), a single reactor pellet and 0.7 μL 10× Activator.sup.2 (baseclick GmbH, Oligo.sup.2 Click Kit) were combined in a total reaction volume of 7 μL. The reaction mixture was incubated at 45° C. for 30 min and then cleaned using a spin column method according to manufacturers' instruction for PCR products (PCR purification kit from Qiagen).

[0144] For transfection a commercial kit (jetMESSENGER™ from POLYPLUS TRANSFECTION®) was used according to manufacturers' instructions using 0.5 μg of mRNA and 25,000 HeLa cells (CLS GMBH) reaching confluence. The cells were incubated at 37° C. for 24 hours before analysis under the fluorescent microscope, GFP filter: (470/22 excitation; 510/42 emission) and Cy5 filter (628/40 excitation; 692/40 emission) were used.

[0145] FIG. 3 shows the results of transfection of non-alkyne (A), alkyne (B) and dye (C) modified mRNA coding for eGFP into HeLa cells. After 24 h incubation at 37° C. green fluorescence of the eGFP was observed (GFP filter). For the Eterneon Red labeled mRNA (C) the localization of the mRNA was observed using Cy5 filter settings.

[0146] In the bright field image cell morphology of healthy HeLa cells was observed (FIG. 3, A-C), using the GFP filter protein expression of the eGFP was visible (exposure time 120 ms for A-B, 250 ms for C). For the click labeled mRNA (FIG. 3, C) also the localization of the mRNA was observed using the Cy5 filter settings of the microscope.

[0147] Supporting Information:

[0148] Structure of the modified nucleotides used during the T7 RNA polymerase reaction described above.

##STR00001##

[0149] The map and complete sequence (from T7 promoter to poly(A) end) of the plasmid used in a linearized form as DNA template during the T7 RNA polymerase reaction described above is shown in FIG. 6. The sequence is also referred to SEQ ID NO: 2.

Example 2

[0150] Alkyne-modified mRNA coding for the enhanced green fluorescent protein (eGFP) was produced by in vitro transcription (IVT) from a DNA template (FIG. 6) using T7 RNA polymerase and nucleotide mixtures. Here 7-ethynyl-adenine-5′-triphosphate (EATP) was incorporated in the IVT mRNA after the T7 RNA polymerase reaction by poly(A) polymerase to generate an alkyne-modified mRNA according to FIG. 4 for subsequent click labeling and transfection into Henrietta Lacks' immortal cells (HeLa cells). The generated mRNA contains a 5′-cap, untranslated regions (UTR), the protein coding part (open reading frame, ORF) and a poly(A) tail alkyne labeled.

[0151] mRNA Production

[0152] In a 50 μL reaction volume 20 units of T7 RNA polymerase, 1 μg of linearized template DNA and several nucleotides were combined in transcription buffer (40 mM Tris-HCl, pH 7.9, 6 mM MgCl.sub.2, 4 mM spermidine, 10 mM DTT).

[0153] Final nucleotide concentrations for non-alkyne modified mRNA production were:

[0154] 1.0 mM GTP, 4.0 mM A.R.C.A. (P1-(5′-(3′-O-methyl)-7-methyl-guanosyl) P3-(5′-(guanosyl))triphosphate, Cap Analog), 1.25 mM CTP, 1.25 mM UTP, 1.25 mM ψUTP (pseudouridine triphosphate), 1.5 mM ATP.

[0155] The mixture was incubated for 2 hours at 37° C. and then 2 units of DNAse I were added and incubated for 15 minutes at 37° C. The mRNA was purified by a spin column method according to manufacturers' instruction for PCR products (PCR purification kit from Qiagen). This yielded 12.3 μg of mRNA which was directly used for poly(A) polymerase reaction with EATP.

[0156] In a 20 μL reaction volume 5 units of E. coli poly(A) polymerase, 4.2 μg of mRNA prepared before and a solution of 1 mM EATP were combined in reaction buffer (250 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl.sub.2, pH 7.9)

[0157] The mixture was incubated for 1 hour at 37° C. The mRNA was purified by a spin column method according to manufacturers' instruction for PCR products (PCR purification kit from Qiagen). This yielded 4 μg of mRNA.

[0158] The click labeling was performed using 1.1 μg of RNA, 1 nmol Eterneon Red 645 Azide (baseclick GmbH), a single reactor pellet and 0.7 μL 10× Activator.sup.2 (baseclick GmbH, Oligo.sup.2 Click Kit) were combined in a total reaction volume of 7 μL. The reaction mixture was incubated at 45° C. for 30 min and then cleaned using a spin column method according to manufacturers' instruction for PCR products (PCR purification kit from Qiagen).

[0159] For transfection a commercial kit (jetMESSENGER™ from POLYPLUS TRANSFECTION®) was used according to manufacturers' instructions using 0.5 μg of mRNA and 25,000 HeLa cells (CLS GMBH) reaching confluence. The cells were incubated at 37° C. for 24 hours before analysis under the fluorescent microscope, GFP filter: (470/22 excitation; 510/42 emission) and Cy5 filter (628/40 excitation; 692/40 emission) were used.

[0160] FIG. 5 shows the results of transfection of Eterneon Red modified mRNA coding for eGFP into HeLa cells. After 24 h incubation at 37° C. green fluorescence of the eGFP was observed (GFP filter). For the Eterneon Red labeled mRNA the localization of the mRNA was observed using Cy5 filter settings.

[0161] In the bright field image cell morphology of healthy HeLa cells was observed (FIG. 5), using the GFP filter protein expression of the eGFP was visible (exposure time 120 ms). Localization of the mRNA labeled with Et-Red was observed using the Cy5 filter settings of the microscope.

Example 3

[0162] In order to prove incorporation of the EATP (Ethynyl-adenosine-5′-triphosphate) within the poly(A) tail a short RNA oligonucleotide (31 mer, CUAGUGCAGUACAUGUAAUCGACCAGAUCAA, SEQ ID NO: 1) was used as template for the poly(A) polymerase reaction using:

[0163] A) 1 mM ATP

[0164] B) 1 mM EATP;

[0165] C) 0.5 mM ATP and 0.5 mM EATP.

[0166] In a 20 μL reaction volume 5 units of Escherichia coli poly(A) polymerase, 2 μg of RNA (31 mer) and nucleotide (final concentration of A-C) were combined in reaction buffer (250 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl.sub.2, pH 7.9). The mixtures were incubated for 30 minutes at 37° C. or for 16 hours at 37° C.

[0167] The results were analyzed by denaturing polyacrylamide gel electrophoresis (7 M urea, 1×TBE, 7% polyacrylamide gel, constant voltage 100 V, 1 h). Compared to the template RNA oligonucleotide (FIG. 7, Lane 2) a band or smear at higher molecular weight appeared for all samples, which were incubated in the presence of the poly(A) polymerase using different nucleotides and incubation durations (FIG. 7, Lane 3-7). This indicated successful incorporation of ATP or its alkyne analog EATP. Within 30 min incubation the incorporation of ATP (FIG. 7, Lane 3) was more efficient compared to EATP (FIG. 7, Lane 4) or a mixture of EATP and ATP (FIG. 7, Lane 5). By extending the incubation time for the incorporation of EATP to 16 h, the length of the poly-EA-addition was increased (FIG. 7, Lane 6) in comparison to 30 min incubation (FIG. 7, Lane 4). Interestingly, for the nucleotide mixture containing ATP and EATP no change was observed after 16 h (FIG. 7, Lane 7) compared to 30 min.

[0168] FIG. 7 shows the ethidium bromide stained 7% denaturing polyacrylamide gel of different polyadenylation reactions as described above. In each lane 500 ng of RNA were loaded. Lane 1: low molecular weight DNA ladder (New England Biolabs), Lane 2: 31 mer RNA oligonucleotide template, Lane 3: polyadenylation reaction with 1 mM ATP for 30 min, Lane 4: like 3 but 1 mM EATP, Lane 5: like 3 but 0.5 mM EATP and 0.5 mM ATP, Lane 6: like 4 but 16 h incubation, Lane 7: like 5 but 16 h incubation.

Example 4

[0169] Azide-modified mRNA coding for the enhanced green fluorescent protein (eGFP) was produced by in vitro transcription (IVT) from a DNA template using T7 RNA polymerase and nucleotide mixture. Here 3′-azido-2′,3′-dideoxyadenosine (AzddATP) was incorporated, thus terminating the elongation, in the IVT mRNA after T7 RNA polymerase reaction using yeast poly(A) polymerase to generate a site-specific single azide modified mRNA according to FIG. 8 for subsequent transfection in Henrietta Lacks' immortal cells (HeLa cells). The generated mRNA contains a 5′-cap, untranslated regions (UTR). The protein coding part (open reading frame, ORF) and a poly(A)-tail with a single terminal azide.

[0170] mRNA Production

[0171] In a 50 μL reaction volume 20 units of T7 RNA polymerase, 1 μg of template DNA and several nucleotides were combined in transcription buffer (40 mM Tris-HCl, pH 7.9, 6 mM MgCl.sub.2, 4 mM spermidine, 10 mM dithiothreitol). Final nucleotide concentrations were:

[0172] 1.0 mM GTP, 4.0 mM A.R.C.A. (P1-(5′-(3′-O-methyl)-7-methyl-guanosyl) P3-(5′-(guanosyl)) triphosphate, cap analog), 1.25 mM CTP, 1.25 mM UTP, 1.25 mM ψUTP (pseudouridine triphosphate), 1.5 mM ATP.

[0173] The mixture was incubated for 2 hours at 37° C. and then 2 units of DNAse I were added and incubated for 15 minutes at 37° C. The mRNA was purified by a spin column method according to manufacturers' instruction for PCR products (PCR purification kit from Qiagen). This yielded 13.7 μg of mRNA which was directly used for yeast poly(A) addition with the azide-containing ATP analog AzddATP.

[0174] In a 25 μL reaction volume 600 units of yeast poly(A) polymerase, 5.8 μg of purified IVT mRNA and 0.5 mM AzddATP were combined in reaction buffer (10% (v/v) glycerol, 20 mM Tris-HCl, 0.6 mM MnCl.sub.2, 20 μM EDTA, 0.2 mM DTT, 100 μg/mL acetylated BSA, pH 7.0) and the solution was incubated for 20 minutes at 37° C. Modified mRNA was purified by a spin column method according to manufacturers' instruction for PCR products (PCR purification kit from Qiagen). This yielded 4.8 μg of mRNA.

[0175] Click labelling was performed using 4.8 μg of RNA and 2 nmol of DBCO-sulfo-Cy3 (Jena Bioscience cat. no. CLK-A140-1), combined in a total reaction volume of 30 μL. The reaction mixture was incubated at room temperature overnight and then cleaned using a spin column method according to manufacturers' instruction for PCR products (PCR purification kit from Qiagen). This yielded 4.0 μg of mRNA.

[0176] For transfection of modified mRNA a commercial kit (jetMESSENGER™ from POLYPLUS TRANSFECTION®) was used according to manufacturers' instructions using 0.5 μg of Cy3 labeled mRNA and 25.000 HeLa cells (CLS GMBH) reaching confluency. The cells were incubated at 37° C. for 24 hours before analysis under the fluorescent microscope, GFP filter: (470/22 excitation; 510/42 emission) and Cy3 filter (531/40 excitation; 593/40 emission) were used.

[0177] In the bright field image cell morphology of healthy HeLa cells was observed (FIG. 9 shows a), using the GFP filter protein expression of the eGFP was visible (exposure time 120 ms). Localization of the mRNA labelled with Cy3 was observed using the Cy3 filter settings of the microscope.

Example 5

[0178] Azide/alkyne-modified mRNA coding for the enhanced green fluorescent protein (eGFP) was produced by in vitro transcription (IVT) from a DNA template using T7 RNA polymerase and nucleotide mixture and yeast poly(A) polymerase. Here 5-ethynyl-uridine-5′-triphosphate (EUTP) was included in the nucleotide mixture to generate an alkyne-modified mRNA followed by incorporation of 3′-azido-2′,3′-dideoxyadenosine (AzddATP), thus terminating the elongation and introducing one single azide. This is the first example of dual labelling of the mRNA.

[0179] mRNA Production

[0180] In a 50 μL reaction volume 20 units of T7 RNA polymerase, 1 μg of template DNA and several nucleotides were combined in transcription buffer (40 mM Tris-HCl, pH 7.9, 6 mM MgCl.sub.2, 4 mM spermidine, 10 mM dithiothreitol). Final nucleotide concentrations were:

[0181] 1.0 mM GTP, 4.0 mM A.R.C.A. (P1-(5′-(3′-O-methyl)-7-methyl-guanosyl) P3-(5′-(guanosyl))triphosphate, Cap Analog), 1.25 mM CTP, 0.625 mM EUTP (5-ethynyluridine triphosphate), 0.625 mM ψUTP (pseudouridine triphosphate), 0.625 mM UTP, 1.5 mM ATP.

[0182] The mixture was incubated for 2 hours at 37° C. and then 2 units of DNAse I were added and incubated for 15 minutes at 37° C. The mRNA was purified by a spin column method according to manufacturers' instruction for PCR products (PCR purification kit from Qiagen). This yielded 13.9 μg of mRNA which was directly used for yeast poly(A) addition with the azide-containing ATP analogue AzddATP.

[0183] In a 25 μL reaction volume 600 units of Yeast Poly(A) polymerase, 5.8 μg of purified IVT mRNA and 0.5 mM AzddATP were combined in reaction buffer (10% (v/v) glycerol, 20 mM Tris-HCl, 0.6 mM MnCl.sub.2, 20 μM EDTA, 0.2 mM DTT, 100 μg/mL acetylated BSA, pH 7.0) and the solution was incubated for 20 minutes at 37° C. Modified mRNA was purified by a spin column method according to manufacturers' instruction for PCR products (PCR purification kit from Qiagen). This yielded 4.35 μg of mRNA.

[0184] The first click labelling (strain promoted azide-alkyne cyclo-addition, SPAAC) was performed using 4.35 μg of RNA and 2 nmol of DBCO-sulfo-Cy3 (Jena Bioscience cat no. CLK-A140-1), combined in a total reaction volume of 30 μL. The reaction mixture was incubated at room temperature overnight and then cleaned using a spin column method according to manufacturers' instruction for PCR products (PCR purification kit from Qiagen). This yielded 2.55 μg of mRNA.

[0185] A second click reaction (Cu catalysed azide-alkyne Cyclo-addition, CuAAC) was performed with 2 μg of RNA, 1 nmol Eterneon Red 645 Azide (baseclick GmbH), a single reactor pellet and 0.7 μL 10× Activator.sup.2 (baseclick GmbH, Oligo.sup.2 Click Kit) combined in a total reaction volume of 7 μL. The reaction mixture was incubated at 45° C. for 30 min and then cleaned using a spin column method according to manufacturers' instruction for PCR products (PCR purification kit from Qiagen).

[0186] For transfection a commercial kit (jetMESSENGER™ from POLYPLUS TRANSFECTION®) was used according to manufacturers' instructions using 0.5 μg of mRNA and 25,000 HeLa cells (CLS GMBH) reaching confluence. The cells were incubated at 37° C. for 24 hours before analysis under the fluorescent microscope, GFP filter: (470/22Ex;510/42 Em), Cy5 filter (628/40Ex;692/40 Em) and Cy3 filter (531/40 excitation; 593/40 emission) were used.

[0187] In the bright field image cell morphology of healthy HeLa cells was observed (FIG. 11). Using the GFP filter, protein expression of the eGFP was visible (exposure time 120 ms). Localization of the mRNA labelled with Cy3 and Eterneon Red was observed using the Cy3 and Cy5 filter settings of the microscope, proving dual labelling with two different molecules.

Example 6: Relative Quantification of mRNA Expression Via Fluorescence-Activated Cell Sorting/Scanning (FACS)

[0188] This experiment was intended to evaluate the expression level of in vitro transcribed (IVT) eGFP mRNA in cells using a FACS device. eGFP expression is directly monitored via its fluorescence emission at 509 nm upon excitation at 475 nm and can indicate whether introduction of a functional group into the RNA, e.g. a terminal alkyne or a dye molecule can change the expression level. Moreover, uptake of dye-modified mRNA can be monitored on a second fluorescence channel. Variations in the expression level within the cell culture population can be detected to evaluate mRNA preparation homogeneity.

[0189] Three different IVT mRNAs were prepared by using the T7 RNA polymerase and a DNA template with different nucleotide mixtures, and if necessary a subsequent click reaction: [0190] A) unmodified nucleotides mixture (=unmodified eGFP mRNA), [0191] B) nucleotide mixture containing 5-ethynyl-uridine 5′-triphosphate (=alkyne modified eGFP mRNA), [0192] C) like B) but subsequent click reaction in the presence of Eterneon-Red azide (Cy5 analog, baseclick GmbH) (=Eterneon Red eGFP mRNA).

[0193] 2 μg of each mRNA preparation were used for transfection into Henrietta Lacks' immortal cells (HeLa) and buffer without mRNA as a negative control. After 24 h incubation at 37° C. the cells were detached, fixed and then at least 10000 cells were analysed using FACS (FACS Canto II, BECTON DICKINSON).

[0194] All samples were analysed using two channels, one for eGFP fluorescence to evaluate the protein expression and one for the Eterneon Red dye fluorescence to evaluate the presence of dye-labelled mRNA. This resulted in a histogram and dot plot which are shown for each experiment and fluorescence channel as reported below. The histogram displays the number of counted cells per fluorescence intensity and the dot plot displays the cell internal organization (SSC) in correlation to the fluorescence intensity (eGFP or Eterneon Red). Data from 10.000 counts (=10.000 cells) were collected for each sample. [0195] a) HeLa cells, which were not transfected with mRNA, were analysed as a negative control and to establish the level of the intrinsic fluorescence. This allowed to set a gate (P1) in the dot plots which defined the level from which cells are considered expressing the eGFP protein. Every dot inside the P1 gate was defined as an eGFP expressing cell with a specific fluorescence intensity. The result is shown in FIG. 12. [0196] b) When transfected with unmodified eGFP mRNA (A) almost all the cells with P1 equal to 96.5% were expressing the fluorescent protein (red population). The results are shown in FIG. 13. A very similar result was obtained when HeLa cells were transfected with alkyne modified eGFP mRNA (B) and a P1 value of 96.4%. The results of this experiment are shown in FIG. 14. [0197] c) When HeLa cells were transfected with Eterneon Red eGFP mRNA (C) a P1 population of 75% was observed, meaning that even by attaching a sterically demanding dye molecule to the eGFP mRNA the ribosomes are still able to translate it into a functional protein with 78% relative expression level as compared to the unmodified eGFP mRNA. Results can be seen in FIG. 15. [0198] d) Furthermore, because the mRNA was labelled with the Eterneon Red dye it was possible to observe the relative mRNA amount per cell. When the cells defined as not expressing eGFP were analysed (gate P2 in light grey) it was observed that all of them correspond to the cells that did internalize low amounts of Eterneon Red labelled mRNA. This assumption derives from the Eterneon Red channel where P2 (light grey) corresponds to the lowest values of fluorescence intensity. The results are shown in FIG. 16.