ELECTROSTATIC NANOPARTICLES AND USE THEREOF
20240024500 · 2024-01-25
Inventors
- Sebastian BÄUMER (Münster, DE)
- Nicole BÄUMER (Münster, DE)
- Wolfgang BERDEL (Münster, DE)
- Georg LENZ (Münster, DE)
- Andreas FAUST (Münster, DE)
- Lisa WITTMANN (Münster, DE)
Cpc classification
A61K47/6811
HUMAN NECESSITIES
A61K2800/57
HUMAN NECESSITIES
A61K47/6935
HUMAN NECESSITIES
International classification
A61K47/68
HUMAN NECESSITIES
Abstract
The present invention relates to a method of generating a nanoparticle comprising (c) contacting an antibody with a composition comprising a first conjugate (A), the first conjugate comprising a positively charged polypeptide conjugated to a bifunctional linker, characterized in that the composition is essentially free of unconjugated bifunctional linker, thereby obtaining a second conjugate (B), the second conjugate comprising the positively charged polypeptide, the bifunctional linker, and the antibody; and (d) contacting the second conjugate (B), a positively charged polypeptide, and a negatively charged molecule, thereby forming a nanoparticle. The present invention also relates to a nanoparticle obtainable by a method of the invention, as well as to a nanoparticle comprising (a) a positively charged polypeptide; (b) a second conjugate (B), the second conjugate comprising an antibody conjugated to a positively charged polypeptide; (c) one or more negatively charged molecules. The present invention also relates to a composition comprising a nanoparticle of the invention and to a nanoparticle or composition of the invention for use in therapy.
Claims
1. A method of generating a nanoparticle comprising c) contacting an antibody with a composition comprising a first conjugate (A), the first conjugate comprising a positively charged polypeptide conjugated to a bifunctional linker, characterized in that the composition is essentially free of unconjugated bifunctional linker, thereby obtaining a second conjugate (B), the second conjugate comprising the positively charged polypeptide, the bifunctional linker, and the antibody; and d) contacting the second conjugate (B), a positively charged polypeptide, and a negatively charged molecule, thereby forming a nanoparticle.
2. The method of claim 1, wherein the method comprises prior to step c): a) conjugating a positively charged polypeptide with a bifunctional linker; b) removing unconjugated bifunctional linker.
3. The method of claim 1 or 2, wherein the molar ratio between the first conjugate (A) and the antibody is at least about 10:1 in step c).
4. The method of any one of the preceding claims, wherein the molar ratio between the positively charged polypeptide and the second conjugate (B) is at least about 10:1 in step d).
5. The method of any one of the preceding claims, wherein the antibody is specific for a cell surface molecule.
6. The method of any one of the preceding claims, wherein the negatively charged molecule is a nucleic acid.
7. The method of any one of the preceding claims, wherein the positively charged polypeptide is a protamine or histone.
8. A nanoparticle obtainable by a method of any one of the preceding claims.
9. A nanoparticle comprising: a) a positively charged polypeptide; b) a second conjugate (B), the second conjugate comprising an antibody conjugated to a positively charged polypeptide; and c) one or more negatively charged molecule(s).
10. The nanoparticle of claim 8 or 9, wherein the second conjugate is enriched in the outer portion of the nanoparticle.
11. The nanoparticle of any one of claims 8-10, wherein the one or more negatively charged molecules are enriched in the inner portion of the nanoparticle.
12. The nanoparticle of any one of claims 8-11, wherein the nanoparticle has a mean diameter of about 0.05 m to about 10 m.
13. A composition comprising a nanoparticle of any one of claims 8-12.
14. A nanoparticle of any one of claims 8-12 or a composition of claim 13 for use in therapy.
15. A kit comprising a nanoparticle of any one of claims 8-12 or a composition of claim 13.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
DETAILED DESCRIPTION
[0098] The inventors of the present application have surprisingly found that a modification of the conjugation protocol for antibody-protamine conjugates as described Bumer, N. et al., 2016 Nat. Protoc. 11, 22-36 results in the formation of nanoparticles comprising the antibody-protamine conjugate and a negatively charged cargo molecule to be delivered to a target.
[0099] Formation of a complex nanoparticle comprising a targeting moiety chemically conjugated to protamine, free protamine and a negatively charge cargo molecule such as a siRNA can be used for cell-type specific therapeutic delivery of siRNA and other effector drugs which can selectively block oncogenic pathways
[0100] In the conjugation protocol of the invention, two steps have been modified. First, the conjugation step for the generation of the antibody-protamine was conducted with an antibody and a SMCC-protamine conjugate that was essentially free of free sulfo-SMCC. In the protocol as described by Bumer, N. et al., 2016 Nat. Protoc. 11, 22-36, free sulfo-SMCC was present in this conjugation step and was only removed after the conjugation step. Second, for the step of loading siRNA onto the antibody-protamine conjugate, the antibody-SMCC conjugate and the siRNA are contacted with each other in the presence of a certain amount of free protamine. Surprisingly, macroparticles comprising antibody-protamine conjugate, free protamine, and the siRNA are formed with this modified protocol.
[0101] The inventors of the present application have further surprisingly found that such nanoparticles provide a more efficient binding and transport of an siRNA, as compared to the conjugates that were generated using the previous protocol as described (Bumer, N. et al., 2016 Nat. Protoc. 11, 22-36).
[0102] The nanostructures generated by the method of the invention is by far bigger than the linear single antibody-protamine-siRNA complex and can be detected as a vesicular structure by light microscopy. The inventors of the present application have found out that a certain amount of unbound protamine is needed to form these nanoparticles and to target the respective cells efficiently. Then, a knockdown of the intended target (onco-) genes is performed specifically. The positively charged nanostructure (micelle) can also serve as carrier for other negatively charged small molecules as shown in Example 6, 15, and 18-21, in which a small molecule was also transported in a targeted and efficient way into the respective cells. With this approach the therapeutic molecule, such as a siRNA, is not only operative to form the electrostatic nanostructure, but is also encapsulated inside the nanostructure.
[0103] Since most cancer types in an advanced and metastasized stage are not effectively curable when the present invention is made, there is a strong need for new, more effective and better tolerable therapy options. The nanoparticle comprising of a targeting moiety such as a cancer cell-specific antibody with chemically bound SMCC-protamine and free protamine is able to transport negatively charged molecules such as siRNA and other small molecules that are otherwise not taken up by eukaryotic cells. Because especially siRNAs can be defined against any gene, this system is potentially applicable to a large number of diseases including cancer, neurodegeneration, and viral infections.
[0104] The present application thus relates to a method of generating a nanoparticle comprising (c) contacting an antibody with a composition comprising a first conjugate (A), the first conjugate comprising a positively charged polypeptide conjugated to a bifunctional linker, characterized in that the composition is essentially free of unconjugated bifunctional linker, thereby obtaining a second conjugate (B), the second conjugate comprising the positively charged polypeptide, the bifunctional linker, and the antibody; and (d) contacting the second conjugate (B), a positively charged polypeptide, and a negatively charged molecule, thereby forming a nanoparticle.
[0105] A first conjugate as used herein refers to conjugate comprising or preferably consisting of a positively charged polypeptide conjugated to a bifunctional linker.
[0106] In the method of the present disclosure, (c) is a conjugation step in which an antibody is conjugated with a first conjugate. In contrast to the method previously described by Bumer, N. et al., 2016 Nat. Protoc. 11, 22-36, the composition comprising the first conjugate that is employed in this step is essentially free of unconjugated bifunctional linker. In line with this, the conjugation of step (c) is preferably carried out in a composition that is essentially free of unconjugated bifunctional linker.
[0107] In step (c), the first conjugate is preferably in molar excess as compared to the antibody, which means that there are preferably more first conjugate molecules than antibody molecules. In some embodiments the molar ratio between the first conjugate and the antibody in step (c) is at least about 10:1, preferably at least about 15:1, preferably at least about 20:1. In some embodiments, the molar ratio between the first conjugate and antibody is up to about 50:1, preferably up to about 45:1, preferably up to about 40:1. In some embodiments, the molar ratio between the first conjugate and the antibody in step (c) is in the range of about 10:1 to 50:1, preferably about 15:1 to about 45:1, preferably about 20:1 to about 40:1. Preferred embodiments, the molar ratio between the first conjugate and the antibody is about 20:1, about 21:1, about 22:1, about 23:1, about 24:1, about 25:1, about 26:1, about 27:1, about 28:1, about 29:1, about 30:1, about 31:1, about 32:1, about 33:1, about 34:1, about 35:1, about 36:1, about 37:1, about 38:1, about 39:1, about 40:1.
[0108] In the method of the present disclosure, in step (d), the second conjugate, a positively charged polypeptide, and a negative charged molecule are contacted with each other. Without wishing to be bound by theory, it is believed that the afore-mentioned three components self-assemble to form a nanoparticle. Here, the second conjugate is the second conjugate that is formed in step (c).
[0109] When referring to a positively charged polypeptide in the context of step (d), the expression encompasses both, a free positively charged polypeptide and a conjugate of a positively charged polypeptide, such as a positively charged polypeptide conjugated with a linker. The positively charged polypeptide of step (d) can be the first conjugated as in step (c), or it can also be another molecule than the first conjugate in step (c). For example, in the context of step (d), the term positively charged polypeptide can encompass both, (free) protamine and SMCC-protamine. In the context of step (d), the term also encompasses mixtures of different positively charged polypeptides, including mixtures of a positively charged polypeptides and conjugates of positively charged polypeptides.
[0110] In some embodiments, the positively charged polypeptide of step (d) is the first conjugate of step (c). As an illustrative example, the positively charged polypeptide of step (d) is SMCC-protamine and the first conjugate of step (c) is also SMCC-protamine. If the positively charged polypeptide of step (d) is the first conjugate of step (c), the composition that is formed in step (c) may be used in step (d) without a step of separating the second conjugate that is formed in step (c) from residual positively charged polypeptides (which includes residual first conjugates in the present context).
[0111] In some embodiments, the positively charged polypeptide of step (d) is different from the first conjugate of step (c). As an illustrative example, the positively charged polypeptide of step (d) is (free) protamine, whereas the first conjugate of step (c) is SMCC-protamine. In such a case, the method may comprise after step (c) a step of separating the second conjugate from the first conjugate after step (c) and/or prior to step (d). The method may also comprise addition of a positively charged polypeptide in and/or prior to step (d).
[0112] Preferred positively charged polypeptides in the context of step (d) include, but are not limited to, protamine, SMCC-protamine, a histone subunit, a histone subunit conjugated to SMCC, or mixtures thereof with protamine, SMCC-protamine or mixtures thereof being preferred, with protamine or SMCC-protamine being more preferred.
[0113] In step (d), the positively charged polypeptide is preferably in molar excess as compared to the second conjugate, which means that there are preferably more positively charged polypeptide molecules than second conjugate molecules. In some embodiments the molar ratio between the positively charged polypeptide and the second conjugate in step (d) is at least about 10:1, preferably at least about 15:1, preferably at least about 20:1. In some embodiments, the molar ratio between the positively charged polypeptide and second conjugate is up to about 50:1, preferably up to about 45:1, preferably up to about 40:1. In some embodiments, the molar ratio between the positively charged polypeptide and the second conjugate in step (d) is in the range of about 10:1 to 50:1, preferably about 15:1 to about 45:1, preferably about 20:1 to about 40:1. Preferred embodiments, the molar ratio between the positively charged polypeptide and the second conjugate is about 20:1, about 21:1, about 22:1, about 23:1, about 24:1, about 25:1, about 26:1, about 27:1, about 28:1, about 29:1, about 30:1, about 31:1, about 32:1, about 33:1, about 34:1, about 35:1, about 36:1, about 37:1, about 38:1, about 39:1, about 40:1.
[0114] In step (d), the negative charged molecule is preferably in molar excess as compared to the second conjugate, which means that there are preferably more negatively charged molecules than second conjugate molecules. In some embodiments the molar ratio between the positively charged polypeptide and the second conjugate in step (d) is at least about 10:1, at least about 15:1, at least about 20:1, at least about 25:1, at least about 30:1, at least about 40:1, at least about 50:1, at least about 70:1, at least about 100:1, at least about 150:1, at least about 200:1, at least about 250:1, at least about 300:1, at least about 400:1, or at least about 500:1.
[0115] In step (d), the negative charged molecule is preferably equimolar or in molar excess as compared to the positively charged polypeptide, which means that there are preferably about the same number or more negatively charged molecules than positively charged polypeptide molecules. In some embodiments the molar ratio between the negatively charged molecule and the positively charged polypeptide in step (d) is at least about 1:1, at least about 2:1, at least about 3:1, at least about 4:1, at least about 5:1, at least about 6:1, at least about 7:1, at least about 8:1, at least about 9:1, at least about 100:1, at least about 20:1, at least about 30:1, at least about 40:1, at least about 50:1, at least about 60:1, at least about 70:1, at least about 80:1, at least about 90:1, or at least about 100:1.
[0116] The method of the disclosure can be carried out at a large range of temperatures. The Examples of the present application show that nanoparticles can be formed at about 4 C., at room temperature, as well as at 37 C. Accordingly, it is envisioned that the method of the present disclosure, including e.g. step (c) and/or step (d), can be carried out at a temperature of from about 1 C. to about 60 C., preferably from about 2 C. to about 50 C., preferably from about 3 C. to about 40 C., more preferably be from about 4 C. to about 37 C. Thus, step (d) can be carried out at a temperature of from about 1 C. to about 60 C., preferably from about 2 C. to about 50, preferably from about 3 C. to about 40 C., more preferably be from about 4 C. to about 37 C.
[0117] It is envisioned that step (d) preferably comprises an incubation step to allow formation of nanoparticles. The incubation step is preferably carried out for at least about 1 h, preferably at least about 1.5 h, preferably at least about 2 h. The incubation step is preferably carried out for up to about 48 h, preferably up to about 24 h, preferably up to about 18 h, preferably up to about 12 h, preferably up to about 10 h, preferably up to about 9 h, preferably up to about 8 h, preferably up to about 7 h, preferably up to about 6 h. The incubation step is preferably carried out for about 1 h to about 48 h, preferably for about 1 h to about 24 h, preferably from about 1 h to about 18 h, preferably from about 1 h to about 12 h, preferably from about 1 h to about 10 h, preferably from about 1 h to about 9 h, preferably from about 1.5 h to about 8 h, preferably from about 1.5 to about 7 h, preferably from about 2 h to about 6 h. Without wishing to be bound by theory, it is believed that optimal results can be achieved within incubation for about 2 hours to about 6 hours. Thus, a preferred embodiments, step comprises an incubation step from about 2 h to about 6 h, including about 2 h, about 2.1 h, about 2.2 h, about 2.3 h, about 2.4 h, about 2.5 h, about 2.6 h, about 2.7 h, about 2.8 h, about 2.9 h, about 3 h, about 3.1 h, about 3.2 h, about 3.3 h, about 3.4 h, about 3.5 h, about 3.6 h, about 3.7 h, about 3.8 h, about 3.9 h, about 4 h, about 4.1 h, about 4.2 h, about 4.3 h, about 4.4 h, about 4.5 h, about 4.6 h, about 4.7 h, about 4.8 h, about 4.9 h, about 5 h, about 5.1 h, about 5.2 h, about 5.3 h, about 5.4 h, about 5.5 h, about 5.6 h, about 5.7 h, about 5.8 h, about 5.9 h, and about 6 h.
[0118] The method of the present disclosure may further comprise, prior to step (c), the steps of (a) conjugating a positively charged polypeptide with a bifunctional linker and (b) removing unconjugated linker.
[0119] The term removing unconjugated linker as used herein refers to any step that is suitable for separating a conjugate of a positively charged polypeptide and a bifunctional linker (i.a. a first conjugate) from unconjugated linker. Such methods are well known to the skilled person and include but are not limited to e.g. filtration, dialysis, gel filtration, chromatography, or electrophoresis.
[0120] The term conjugation or conjugate as used herein refer to the joining together of two or more molecules, through all forms of covalent linkage, by means including, but not limited to chemical conjugation. So, the conjugation may include conjugation of at least one portion of a linker to a polypeptide. This connection can be achieved via different reactive groups or via the same reactive groups.
[0121] Functional groups on a polypeptide that can be targeted for crosslinking include primary amines, sulfhydryls, carbonyls, hydroxyls, carbohydrates, carboxylic acids and the like, preferably via amine and/or sulfhydryl and/or carboxyl. In some embodiments, the conjugation of a linker to a polypeptide is achieved via a NH2-group of said polypeptide. In some embodiments, the conjugation of a linker to a polypeptide is achieved via a thiol-group of said polypeptide. In some embodiments, the conjugation of a linker to a polypeptide is achieved via a carboxyl-group of said polypeptide. Methods of chemically conjugating a linker (or cross-linking agent) to a polypeptide are well known to the skilled person.
[0122] The methods of the present disclosure may further comprise, prior to step (c), a step of purification of the antibody. Such purification step may be a desalting step. Such desalting methods are well-known to the skilled person and include, but are not limited to, e.g. gel filtration or dialysis.
[0123] The methods of the present disclosure may further comprise a step of separating and/or recovering a nanoparticle obtained in step (c) from a component of its production environment. Preferably, after the separation and/or recovery, the nanoparticle is free or substantially free of association with all other components from its production environment. Contaminant components of its production environment, are materials that would typically interfere with the uses, in particular therapeutic uses for the nanoparticle, and may include free second conjugates (i.e. Second conjugates not comprised in a nanoparticle), free positively charged polypeptides (i.e. not comprised in a nanoparticle), or free negatively charged molecules (i.e. not comprised in a nanoparticle). The nanoparticles may e.g constitute at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45% by weight of the total protein in a given sample. In preferred embodiments, the nanoparticles constitute at least about 50% at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85% by weight of the total protein in a given sample. In preferred embodiments, the nanoparticles constitute at least about 90% at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% by weight of the total protein in a given sample. It is understood that the isolated nanoparticle may constitute from about 5% to about 99.9% or about 100% by weight of the total protein content, depending on the circumstances.
[0124] The method of the present disclosure may comprise following steps: [0125] Optionally: (a) conjugating a positively charged polypeptide with a bifunctional linker; [0126] Optionally: (b) removing unconjugated bifunctional linker; [0127] Optionally: purification of the antibody; [0128] (c) contacting an antibody with a composition comprising a first conjugate (A), the first conjugate comprising a positively charged polypeptide conjugated to a bifunctional linker, characterized in that the composition is essentially free of unconjugated bifunctional linker, thereby obtaining a second conjugate (B), the second conjugate comprising the positively charged polypeptide, the bifunctional linker, and the antibody; [0129] Optionally: determining of protein content; [0130] Optionally; assessment of antibody functionality, preferably via flow cytometry; [0131] (d) contacting the second conjugate (B), a positively charged polypeptide, and a negatively charged molecule, thereby forming a nanoparticle; and/or [0132] Optionally: recovery and/or isolation of the nanoparticle.
[0133] The term polypeptide as used herein refers to a compound made up of a single chain of amino acid residues linked by peptide bonds. The term protein as used herein may be synonymous with the term polypeptide or may refer, in addition, to a complex of two or more polypeptides. A polypeptide as used herein may comprise at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 150, at least about 200, at least about 250, at least about 300, at least about 350, at least about 400, at least about 450, at least about 500, at least about 600, at least about 700 or even more amino acids.
[0134] A polypeptide as used herein preferably consists of naturally occurring and/or proteogenic amino acids. However, peptidomimetics wherein amino acid(s) and/or peptide bond(s) have been replaced by functional analogues are also encompassed by the invention. The term polypeptide also refers to, and does not exclude, modifications of the polypeptide, e.g., glycosylation, acetylation, phosphorylation and the like. Such modifications are well described in basic texts and in more detailed monographs, as well as in the research literature.
[0135] The term positively charged polypeptide means a polypeptide having a net positive charge at or near physiological pH (e.g., in solutions having a pH between 4 to 10, between 5 to 9, or between 6 to 8) and that is preferably capable of binding a nucleic acid or a negatively charged small molecule through electrostatic interactions. Carriers of this class include, but are not limited to a protamine, a histone or histone subunit. Preferably, such a positively charged polypeptide has a net charge of at least 2+, preferably at least 3+, preferably at least 4+, preferably at least 5+, preferably at least 6+ preferably at least 7+, preferably at least 8+, preferably at least 9+, preferably at least 10+, preferably at least 11+, preferably at least 12+, preferably at least 13+, preferably at least 14+, preferably at least 15+, preferably at least 16+, preferably at least 17+, preferably at least 18+, preferably at least 19+, preferably at least 20+. The term positively charged polypeptide may encompass both, a free (i.e. unconjugated) polypeptide, as well as conjugated polypeptides, such as a polypeptide conjugated to a linker.
[0136] A preferred positively charged polypeptide according to the disclosure comprises a protamine. A protamine refers to small, strongly basic proteins, the positively charged amino acid groups of which (especially arginines) are usually arranged in groups and neutralize the negative charges of nucleic acids because of their polycationic nature. The term protamine as used herein are meant to comprise any protamine amino acid sequence obtained or derived from native or biological sources including fragments thereof and multimeric forms of said amino acid sequence or fragment thereof. Protamines may be of natural origin or produced by recombinant methods. Use of recombinant methods allows multiple copies of the protamine to be produced or modifications may be made in the molecular size and amino acid sequence of the protamine. Corresponding compounds may also be chemically synthesized. When an artificial protamine is synthesized, the procedure used may include, for example, replacing amino acid residues which have functions in the natural protamine that are undesirable for the transporting function (e.g., the condensation of DNA) with other suitable amino acids. Generally, a protamine according to the disclosure can be of any species or derived from any species. A protamine of the disclosure can be from a mammal, a bird, an amphibian, a reptile, or a fish. A protamine of the disclosure can be of any species or derived from any species selected from the group consisting of a human, dog, cat, mouse, rat, horse, cattle, pig, goat, chicken, sheep, donkey, rabbit, alpaca, llama, goose, ox, turkey, salmon, or the like, preferably human or salmon. A protamine of the disclosure may also be a mixture of different protamines. Preferred protamines include salmon protamine. Preferred protamines include human protamine. A preferred protamine comprises or preferably consists of a sequence that has at least about 80%, preferably at least about 85%, preferably at least about 90%, preferably at least about 95%, sequence identity to salmon protamine as shown in SEQ ID NO: 53. A preferred protamine comprises or preferably consists of salmon protamine as shown in SEQ ID NO: 53. A preferred protamine comprises or preferably consists of a sequence that has at least about 80%, preferably at least about 85%, preferably at least about 90%, preferably at least about 95%, sequence identity to human protamine 1 as shown in SEQ ID NO: 55. A preferred protamine comprises or preferably consists of human protamine 1 as shown in SEQ ID NO: 55.
[0137] As described above, protamine is a strong positively charged protein that also interacts immediately with negatively charged nucleic acids such as siRNA. Without wishing to be bound by theory it is believed that the uptake of the complex into the cell is mediated via receptor-mediated endocytosis. It is further believed that the antibody binds to the receptor and the nanoparticle is internalized via endocytosis in clathrin coated pits. It is further believed that the vesicles are transported into the cell where the siRNA is released from the nanoparticle and can enter the RNAi pathway.
[0138] A further preferred positively charged polypeptide according to the disclosure comprises a histone or histone subunit. Histones refer to small DNA-binding proteins present in the chromatin having a high pro-portion of positively charged amino acids (lysine and arginine) which enable them to bind to DNA independently of the nucleotide sequence and fold it into nucleosomes. The term histone as used herein are meant to comprise any histone amino acid sequence obtained or derived from native or biological sources including histone subunits, fragments thereof and multimeric forms of said amino acid sequence or fragment thereof. The histones H2, H3 and H4 being particularly suitable. Generally, a histone according to the disclosure can be of any species or derived from any species. A histone of the disclosure can be from a mammal, a bird, an amphibian, a reptile, or a fish. A histone of the disclosure can be of any species or derived from any species selected from the group consisting of a human, dog, cat, mouse, rat, horse, cattle, pig, goat, chicken, sheep, donkey, rabbit, alpaca, llama, goose, ox, turkey, salmon, or the like, preferably human. A histone of the disclosure may also be a mixture of different histones or histone subunits. Preferred histones include a human histone. A preferred histone comprises or preferably consists of a sequence that has at least about 80%, preferably at least about 85%, preferably at least about 90%, preferably at least about 95%, preferably at least about 98%, preferably at least about 99% sequence identity to human histone H2 as shown in SEQ ID NO: 56. A preferred histone comprises or preferably consists of human histone H2 as shown in SEQ ID NO: 56. A preferred histone comprises or preferably consists of a sequence that has at least about 80%, preferably at least about 85%, preferably at least about 90%, preferably at least about 95% sequence identity to the human histone H2 derived peptide as shown in SEQ ID NO: 57. A preferred histone comprises or preferably consists of the human histone H2 derived peptide as shown in SEQ ID NO: 57. A preferred histone comprises or preferably consists of a sequence that has at least about 80%, preferably at least about 85%, preferably at least about 90%, preferably at least about 95% sequence identity to the human histone H2 derived peptide as shown in SEQ ID NO: 58. A preferred histone comprises or preferably consists of the human histone H2 derived peptide as shown in SEQ ID NO: 58.
[0139] A linker as used herein may refers to a crosslinker or cross-linking agent containing at least two functional groups in its free (i.e. unconjugated) form. In one embodiment, the method of the present invention includes cross-linking agents that are homo- or heterobifunctional having functional groups including but not limited to carbodiimide, carbonyl, imidoester, isocynate, maleimide, N-hydroxysuccinimide (NHS)-ester, sulfo-NHS-ester, PFP-ester, hydroxymethyl phosphine, arylazide, pyridyl disulfite, vinyl sulfone. The bonds they produce include, but are not limited to, amide, disulfide, hydrazine, thioether and ester bonds. Functional groups that can be targeted by the linker or cross-linking agent for crosslinking include primary amines, sulhydryls, carbonyls, hydroxyls, carbohydrates, carboxyls and the like, preferably amines and sulfhydryl, most preferably sulfhydryl. Preferably a linker comprises no cleavable disulfide bond (SS). In one embodiment, the linker comprises a pH-depended cleavable side. A linker may be water soluble, cell membrane permeable, of various spacer arm length, be spontaneously reactive or comprise photoreactive groups. Furthermore, the linker may be labeled or tagged.
[0140] In one embodiment, the linker can directly be conjugated with the antibody and the positively charged polypeptide, an example for that is the sulfo-SMCC linker. Examples of cross-linking agents include, but are not limited to N-hydroxysulfosuccinimide (sulfo-NHS), sulfosuccinimidyl(perfluoro-zidobenzamido)ethyl-1,3-dithiopropionate (sulfo-SFAD), succinimidyl 4-formylbenzoate (SFB), succinimidyl 4-hydrazinonicotinate acetone hydrazone (SANH), 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC), N-succinimidyl 3-(2-pyridyldithio)-propionate (SPDP), 2-Iminothiolane (Traut's Reagent), N-succinimidyl (acetylthio)acetate (SATA) and 3[2-py-ridyldithio]propionyl hydrazide (PDPH) or any other linker which is publicly available and known to the person skilled in the art.
[0141] A heterofunctional linker refers a linker, wherein the targeted functional groups are different from each other. In one embodiment, the linker comprises an amine and a sulfhydryl, or an amine and a hydroxyl as functional groups that are targeted for cross-linking, preferably amine and a sulfhydryl. In another embodiment, the method of the present invention includes a linker that comprises an amine and a sulfhydryl as functional groups that are targeted for cross-linking. In another embodiment, the method of the present invention includes a heterobifunctional linker that does not comprise a cleavage site e.g. has no cleavable disulfide bond (SS). Preferred heterofunctional linkers are e.g. -maleimidoacetoxy-succinimide ester (AMAS), N(4-[p-azidosalicylamido]butyl)-3-(2-pyridyldithio) propionamide (APDP*), (-maleimidopropionic acid)hydrazide.Math.TFA (BMPH), (-maleimidopropyloxy)succinimide ester (BMPS), F-maleimidocaproic acid (EMCA), (F-maleimidocaproyloxy)succinimide ester (EMCS), (-maleimidobutyryloxy)succinimide ester (GMBS), -maleimidoundecanoic acid (KMUA), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxy-(6-amidocaproate) (LC-SMCC), succinimidyl-6-(3-[2-pyridyl-dithio]propionamido)hexanoate (LC-SPDP), m-maleimidobenzoyl-N-hydroxysuccinimide ester (IMBS), succinimdyl-3-(bromoacetamido)propionate (SBAP), succinimidyl(4-iodoacetyl)aminobenzoate (SIAB), succinimidyl iodoacetate (SIA), succinimidyl 4-(p-maleimido-phenyl)butyrate (SMPB), NHS-PEG24-maleimide SM(PEG24), NHS-PEG12-maliemide (SM[PEG]12), NHS-PEG8-maliemide (SM[PEG]8), NHS-PEG6-maleimide (SM(PEG)6), NHS-PEG4-maliemide (SM[PEG]4), NHS-PEG2-maliemide (SM[PEG]2), succinimidyl 4-(N-maleimido-methyl)cyclohexane-carboxylate (SMCC), succinimidyl iodoacetate (SIA), succinimidyl(4-iodoacetyl)aminobenzoate (SIAB), (s-maleimidocaproyloxy)sulfosuccinimide ester (sulfo-EMCS),-succinimidyl-3-(2-pyridyldithio)propionate (SPDP), succinimidyl-6-(-maleimidopropionamido)hexanoate (SMPH), N-(-maleimidobutryloxy)sulfosuccinimide ester (sulfo-GMBS),-(-maleimidoundecanoyloxy)sulfosuccinimide ester (sulfo-KMUS), sulfosuccinimidyl 6-(-methyl--[2-pyridyldithio]-toluamido)hexanoate (sulfo-LC-SMPT), sulfosuccinimidyl 6-(3-[2-pyridyl-dithio]propionamido)hexanoate (sulfo-LC-SPDP), maleimidobenzoyl-hydroxysulfosuccinimide ester (sulfo-MBS), sulfosuccinimidyl(4-iodo-acetyl)aminobenzoate (Sulfo-SIAB), sulfosuccinimidyl 4-(N-maleimido methyl)cyclohexane-1-carboxylate (sulfo-SMCC), sulfosuccinimidyl 4-(p-maleimidophenyl)butyrate (sulfo-SMPB) N,N-Dicyclohexylcarbodiimide (DCC), 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC), sulfo-NHS-(2-6-[Biotinamido]-2-(p-azidobezamido) (sulfo-SBED). A heterobifunctional linker is preferred in the methods of the present invention.
[0142] In some embodiments, the method of the present invention includes a heterobifunctional linker that is sulfo-SMCC.
[0143] A unconjugated bifunctional linker as used herein refers to a bifunctional linker, in which both functional groups are unconjugated. In some embodiment, an unconjugated bifunctional linker is not conjugated to a positively charged polypeptide. In some embodiments, an unconjugated bifunctional linker is not conjugated to an antibody.
[0144] The term essentially free of unconjugated bifunctional linker as used herein means that, while it is preferred that no unconjugated bifunctional linker be present in the composition, it is possible to have very small amounts of unconjugated bifunctional linker in the composition according to the disclosure, preferably provided that these amounts do not materially affect the advantageous utilization of such a composition. In some embodiments, a composition comprising a first conjugate that is essentially free of unconjugated linker comprises at least about 10-fold more first conjugate molecules than unconjugated linker molecules. Accordingly, a first conjugate that is essentially free of unconjugated linker preferably has a molar ratio of first conjugate to unconjugated linker that is about 10:1 or more, preferably about 20:1 or more, preferably about 50:1 or more, preferably about 100:1 or more, preferably about 200:1 or more, preferably about 500:1 or more, preferably about 1000:1 or more, preferably about 2000:1 or more, preferably about 5000:1 or more, preferably about 10000:1 or more. In some embodiments, a composition that originally comprised first conjugates and an unconjugated bifunctional linkers, which has undergone a purification step that is capable of completely or partially removing unconjugated bifunctional linkers, such as a desalting step, is considered to be a composition that is essentially free of unconjugated bifunctional linker.
[0145] The definition of the term antibody includes embodiments such as monoclonal, chimeric, single chain, humanized and human antibodies. In addition to full-length antibodies, the definition also includes antibody derivatives and antibody fragments, like, inter alia, Fab fragments. Antibody fragments or derivatives further comprise F(ab)2, Fv, scFv fragments or single domain antibodies such as domain antibodies or nanobodies, single variable domain antibodies or immunoglobulin single variable domain comprising merely one variable domain, which might be VHH, VH or VL, that specifically bind an antigen or epitope independently of other V regions or domains. Said term also includes diabodies or Dual-Affinity Re-Targeting (DART) antibodies. Further envisaged are (bispecific) single chain diabody, tandem diabody (Tandab), minibodies exemplified by a structure which is as follows: (VH-VL-CH3).sub.2, (scFv-CH3).sub.2 or (scFv-CH3-scFv).sub.2, Fc DART and IgG DART, multibodies such as triabodies. Immunoglobulin single variable domains encompass not only an isolated antibody single variable domain polypeptide, but also larger polypeptides that comprise one or more monomers of an antibody single variable domain polypeptide sequence.
[0146] Furthermore, the term antibody as employed herein also relates to derivatives or variants of the antibodies described herein which display the same specificity as the described antibodies. Examples of antibody variants include humanized variants of non-human antibodies, affinity matured antibodies and antibody mutants with altered effector function(s) (see, e.g., U.S. Pat. No. 5,648,260).
[0147] The term antibody also comprises immunoglobulins (Ig's) of different classes (i.e. IgA, IgG, IgM, IgD and IgE) and subclasses (such as IgG1, IgG2 etc.). Derivatives of antibodies, which also fall under the definition of the term antibody in the meaning of the invention, include modifications of such molecules as for example glycosylation, acetylation, phosphorylation, disulfide bond formation, farnesylation, hydroxylation, methylation or esterification.
[0148] A functional fragment of an antibody includes the domain of a F(ab)2 fragment, a Fab fragment, scFv or constructs comprising single immunoglobulin variable domains or single domain antibody polypeptides, e.g. single heavy chain variable domains or single light chain variable domains as well as other antibody fragments as described herein above. The F(ab).sub.2 or Fab may be engineered to minimize or completely remove the intermolecular disulphide interactions that occur between the CH1 and CL domains.
[0149] The term human antibody as used herein is to be understood as meaning that the antibody or its functional fragment, comprises (an) amino acid sequence(s) contained in the human germline antibody repertoire. For the purposes of definition herein, an antibody, or its fragment, may therefore be considered human if it consists of such (a) human germline amino acid sequence(s), i.e. if the amino acid sequence(s) of the antibody in question or functional fragment thereof is (are) identical to (an) expressed human germline amino acid sequence(s). An antibody or functional fragment thereof may also be regarded as human if it consists of (a) sequence(s) that deviate(s) from its (their) closest human germline sequence(s) by no more than would be expected due to the imprint of somatic hypermutation. Additionally, the antibodies of many non-human mammals, for example rodents such as mice and rats, comprise VH CDR3 amino acid sequences which one may expect to exist in the expressed human antibody repertoire as well. Any such sequence(s) of human or non-human origin which may be expected to exist in the expressed human repertoire would also be considered human for the purposes of the present invention. The term human antibody hence includes antibodies having variable and constant regions corresponding substantially to human germline immunoglobulin sequences known in the art, including, for example, those described by Kabat et al (Kabat et al., (1991) Sequences of Proteins of Immunological Interest, 5th Ed., National Institutes of Health).
[0150] The human antibodies of the disclosure may include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo), for example in the CDRs, and in particular, CDR3. The human antibody can have at least one, two, three, four, five, or more positions replaced with an amino acid residue that is not encoded by the human germline immunoglobulin sequence.
[0151] The non-human and human antibodies or functional fragments thereof are preferably monoclonal. It is particularly difficult to prepare human antibodies which are monoclonal. In contrast to fusions of murine B cells with immortalized cell lines, fusions of human B cells with immortalized cell lines are not viable. Thus, the human monoclonal antibodies are the result of overcoming significant technical hurdles generally acknowledged to exist in the field of antibody technology. The monoclonal nature of the antibodies makes them particularly well suited for use as therapeutic agents, since such antibodies will exist as a single, homogeneous molecular species which can be well-characterized and reproducibly made and purified. These factors result in products whose biological activities can be predicted with a high level of precision, very important if such molecules are going to gain regulatory approval for therapeutic administration in humans. The term monoclonal antibody as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations and/or post-translation modifications (e.g., isomerizations, amidations) that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. Furthermore, in contrast to conventional (polyclonal) antibody preparations which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen. In addition to their specificity, the monoclonal antibodies are advantageous in that they are synthesized by the hybridoma culture, uncontaminated by other immunoglobulins. The modifier monoclonal indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method. For example, the monoclonal antibodies to be used in accordance with the present invention may be made by the hybridoma method first described by Kohler et al., Nature, 256: 495 (1975), or may be made by recombinant DNA methods (see, e.g., U.S. Pat. No. 4,816,567). The monoclonal antibodies may also be isolated from phage antibody libraries using the techniques described in Clackson et al., Nature, 352: 624-628 (1991) and Marks et al., J. Mol. Biol., 222: 581-597 (1991), for example.
[0152] It is especially preferred that the monoclonal antibodies or corresponding functional fragments be human antibodies or corresponding functional fragments. In contemplating antibody agents intended for therapeutic administration to humans, it is highly advantageous that the antibodies are of human origin. Following administration to a human patient, a human antibody or functional fragment thereof will most probably not elicit a strong immunogenic response by the patient's immune system, i.e. will not be recognized as being a foreign that is non-human protein. This means that no host, i.e. patient, antibodies will be generated against the therapeutic antibody which would otherwise block the therapeutic antibody's activity and/or accelerate the therapeutic antibody's elimination from the body of the patient, thus preventing it from exerting its desired therapeutic effect.
[0153] According to a further embodiment of the invention, the antibody may be an immunoglobulin. According to a further embodiment of the invention, the antibody may be an IgG antibody. An IgG isotype comprises not only the variable antibody regions of the heavy and light chains responsible for the highly discriminative antigen recognition and binding, but also the constant regions of the heavy and light antibody polypeptide chains normally present in naturally produced antibodies and, in some cases, even modification at one or more sites with carbohydrates. Such glycosylation is generally a hallmark of the IgG format, and located in the constant regions comprising the so called Fc region of a full antibody which is known to elicit various effector functions in vivo. In addition, the Fc region mediates binding of IgG to Fc receptor, as well as facilitating homing of the IgG to locations with increased Fc receptor presenceinflamed tissue, for example. Advantageously, the IgG antibody is an IgG1 antibody or an IgG4 antibody, formats which are preferred since their mechanism of action in vivo is particularly well understood and characterized. This is especially the case for IgG1 antibodies.
[0154] According to a further embodiment of the invention, the functional fragment of the antibody may preferably be an scFv, a single domain antibody, an Fv, a VHH antibody, a diabody, a tandem diabody, a Fab, a Fab or a F(ab)2. These formats may generally be divided into two subclasses, namely those which consist of a single polypeptide chain, and those which comprise at least two polypeptide chains. Members of the former subclass include a scFv (comprising one VH region and one VL region joined into a single polypeptide chain via a polypeptide linker); a single domain antibody (comprising a single antibody variable region) such as a VHH antibody (comprising a single VH region). Members of the latter subclass include an Fv (comprising one VH region and one VL region as separate polypeptide chains which are non-covalently associated with one another); a diabody (comprising two non-covalently associated polypeptide chains, each of which comprises two antibody variable regionsnormally one VH and one VL per polypeptide chainthe two polypeptide chains being arranged in a head-to-tail conformation so that a bivalent antibody molecule results); a tandem diabody (bispecific single-chain Fv antibodies comprising four covalently linked immunoglobulin variableVH and VLregions of two different specificities, forming a homodimer that is twice as large as the diabody described above); a Fab (comprising as one polypeptide chain an entire antibody light chain, itself comprising a VL region and the entire light chain constant region and, as another polypeptide chain, a part of an antibody heavy chain comprising a complete VH region and part of the heavy chain constant region, said two polypeptide chains being intermolecularly connected via an interchain disulfide bond); a Fab (as a Fab, above, except with additional reduced disulfide bonds comprised on the antibody heavy chain); and a F(ab)2 (comprising two Fab molecules, each Fab molecule being linked to the respective other Fab molecule via interchain disulfide bonds). In general, functional antibody fragments of the type described hereinabove allow great flexibility in tailoring, for example, the pharmacokinetic properties of an antibody desired for therapeutic administration to the particular exigencies at hand. For example, it may be desirable to reduce the size of the antibody administered in order to increase the degree of tissue penetration when treating tissues known to be poorly vascularized (for example, joints). Under some circumstances, it may also be desirable to increase the rate at which the therapeutic antibody is eliminated from the body, said rate generally being accelerable by decreasing the size of the antibody administered. An antibody fragment is defined as a functional antibody fragment in the context of the invention as long as the fragment maintains the specific binding characteristics for the epitope/target of the parent antibody, e.g. as long as it specifically binds to CD33, EGFR, IGF1R, or CD20, or antibodies targeted to other cell surface structures a with the ability to internalize upon antibody binding.
[0155] According to a further embodiment of the invention, said antibody may comprise a CL domain. According to a further embodiment of the invention, said antibody may comprise a CH1 domain. According to a further embodiment of the invention, said antibody may comprise a CH2 domain. According to a further embodiment of the invention, said antibody may comprise a CH3 domain. According to a further embodiment of the invention, said antibody may comprise an entire light chain. According to a further embodiment of the invention, said antibody may comprise an entire heavy chain.
[0156] According to a further embodiment of the invention, said antibody or functional fragment thereof may be present in monovalent monospecific; multivalent monospecific, in particular bivalent monospecific; or multivalent multispecific, in particular bivalent bispecific forms. In general, a multivalent monospecific, in particular bivalent monospecific antibody such as a full human IgG as described hereinabove may bring with it the therapeutic advantage that the neutralization effected by such an antibody is potentiated by avidity effects, i.e. binding by the same antibody to multiple molecules of the same antigen, here e.g. CD33, EGFR, IGF1R, or CD20. Several monovalent monospecific forms of fragments of antibodies have been described above (for example, a scFv, an Fv, a VHH or a single domain antibody).
[0157] The antibodies or functional fragments thereof may be derivatized, for example with an organic polymer, for example with one or more molecules of polyethylene glycol (PEG) and/or polyvinyl pyrrolidone (PVP). As is known in the art, such derivatization can be advantageous in modulating the pharmacodynamic properties of antibodies or functional fragments thereof. Especially preferred are PEG molecules derivatized as PEG-maleimide, enabling conjugation with the antibody or functional fragment thereof in a site-specific manner via the sulfhydryl group of a cysteine amino acid. Of these, especially preferred are 20 kD and/or 40 kD PEG-maleimide, in either branched or straight-chain form. It may be especially advantageous to increase the effective molecular weight of smaller human antibody fragments such as scFv fragments by coupling the latter to one or more molecules of PEG, especially PEG-maleimide.
[0158] The antibodies of the present disclosure also include chimeric antibodies (immunoglobulins) in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is(are) identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (U.S. Pat. No. 4,816,567; Morrison et al., Proc. Natl. Acad. Sci. USA, 81: 6851-6855 (1984)). Chimeric antibodies of interest herein include primitized antibodies comprising variable domain antigen-binding sequences derived from a non-human primate (e.g., Old World Monkey, Ape etc.) and human constant region sequences.
[0159] Humanized forms of non-human (e.g., murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab, F(ab)2 or other antigen-binding subsequences of antibodies) of mostly human sequences, which contain minimal sequence derived from non-human immunoglobulin. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a hypervariable region (also CDR) of the recipient are replaced by residues from a hypervariable region of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity, and capacity. In some instances, Fv framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, humanized antibodies as used herein may also comprise residues which are found neither in the recipient antibody nor the donor antibody. These modifications are made to further refine and optimize antibody performance. The humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. For further details, see Jones et al., Nature, 321: 522-525 (1986); Reichmann et al., Nature, 332: 323-329 (1988); and Presta, Curr. Op. Struct. Biol., 2: 593-596 (1992).
[0160] Preferred antibodies are those which bind a cell surface molecule, preferably a cell surface domain, which is preferably internalized in a receptor-dependent manner, e.g. anti-CD33 antibodies, anti-EGFR antibodies, anti-IGF1R antibodies, or anti-CD20 antibodies. A preferred antibody is selected from the group consisting of cetuximab, gemtuzumab, cixutumumab, teprotumumab, GR11L, and rituximab. Further antibodies that bind cell surface domains and are internalized in a receptor-dependent manner are disclosed in LU 92353 A, which is incorporated by reference.
[0161] A preferred antibody, comprises a VH domain comprising the following three heavy chain CDRs and a VL domain comprising the following three light chain CDRs: a CDR-H1 having the sequence GFSLTNYG (SEQ ID NO: 1), a CDR-H2 having the sequence IWSGGNT (SEQ ID NO: 2), a CDR-H3 having the sequence ARALTYYDYEFAY (SEQ ID NO: 3), a CDR-L1 having the sequence QSIGTN (SEQ ID NO: 4), a CDR-L2 having the sequence YAS, and a CDR-L3 having the sequence QQNNNWPTT (SEQ ID NO: 5). A preferred antibody comprises a VH domain having the sequence set forth in SEQ ID NO 6 and a VL domain having a sequence set forth in SEQ ID NO: 7. A preferred antibody comprises a heavy chain having the sequence set forth in SEQ ID NO: 8 and a light chain having the sequence set forth in SEQ ID NO: 9.
[0162] A preferred antibody, comprises a VH domain comprising the following three heavy chain CDRs and a VL domain comprising the following three light chain CDRs: a CDR-H1 having the sequence GYTITDSN (SEQ ID NO: 10), a CDR-H2 having the sequence IYPYNGGT (SEQ ID NO: 11), a CDR-H3 having the sequence VNGNPWLAY (SEQ ID NO: 12), a CDR-L1 having the sequence ESLDNYGIRF (SEQ ID NO: 13), a CDR-L2 having the sequence AAS, and a CDR-L3 having the sequence QQTKEVPWS (SEQ ID NO: 14). A preferred antibody comprises a VH domain having the sequence set forth in SEQ ID NO 15 and a VL domain having a sequence set forth in SEQ ID NO: 16. A preferred antibody comprises a heavy chain having the sequence set forth in SEQ ID NO: 17 and a light chain having the sequence set forth in SEQ ID NO: 18. A preferred antibody comprises a heavy chain having the sequence set forth in SEQ ID NO: 65 and a light chain having the sequence set forth in SEQ ID NO: 18.
[0163] A preferred antibody, comprises a VH domain comprising the following three heavy chain CDRs and a VL domain comprising the following three light chain CDRs: a CDR-H1 having the sequence GGTFSSYAIS (SEQ ID NO: 19), a CDR-H2 having the sequence GIIPIFGTANYAQKFQ (SEQ ID NO: 20), a CDR-H3 having the sequence APLRFLEWSTQDHYYYYYMDV (SEQ ID NO: 21), a CDR-L1 having the sequence QGDSLRSYYAT (SEQ ID NO: 22), a CDR-L2 having the sequence GENKRPS (SEQ ID NO: 23), and a CDR-L3 having the sequence KSRDGSGQHLV (SEQ ID NO: 24). A preferred antibody comprises a VH domain having the sequence set forth in SEQ ID NO 25 and a VL domain having a sequence set forth in SEQ ID NO: 26. A preferred antibody comprises a heavy chain having the sequence set forth in SEQ ID NO: 27 and a light chain having the sequence set forth in SEQ ID NO: 28.
[0164] A preferred antibody comprises a VH domain comprising the following three heavy chain CDRs and a VL domain comprising the following three light chain CDRs: a CDR-H1 having the sequence GFTFSSYG (SEQ ID NO: 29), a CDR-H2 having the sequence IWFDGSST (SEQ ID NO: 30), a CDR-H3 having the sequence ARELGRRYFDL (SEQ ID NO: 31), a CDR-L1 having the sequence QSVSSY (SEQ ID NO: 32), a CDR-L2 having the sequence IWFDGSST (SEQ ID NO: 33), and a CDR-L3 having the sequence QQRSKWPPWT (SEQ ID NO: 34). A preferred antibody comprises a VH domain having the sequence set forth in SEQ ID NO 35 and a VL domain having a sequence set forth in SEQ ID NO: 36. A preferred antibody comprises a heavy chain having the sequence set forth in SEQ ID NO: 37 and a light chain having the sequence set forth in SEQ ID NO: 38.
[0165] A preferred antibody comprises a VH domain comprising the following three heavy chain CDRs and a VL domain comprising the following three light chain CDRs: a CDR-H1 having the sequence GYTFTSYN (SEQ ID NO: 39), a CDR-H2 having the sequence IYPGNGDT (SEQ ID NO: 40), a CDR-H3 having the sequence CARSTYYGGDWYFNV (SEQ ID NO: 41), a CDR-L1 having the sequence SSVSYI (SEQ ID NO: 42), a CDR-L2 having the sequence ATS, and a CDR-L3 having the sequence QQWTSNPPT (SEQ ID NO: 43). A preferred antibody comprises a VH domain having the sequence set forth in SEQ ID NO 44 and a VL domain having a sequence set forth in SEQ ID NO: 45. A preferred antibody comprises a heavy chain having the sequence set forth in SEQ ID NO: 46 and a light chain having the sequence set forth in SEQ ID NO: 47.
[0166] A cell surface domain as used herein means any protein on the cell surface. The cell surface domain also includes a cell surface antigen. It additionally includes any epitope that can be recognized on the cell surface of a cell. Preferably, the epitope or protein is cell type-specific as it only is present in a certain cell type. In one embodiment, the cell surface domain is present on a cancer cell. Potential cell surface targets include CD19, CD20, CD22, CD25, CD30, CD33, CD40, CD56, CD64, CD70, CD74, CD79, CD105, CD138, CD174, CD205, CD227, CD326, CD340, MUC16, GPNMB, PSMA, Cripto, ED-B, TMEFF2, EphB2, EphA2, FAP Av, integrin, Mesothelin, EGFR, TAG-72, GD2, CAIX and/or 5T4. Other potential cell surface domains include CD52, CD3, CD117, CD99, CD34, CD44, CD117, CA15-3, CA-125, CA27-29, EpCAM, Carcinoembryonic antigen, melanoma antigen recognized by T-cells 1 (MART1), trophoblast glycoprotein (TPBG). A cell surface molecule according to the invention is one that is preferably expressed on a cell which is susceptible to therapeutic treatment by the negatively charged molecule.
[0167] Preferably such a cell surface domain is CD33, EGFR, IGF1R, CD20. The cell surface domain can also provide for an epitope to which an antibody in accordance with the present invention can bind.
[0168] In line with the above, the term epitope defines an antigenic determinant, which is specifically bound/identified by an antibody as defined herein. The antibody may specifically bind to/interact with conformational or continuous epitopes, which are unique for the target structure.
[0169] In preferred embodiment, the antibody of the disclosure is specific for a cancer associated antigen. As used herein, cancer associated antigen or tumor associated antigen, which can be used interchangeably herein, generally refers to any antigen that is associated with cancer or tumor cells, ie, occurs to the same or a greater extent compared to normal cells. Such antigens can be relatively tumor specific and their expression on the surface of malignant cells is limited, but they can also be found in non-malignant cells. In one embodiment, the antibody of the disclosure binds to a cancer-associated antigen.
[0170] The term internalized as used in the present invention means endocytosis, in which molecules such as proteins are engulfed by the cell membrane and drawn into the cell. In particular, the cell surface domain to which the binding domain binds is internalized. A method of how this internalization can be measured is disclosed in the examples of the present application. Otherwise, for example such a process may be observed by time-laps microscopy, where the receptor of interest and the cell membrane are double stained. Preferably, the nanoparticle comprising an antibody capable of binding to a cell surface molecule is internalized upon binding to the cell surface molecule.
[0171] A second conjugate (B) as used herein refers to a conjugate comprising or preferably consisting of an antibody disclosed herein, a positively charged polypeptide disclosed herein and preferably a bifunctional linker disclosed herein. Here, the positively charged polypeptide and the antibody are preferably interconnected via the bifunctional linker.
[0172] The term negatively charged molecule refers to a molecule having a net positive charge at or near physiological pH (e.g., in solutions having a pH between 4 to 10, between 5 to 9, or between 6 to 8) and that is preferably capable of binding a positively charged polypeptide, such as a protamine or a histone through electrostatic interactions. Preferred negatively charged molecules are nucleic acids and negatively charged small molecules. Preferably, such a negatively charged molecule has a net charge of at least 2, preferably at least 3, preferably at least 4, preferably at least 5, preferably at least 6, preferably at least 7, preferably at least 8, preferably at least 9, or preferably at least 10.
[0173] When referred to herein the terms nucleotide sequence(s), polynucleotide(s), nucleic acid(s), nucleic acid molecule are used interchangeably and refer to nucleotides, either ribonucleotides or deoxyribonucleotides or a combination of both, in a polymeric unbranched form of any length. Nucleic acid sequences include DNA, cDNA, genomic DNA, RNA such as e.g. mRNA, siRNA, synthetic forms and mixed polymers, both sense and antisense strands, or may contain non-natural or derivatives nucleotide bases, as will be readily appreciated by those skilled in the art. Further, non-limiting examples of such nucleic acids include but are not limited to any type of RNA interfering (RNAi), whether single stranded or double stranded, that perform gene cessation and/or gene knockdown, including gene knockdown of message (mRNA) by degradation or translational arrest of the mRNA, inhibition of tRNA and rRNA functions or epigenetic effects; short (or small) interfering RNA (siRNA), short hairpin RNA (shRNA), endoribonuclease-prepared siRNAs (esiRNA), antisense oligonucleotides, microRNA and non-coding RNA or the like, short RNAs activity on DNA, and Dicer-substrate siRNAs. Preferred nucleic acids are siRNA, esiRNA antisense oligonucleotides, or miRNA, with siRNA being most preferred. In some embodiments, a nucleic acid has about 18 to about 25 bp, preferably if the nucleic acid is double stranded. In some embodiments, a nucleic acid has about 18 to about 25 nt, preferably if the nucleic acid is single stranded.
[0174] The nucleic acid utilized by the present invention effects a target cell. E.g. via provision of the nucleic acid molecule the expression of a specific molecule or protein is reduced or increased in a target cell. Preferably, the expression of a specific molecule protein is reduced by utilization of a nucleic acid molecule.
[0175] The nucleic acids according to the disclosure include siRNA molecules that are designed to target and suppress or block the expression of a gene or protein associated with cancer or is involved in the development and/or progression of cancer.
[0176] Preferred nucleic acid molecules are selected from siRNA, esiRNA, antisense oligonucleotides, or miRNA that is/are preferably specific for KRAS, BRAF, PIK3CA, PAX3-FKHR, EWS-FLI1, c-MYC, TP53, DNMT3A, IDH1, NPM1, or FLT3. Even more preferred is a siRNA specific for KRAS, BRAF, PIK3CA, PAX3-FKHR, EWS-FLI1, c-MYC, TP53, DNMT3A, IDH1, NPM1, or FLT3. Such siRNA are known to the skilled person and illustrative examples for such siRNA are shown in the following table.
TABLE-US-00001 Target siRNAsequence KRAS UUCUGCUUGUGACAUUAAAAA (SEQIDNO:59) PIK3CA AAACUUGGCUGAAGUUUAAAA (SEQIDNO:60) PAX3-FKHR UGAAUUCUGAGGUGAGAGGCTT (SEQIDNO:61) EWS-FLI1 GGCAGCAGAACCCUUCUUAUU (SEQIDNO:62) c-MYC ACACAAACUUGAACAGCUATT (SEQIDNO:63) TP53 GAAAUGUUCUUGCAGUUAATT (SEQIDNO:64)
[0177] Preferred nucleic acids of the disclosure also include a mixture of different siRNA that are directed against one or more targets, preferably one target. For example, nucleic acids of the disclosure may comprise a mixture of siRNA that are specific for a target selected from the group consisting of KRAS, BRAF, PIK3CA, PAX3-FKHR, EWS-FLI1, c-MYC, TP53, DNMT3A, IDH1, NPM1, and FLT3.
[0178] A negatively charged molecule according to the invention may also be a molecule that is not a nucleic acid. Such a molecule may be a small molecule, or preferably, a small organic molecule. A negatively charged molecule may have a molecular weight of about 20 kDa or less, preferably about 15 kDa or less, or about 10 kDa or less. A negatively charged molecule may also have a molecular weight of about 9 kDa or less, about 8 kDa or less, about 7 kDa or less, about 6 kDa or less, about 5 kDa or less, about 4 kDa or less, about 3 kDa or less, or about 2 kDa or less. As an illustrative example, the negatively charged molecule can be a drug and/or prodrug. The drug and/or prodrug can be conjugated with a negatively charged moiety. For example, the drug may be ibrutinib that is conjugated to a negatively charged moiety, e.g. Cy 3.5 or Alexa488. However, the drug may also be conjugated to another negatively charged moieties. Suitable negatively charged moieties for conjugation are known to the skilled person. Illustrative examples of suitable negatively charged moieties include (poly)sulfonated aryls (e.g. as co-ligands for transition metals), (poly)sulfonated dyes (e.g. canine dyes), mono/di/triphosphates, (poly)sulfates of monosaccharides or branched oligosaccharides, oligopeptides from glutamic or aspartic acid. The drug and/or prodrug can have a negative net charge without being conjugated to any additional moiety. As an illustrative example, a drug having a negative net charge is remdesivir triphosphate. The skilled person will understand that the aforementioned examples are for illustration purposes only and that many other negatively charged molecules can be used within the context of the present invention.
[0179] As used herein ibrutinib (IUPAC name: 1-[(3R)-3-[4-amino-3-(4-phenoxyphenyl)pyrazolo[3,4-d]pyrimidin-1-yl]piperidin-1-yl]prop-2-en-1-one, CAS number: 936563-96-1) relates to a molecule having (in its free form) the following structure.
##STR00001##
[0180] As used herein remdesivir triphosphate (IUPAC name [[(2R,3S,4R,5R)-5-(4-aminopyrrolo[2,1-f][1,2,4]triazin-7-yl)-5-cyano-3,4-dihydroxyoxolan-2-yl]methoxy-hydroxyphosphoryl] phosphono hydrogen phosphate, CAS number: 1355149-45-9) relates to a molecule having the following structure.
##STR00002##
[0181] The present application also relates to a nanoparticle. Such a nanoparticle is preferably obtainable by a method described herein. A nanoparticle of the invention may comprise (a) a positively charged polypeptide, preferably as disclosed herein; (b) a second conjugate (B), the second conjugate comprising an antibody conjugated to a positively charged polypeptide preferably via a bifunctional linker; and (c) one or more negatively charged molecules, preferably as disclosed herein.
[0182] Without wishing to be bound by theory, it is believed that the positively charged polypeptide, the second conjugate, and the one or more negatively charged molecule(s), are not homogeneously distributed within the particle. Instead, in some embodiments, the second conjugate is enriched in the outer portion of the nanoparticle. In some embodiments, the one or more negatively charged molecule(s) is/are enriched in the inner portion of the nanoparticle. In some embodiments, the positively charged polypeptide is enriched in the outer portion of the nanoparticle. In some embodiments, the positively charged polypeptide is enriched in the inner portion of the nanoparticle. Thus, the nanoparticle of the invention may form a vesicle-like structure, in which the second conjugate is predominantly present in the outer portion, while the negatively charged molecule is enriched or encapsulated in the inner portion of the nanoparticle. Without wishing to be bound by theory, it is believed that such a structure protects the negatively charged molecules and thus increase their stability. It is further believed that at least a part or even the entire nanoparticle can be internalized upon binding to a cell via the second conjugate.
[0183] In some embodiment, the nanoparticles of the disclosure have a mean diameter that is at least about 0.05 m. In some embodiment, the nanoparticles of the disclosure have a mean diameter that is at least about 0.1 m. In some embodiment, the mean diameter of the nanoparticle is at least about 0.2 m. In some embodiments, the nanoparticles of the disclosure have a mean diameter in the range from about 0.05 m to about 10 m, preferably from about 0.1 m to about 10 m, preferably from about 0.2 m to about 5 m. The mean diameter of the nanoparticles of the disclosure may also be in a range of about 0.3 m to about 4 m, about 0.4 m to about 3 m, or about 0.5 m to about 2 m. The mean diameter of the nanoparticles may be determined by any method suitable for the determination of particle sizes, including dynamic light scattering and microscopic analysis. The preferred method for the determination of particle sizes is by microscopic analysis, preferably by transmission light microscopy.
[0184] The present invention further relates to a composition comprising the nanoparticle of the invention and/or the nanoparticle obtainable by the method of the present invention.
[0185] The present invention further relates to a pharmaceutical composition comprising the nanoparticle of the present invention and/or the nanoparticle obtainable by the method of the present invention.
[0186] In a composition of the disclosure, including a pharmaceutical composition of the disclosure, at least about 10% of the second conjugates that are comprised in the composition may be comprised in a nanoparticle. In preferred embodiments, at least 20%, preferably at least 30%, preferably at least 40%, preferably at least 50%, preferably at least 60%, preferably at least 70%, preferably at least 80%, preferably at least 90%, preferably at least 95%, preferably at least 98%, preferably at least 99% of the second conjugates that are comprised in the composition are comprised in a nanoparticle. In preferred embodiments, the composition is essentially free of second conjugates that are not comprised in a nanoparticle.
[0187] In a composition of the disclosure, including a pharmaceutical composition of the disclosure, at least about 10% of the positively charged polypeptides that are comprised in the composition may be comprised in a nanoparticle. In preferred embodiments, at least 20%, preferably at least 30%, preferably at least 40%, preferably at least 50%, preferably at least 60%, preferably at least 70%, preferably at least 80%, preferably at least 90%, preferably at least 95%, preferably at least 98%, preferably at least 99% of the positively charged polypeptides that are comprised in the composition are comprised in a nanoparticle. In preferred embodiments, the composition is essentially free of positively charged polypeptides that are not comprised in a nanoparticle.
[0188] In a composition of the disclosure, including a pharmaceutical composition of the disclosure, at least about 10% of the negatively charged molecule that are comprised in the composition may be comprised in a nanoparticle. In preferred embodiments, at least 20%, preferably at least 30%, preferably at least 40%, preferably at least 50%, preferably at least 60%, preferably at least 70%, preferably at least 80%, preferably at least 90%, preferably at least 95%, preferably at least 98%, preferably at least 99% of the negatively charged molecule that are comprised in the composition are comprised in a nanoparticle. In preferred embodiments, the composition is essentially free of negatively charged molecules that are not comprised in a nanoparticle.
[0189] The term pharmaceutical composition relates to a composition for administration to a patient, preferably a human patient. Pharmaceutical compositions or formulations are usually in such a form as to allow the biological activity of the active ingredient to be effective and may therefore be administered to a subject for therapeutic use as described herein. Usually, a pharmaceutical composition comprises suitable (i.e. pharmaceutically acceptable) formulations of carriers, stabilizers and/or excipients. Examples of suitable pharmaceutical carriers are described in Remington's Pharmaceutical Sciences by E. W. Martin. Such compositions will contain a therapeutically effective amount of the aforementioned molecules, preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the patient. The formulation should suit the mode of administration.
[0190] In one embodiment, the pharmaceutical composition is a composition for parenteral, trans-dermal, intra-luminal, intra-arterial, intrathecal and/or intranasal administration or for direct injection into tissue. It is in particular envisaged that said composition is administered to a patient via infusion or injection. Administration of the suitable compositions may be effected by different ways, e.g., by intravenous, intra-peritoneal, subcutaneous, intra-muscular, topical or intra-dermal administration. The composition of the present invention may further comprise a pharmaceutically acceptable carrier. Examples of suitable pharmaceutical carriers are well known in the art and include buffered saline solutions, water, emulsions, such as oil/water emulsions, various types of wetting agents, sterile solutions, liposomes, etc. Compositions comprising such carriers can be formulated by well-known conventional methods.
[0191] In accordance with the present embodiments, the term therapeutically effective amount refers to an amount of the molecules of the present invention and/or the molecule obtainable by the method of the present invention that is effective for the treatment of diseases associated with cancer. Preferred dosages and preferred methods of administration are such that after administration the molecules of the present invention and/or the molecule obtainable by the method of the present invention is present in the blood in effective dosages. The administration schedule can be adjusted by observing the disease conditions and analysing serum levels of the molecule decreasing the expression of target molecules in laboratory tests followed by either extending the administration interval e.g. from twice per week or once per week to once per two weeks, once per three weeks, once per four weeks, and the like, or, alternatively, reducing the administration interval correspondingly. In the case of cancer, the therapeutically effective amount of the molecules or compositions disclosed herein may reduce the number of cancer cells; reduce the tumor size; inhibit (i.e., slow and/or stop) cancer cell infiltration into peripheral organs; inhibit (i.e., slow and/or stop) tumor metastasis; inhibit tumor growth; and/or relieve one or more of the symptoms associated with the cancer.
[0192] In another embodiment, the pharmaceutical composition is suitable to be administered in combination with an additional drug, i.e. as part of a co-therapy. In said co-therapy, an active agent may be optionally included in the same pharmaceutical composition as the molecule of the invention, or may be included in a separate pharmaceutical composition. In this latter case, said separate pharmaceutical composition is suitable for administration prior to, simultaneously as or following administration of said pharmaceutical composition comprising the molecule of the invention. The additional drug or pharmaceutical composition may be a non-proteinaceous compound or a proteinaceous compound. In the case that the additional drug is a proteinaceous compound, it is advantageous that the proteinaceous compound be capable of providing an activation signal for immune effector cells. Preferably, said proteinaceous compound or non-proteinaceous compound may be administered simultaneously or non-simultaneously with the molecule (or preparation) of the invention as defined hereinabove, a vector as defined hereinabove, or a host as defined hereinabove.
[0193] The pharmaceutical compositions can be administered to the subject at a suitable dose. The dosage regimen will be determined by the attending physician and by clinical factors. As is well known in the medical arts, dosages for any one patient depend upon many factors, including the patient's size, body surface area, age, the particular compound to be administered, sex, time and route of administration, general health, and other drugs being administered concurrently.
[0194] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, inert gases and the like. In addition, the pharmaceutical composition in accordance with the present invention might comprise proteinaceous carriers, like, e.g., serum albumin or immunoglobulin, preferably of human origin. It is envisaged that the pharmaceutical composition in accordance with the invention might comprise, in addition to the above described molecules further biologically active agents, depending on the intended use of the pharmaceutical composition. Such agents might be drugs acting on the gastro-intestinal system, drugs acting as cytostatica, drugs preventing hyperurikemia, drugs inhibiting immunoreactions (e.g. corticosteroids), drugs modulating the inflammatory response, drugs acting on the circulatory system and/or agents such as cytokines known in the art.
[0195] To analyse the effect of the nanoparticles of the present invention and/or the nanoparticles obtainable by the method of the present invention for example in cancer therapy, outcome measures can be selected e.g. from pharmacokinetics, immunogenicity, and the potential to decrease the size of a cancer by e.g. MRI imaging as well as patient reported outcomes.
[0196] Another major challenge in the development of drugs such as the pharmaceutical composition in accordance with the invention is the predictable modulation of pharmacokinetic properties. To this end, a pharmacokinetic profile of the drug candidate, i.e. a profile of the pharmacokinetic parameters that affect the ability of a particular drug to treat a given condition, is established. Pharmacokinetic parameters of the drug influencing the ability of a drug for treating a certain disease entity include, but are not limited to: half-life, volume of distribution, hepatic first-pass metabolism and the degree of blood serum binding. The efficacy of a given drug agent can be influenced by each of the parameters mentioned above. Half-life means the time where 50% of an administered drug are eliminated through biological processes, e.g. metabolism, excretion, etc. By hepatic first-pass metabolism is meant the propensity of a drug to be metabolized upon first contact with the liver, i.e. during its first pass through the liver. Volume of distribution means the degree of retention of a drug throughout the various compartments of the body, like e.g. intracellular and extracellular spaces, tissues and organs, etc. and the distribution of the drug within these compartments.
[0197] Degree of blood serum binding means the propensity of a drug to interact with and bind to blood serum proteins, such as albumin, leading to a reduction or loss of biological activity of the drug.
[0198] Pharmacokinetic parameters also include bioavailability, lag time (Tlag), Tmax, absorption rates and/or Cmax for a given amount of drug administered. Bioavailability means the amount of a drug in the blood compartment. Lag time means the time delay between the administration of the drug and its detection and measurability in blood or plasma. Tmax is the time after which maximal blood concentration of the drug is reached, the absorption is defined as the movement of a drug from the site of administration into the systemic circulation, and Cmax is the blood concentration maximally obtained with a given drug. The time to reach a blood or tissue concentration of the drug which is required for its biological effect is influenced by all parameters.
[0199] The term toxicity as used herein refers to the toxic effects of a drug manifested in adverse events or severe adverse events. These side events might refer to a lack of tolerability of the drug in general and/or a lack of local tolerance after administration. Toxicity could also include teratogenic or carcinogenic effects caused by the drug.
[0200] The terms safety, in vivo safety or tolerability as used herein define the administration of a drug without inducing severe adverse events directly after administration (local tolerance) and during a longer period of application of the drug. Safety, in vivo safety or tolerability can be evaluated e.g. at regular intervals during the treatment and follow-up period. Measurements include clinical evaluation, e.g. organ manifestations, and screening of laboratory abnormalities. Clinical evaluation may be carried out and deviating to normal findings recorded/coded according to NCI-CTC and/or MedDRA standards. Organ manifestations may include criteria such as allergy/immunology, blood/bone marrow, cardiac arrhythmia, coagulation and the like, as set forth e.g. in the Common Terminology Criteria for adverse events v3.0 (CTCAE). Laboratory parameters which may be tested include for instance haematology, clinical chemistry, coagulation profile and urine analysis and examination of other body fluids such as serum, plasma, lymphoid or spinal fluid, liquor and the like. Safety can thus be assessed e.g. by physical examination, imaging techniques (i.e. ultrasound, x-ray, CT scans, Magnetic Resonance Imaging (MRI), other measures with technical devices (i.e. electrocardiogram), vital signs, by measuring laboratory parameters and recording adverse events. The term effective and non-toxic dose as used herein refers to a tolerable dose of the molecules of the present invention and/or the molecule obtainable by the method of the present invention, preferably the antibody as defined herein, which is high enough to cure or stabilize the disease of interest without or essentially without major toxic effects. Such effective and non-toxic doses may be determined e.g. by dose escalation studies described in the art and should be below the dose inducing severe adverse side events (dose limiting toxicity, DLT).
[0201] The pharmaceutical composition of the present invention may have different formulations. The formulation (sometimes also referred to herein as composition of matter; composition, or solution) may preferably be in various physical states such as liquid, frozen, lyophilized, freeze-dried, spray-dried and reconstituted formulations, with liquid and frozen being preferred.
[0202] Liquid formulation as used herein refers to a composition of matter that is found as a liquid, characterized by free movement of the constituent molecules among themselves but without the tendency to separate at room temperature. Liquid formulations include aqueous and non-aqueous liquid, with aqueous formulations being preferred. An aqueous formulation is a formulation in which the solvent or main solvent is water, preferably water for injection (WFI). The dissolution of the molecules of the present invention and/or the molecule obtainable by the method of the present invention in the formulation may be homogenous or heterogeneous, with homogenous being preferred as described above.
[0203] Any suitable non-aqueous liquid may be employed provided that it provides stability to the formulation of the invention. Preferably, the non-aqueous liquid is a hydrophilic liquid. Illustrative examples of suitable non-aqueous liquids include: glycerol; dimethyl sulfoxide (DMSO); polydimethylsiloxane (PMS); ethylene glycols, such as ethylene glycol, diethylene glycol, triethylene glycol, polyethylene glycol (PEG) 200, PEG 300, and PEG 400; and propylene glycols, such as dipropylene glycol, tripropylene glycol, polypropylene glycol (PPG) 425 and PPG 725.
[0204] Mixed aqueous/non-aqueous liquid formulation as used herein refers to a liquid formulation that contains a mixture of water, preferably WFI, and an additional liquid composition.
[0205] When used herein a formulation or composition is a mixture of the molecules of the present invention and/or the molecule obtainable by the method of the present invention (i.e., the active drug/substance) and further chemical substances and/or additives required for a medicinal product which is preferably in a liquid state. A formulation of the invention includes a pharmaceutical formulation.
[0206] The preparation of the formulation includes the process in which different chemical substances, including the active drug, are combined to produce a final medicinal product such as a pharmaceutical composition. The active drug of the formulation of the invention is the nanoparticle of the present invention and/or the nanoparticle obtainable by the method of the present invention.
[0207] In certain embodiments, the nanoparticle of the present invention and/or the nanoparticle obtainable by the method of the present invention can be formulated essentially pure and/or essentially homogeneous (i.e., substantially free from contaminating substances, e.g. proteins, etc. which can be product-related and/or process-related impurities). The term essentially pure means a composition comprising at least about 80%, preferably about 90% by weight of the compound, preferably at least about 95% by weight of the compound, more preferably at least about 97% by weight of the compound or most preferably at least about 98% by weight of the compound. The term essentially homogeneous means a composition comprising at least about 99% by weight of the compound, preferably of the compound in a monomeric state, excluding the mass of various stabilizers and water in solution.
[0208] A stable formulation is one in which the molecules of the present invention and/or the molecule obtainable by the method of the present invention therein essentially retains its physical stability and/or chemical stability and/or biological activity upon storage and/or does not show substantial signs of aggregation, precipitation, fragmentation, degradation and/or denaturation compared to a control sample, preferably upon visual examination of colour and/or clarity, or as measured by UV light scattering or by size exclusion chromatography. Various further analytical techniques for measuring protein stability are available in the art and are reviewed in Peptide and Protein Drug Delivery, 247-301, Vincent Lee Ed., Marcel Dekker, Inc., New York, N.Y., Pubs. (1991) and Jones, A. Adv. Drug Delivery Rev. 10: 29-90 (1993), for example.
[0209] During storage, as used herein, means a formulation that once prepared, is not immediately used; rather, following its preparation, it is packaged for storage, either in a liquid form, in a frozen state, or in a dried form for later reconstitution into a liquid form or other form.
[0210] A subject in accordance with the present invention is a vertebrate, preferably a mammal, more preferably a human subject.
[0211] A vertebrate includes vertebrate fish, birds, amphibians, reptiles and mammals.
[0212] A mammal includes dogs, cats, horses, rats, mice, apes, rabbits, cows, pigs, sheep, and preferably humans. To a human can also be referred to by the term patient.
[0213] The present invention further relates to the nanoparticle obtainable by the method of the present invention or the nanoparticle of the present invention and/or the pharmaceutical composition of the present invention for use in therapy. The use in therapy is preferably in a method for treating cancer in a subject.
[0214] The term cancer and cancerous as used by the present invention means a condition in vertebrates, preferably mammals, more preferably humans that is typically characterized by unregulated cell growth.
[0215] Cancers are classified by the type of cell that the tumor cells resemble and are therefore presumed to be the origin of the tumor. These types include carcinoma, sarcoma, blood cancer, germ cell tumors, and blastoma.
[0216] A carcinoma when referred to herein can include cancers derived from epithelial cells.
[0217] A sarcoma when referred to herein can include a cancer that arises from cells of mesenchymal (connective tissue) origin.
[0218] A blood cancer when referred to herein can include classes of cancer arising from hematopoietic (blood-forming) cells that leave the marrow and tend to mature in the lymph nodes and blood, respectively. When referred herein to leukemia, bone marrow-derived cells that normally mature in the bloodstream can be included. When referring herein to a lymphoma, bone marrow-derived cells that normally mature in the lymphatic system can be included.
[0219] A germ cell tumor when referred to herein can include cancers derived from pluripotent cells, most often presenting in the testicle or the ovary.
[0220] A blastoma when referred to herein can include cancers derived from immature precursor cells or embryonic tissue.
[0221] The molecule obtainable by a process of the present invention or the molecules of the present invention and/or the molecule obtainable by the method of the present invention may be used in a method for treating cancer, wherein the cancer may be selected from the group consisting of lung cancer, such as non small cell lung cancer, sarcoma, such as rhabdomyosarcoma or Ewing's sarcoma, colorectal cancer, blood cancer, such as leukemia or lymphoma, such as acute myeloid leukemia (AML) or diffuse large B-cell lymphoma (DLBLC).
[0222] The term treatment as used herein, means to alleviate, reduce, stabilize, or inhibit progression of a disease or disorder, such as cancer.
[0223] The present invention further relates to the nanoparticle obtainable by a process of the present invention or the nanoparticle of the present invention or the pharmaceutical composition of the present invention which is used in a method for inhibiting and/or controlling tumor growth in a subject.
[0224] A tumor or neoplasm is an abnormal mass of tissue as a result of abnormal growth or division of cells. The growth of neoplastic cells exceeds, and is not coordinated with that of the normal tissues around it. However, a tumor in the sense of the present invention does also include leukemia, and carcinoma in situ. A tumor can be benign, pre-malignant, or malignant. In a preferred embodiment the tumors are pre-malignant or malignant. Most preferably, the tumor is malignant.
[0225] The present invention further relates to the nanoparticle obtainable by a method of the present invention or the nanoparticle of the present invention or the (pharmaceutical) composition of the present invention for delivering a nucleic acid molecule to the site of a tumor in a subject.
[0226] In one embodiment of the present invention, the nanoparticle obtainable by a process of the present invention or the nanoparticle of the present invention or the pharmaceutical composition of the present invention for use of the present invention includes a siRNA selected from the group consisting of KRAS, BRAF, PIK3CA, PAX3-FKHR, EWS-FLI1, c-MYC, TP53, DNMT3A, IDH1, NPM1, and FLT3 siRNA. An siRNA of the present invention can target KRAS, BRAF, PIK3CA, PAX3-FKHR, EWS-FLI1, c-MYC, TP53, DNMT3A, IDH1, NPM1, or FLT3. Preferably the siRNA reduces the expression of KRAS, BRAF, PIK3CA, PAX3-FKHR, EWS-FLI1, c-MYC, TP53, DNMT3A, IDH1, NPM1, or FLT3 of a cell. Preferably, the expression of these targets is decreased.
[0227] A siRNA targeting means the target which is recognized by a specific siRNA. siRNAs can be constructed in different ways. For example, a siRNA can be targeting mRNA.
[0228] In general, the design of a siRNA is known to the skilled artesian. See for example Reynolds et al., (Reynolds et al., (2004) Rational siRNA design for RNA interference Nature Biotechnology 22, 326-330) or Judge et al., (Judge et al., 2006) Design of Noninflammatory Synthetic siRNA Mediating Potent Gene Silencing in Vivo Molecular Therapy (2006) 13, 494-505) or Sioud and Leirdal (Sioud and Leirdal (2004) Potential design rules and enzymatic synthesis of siRNAs Methods Mol Biol. 2004; 252:457-69).
[0229] The term expression or gene expression means the transcription of a specific gene or specific genes or specific genetic construct. The term expression or gene expression in particular means the transcription of a gene or genes or genetic construct into structural RNA (rRNA, tRNA) or mRNA with or without subsequent translation of the latter into a protein. The process includes transcription of DNA and processing of the resulting mRNA product. The mRNA is then translated into peptide/polypeptide chains, which are ultimately folded into the final peptide/polypeptides/proteins. Protein expression is commonly used by proteomics researchers to denote the measurement of the presence and abundance of one or more proteins in a particular cell or tissue. The expression of a protein of a cell can be measured by various means. For example, with immunohistochemistry or western blot analysis. Here, the obtained results should be evaluated in comparison, to a healthy cell, or control standard. A lower expressing cell shows a staining, which is decreased e.g. in intensity, when compared to a control cell. A higher expressing cell shows a staining, which is increased e.g. in intensity, when compared to a control cell in the same setting. Also, the expression of the mRNA can be measured e.g. by RT-PCR. Here, a lower expressing cell shows e.g. a higher number of amplification cycles to overt a detectable signal when compared to a control cell in the same setting. The person skilled in the art knows different techniques, how to determine the expression of a protein, mRNA of a cell.
[0230] For example, the cell can be present in the blood, liver, stomach, mouth, skin, lung, lymphatic system, spleen, bladder, pancreas, bone marrow, brain, kidneys, intestines, gallbladder, brain, larynx or pharynx of the subject.
[0231] In one embodiment, the nanoparticle obtainable by a method of the present invention or the nanoparticle of the present invention or the pharmaceutical composition of the present invention is used according to the present invention, wherein the subject is mammal, preferably a human being.
[0232] The present invention also relates to a kit comprising one or more coupling buffer/reagents and protocol suitable for performing the method of the present invention.
[0233] In one embodiment, the kit comprises one or more coupling buffer/reagents and protocol suitable for performing the method of the present invention.
[0234] The present invention relates to a kit comprising buffer/reagents and protocol suitable for performing the method of the present invention and optionally means to purify or enrich for e.g. molecules of the present invention or molecules obtained by the method of the present invention and/or means to wash said molecules and/or means to store said molecules. Said molecules and the additional means are thereby preferably packaged together in one sealed package or kit.
[0235] The present invention also relates to a kit that comprises the nanoparticle of the present invention and/or the nanoparticle obtainable by a method of the present invention.
[0236] The present invention relates to a kit comprising the nanoparticle of the present invention and/or the nanoparticle obtainable by a method of the present invention and/or optionally means to purify or enrich said molecules and/or means to wash said molecules and/or means to store said molecules. Said molecules and the additional means are thereby preferably packaged together in one sealed package or kit.
[0237] Parts of the kit (or the kit of parts) of the invention can be packaged individually in vials or bottles or in combination in containers or multicontainer units. The manufacture of the kits follows preferably standard procedures, which are known to the person skilled in the art.
[0238] The kit of the present invention may comprise one or more container(s), optionally with a label. Suitable containers include, for example, bottles, vials, and test tubes. The containers may be formed from a variety of materials such as glass or plastic, and are preferably sterilized. The container holds a composition having an active ingredient or comprising a buffer which is effective for the method of the present invention. Further container may hold suitable buffers (for example reaction buffers), which allow the specific reactions to take place. It is also envisaged that containers are included which hold diverse buffers, for example reaction buffers and/or buffers for the purification of the molecules of the present invention and/or the molecule obtainable by the method of the present invention etc. The active agent in the composition is preferably the molecule obtainable by the method of the present invention or the molecule of the present invention or the pharmaceutical composition of the present invention.
[0239] The kit may also comprise written instructions for performing the method of the present invention in accordance with the methods and uses of the present invention. Said kit may further comprise a label or imprint indicating that the contents can be used for the augmentation of the nanoparticle in accordance with the present invention and/or for said nanoparticle of the present invention.
[0240] It is also envisaged that the kit of the present invention, further comprises for example buffers, vials, control(s), stabilizer(s), written instructions which aid the skilled person in the preparation or use of the nanoparticle of the present invention.
[0241] In addition the present invention also relates to the use of the nanoparticle of the present invention or the nanoparticle obtainable by the method of the present invention or the pharmaceutical composition of the present invention in therapy, preferably in the treatment of cancer in a subject.
[0242] The present invention also relates to a method of treating cancer in a subject, comprising administering a therapeutically effective amount of the nanoparticle of the present invention or the nanoparticle obtainable by the method of the present invention or the pharmaceutical composition of the present invention to said subject.
[0243] The term administration means administering of a therapeutically or diagnostically effective dose of the aforementioned nanoparticle of the present invention to a subject. Different routes of administration are possible and are described above.
[0244] The present invention also relates to the use of the nanoparticle of the present invention or the nanoparticle obtainable by the method of the present invention or the pharmaceutical composition of the present invention, for the preparation of a medicament. For example, for a medicament effective in the treatment of cancer.
[0245] Unless otherwise stated, the following terms used in this document, including the description and claims, have the definitions given below.
[0246] Those skilled in the art will recognize, or be able to ascertain, using not more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the present invention.
[0247] It is to be noted that as used herein, the singular forms a, an, and the, include plural references unless the context clearly indicates otherwise. Thus, for example, reference to a reagent includes one or more of such different reagents and reference to the method includes reference to equivalent steps and methods known to those of ordinary skill in the art that could be modified or substituted for the methods described herein.
[0248] Unless otherwise indicated, the term at least preceding a series of elements is to be understood to refer to every element in the series.
[0249] The term and/or wherever used herein includes the meaning of and, or and all or any other combination of the elements connected by said term.
[0250] The term about or approximately as used herein means within 20%, preferably within 10%, and more preferably within 5% of a given value or range. It includes, however, also the concrete number, e.g., about 20 includes 20.
[0251] Throughout this specification and the claims which follow, unless the context requires otherwise, the word comprise, and variations such as comprises and comprising, will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integer or step. When used herein, the term comprising can be substituted with the term containing or including or sometimes when used herein with the term having.
[0252] When used herein, consisting of excludes any element, step, or ingredient not specified in the claim element. When used herein, consisting essentially of does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claim.
[0253] In each instance herein any of the terms comprising, consisting essentially of and consisting of may be replaced with either of the other two terms. Any such replacement is envisioned by the present disclosure.
[0254] It should be understood that this invention is not limited to the particular methodology, protocols, material, reagents, and substances, etc., described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims.
[0255] All documents cited throughout the text of this specification (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.) are hereby incorporated by reference in their entirety. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention. To the extent the material incorporated by reference contradicts or is inconsistent with this specification, the specification will supersede any such material.
[0256] The invention is further illustrated by following items:
[0257] Item 1. A method of generating a nanoparticle comprising c) contacting an antibody with a composition comprising a first conjugate (A), the first conjugate comprising a positively charged polypeptide conjugated to a bifunctional linker, characterized in that the composition is essentially free of unconjugated bifunctional linker, thereby obtaining a second conjugate (B), the second conjugate comprising the positively charged polypeptide, the bifunctional linker, and the antibody; and d) contacting the second conjugate (B), a positively charged polypeptide, and a negatively charged molecule, thereby forming a nanoparticle.
[0258] Item 2. The method of item 1, wherein the method comprises prior to step c): a) conjugating a positively charged polypeptide with a bifunctional linker; b) removing unconjugated bifunctional linker.
[0259] Item 3. The method of item 1 or 2, wherein the antibody is purified prior to step c).
[0260] Item 4. The method of any one of the preceding items, wherein the method further comprises recovery of the nanoparticle.
[0261] Item 5. The method of any one of the preceding items, wherein in step c) the first conjugate is in molar excess compared to the antibody.
[0262] Item 6. The method of any one of the preceding items, wherein in step d) the positively charged polypeptide is in molar excess compared to the second conjugate (B).
[0263] Item 7. The method of any one of the preceding items, wherein in step d) the negatively charged molecule is in molar excess compared to the second conjugate (B).
[0264] Item 8. The method of any one of the preceding items, wherein in step d) the negatively charged molecule is in molar excess compared to the positively charged polypeptide.
[0265] Item 9. The method of any one of the preceding items, wherein the molar ratio between the first conjugate (A) and the antibody is at least about 10:1 in step c).
[0266] Item 10. The method of any one of the preceding items, wherein the molar ratio between the first conjugate (A) and the antibody is from about 10:1 to about 50:1 in step c).
[0267] Item 11. The method of any one of the preceding items, wherein the molar ratio between the positively charged polypeptide and the second conjugate (B) is at least about 10:1 in step d).
[0268] Item 12. The method of any one of the preceding items, wherein the molar ratio between the positively charged polypeptide and the second conjugate (B) is from about 10:1 to about 50:1 in step d).
[0269] Item 13. The method of any one of the preceding items, wherein the molar ratio between the negatively charged molecule and the second conjugate is at least about 1:1 in step d).
[0270] Item 14. The method of any one of the preceding items, wherein the nanoparticle is formed by self-assembly in step d).
[0271] Item 15. The method of any one of the preceding items, wherein step d) comprises incubation at about 4-37 C.
[0272] Item 16. The method of any one of the preceding items, wherein step d) comprises incubation for at least about 1 h.
[0273] Item 17. The method of any one of the preceding items, wherein the positively charged polypeptide and the antibody are interconnected via the bifunctional linker in the second conjugate.
[0274] Item 18. The method of any one of the preceding items, wherein the antibody comprises a heavy chain and a light chain.
[0275] Item 19. The method of any one of the preceding items, wherein the antibody is specific for a cell surface molecule.
[0276] Item 20. The method of item 19, wherein cell surface molecule is capable of internalization upon binding of the antibody.
[0277] Item 21. The method of item 19 or 20, wherein the cell surface molecule is expressed on a cell which is susceptible to therapeutic treatment by the negatively charged molecule.
[0278] Item 22. The method of any one of the preceding items, wherein the antibody is specific for a cancer-associated antigen.
[0279] Item 23. The method of any one of the preceding items, wherein the antibody is specific for CD33, EGFR, IGF1R, or CD20.
[0280] Item 24. The method of any one of the preceding items, wherein the antibody is gemtuzumab, cetuximab, cixutumumab, teprotumumab, GR11L, rituximab.
[0281] Item 25. The method of any one of the preceding items, wherein the antibody has the CDR sequences selected form the group consisting of a. CDR-H1: GFSLTNYG (SEQ ID NO: 1), CDR-H2: IWSGGNT (SEQ ID NO: 2), CDR-H3: ARALTYYDYEFAY (SEQ ID NO: 3), CDR-L1: QSIGTN (SEQ ID NO: 4), CDR-L2: YAS, and CDR-L3: QQNNNWPTT (SEQ ID NO: 5); b. CDR-H1: GYTITDSN (SEQ ID NO: 10), CDR-H2: IYPYNGGT (SEQ ID NO: 11), CDR-H3: VNGNPWLAY (SEQ ID NO: 12), CDR-L1: ESLDNYGIRF (SEQ ID NO: 13), CDR-L2: AAS, and CDR-L3: QQTKEVPWS (SEQ ID NO: 14); c. CDR-H1: GGTFSSYAIS (SEQ ID NO: 19), CDR-H2: GIIPIFGTANYAQKFQ (SEQ ID NO: 20), CDR-H3: APLRFLEWSTQDHYYYYYMDV (SEQ ID NO: 21), CDR-L1: QGDSLRSYYAT (SEQ ID NO: 22), CDR-L2: GENKRPS (SEQ ID NO: 23), and CDR-L3: KSRDGSGQHLV (SEQ ID NO: 24); d. CDR-H1: GFTFSSYG (SEQ ID NO: 29), CDR-H2: IWFDGSST (SEQ ID NO: 30), CDR-H3: ARELGRRYFDL (SEQ ID NO: 31), CDR-L1: QSVSSY (SEQ ID NO: 32), CDR-L2: IWFDGSST (SEQ ID NO: 33), and CDR-L3: QQRSKWPPWT (SEQ ID NO: 34); and e. CDR-H1: GYTFTSYN (SEQ ID NO: 39), CDR-H2: IYPGNGDT (SEQ ID NO: 40), CDR-H3: CARSTYYGGDWYFNV (SEQ ID NO: 41), CDR-L1: SSVSYI (SEQ ID NO: 42), CDR-L2: ATS, and CDR-L3: QQWTSNPPT (SEQ ID NO: 43).
[0282] Item 26. The method of any one of the preceding items, wherein the antibody has the VH and VL sequences selected form the group consisting of: a. SEQ ID NO: 6 and 7; b. SEQ ID NO: 15 and 16; c. SEQ ID NO: 25 and 26; d. SEQ ID NO: 35 and 36; and e. SEQ ID NO: 44 and 45.
[0283] Item 27. The method of any one of the preceding items, wherein the antibody has the heavy chain and light chain sequences selected form the group consisting of: a. SEQ ID NO: 8 and 9; b. SEQ ID NO: 17 and 18; c. SEQ ID NO: 27 and 28; d. SEQ ID NO: 37 and 38; e. SEQ ID NO: 46 and 47; and f. SEQ ID NO: 65 and 18.
[0284] Item 28. The method of any one of the preceding items, wherein the negatively charged molecule is a nucleic acid.
[0285] Item 29. The method of item 28, wherein the nucleic acid is a double stranded nucleic acid.
[0286] Item 30. The method of item 28, wherein the nucleic acid is a single stranded nucleic acid.
[0287] Item 31. The method of any one of items 28-30, wherein the nucleic acid has about 18 to about 25 bp.
[0288] Item 32. The method of any one of items 28-30, wherein the nucleic acid has about 18 to about 25 nt.
[0289] Item 33. The method of any one of the preceding items, wherein the negatively charged molecule is a DNA or RNA.
[0290] Item 34. The method of any one of the preceding items, wherein the negatively charged molecule is siRNA, esiRNA, shRNA, antisense oligonucleotide, or miRNA.
[0291] Item 35. The method of any one of the preceding items, wherein the negatively charged molecule is a siRNA specific for KRAS, BRAF, PIK3CA, PAX3-FKHR, EWS-FLI1, c-MYC, TP53, DNMT3A, IDH1, NPM1, or FLT3.
[0292] Item 36. The method of any one of the preceding items, wherein the negatively charged molecule is a mixture of siRNAs specific for one or more targets preferably selected from the group consisting of KRAS, BRAF, PIK3CA, PAX3-FKHR, EWS-FLI1, c-MYC, TP53, DNMT3A, IDH1, NPM1, and FLT3.
[0293] Item 37. The method of any one of the preceding items, wherein the negatively charged molecule has a molecular weight of about 20 kDa or less.
[0294] Item 38. The method of any one of the preceding items, wherein the negatively charged molecule has a charge of at least 2.
[0295] Item 39. The method of any one of the preceding items, wherein the positively charged polypeptide is a protamine or histone.
[0296] Item 40. The method of any one of the preceding items, wherein the bifunctional linker is a heterobifunctional linker.
[0297] Item 41. The method of any one of the preceding items, wherein the bifunctional linker is sulfo-SMCC.
[0298] Item 42. A nanoparticle obtainable by a method of any one of the preceding items.
[0299] Item 43. A nanoparticle comprising: a) a positively charged polypeptide; b) a second conjugate (B), the second conjugate comprising an antibody conjugated to a positively charged polypeptide; and c) one or more negatively charged molecule(s).
[0300] Item 44. The nanoparticle of item 42 or 43, wherein the positively charged polypeptide is enriched in the outer and/or inner portion of the nanoparticle.
[0301] Item 45. The nanoparticle of any one of items 42-44, wherein the second conjugate is enriched in the outer portion of the nanoparticle.
[0302] Item 46. The nanoparticle of any one of items 42-45, wherein the one or more negatively charged molecules are enriched in the inner portion of the nanoparticle.
[0303] Item 47. The nanoparticle of any one of items 42-46, wherein the nanoparticle has a mean diameter of about 0.05 m to about 10 m.
[0304] Item 48. The nanoparticle of any one of items 42-47, wherein the positively charged polypeptide and the antibody are interconnected via the bifunctional linker in the second conjugate.
[0305] Item 49. The nanoparticle of any one of items 42-48, wherein the antibody comprises a heavy chain and a light chain.
[0306] Item 50. The nanoparticle of any one of items 42-49, wherein the antibody is specific for a cell surface molecule.
[0307] Item 51. The method of item 50, wherein cell surface molecule is capable of internalization upon binding of the antibody.
[0308] Item 52. The nanoparticle of item 50 or 51, wherein the cell surface molecule is expressed on a cell which is susceptible to therapeutic treatment by the negatively charged molecule.
[0309] Item 53. The nanoparticle of any one of items 42-52, wherein the antibody is specific for a cancer-associated antigen.
[0310] Item 54. The nanoparticle of any one of items 42-53, wherein the antibody is specific for CD33, EGFR, IGF1R, or CD20.
[0311] Item 55. The nanoparticle of any one of items 42-54, wherein the antibody is gemtuzumab, cetuximab, cixutumumab, teprotumumab, GR11L, rituximab.
[0312] Item 56. The nanoparticle of any one of items 42-55, wherein the antibody has the CDR sequences selected form the group consisting of: a. CDR-H1: GFSLTNYG (SEQ ID NO: 1), CDR-H2: IWSGGNT (SEQ ID NO: 2), CDR-H3: ARALTYYDYEFAY (SEQ ID NO: 3), CDR-L1: QSIGTN (SEQ ID NO: 4), CDR-L2: YAS, and CDR-L3: QQNNNWPTT (SEQ ID NO: 5); b. CDR-H1: GYTITDSN (SEQ ID NO: 10), CDR-H2: IYPYNGGT (SEQ ID NO: 11), CDR-H3: VNGNPWLAY (SEQ ID NO: 12), CDR-L1: ESLDNYGIRF (SEQ ID NO: 13), CDR-L2: AAS, and CDR-L3: QQTKEVPWS (SEQ ID NO: 14); c. CDR-H1: GGTFSSYAIS (SEQ ID NO: 19), CDR-H2: GIIPIFGTANYAQKFQ (SEQ ID NO: 20), CDR-H3: APLRFLEWSTQDHYYYYYMDV (SEQ ID NO: 21), CDR-L1: QGDSLRSYYAT (SEQ ID NO: 22), CDR-L2: GENKRPS (SEQ ID NO: 23), and CDR-L3: KSRDGSGQHLV (SEQ ID NO: 24); d. CDR-H1: GFTFSSYG (SEQ ID NO: 29), CDR-H2: IWFDGSST (SEQ ID NO: 30), CDR-H3: ARELGRRYFDL (SEQ ID NO: 31), CDR-L1: QSVSSY (SEQ ID NO: 32), CDR-L2: IWFDGSST (SEQ ID NO: 33), and CDR-L3: QQRSKWPPWT (SEQ ID NO: 34); and e. CDR-H1: GYTFTSYN (SEQ ID NO: 39), CDR-H2: IYPGNGDT (SEQ ID NO: 40), CDR-H3: CARSTYYGGDWYFNV (SEQ ID NO: 41), CDR-L1: SSVSYI (SEQ ID NO: 42), CDR-L2: ATS, and CDR-L3: QQWTSNPPT (SEQ ID NO: 43).
[0313] Item 57. The nanoparticle of any one of items 42-56, wherein the antibody has the VH and VL sequences selected form the group consisting of a. SEQ ID NO: 6 and 7; b. SEQ ID NO: 15 and 16; c. SEQ ID NO: 25 and 26; d. SEQ ID NO: 35 and 36; and e. SEQ ID NO: 44 and 45.
[0314] Item 58. The nanoparticle of any one of items 42-57, wherein the antibody has the heavy chain and light chain sequences selected form the group consisting of a. SEQ ID NO: 8 and 9; b. SEQ ID NO: 17 and 18; c. SEQ ID NO: 27 and 28; d. SEQ ID NO: 37 and 38; e. SEQ ID NO: 46 and 47; and f. SEQ ID NO: 65 and 18.
[0315] Item 59. The nanoparticle of any one of items 42-58, wherein negatively charged molecule is a nucleic acid.
[0316] Item 60. The nanoparticle of any one of items 42-59, wherein the nucleic acid is a double stranded nucleic acid.
[0317] Item 61. The nanoparticle of any one of items 42-60, wherein the nucleic acid is a single stranded nucleic acid.
[0318] Item 62. The nanoparticle of any one of items 42-61, wherein the nucleic acid has about 18 to about 25 bp.
[0319] Item 63. The nanoparticle of any one of items 42-62, wherein the single stranded nucleic acid has about 18 to about 25 nt.
[0320] Item 64. The nanoparticle of any one of items 42-63, wherein the negatively charged molecule is a DNA or RNA.
[0321] Item 65. The nanoparticle of any one of items 42-64, wherein the negatively charged molecule is siRNA, esiRNA, shRNA, antisense oligonucleotide, or miRNA.
[0322] Item 66. The nanoparticle of any one of items 42-65, wherein the negatively charged molecule is siRNA specific for KRAS, BRAF, PIK3CA, PAX3-FKHR, EWS-FLI1, c-MYC, TP53, DNMT3A, IDH1, NPM1, or FLT3.
[0323] Item 67. The nanoparticle of any one of items 42-66, wherein the negatively charged molecule is a mixture of siRNAs specific for one or more targets preferably selected from the group consisting of KRAS, BRAF, PIK3CA, PAX3-FKHR, EWS-FLI1, c-MYC, TP53, DNMT3A, IDH1, NPM1, and FLT3.
[0324] Item 68. The nanoparticle of any one of items 42-67, wherein the negatively charged molecule has a molecular weight of about 20 kDa or less.
[0325] Item 69. The nanoparticle of any one of items 42-68, wherein the negatively charged molecule has a charge of at least 2.
[0326] Item 70. The nanoparticle of any one of items 42-69, wherein the positively charged polypeptide is a protamine or histone.
[0327] Item 71. The nanoparticle of any one of items 42-70, wherein the bifunctional linker is a heterobifunctional linker.
[0328] Item 72. The nanoparticle of any one of items 42-71, wherein the bifunctional linker is Sulfo-SMCC.
[0329] Item 73. A composition comprising a nanoparticle of any one of items 42-72.
[0330] Item 74. The composition of item 73, wherein the composition is a pharmaceutical composition.
[0331] Item 75. A nanoparticle of any one of items 42-72 or a composition of item 73 or 74 for use in therapy.
[0332] Item 76. The nanoparticle or composition for the use of item 75, wherein the use is in the treatment of cancer.
[0333] Item 77. The nanoparticle or composition for the use of item 75, wherein the use is in the treatment of a solid tumor.
[0334] Item 78. The nanoparticle or composition for the use of item 75, wherein the use is in the treatment of a cancer selected from the group consisting of lung cancer, sarcoma, colorectal cancer, blood cancer.
[0335] Item 79. A kit comprising a nanoparticle of any one of items 42-72 or a composition of item 73 or 74.
[0336] Item 80. The method of any one of items 1-41 or the nanoparticle of any one of items 42-72, wherein the negatively charged molecule is a drug and/or prodrug, such as remdesivir triphosphate.
[0337] Item 81. The method of any one of items 1-41 or the nanoparticle of any one of items 42-72, wherein the negatively charged molecule is a drug and/or prodrug, such as ibrutinib, conjugated to a moiety having a negative net charge, such as Cy 3.5 or Alexa488.
EXAMPLES
[0338] The following examples illustrate the invention. These examples should not be construed as to limit the scope of this invention. The examples are included for purposes of illustration and the present invention is limited only by the claims.
Example 1: Modification of the Conjugation Protocol
[0339] While we performed the chemical conjugations between the chosen carrier antibodies, sulfo-SMCC and protamine as published in Bumer, N. et al., 2016; Bumer, N. et al., 2018; Bumer, S. et al., 2015, we were puzzled by resulting conjugates, that had unintended properties in SDS-PAGE electrophoresis: For instance, we frequently observed the phenomenon of IgG conjugates, that prove to be no longer reducible by reducing agents such as DTT, DTE, beta-mercapto-ethanol or TCEP (
[0340] Figure, C, see gel B for illustration). In extreme cases, the complexity of all of those side reactions lead to a cloud-like appearance of the resulting conjugates, probably caused by a mixture of all of these conjugates a-d in
[0341] Conversely, the intended conjugate was the formulation marked with C in
[0342] As a consequence, we have modified the conjugation protocol by introducing an additional purification step after the amino-terminal activation of the protamine peptide with sulfo-SMCC. The resulting products were purified by gel chromatography, separating the activated SMCC-protamine from the still active excess educt sulfo-SMCC. From this step on, the antibody conjugation was performed by a homogeneous solution of pure SMCC-protamine, without any contaminations of residual crosslinker (
[0343] As a consequence, all experiments shown in the following Examples were performed by following the new SMCC-depletion protocol. The resulting complexes improved enormously regarding their electrophoretical homogeneity, targeting performance and functional effectivity.
[0344] So, all findings shown here were performed with a therapeutic agent synthesized by a new production process, not with the formulations published in Bumer, N. et al., 2016; Bumer, N. et al., 2018; Bumer, S. et al., 2015.
Example 2: Oncogene Inactivation in Non-Small Cell Lung Cancer Using the Unpublished Modified Conjugation Protocol
[0345] Next, we targeted EGFR-expressing non-small cell lung cancer cell lines (NSCLC) with cetuximab-protamine. Here, cetuximab-protamine was able to bind 8 mol of siRNA per mol of cetuximab-protamine (
[0346] Next, we investigated the effect of the systemic anti-EGFR-mAB-siRNA treatment of the NSCLC xenograft tumors on proliferation marker Ki67 expression in immunofluorescence on cryo-sections (A549 tumors) and paraffin sections (SK-LU-1 tumors). In PBS or anti-EGFR-mAB-control-siRNA treated A549 (
[0347] Tumor growth retardation by systemic anti-EGFR-mAB-siRNA application can be induced not only by a reduced proliferation of the tumor tissue, but also by increased apoptosis. Moreover, the induction of apoptosis is of course a desirable effect of a potential cancer therapeutic agent to be able to actively reduce tumor size. We aimed to investigate the abundance of apoptotic cells by TUNEL (terminal deoxynucleotidyl transferase dUTP nick end labeling) staining of the respective tumor tissues ex vivo that reveals DNA fragmentation in nuclei as a sign for apoptosis. After peroxidase-staining development, control treated tumor sections exhibited a doubling in TUNEL-positive nuclei in A549 tumors treated with anti-EGFR-mAB-control siRNA (
[0348] Taken together, the marked and significant reduction of the tumor size by treatment with anti-EGFR-mAB-KRAS siRNA can be explained by a combination of reduced proliferation and increased apoptosis in the respective tumors.
[0349] Moreover, we also exploit the fact that EGFR is surface-expressed also in sarcomas (see (Herrmann et al., 2010) and next chapter. The observation that cetuximab was ineffective as a single agent in a first clinical trial in sarcoma (Ha et al., 2013) is not relevant for our purposes, since our system relies on the antibody not as an active anti-cancer agent but as a component of the shuttle system carrying the oncogene-specific effector siRNA.
Example 3: Targeting Oncogenes in Rhabdomyosarcoma
[0350] Rhabdomyosarcomas (RMS) are aggressive soft tissue sarcomas that originate from immature myoblasts and mainly occur in children and young adults. Pediatric RMS are divided into two major categories according to their histological appearance: approximately represent embryonal RMS (ERMS), which have a more favorable prognosis, and represent the more aggressive alveolar RMS (ARMS) (Stevens, 2005). So far, no common genetic lesions of diagnostic value have been found in ERMS, except an accumulation of loss of heterozygosity in 11p15 (Chen et al., 2013). Targeting critical drivers of ARMS is more likely to have a therapeutic impact. Genetic lesions characterizing alveolar rhabdomysarcoma (ARMS) are the PAX3-FKHR or PAX7-FKHR fusions by chromosomal translocation of t(1;13) or t(2;13). Thus, targeting of PAX-FKHR fusion genes and their transcripts could be a specific and effective means to inhibit malignant growth and induce apoptosis of ARMS cells. Inhibition of oncogenic fusion proteins or mutated proteins was found to be challenging. Either the proteins were stated undruggable, or drug treatment led to the selection of a resistant version of the protein and to a more aggressive relapse (Verdine and Walensky, 2007).
[0351] Downregulation of fusion proteins by RNAi is intended to overcome these problems, since the expression is inhibited on the mRNA level. Specifically, downregulation of expression of the PAX3-FKHR fusion protein by RNAi in RMS cells had a direct effect on the malignant phenotype. Silencing PAX3-FKHR fusion by siRNA against PAX3 or PAX3-FKHR reduced proliferation, mobility and colony formation of RMS cell lines (Kikuchi et al., 2008; Liu, L. et al., 2012). Therefore, we hoped that effective downregulation of ARMS-specific fusion proteins by RNAi carried to the tumor cells by a stable and specific method by our established antibody-protamine carrier system in vivo leads to a therapeutic effect.
[0352] In RMS, IGF1R and epithelial growth factor receptor (EGFR) are candidate targets for our modular carrier. Our technique allows to distinguish tumor cells from other cells by two independent characteristics and thus provides a dual layer of specificity: a) The cell surface receptor decoration and b) the cellular oncogenic equipment. We and others (Herrmann et al., 2010) identified EGFR as well as IGF1R high-density surface expression on different alveolar (and embryonic) RMS cell lines. Both cell surface receptors can serve as target components of our system.
[0353] To check targeting efficiency of our antibody constructs in RMS cell lines, we treated the ERMS EGFR.sup.+ cell line RD with anti-EGFR antibody (cetuximab)-siRNA complexes and the ARMS IGF1R.sup.+ cell line RH-30 with anti-IGF1R-siRNA complexes (
[0354] To perform a proof-of-principle experiment for a specific targeting of RMS-typical PAX3-Forkhead fusion oncogene, we designed various siRNAs spanning the breakpoint region (
[0355] These results illustrate that we can target RMS cell lines using our modular antibody-siRNA system with at least 2 different monoclonal antibodies, depending on receptor decoration of RMS tumors to specifically transport nucleic acids of our choice to elicit oncogene inactivation.
Example 4: Targeting Oncogenes in Ewing's Sarcoma
[0356] Ewing-sarcomas are bone tumors in children and young adults. With less than 35% long-term complete remissions in the metastasized stage, there is a high need for better therapeutic options (Paulussen et al., 1998; Paulussen et al., 2008). A central genetic event is the occurrence of the chromosomal translocation t(11;22) that results in the formation of the fusion protein EWS-FLI1 in these tumor cells (Arvand and Denny, 2001). Ewing sarcoma cells express high amounts of IGF1R on their surface. We therefore intended to apply our modular therapy using the anti-IGF1R-antibody like the clone ImcA12 (cixutumumab) or teprotumumab as SMCC-protamine conjugate to transport EWS-FLI1 breakpoint-specific siRNA. As a proof-of-principle, we used the commercial anti-IGF1R murine antibody GR11L (Merck) and showed targeting of Ewing cells. These results were published in (Bumer, N. et al., 2016) and are depicted in
[0357] To be able to use this therapy option, we cloned and expressed two different IGF1R-antibodies in CHO-S cells and purified them using HPLC. These were the clones cixutumumab (here referred to as A12) and teprotumumab (here referred to as Tepro). Both were produced in sufficient amounts and coupled to SMCC-protamine (
[0358] When cells were incubated with these IGF1R-mAB-protamine conjugates in complex with siRNA against EWS-FLI1 and seeded in semisolid soft-agar, colony formation was significantly reduced (
[0359] We therefore conclude that our modular system can also be applied for the use of anti-IGF1R antibodies and sarcoma cells and especially for the knockdown of fusion proteins specific siRNA such as the EWS-FLI1-siRNAs.
Example 5: Oncogene Targeting in Lymphoma Models
[0360] Diffuse large B-cell lymphoma (DLBCL) represents a frequent lymphoma subtype. DLBCL cells express CD20 on their surface. The standard first-line therapy for affected patients is a combination of chemotherapy and the anti-CD20 antibody rituximab. Rituximab binds and blocks the CD20 molecule and leads to antibody-dependent cellular cytotoxicity (ADCC). By this approach, roughly 65% of patients can be cured. Patients who are refractory to first-line treatment or who relapse after initial response are characterized by extremely poor survival indicating that novel therapeutic approaches are urgently warranted. Therefore, we aimed to combine the first line drug rituximab as a cell-targeting antibody with siRNAs against different oncogenes identified in the genetically quite diverse lymphoma cells (
[0361] We first chemically coupled the CD20-antibody rituximab with different ratios of SMCC-protamine to compare the effectivity of each complex to bind siRNA (
[0362] Subsequently, different DLBCL cell lines were tested positive for surface expression of CD20 and CD33 (
[0363] DLBCL cell lines were subjected to a B-cell receptor-axis molecular screen by means of antibody-mediated siRNA knockdown to give rise to further target molecules besides BTK (
Example 6: Complexes Formed by Carrier Antibodies-Protamine and Small Molecular Weight Poly-Anionic Drugs with Chemical Structures Different from siRNA
[0364] In another project, we hypothesized that therapeutic monoclonal antibodies such as rituximab or gemtuzumab could be harnessed as carrier molecules for low molecular weight (lmw) drugs. This strategy would be of importance in the clinic, because the pharmacodynamics and safety of a number of lmw drugs, such as the group of kinase inhibitors, could possibly be improved by the targeted carrier over the untargeted form. Thus, we hypothesized for the use of such antibody-inhibitor conjugates that i) they can be applied in lower dosage, because the antibody helps to enrich the inhibitor in the intended target cells and ii) the antibody inhibits the inhibitor to be taken up by non-intended cells, where it may induce unintended toxic reactions.
[0365] In a first set of experiments, we synthesized negatively charged small molecule having the charge of 4that is a derivative of a known proliferation inhibitor, here referred to as Small Molecule 1 (SM-1). Therefore, we converted the uncharged small-molecule-inhibitor to the strongly anionic compound by adding a negative charged and emitting red-fluorescent light (here referred to as SM-1/RF), which allowed to bind it by means of electrostatic force to our protamine-based carrier system in order to form an antibody-inhibitor-conjugate.
[0366] Besides the strong polyanionic charge of the red fluorescent dye, the conjugate had the advantage of being easily traceable in vitro and in vivo in form of a red fluorescence.
[0367] Subsequently, we performed the same experiments for the binding between SM-1/RF and two carrier systems, rituximab (CD20)-protamine and the reliable cetuximab (EGFR)-protamine. Both carriers showed a strong co-assembly of the SM-1/RF and, due to its low molecular weight as compared to siRNA (appr. 13 kDa), an extremely high mol/mol ratio of electrostatic saturation, exceeding 100 mol SM-1/RF per mol of carrier mAB (
[0368] The corresponding conjugates rituximab- and cetuximab-protamine loaded with a sub-critical 20 excess of SM-1/RF were incubated with CD20 and EGFR-expressing cell lines and analysed for intracellular enrichment of SM-1/RF. In both cases, intracellular enrichment of fluorescent signals at the typical red fluorescent excitation/emission wavelength combination could be documented (
Example 7: Surprising Features of Effective Antibody-Protamine-siRNA Formulations
[0369] The exact conjugation procedure of all our used antibodies can be divided in two steps: First, the amino-terminal conjugation of the protamine to sulfo-SMCC, then a size exclusion process to remove the excess of conjugation cross-linker, and second the cysteine-directed conjugation of the activated protamine-SMCC to the IgG backbone. The resulting bioconjugate exhibits a significant molecular weight shift as seen from SDS-PAGE electrophoresis both, in the heavy chain and in the light chain of the IgG. About 60-80% of the IgG is converted to contain protamine-tags, and residual amount of the excess protamine was always visible.
[0370] As shown in
[0371] To further examine the effectivity of the protamine-containing and protamine-depleted preparations, we treated EGFR-expressing and KRAS-dependent A549 and SK-LU1 NSCLC cell lines with both preparations transporting KRAS-siRNA and control-siRNA. Only those preparations containing free protamine (see
[0372] We performed exactly the same purification procedures to the anti-CD33 mAB gemtuzumab, which we used for experimental treatment of AML and observed the same effect: conjugate preparations with unbound protamine depleted by HPLC did not bind siRNA to a desirable amount (
[0373] Furthermore, in contrast to non-purified material, the carrier without unbound SMCC-protamine had no remaining inhibitory efficacy of anti-DNMT3A-siRNA to OCI-AML2 cells in a colony formation assay (
[0374] To find an explanation for these puzzling and unexpected observations, we performed multiple experiments.
[0375] Taking the results from
[0376] Identical findings were made by using the anti-IGF1R monoclonal AB IMCA-12 conjugates (
[0377] In
Example 8: Deciphering the Role of Free SMCC-Protamine within the Antibody-SMCC-Protamine/Free SMCC-Protamine Complexes
[0378] According to the former results, we found out that our targeting does not work if free SMCC-protamine is absent. We therefore wanted to find out which role the free SMCC-protamine plays within the complex. Of course we had to rule out that the main function was performed by the free SMCC-protamine. We therefore performed a series of experiments with free SMCC-protamine and other negative controls.
[0379] First, we performed colony formation assays with the IGF1R-positive, but EGFR-negative Ewing's sarcoma cell line SKNM-C that is dependent on the EWS-FLI1-translocation product (
[0380] Next, we confronted SKNM-C Ewing's sarcoma cells with the regular targeting mixture including the anti-IGF1R antibody conjugated to SMCC-protamine, free SMCC-protamine in the same amount as present in the anti-IGF1R-mAB-protamine complex (60 nM carrier conjugated with 30-fold excess of SMCC-protamine equals 1800 nM of potentially free SMCC-protamine) and effective anti-EWS-FLI1-siRNA (
[0381] This lead us to the assumption that while the correct antibody is needed for the detection of the intended target cell surface molecules, two additional preconditions to effectively bind and complex siRNA and target it to the oncogenic molecules for therapeutic efficacy must be fulfilled: a) protamine conjugated to the targeting antibody and b) a sufficient residual amount of unbound SMCC-protamine present in the mixture. Free SMCC-protamine without the antibody-coupled carrier could not fulfil these requirements.
[0382] The next question to be answered was which modified assembly structure of our carrier system could explain without contradiction all in vitro and in vivo efficacy results observed in our studies.
Example 9: Detection and Visualization of an Unexpected Electrostatic Macrostructure Forming a Stable Nanoparticle
[0383] The intracellular antibody-protamine-siRNA complexes are easily identified in treated cell culture samples, if the corresponding cell surface receptor or molecule is expressed, such as depicted in
Example 10: No Internalisation of Antibody-Protamine-siRNA Complexes without Free SMCC-Protamine or of Free SMCC-Protamine-siRNA Alone in Target Cells
[0384] Interestingly, typical internalized vesicular structures were only seen, if residual SMCC-protamine from the conjugation protocol was left in the mixture (
[0385] We performed this also with other antibody-SMCC-protamine complexes in comparison to their counterparts that were depleted from free SMCC-protamine via IPLC and with free SMCC-protamine: no internalisation could be observed in any cell line with antibody-protamine-siRNA complexes without free SMCC-protamine nor with free SMCC-protamine only (
Example 11: Formation of Vesicular Structures In Vitro by Antibody-Protamine-siRNA Complexes
[0386] Whenever we performed negative control experiments, i.e. treating cells NOT expressing the EGF receptor with effective conjugates targeting the EGF receptor, we consequently observed extremely low cellular targeting efficiencies (
[0387] Therefore, we assumed the 3 components 1. cetuximab-SMCC-protamine, 2. siRNA and 3. unbound SMCC-protamine to form a kind of stable macrostructure necessary for activity. To verify the existence of such a macrostructure that is responsible for the efficiency of the IgG-protamine-siRNA, we applied particle size detection by means of dynamic light scattering (DLS) on a zeta-counter (MALVERN), which correlates light diffusion caused by particles in a solution. The results were intriguing: As a dynamic process, the components, which are of completely plausible sizes (22 nm for the IgG-protamine-protamine-siRNA monomer) spontaneously assemble to nanostructures greater 400 nm in size after a few hours, while this process is not detectable in protamine-depleted preparations (
[0388] This process is time-dependent and the larger structures only form after certain times of incubation (
[0389] Based upon these measurements, we hypothesized that the antibody-protamine/free SMCC-protamine/siRNA complexes form outside cells and independently of a cellular context. To visualize these complexes, we incubated different complex compositions without cells using Alexa488-siRNA on coated chamber slides overnight and fixed the developed structures at next day. Fluorescence microscopy revealed that vesicular structures only form when the 3 components find each other: 1. antibody-SMCC-protamine, 2. free SMCC-protamine, 3. siRNA (see
[0390] All antibody-protamine complexes with free SMCC-protamine do form vesicular nanostructures, whereas without free SMCC-protamine or SMCC-protamine alone did not form any nanostructure (
[0391] In detail, the nanostructures resemble a spheroid shape of micrometre size, formed by the three components mAB-SMCC-protamine, unconjugated SMCC-protamine and the Alexa488-labeled siRNA (
[0392] The results are summarized in the following Table.
TABLE-US-00002 Dynamic light Microscopic Sample scattering analysis synopsis Cetuximab-SMCC- 512 22 nm >0.5 m, <2 m >0.2 m <5 m protamine + siRNA CD20-SMCC- 607 31 nm >0.5 m <2 m >0.2 m <5 m protamine + siRNA CD20-SMCC- No visible protamine (SMCC- vesicles protamine depleted) + siRNA CD20-SMCC- No visible protamine vesicles
Example 12: Vesicular Structures In Vitro Occurs at Different Temperatures
[0393] We also tested if the formation of vesicular structures is dependent on a certain temperature. In fact, they are formed at 4 C., at room temperature (22 C.) and at 37 C. (
Example 13: The Formation of Functional Vesicular Structures In Vitro by Antibody-Protamine-siRNA Complexes Depends on the Amount of Free SMCC-Protamine
[0394] To further elucidate the function of SMCC-protamine coupled to the antibody and as free molecule within the complex, we titrated the amount of SMCC-protamine added to the antibody, here: the anti-EGFR-antibody cetuximab. We used a constant amount of cetuximab and added molar ratios of 1:1 up to 1:100 of SMCC-protamine (for details see (
[0395] We analysed the siRNA binding capacity of these different conjugations by our routine bandshift assays (
[0396] We further analysed the properties of the different conjugation products according to their capacity to form vesicular-structures without cells when these conjugation products were incubated with Alexa488-control-siRNA (
[0397] As a functional assay, we compared the efficiency of the different conjugation products to inhibit the colony formation of A549 cells upon knockdown of the oncogene KRAS. We also compared this to the equal amount of free SMCC-protamine without conjugated cetuximab to elucidate the impact of the unbound SMCC-protamine alone (
Example 14: Free SMCC-Protamine can be Re-Added to the SMCC-Protamine-Depleted Antibody-Protamine Conjugates to Form Vesicular Structures In Vitro and Free SMCC-Protamine can be Substituted by Free Protamine
[0398] To further elucidate the function of SMCC-protamine coupled to the antibody and as free molecule within the complex, we titrated the amount of SMCC-protamine added to the antibody-protamine-conjugates that were depleted from free SMCC-protamine by HPLC. These antibody-protamine conjugates are not able to form vesicular structures with fluorescent siRNA as depicted in
Example 15: Formation of Vesicular Structures In Vitro by Antibody-Protamine-siRNA and/or SM-1/RF Complexes
[0399] To test this new and unexpected nanostructure model we used the structurally completely different, but electrostatically equally charged molecule SM-1/RF (see Example 8) and complexed it to antibody-protamine conjugates (
[0400] During the inspection of the results of the cell-free assembly of mAB-protamine-SM-1/RF-conjugates with and without additional siRNA, we observed marked differences in the quantity and size of the respective nanostructures: Those assembled by siRNA AND the SM-1/RF complexed by mAB-protamine plus free SMCC-protamine were considerably larger and more frequent than without siRNA (
[0401] This phenomenon that mixed antibody-protamine particles are more frequent and much larger than those with only SM-1/RF complexed to the mAB-protamine could be seen both with anti-CD20-mAB rituximab (
[0402] This means that the negatively charged SM-1/RF can form small vesicles with antibody-protamine complexes (
[0403] The large micellar structures as seen in
[0404] We further confirmed this observation by laser scan microscopy (LSM,
Example 16: Proposed Model
[0405] Taken together, the principle of binding anionic cargo molecules by a carrier-antibody-protamine plus unbound protamine can be applied also to cargos other than siRNA-nucleic acids. Here, it is important to modify the cargo molecule to give it a polyanionic character, and to leave unbound protamine-SMCC in the preparation to enable a strong electrostatic coordination and self-assembly of the reactants.
[0406] This observation strongly supports the new and unexpected macromolecular nanostructure as being potentially necessary and sufficient for the in vitro and in vivo pharmacodynamic efficacy of our carrier system.
[0407] Therefore, we hypothesize the combination of the components 1. antibody-protamine, 2. siRNA/anionic small molecule inhibitor and 3. unbound (SMCC-)protamine to form a nanoparticle-like macrostructure, which is responsible for the stability of siRNA and can effectivity deliver siRNA and/or anionic small molecule inhibitors to the intended cells, which is a totally unexpected observation. An illustrative and idealized model of this nanostructure assembly is shown in
[0408] In conclusion, experiments using various chemically different effector pay loads with the minimal common denominator requirement of being poly-anionic and no other structural similarity, lend experimental evidence for our new and unexpected nanostructure model as being the basis for the in vitro and in vivo pharmacodynamic characteristics of our antibody-SMCC linker-protamine siRNA carrier and our antibody-SM-1/RF system.
[0409] This modular nanostructure system with dual specificity, 1. for siRNA/anionic small molecule transport and specific delivery to target cells and 2. for specific intracellular oncogene inactivation can be used for various disease groups including cancer.
Example 17: Coupling Antisense Oligonucleotides to Antibody-Protamine Conjugate
[0410] To check if the antibody-protamine nanoparticle can also be used to transport single-stranded oligonucleotides, which are currently used as an alternative tool to knockdown gene expression. These synthetic antisense single-stranded oligonucleotides (ASO) are as short as siRNA and it is hypothesized that they bind to the EGFR-mAB-protamine conjugate analogous to siRNA. We therefore performed a band shift assay using a control ASO and saw that 1 mol EGFR-mAB-protamine conjugate can bind at least 8 to 32 mol of ASO when incubated for one hour at room temperature or five minutes at 37 C. (
Example 18: Synthesis of the Small Molecular Weight Poly-Anionic Drug Ibrutinib-Cy3.5 (RMA561)
[0411] Ibrutinib is a covalent binder of the Bruton's kinase. Ibrutinib is used in some lymphoma subtypes and blocks signal transduction downstream of the B-cell receptor by covalent addition to a cysteine in an ATP binding pocket in the soluble Bruton's kinase. Ibrutinib can have severe side effects such as infections, pneumonitis, or arrhythmias as ibrutinib does not only target lymphoma cells, but also BTK in normal cells (Wilson et al. 2015). The latter leads to higher dosage, interception by irrelevant cells and in addition to adverse effects, which could be partly due to the bystander effects on targets other than BTK (Byrd et al. 2013). Next, prolonged ibrutinib dosage can lead to development of resistance (Lenz 2017). Here, we first tried to conjugate ibrutinib by means of advanced linker chemistry to a suitable carrier antibody, rituximab which targets CD20 and is part of the standard therapy in DLBCL. The conjugation was successful, but it changed the solubility of the conjugate and thus proved to be not further exploitable.
[0412] Therefore, we converted the uncharged ibrutinib to the strongly anionic compound Cy3.5-RMA561, herein referred to as ibrutinib-Cy3.5, which allowed to bind it by means of electrostatic force to our protamine-based carrier system in order to form an antibody-inhibitor-complex The cyanine dye Cy3.5 exhibits strong anionic character by exposing four sulfonic acid groups as potential binders (
[0413] The Boc-protected derivative 5 (8.2 mg, 0.014 mmol, 1.05 eq.) was dissolved in 0.5 mL dry dichloromethane (dried on mol. sieves 4A), hydrogen chloride 4M solution in dioxane (41 L, 0.166 mmol, 12 eq.) was added and reaction mixture was stirred at room temperature until complete conversion of 5 into the free amine (tracking by TLC: silica, solvent: 10% MeOH/EtOAc, detection: UV254 and ninhydrin staining). The reaction mixture was evaporated on vacuum with heating to 35 C. The residual white solid was dissolved in 0.5 mL anhydrous dimethylformamide and to that solution was added the NHS ester of Cy3.5 (sulfo-Cy3.5 NHS ester by Lumiprobe; 15 mg, 0.014 mmol, 1.0 eq.) dissolved in 0.5 mL anhydrous dimethylformamide and N,N-diisopropylethylamine (72 L, 0.414 mmol, 30 eq.). The reaction mixture was stirred protected from light at room temperature until completion of reaction, controlled by TLC analysis (RP C-18, solvent: MeOH/H2O/AcOH 10/0.5/0.2 v/v/v, detection: UV-VIS and ninhydrin staining). The reaction mixture was evaporated on vacuum with heating to 35 C. and the residue was triturated with pentane, diethyl ether, ethyl acetate and dried in vacuum at room temperature to give 21 mg of crude product (Cy3.5-RMA561) in form of violet solid.
[0414] Analytically pure sample was prepared by chromatographic purification of crude product on 12 g C18 SPE cartridge. Cartridge was preconditioned by washing with water (10 mL). Crude product was divided in two parts, each dissolved in 0.5 mL water, loaded on the cartridge and then washed with water (10 mL) and further with acetonitrile (10 mL) to remove impurities and side products of the reaction. After that, product was eluted with mixture ACN/H2O 1:1 (v/v) in a few fractions containing exclusively pure Cy3.5-RMA561. After lyophilisation 28 mg of pure product Cy3.5-RMA561 as violet solid was obtained.
[0415] Besides the strong polyanionic character of the Cy3.5 dye, the conjugate had the advantage of being easily traceable in vitro and in vivo in form of a red fluorescence.
Example 19: Analysis of Antibody-Protamine/Protamine Complex Formation with Ibrutinib-Cy3.5 In Vitro
[0416] First, we performed experiments to characterize the binding between ibrutinib-Cy3.5 and two carrier systems, the both antibodies (rituximab and cetuximab) chemically conjugated by the bifunctional cross-linker sulfo-SMCC to protamine, namely rituximab (anti-CD20-mAB)-protamine, containing unbound protamine-SMCC and the cetuximab (anti-EGFR-mAB)-protamine, containing unbound protamine-SMCC in Bandshift assays. Both carrier-conjugates containing unbound protamine-SMCC showed a strong co-assembly of the ibrutinib-Cy3.5 derivate and, due to its low molecular weight as compared to siRNA (appr. 13 kDa), an extremely high mol/mol ratio of electrostatic saturation, exceeding 100 mol ibrutinib-Cy3.5 per mol of carrier mAB (
[0417] The corresponding conjugates rituximab- and cetuximab-protamine, both containing unbound protamine-SMCC loaded with a sub-critical 20 excess of ibrutinib-Cy3.5 were incubated with CD20 and EGFR-expressing cell lines and analysed for intracellular enrichment of ibrutinib-Cy3.5. In both cases, intracellular enrichment of fluorescence signals at the typical Cy3.5 excitation/emission wavelength combination could be documented (
[0418] Next, we confronted DLBCL cell lines with the ibrutinib-Cy3.5 derivative coupled to rituximab carrier antibody, lysed the cells and subjected the lysate to SDS PAGE analysis. The gel was then UV-illuminated and scanned for emission from Cy3.5 chromophore, and indeed, there was a single protein band at 70 kDa emitting Cy3.5 fluorescence, which later was identified for being Bruton's kinase BTK by western bot analysis (
[0419] In conclusion, the chemical modification of the ibrutinib core structure to a polyanionic derivative does not alter the efficiency of the conjugate to bind Bruton's kinase BTK.
[0420] Next, we planned functional assays for identifying the effectivity of the antibody-inhibitor-complexes. DLBCL tumor cells were seeded in methylcellulose to form anchorage-free colony growth as a substitute marker for tumorigenicity. Assays were treated with combinations of antibody-inhibitor complexes and compared with appropriate control groups. It became evident, that HBL-1 cells, high in CD20-expression, formed only 30% of colonies when treated with rituximab-protamine/protamine with ibrutinib-Cy3.5 as compared to the control groups without the carrier mAB. In contrast, unconjugated rituximab had only a mild effect on colony growth. Additionally, in A549 NSCLC cells, high in EGFR-expression but low in CD20-expression (
[0421] As seen from results of our antibody-protamine/free protamine-SMCC/siRNA conjugation experiments, we hypothesized, that the presence of unbound/free protamine-SMCC in the CD20mAB-protamine-ibrutinib-Cy3.5-protamine adduct could be as important as in the siRNA adducts, so we depleted free protamine-SMCC from the rituximab-CD20 mAB preparation by affinity chromatography as done before. As expected, the depleted preparation (
Example 20: Analysis of Antibody-Protamine/Free Protamine-SMCC Complex Formation with Ibrutinib-Cy3.5 In Vivo
[0422] In order to further characterize the therapeutic in vivo efficacy of rituximab-protamine/free protamine/ibrutinib-Cy3.5 carrier in comparison to all necessary component controls, we performed in vivo treatment experiments as depicted (see
[0423] Therefore, rituximab-protamine/free protamine/ibrutinib-Cy3.5 1:20 complex in an in vivo model, showed significantly superior targeting and therapeutic profile in comparison to all appropriate component controls. Furthermore, the applied single doses of ibrutinib were in the range of twentyfold lower (12.5 nmol of ibrutinib corresponds to 0.720 mg/kg mouse, the standard dose is 12 mg/kg in Nod-SCID mice (Chen et al. 2016; Zhang et al. 2017).
[0424] In order to prove this hypothesis, we prepared organs from sacrificed mice and subjected them to ex vivo fluorescence detection of incorporated ibrutinib-Cy3.5 (
[0425] Moreover, no specific fluorescence was detected in the organs analyzed (
Example 21: Formation of Vesicular Structures In Vitro by Antibody-Protamine/Free Protamine-siRNA and/or Ibrutinib-Cy3.5 Complexes
[0426] To further characterize the new nanostructure, we used electrostatically charged green-fluorescent siRNAs and red-fluorescent ibrutinib-Cy3.5 and complexed it to antibody-protamine/free protamine-SMCC conjugates (
[0427] During the inspection of the results of the cell-free assembly of mAB-protamine/free protamine/ibrutinib-Cy3.5conjugates with and without additional siRNA, we observed marked differences in the quantity and size of the respective nanostructures: those assembled by siRNA AND the ibrutinib-Cy3.5 complexed by mAB-protamine plus free protamine-SMCC were considerably larger and more frequent than without siRNA (
[0428] This phenomenon that mixed antibody-protamine particles are more frequent and much larger than those with only ibrutinib-Cy3.5 complexed to the mAB-protamine/protamine carrier could be seen both with CD20-mAB rituximab (
[0429] This means that the negatively charged ibrutinib-Cy3.5 can form small vesicles with antibody-protamine complexes (
[0430] To further characterize this structure, we performed measurements of particle sizes using a ZetaView nanoparticle tracking video-microscope. Here, particles between 1 and 1000 nm were detected and analysed for their size and number (
Example 22: Complexation of Anionic Small Molecular Drugs by Carrier-Antibody-Protamine Fusions or Antibody-Protamine Conjugates
[0431] Concerning the complexation of anionic small molecules, we found that CD20-mAB rituximab-protamine/free protamine-SMCC (CD20-mAB-P/P) conjugates bind ibrutinib-Alexa488 in a Bandshift assay using CD20-mAB-protamine using different ratios of ibrutinib-Alexa488 up to 1:2. , anti. (
[0432] The building of an antibody-inhibitor-complex in form of a stable nanoparticle could be detected in fluorescence microscopy (
[0433] When incubated in vitro, CD20-mAB-P/P loaded with ibrutinib-Cy3.5 led to the assembly of electrostatically stabilized nanoparticles exposing red Cy3.5 fluorescence (
[0434] Concerning the comparison of anionic charged small molecules versus uncharged small molecules in terms of complexation with protamine conjugates, we found that charged ibrutinib-Cy3.5, but not uncharged ibrutinib (trade name: imbruvica) forms stable nanoparticles with protamine-conjugated mABs. The respective antibody carriers, conjugated to protamine were loaded with charged ibrutinib-Cy3.5 versus uncharged ibrutinib. Of note, only those ibrutinib samples conjugated with Cy3.5 showed a dense formation of nanoparticles, but not uncharged ibrutinib (
Example 23: Proposed Model
[0435] Taken together, the principle of binding anionic cargo molecules by a carrier consisting of antibody-protamine plus unbound protamine can be applied also to cargos other than siRNA-nucleic acids, such as small molecules, e.g. the kinase inhibitor ibrutinib. Here, it is important to modify the cargo molecule to give it a polyanionic character, and to leave unbound protamine-SMCC in the preparation to enable a strong electrostatic self-assembly of the components into the nano-structure.
[0436] This observation strongly supports that the new and unexpected macromolecular nanostructure is responsible for the in vitro and in vivo pharmacodynamic efficacy of our carrier system.
[0437] Therefore, we expect the combination of the components 1. antibody-protamine, 2. siRNA/anionic small molecule and 3. unbound protamine(-SMCC) to form a nanoparticle-like macrostructure, which is responsible for the stability of siRNA and can effectivity deliver siRNA and/or anionic small molecule inhibitors to the intended cells, which is a totally unexpected observation. An idealized model of this nanostructure assembly is shown in
[0438] In conclusion, experiments using various chemically different effector pay loads with the minimal common denominator requirement of being poly-anionic and no other structural similarity, lend experimental evidence for our new and unexpected nanostructure model as being the basis for the in vitro and in vivo pharmacodynamic characteristics of our nanocarrier-siRNA carrier and our nanocarrier-ibrutinib-Cy3.5 system.
[0439] This modular nanostructure system with dual specificity, 1. for siRNA/anionic small molecule transport and specific delivery to target cells and 2. for specific intracellular oncogene inactivation or pharmacological activity can be used for various disease groups including cancer.
Example 24: Functional Analysis of the CD20-mAB-P/P-Ibrutinib-Cy3.5 Nanocarrier In Vitro
[0440] Next, the efficacy of this CD20-mAB-P/P-ibrutinib-Cy3.5 nanocarrier in different cellular model systems was investigated.
[0441] First, the internalisation into CD20-positive DLBCL cells via Cy3.5 fluorescence was examined. HBL1 and TMD-8 lymphoma cells treated overnight with uncoupled ibrutinib-Cy3.5 show decent red fluorescence marking of cells (white in
[0442] Moreover, HBL1 cells were incubated with ibrutinib-bodipy for 2 h, washed and treated with CD20-mAB-P/P-ibrutinib-Cy3.5. Cells incorporate ibrutinib-bodipy (FIGS. 66 N and P), but Cy3.5 fluorescence only appears in non-pretreated cells (
[0443] The functional effect of covalent targeting of BTK by ibrutinib is the inhibition of BTK autophosphorylation ability. Therefore, the phosphorylation status of BTK in DLBCL cells after ibrutinib-Cy3.5 treatment with and without complexation in the CD20-mAB/P/P nanocarrier was analysed (
[0444] Interestingly, in all tested lymphoma cell lines, the lymphoma-specific CD20-mAB-P/P/ibru-Cy3.5 nanocarrier system significantly inhibited colony growth in soft agar cultures. This was observed to a much lesser degree for ibrutinib or ibrutinib-Cy3.5 as single agents, and not if unmodified rituximab (CD20-mAB) was used (HBL1:
[0445] Next, the functional consequences of BTK inactivation by CD20-mAB-P/P-ibrutinib-Cy3.5 on DLBCL cell lines in terms of induction of apoptosis was explored. Here, in HBL1 (
Example 25: Ewing Sarcoma Xenograft Tumor Growth is Inhibited Upon Knockdown of Oncogenic EWS-FLI1 Translocation Product Through Systemic Therapy with IGF1R-mAB-Protamine-siRNA-Protamine Nano-Carriers
[0446] To test the in vivo-efficacy of teprotumumab-protamine nanocarriers, 107 human SK-N-MC cells were subcutaneously (s.c.) xenotransplanted into the flank of CD1-nude mice and treated cohorts of at least 7 mice with either PBS or IGF1R-mAB-P/P in complex with scrambled control-siRNA, or in complex with the above mentioned EWS-FLI1-siRNA i.p. (
Example 26: Nanoparticles Formed by Carrier Antibodies-Protamine/Free Protamine and siRNA Expose an Almost Neutral Surface Charge
[0447] The formation of nanoparticles from antibody-protamine/free protamine plus siRNA was found to be rapid and reproducible, but depending on the antibody preparation. For instance, different -IGFR-protamine preparations tended towards larger particles than those formed by EGFR-protamine preparations or CD33-preparations, seen by DLS analysis (
Example 27: Deciphering Preconditions for Effective Nanoparticle Formation Between Anti-EGFR-mAB-SMCC-Protamine Conjugate, Free SMCC-Protamine and siRNA
[0448] Moreover, it was assessed if siRNA is needed to form vesicles. A constant amount of EGFR-mAB-P with constant 32 free SMCC-protamine was incubated with different amounts of Alexa488-control-siRNA (
Example 28: Nanoparticles Formed by EGFR-Protamine/Free Protamine Free Protamine-Alexa488-siRNA are Stable in Serum-Containing Conditions
[0449] For a systemic therapeutic application of a targeted nanoparticle, its stability in various challenging conditions is of highest importance, otherwise the active substance would be separated from the nanocarrier by disintegration. Here, the EGFR-mAB-protamine, free protamine and Alexa488-siRNA were tested for stability in a high concentration of bovine serum albumin and the nanocarrier proved to be stable even after 24 hrs (
Example 29: Serum Stability of the CD20-mAB-Protamine/Free P-Ibrutinib-Cy3.5 Nanocarrier
[0450] The building of an CD20-mAB-protamine/free P-ibrutinib-Cy3.5 antibody-inhibitor-complex in form of a stable nanoparticle could be detected in fluorescence microscopy (
Example 30: pH Stability of siRNA Nanocarriers Constructed with Three Different Targeting Antibodies
[0451] For a systemic application of the nanocarriers, it is important under which pH conditions the structures are stable, in order to prevent a premature disassembly and loss of coordinated siRNA effector molecule. Here, we formed siRNA nanocarriers with three different targeting antibodies and siRNA under standard conditions and tested them for integrity under pH conditions ranging between pH 4.8 and 8.0 (
Example 31: pH Stability of Nanocarriers Constructed with CD20-mAB-Protamine/Free Protamine and Ibrutinib-Cy3.5
[0452] Here, ibrutinib-Cy3.5 nanocarriers were formed with CD20-mAB-protamine/free protamine under standard conditions and tested them for integrity under pH conditions ranging between pH 4.8 and 8.0, thus covering all pH conditions the nanocarrier may be challenged with during therapeutic application (
Example 32: Immunolabeling of Targeting IgG Antibodies in EGFR-mAB-P/Free Protamine-siRNA Nanocarriers and in IGF1R-mAB-P/Free Protamine siRNA Nanocarriers
[0453] The auto-assembly process of the cationic antibody-protamine/free protamine preparation and the siRNA leads to a nanoparticle structure with defined architecture: Here, EGFR-mAB-protamine/free protamine-siRNA nanoparticles (
Example 33: Visualisation of the Free Protamine in the Nanocarrier Complex
[0454] The position of the important free protamine in the nanocarrier remained unclear so far, so we turned towards this point and replaced the free protamine of a give EGFR-protamine preparation with protamine that was conjugated to Cy3-NHS ester (
Example 34: Synthesis of Cyanine-Dye Conjugated Inhibitors Gefitinib, Gemcitabine and Venetoclax
[0455] To this end, the synthesis of the three new compounds are to be conducted, each connected to two different cyanine dyes, sulfo-Cy3.5 (excitation 591 nm/emission 604 nm) and sulfo-Cy5.5 (ex 684 nm, em 710 nm). Both cyanine dyes share the identical core fluorophore structure exhibiting the four strongly anionic sulfonyl groups necessary for the protamine cationic peptide coordination, but differ only in the number of conjugated double bonds, leading to discriminable fluorochrome attributes. Analogously to ibrutinib, three different drug-dye-conjugates are to be synthesized with comparable overall molecular shape. As possible candidates gefitinib (EGFR inhibitor), gemcitabine (cytostatic drug) and venetoclax (BLCL-2 inhibitor) were chosen because in all cases, they retained their binding potency to the target molecule after conjugation to dyes and allow fluorescence imaging applications (Wu et al. 2020; Zhu et al. 2018; Gonzales et al. 2018). They are to be conjugated to the cyanine dyes by installing a PEG4-spacer and using commercially available reactive NHS-ester or azido functionalized dyes (see
[0456] First, the gefitinib analog is to be synthesized starting with the commercially available gefitinib 1, which will be demethylated and the resulting phenol will be converted by nucleophilic attack of an azido-PEG4-mesylate. The resulting azide will be reduced to the amine 2 and labelled with sulfo-Cy3.5 or sulfo-Cy5.5 yielding the gefitinib-conjugates for further complexation into the nanocarrier.
[0457] For gemcitabine 3, the hydroxyl groups will be protected and a leaving group will be installed on the cytosine to get after nucleophilic attack of propargyl amine the alkyne 4. (Solanki et al. 2020). After labelling with the corresponding azido functionalized cyanine dyes by click-reaction, the needed conjugates will be obtained.
[0458] In terms of the third example venetoclax, it will be started with the synthesis of the known venetoclax core-structure 5. (Giedt et al. 2014) The sulfonamide 6 will be reached in three steps using the already mentioned mesyl-PEG4-azide and after connection to 5, reduction of the azide and subsequent labelling with the cyanine dyes (NHS-ester) yield the corresponding venetoclax conjugates for further evaluation.
Example 35: Expanding the Concept to Easier and Cheaper Polyanionic Molecular Moieties and Also to Other Therapeutic Interventions Like PDT and Radiotherapy
[0459] After the conversion and evaluation of the electrostatic binding principle to other anticancer drugs with different binding motifs and targets it is intended to change the necessary anionic character from the cyanine dyes used here (important for initial optical characterization and fluorescence imaging) to (1) easier accessible electrostatic connectors in terms of easier and cheaper synthesis, to facilitate a translation into the clinical evaluation. Candidates for this are poly-sulfated mono-, di- and branched oligosaccharides or mono-, di- and triphosphates which could pave the way for large scale synthesis (
[0460] The invention illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by exemplary embodiments and optional features, modification and variation of the inventions embodied therein herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.
[0461] The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.
[0462] Other embodiments are within the following claims.
NON-PATENT REFERENCES
[0463] Arvand, A., and Denny, C. T. (2001). Biology of EWS/ETS fusions in Ewing's family tumors. Oncogene 20, 5747-5754. [0464] Bumer, N., Appel, N., Terheyden, L., Buchholz, F., Rossig, C., Mller-Tidow, C., Berdel, W. E., and Bumer, S. (2016). Antibody-coupled siRNA as an efficient method for in vivo mRNA knockdown. Nat. Protoc. 11, 22-36. [0465] Bumer, N., Berdel, W. E., and Bumer, S. (2017). Immunoprotein-Mediated siRNA Delivery. Mol. Pharm. 14, 1339-1351. [0466] Bumer, N., Rehkmper, J., Appel, N., Terheyden, L., Hartmann, W., Wardelmann, E., Buchholz, F., Mller-Tidow, C., Berdel, W. E., and Bumer, S. (2018). Downregulation of PIK3CA via antibody-esiRNA-complexes suppresses human xenograft tumor growth. PLoS One 13, e0200163. [0467] Bumer, S., Bumer, N., Appel, N., Terheyden, L., Fremerey, J., Schelhaas, S., Wardelmann, E., Buchholz, F., Berdel, W. E., and Mller-Tidow, C. (2015). Antibody-Mediated Delivery of Anti-KRAS-siRNA In Vivo Overcomes Therapy Resistance in Colon Cancer. Clin Cancer Res 21, 1383-94. [0468] Bose, P., and Grant, S. (2013). Mcl-1 as a Therapeutic Target in Acute Myelogenous Leukemia (AML). Leuk Res. Rep. 2, 12-14. [0469] Byrd, J. C.; Furman, R. R.; Coutre, S. E.; Flinn, I. W.; Burger, J. A.; Blum, K. A. et al. (2013): Targeting BTK with ibrutinib in relapsed chronic lymphocytic leukemia. In: N. Engl. J. Med. 369 (1), S. 32-42. DOI: 10.1056/NEJMoa1215637. [0470] Chen, J.; Kinoshita, T.; Sukbuntherng, J.; Chang, B. Y.; Elias, L. (2016): Ibrutinib Inhibits ERBB Receptor Tyrosine Kinases and HER2-Amplified Breast Cancer Cell Growth. In: Mol. Cancer. Ther. 15 (12), S. 2835-2844. [0471] Chen, X., Stewart, E., Shelat, A. A., Qu, C., Bahrami, A., Hatley, M., Wu, G., Bradley, C., McEvoy, J., Pappo, A., et al. (2013). Targeting oxidative stress in embryonal rhabdomyosarcoma. Cancer. Cell. 24, 710-724. [0472] Choi, Y. S., Lee, J. Y., Suh, J. S., Kwon, Y. M., Lee, S. J., Chung, J. K., Lee, D. S., Yang, V. C., Chung, C. P., and Park, Y. J. (2009). The systemic delivery of siRNAs by a cell penetrating peptide, low molecular weight protamine. Biomaterials 31, 1429-43. [0473] Chono, S., Li, S. D., Conwell, C. C., and Huang, L. (2008). An efficient and low immunostimulatory nanoparticle formulation for systemic siRNA delivery to the tumor. J. Control. Release 131, 64-69. [0474] Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E., and Mello, C. C. (1998). Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391, 806-11. [0475] Giedt, R. J., Sprachman, M. M., Yang, K. S. & Weissleder, R. Imaging cellular distribution of Bcl inhibitors using small molecule drug conjugates. Bioconjug. Chem. 25, 2081-2085; 10.1021/bc500433k (2014). [0476] Gonzales, J. et al. Nanoemulsion-Based Delivery of Fluorescent PARP Inhibitors in Mouse Models of Small Cell Lung Cancer. Bioconjug. Chem. 29, 3776-3782; 10.1021/acs.bioconjchem.8b00640 (2018). [0477] Ha, H. T., Griffith, K. A., Zalupski, M. M., Schuetze, S. M., Thomas, D. G., Lucas, D. R., Baker, L. H., and Chugh, R. (2013). Phase II trial of cetuximab in patients with metastatic or locally advanced soft tissue or bone sarcoma. Am. J. Clin. Oncol. 36, 77-82. [0478] Hansen, B., Linde, S., Kolendorf, K., and Jensen, F. (1979). Absorption of protamine-insulin in diabetic patients. I. Preparation and characterization of protamine-125I-insulin. Horm. Metab. Res. 11, 85-90. [0479] Hauser, P. V., Pippin, J. W., Kaiser, C., Krofft, R. D., Brinkkoetter, P. T., Hudkins, K. L., Kerjaschki, D., Reiser, J., Alpers, C. E., and Shankland, S. J. (2010). Novel siRNA delivery system to target podocytes in vivo. PLoS One 5, e9463. [0480] He, H., Ye, J., Liu, E., Liang, Q., Liu, Q., and Yang, V. C. (2014). Low molecular weight protamine (LMWP): a nontoxic protamine substitute and an effective cell-penetrating peptide. J. Control. Release 193, 63-73. [0481] Herrmann, D., Seitz, G., Warmann, S. W., Bonin, M., Fuchs, J., and Armeanu-Ebinger, S. (2010). Cetuximab promotes immunotoxicity against rhabdomyosarcoma in vitro. J. Immunother. 33, 279-286. [0482] Kikuchi, K., Tsuchiya, K., Otabe, O., Gotoh, T., Tamura, S., Katsumi, Y., Yagyu, S., Tsubai-Shimizu, S., Miyachi, M., Iehara, T., and Hosoi, H. (2008). Effects of PAX3-FKHR on malignant phenotypes in alveolar rhabdomyosarcoma. Biochem. Biophys. Res. Commun. 365, 568-574. [0483] Kim, E.; Yang, K. S.; Kohler, R. H.; Dubach, J. M.; Mikula, H.; Weissleder, R. (2015): Optimized Near-IR Fluorescent Agents for in Vivo Imaging of Btk Expression. In: Bioconjug. Chem. 26 (8), S. 1513-1518. DOI: 10.1021/acs.bioconjchem.5b00152. [0484] Lenz, G. (2017): Deciphering Ibrutinib Resistance in Chronic Lymphocytic Leukemia. In: J. Clin. Oncol. 35 (13), S. 1451-1452. DOI: 10.1200/JCO.2016.72.0102. [0485] Liu, B. (2007). Exploring cell type-specific internalizing antibodies for targeted delivery of siRNA. Brief Funct. Genomic Proteomic 6, 112-119. [0486] Liu, L., Wang, Y. D., Wu, J., Cui, J., and Chen, T. (2012). Carnitine palmitoyltransferase 1A (CPT1A): a transcriptional target of PAX3-FKHR and mediates PAX3-FKHR-dependent motility in alveolar rhabdomyosarcoma cells. BMC Cancer 12, 154-2407-12-154. [0487] Paulussen, M., Ahrens, S., Craft, A. W., Dunst, J., Frohlich, B., Jabar, S., Rube, C., Winkelmann, W., Wissing, S., Zoubek, A., and Jurgens, H. (1998). Ewing's tumors with primary lung metastases: survival analysis of 114 (European Intergroup) Cooperative Ewing's Sarcoma Studies patients. J. Clin. Oncol. 16, 3044-3052. [0488] Paulussen, M., Bielack, S., Jurgens, H., Jost, L., and ESMO Guidelines Working Group. (2008). Ewing's sarcoma of the bone: ESMO clinical recommendations for diagnosis, treatment and follow-up. Ann. Oncol. 19 Suppl 2, ii97-8. [0489] Smith, C. G., Fisher, D., Claes, B., Maughan, T. S., Idziaszczyk, S., Peuteman, G., Harris, R., James, M. D., Meade, A., Jasani, B., et al. (2013). Somatic profiling of the epidermal growth factor receptor pathway in tumors from patients with advanced colorectal cancer treated with chemotherapy+/cetuximab. Clin. Cancer Res. 19, 4104-4113. [0490] Solanki, A., King, D., Thibault, G., Wang, L. & Gibbs, S. L. Quantification of fluorophore distribution and therapeutic response in matched in vivo and ex vivo pancreatic cancer model systems. PLoS One 15, e0229407; 10.1371/journal.pone.0229407 (2020). [0491] Song, E., Zhu, P., Lee, S. K., Chowdhury, D., Kussman, S., Dykxhoorn, D. M., Feng, Y., Palliser, D., Weiner, D. B., Shankar, P., Marasco, W. A., and Lieberman, J. (2005a). Antibody mediated in vivo delivery of small interfering RNAs via cell-surface receptors. Nat Biotechnol 23, 709-17. [0492] Song, E., Zhu, P., Lee, S. K., Chowdhury, D., Kussman, S., Dykxhoorn, D. M., Feng, Y., Palliser, D., Weiner, D. B., Shankar, P., Marasco, W. A., and Lieberman, J. (2005b). Antibody mediated in vivo delivery of small interfering RNAs via cell-surface receptors. Nat Biotechnol 23, 709-17. [0493] Stevens, M. C. (2005). Treatment for childhood rhabdomyosarcoma: the cost of cure. Lancet Oncol. 6, 77-84. [0494] Turetsky, A.; Kim, E.; Kohler, R. H.; Miller, M. A.; Weissleder, R. (2014): Single cell imaging of Bruton's tyrosine kinase using an irreversible inhibitor. In: Sci. Rep. 4, S. 4782. DOI: 10.1038/srep04782. [0495] Verdine, G. L., and Walensky, L. D. (2007). The challenge of drugging undruggable targets in cancer: lessons learned from targeting BCL-2 family members. Clin. Cancer Res. 13, 7264-7270. [0496] Wilson, W. H.; Young, R. M.; Schmitz, R.; Yang, Y.; Pittaluga, S.; Wright, G. et al. (2015): Targeting B cell receptor signaling with ibrutinib in diffuse large B cell lymphoma. In: Nat. Med. 21 (8), S. 922-926. DOI: 10.1038/nm.3884. [0497] Wu, Q. et al. Development of small molecule inhibitor-based fluorescent probes for highly specific super-resolution imaging. Nanoscale 12, 21591-21598; 10.1039/d0nr05188h (2020). [0498] Zhang, Hui; Patel, Atish; Wang, Yi-Jun; Zhang, Yun-Kai; Kathawala, Rishil J.; Qiu, Long-Hui et al. (2017): The BTK Inhibitor Ibrutinib (PCI-32765) Overcomes Paclitaxel Resistance in ABCB1- and ABCC10-Overexpressing Cells and Tumors. In: Mol. Cancer. Ther. 16 (6), S. 1021-1030. DOI: 10.1158/1535-7163.MCT-16-0511. [0499] Zhu, D. et al. Cell- and Tissue-Based Proteome Profiling and Dual Imaging of Apoptosis Markers with Probes Derived from Venetoclax and Idasanutlin. Angewandte Chemie (International ed. in English) 57, 9284-9289; 10.1002/anie.201802003 (2018).