CELL CONSTRUCT COMPRISING SCHWANN CELLS OR SCHWANN CELL-LIKE CELLS AND A BIOCOMPATIBLE MATRIX

Abstract

A method for producing a cell construct including, contacting Schwann cells or Schwann cell-like cells with a biocompatible matrix, and subjecting to cultivation, where the cultivation is at least partially performed by administering mechanical stimulation on the cells in contact with the biocompatible matrix. A cell construct obtained by the method.

Claims

1. A method for producing a cell construct comprising: contacting Schwann cells or Schwann cell-like cells with a biocompatible matrix; and subjecting to cultivation, wherein the cultivation is at least partially performed by administering mechanical stimulation on the cells in contact with the biocompatible matrix.

2. The method according to claim 1, wherein the biocompatible matrix is selected from synthetic biomaterials, polysaccharides, and mixtures thereof.

3. The method according to claim 1, wherein the cultivation is performed in a bioreactor.

4. The method according to claim 1, wherein the biocompatible matrix is present in a three-dimensional form, wherein the three-dimensional form is a three-dimensional cylinder form, a three-dimensional cuboid form, a three-dimensional sheet form or a three-dimensional ring form.

5. The method according to claim 1, wherein the cultivation is performed for a duration of 3 to 60 days.

6. The method according to claim 1, wherein the mechanical stimulation on the cells in contact with the biocompatible matrix during cultivation is performed for a duration of 1 to 60 days.

7. The method according to claim 1, wherein the mechanical stimulation on the cells is performed by a static strain treatment or a ramp strain treatment.

8. The method according to claim 1, wherein the cultivation and mechanical stimulation is performed until bands of Büngner-like structures have formed.

9. The method according to claim 1, wherein the cell construct has a ratio of length to diameter or thickness of from 2:1 to 100:1.

10. The method according to claim 1, wherein the cultivation and mechanical stimulation are performed under aseptic conditions.

11. The method according to claim 1, wherein the mechanical stimulation is performed as a strain treatment of 1 to 50%.

12. The method according to claim 1, wherein the cell construct has a length of 1 mm to 30 cm.

13. The method according to claim 1, wherein the mechanical stimulation is performed on the construct with a Young's modulus of 5 to 50 kPa.

14. The method according to claim 1, wherein the mechanical stimulation is performed as an extrinsic deformation expressed as a percentual change of length in the load axis of 1 to 50%.

15. The method according to claim 1, wherein the mechanical stimulation is performed as an extrinsic deformation expressed as a percentual change of length in the load axis of at least 2%.

16. The method according to claim 1, wherein the mechanical stimulation is performed as an extrinsic deformation expressed as a percentual change of length in the load axis of at least 8%.

17. The method according to claim 1, wherein the construct is at least partially exposed to electrical stimulation.

18. A cell construct obtained by the method according to claim 1.

19. A cell construct comprising Schwann cells or Schwann cell-like cells and a biocompatible matrix, wherein the cell construct has a bands of Büngner structure.

20. The cell construct according to claim 18, wherein the construct is a nerve guidance graft.

21. The cell construct according to claim 18, wherein the construct has a three-dimensional cylinder form, a three-dimensional cuboid form, a three-dimensional sheet form or a three-dimensional ring form; and wherein the construct has a diameter or thickness of the cylinder or the ring or the longest extension of the cuboid or sheet of 0.5 mm to 25 mm.

22. A therapeutic treatment comprising, the cell construct according to claim 18.

23. A method of treating a Degree I to V injury comprising, administering the cell construct according to claim 18 to a patient in need thereof.

Description

[0087] The present invention is further exemplified by the following examples and the figures, yet without being limited thereto.

[0088] FIG. 1 shows that the differentiation of rat adipose-derived stem cells into Schwann cell-like cells requires the use of three different differentiation media. Cells are first incubated in growth medium supplemented with 1 mM β-mercaptoethanol for 24 hours (DM1), followed by preconditioning in growth medium containing 35 ng/μl all-trans retinoic acid for 72 hours (DM2). Afterwards, cells are cultivated in medium containing bFGF, PDGF, heregulin β1 as well as forskolin for at least 14 days (DM3), with media exchanges every third day. (DM—differentiation medium);

[0089] FIG. 2 shows the set-up of the MagneTissue bioreactor system. A: Ring-shaped fibrin hydrogels are cast using polyoxymethylene (POM) molds. B: Polymerized fibrin rings after casting. C: Schematic of the spool-hook system onto which ring-shaped fibrin hydrogels are mounted for the MagneTissue bioreactor. A magnet is integrated into the hook. The bar bottom right in the picture of the aligned cellular fibrin construct indicates 100 μm. D: The MagneTissue bioreactor consists of a sample holder row and a bottom plate with integrated magnets that interact with the magnets of the hooks, thereby enabling stretching of the constructs via magnetic force transmission when the bottom plate is moved up and down through a connected stepper motor.

[0090] FIG. 3 shows static, cyclic and ramp strain regimes applied to Schwann cell-embedded fibrin hydrogels. A: Constant static strain of 10% was applied 48 hours after casting of fibrin rings and maintained for another 48 hours, followed by an increase to 12% constant static strain until day 7. B: In the ramp strain group, scaffolds were subjected to 10% constant static strain 48 hours after casting, which was followed by an increase of static strain by 2% per day, resulting in a maximum of 20% strain exposed to the constructs on day 7. C: The cyclic strain regime consisted of a combination of both, static and cyclic strain. 48 hours after casting, 10% constant static strain was first applied for 2 days, after which the strain regime was switched to 2 repetitions each day of 0-12% cyclic strain at 250 mHz for 6 hours and subsequently a resting phase at 0-3% cyclic strain at 250 mHz for 6 hours (see close-ups). This cyclic strain protocol was maintained until day 7.

[0091] FIG. 4 shows the differentiation of rat adipose-derived stem cells (rASC) into Schwann cell-like cells. A: ASC were isolated from rat epididymal fat pads and show the typical flattened, spindle-shaped morphology. Cells were subsequently cultivated in Schwann cell differentiation medium containing a mix of different growth factors. B: After 20 days of differentiation, most cells have remodeled and obtained the typical Schwann cell morphology with a small and shiny cell body and long protrusions. Scale bars bottom right indicate 200 μm.

[0092] FIG. 5 shows that mechanical stimulation induces cellular alignment of putative Schwann cell-like cells. 250,000 cells were embedded in fibrin hydrogels and subjected to 10% static strain either constantly or for 6 hours a day, while floating rings served as controls. A, B: Cells cultured as floating controls oriented randomly inside the fibrin matrices. C, D: 10% static strain applied for 6 hours a day leads to minor alignment of putative Schwann cell-like cells along the axis of strain. E, F: In contrast, stimulation with 10% constant static strain generates highly aligned Schwann cell-like cell fibrin constructs, Cells were stained with phalloidin to visualize F-actin filaments. Arrows indicate the axis of strain. Scale bars bottom right indicate 200 μm.

[0093] FIG. 6 shows the isolation of Schwann cells. A: Sciatic nerves were isolated from rat Sprague Dawley rats. The arrow indicates the exposed sciatic nerve. B: Removal of the epineurium is critical to minimize potential fibroblast contamination. After epineurial removal, the individual nerve fascicles become visible (arrowheads).

[0094] FIG. 7 shows the different stages during primary Schwann cell culture and morphologic characteristics. A: Brightfield images of Schwann cell culture 5 days after isolation, showing the presence of both fibroblasts (arrowhead) as well as Schwann cells (arrow). B: On day 15, fibroblasts are no longer present while Schwann cells are proliferating and show their typical bipolar morphology. C: At confluency, Schwann cells exhibit their characteristic swirling pattern. Scale bars bottom right indicate 200 μm.

[0095] FIG. 8 shows isolated Schwann cells stained positively for the glial cell marker S100. A, B: Almost all cells obtained after Schwann cell isolation are stained positive for S100 (green), which is expressed both in the nuclei as well as in the cytoplasm. Note the different intensities of S100 expression among cells. Cells were counterstained with DAPI (blue) to visualize nuclei to distinguish between Schwann cells and S100 negative cells. Scale bars bottom right indicate 500 μm (A) and 200 μm (B).

[0096] FIG. 9 shows that primary cell isolations from rat sciatic nerves achieved highly pure Schwann cell cultures as analysed by flow cytometry. A: Representative Schwann cell flow cytometry dot plot with the gated population (“live cells 90.7”). The gate was set to include most viable cells, while excluding cell debris, dead cells, and duplets. This gate was used for analysis of S100 positive live cells. B: Representative flow cytometry histogram of S100-stained cells, showing that 99% of live cells expressed S100. Dashed line shows secondary antibody control staining, solid line shows specific S100 staining. C: Schwann cell purities obtained from 10 individual donors show that all isolations yielded purities of over 90%. D: Average S100 expression of all Schwann cell donors revealed that high Schwann cell purities of 97±2.4% were obtained.

[0097] FIG. 10 shows that application of 10% static strain induced both elongation and alignment of Schwann cells. 250,000 and 500,000 cells were embedded in ring-shaped fibrin hydrogels. A: Cells cultivated as floating controls were randomly distributed inside fibrin hydrogels. B, C: Conversely, application of 10% constant static strain induced alignment of Schwann cells. The effect of mechanical stimulation on cellular behaviour was assessed by immunolabeling with the glial marker S100 (green) together with a DAPI counterstain (blue) to visualize nuclei. Scale bars bottom right indicate 50 μm (A) and 100 (B, C) μm.

[0098] FIG. 11 shows that static strain induces adequate formation of aligned bands of Büngner-like structures in fibrin matrices containing 2×10.sup.6 cells. A: Cells cultivated as floating controls oriented randomly inside fibrin hydrogels. B, C: In contrast, 10% static mechanical stimulation generated highly aligned Schwann cell constructs. The effect of mechanical stimulation on cellular behaviour was assessed by immunolabeling with the glial marker S100 (green) together with a DAPI counterstain (blue) to visualize nuclei. Scale bars bottom right indicate 200 μm (A, B) and 100 μm (C).

[0099] FIG. 12 shows that different strain types strongly influence the degree of Schwann cell alignment. 3×10.sup.6 cells were embedded into fibrin hydrogels and after a resting phase of 48 hours subjected to either 10% static strain, which was increased to either 12% on day 4 (static strain) or switched to alternating phases of 0-12% cyclic strain followed by 0-3% cyclic strain for 6 hours each per day (cyclic strain). Additionally, a ramp strain regime was applied, increasing the static strain by 2% each day, finally resulting in 20% strain on day 7 (ramp strain). Rings cultivated floating in growth medium served as controls. While both, static and ramp strain induced pronounced alignment of Schwann cells along the axis of strain, application of cyclic strain only led to minor alignment. Cells were stained for the glial marker S100 (green) and nuclei were counterstained with DAPI. Arrows indicate the axis of strain. Scale bars bottom right indicate 200 μm (A, C, E, G) and 100 μm (B, D, F, H).

[0100] FIG. 13 shows that superior alignment of embedded Schwann cells can be achieved with ramp strain treatment compared to static strain. 3×10.sup.6, 4×10.sup.6, or 5×10.sup.6 cells were embedded into fibrin hydrogels and after a resting phase of 48 hours subjected to either 10% static strain, which was increased to either 12% on day 4 (static strain) or a ramp strain regime by increasing the static strain by 2% each day, finally resulting in 20% strain on day 7 (ramp strain). The most appropriate band of Büngner-like constructs were achieved upon ramp strain treatment of 4×10.sup.6 Schwann cells embedded in fibrin hydrogels. Cells were stained for the glial marker S100 (green) and nuclei were counterstained with DAPI. Arrows indicate the axis of strain. Scale bars bottom right indicate 100 μm.

[0101] FIG. 14 shows the influence of mechanical stimulation on gene expression in highly aligned Schwann cells as analysed by qPCR. The most prominent changes were present in the expression of the pro-regenerative marker BDNF, which was upregulated in all groups on day 7 compared to day 0, but with the strongest upregulation by approximately 3.6-fold seen in constructs subjected to ramp strain. Concomitantly, the expression of myelin-associated genes Sox10 and MBP was downregulated after 7 days of cultivation. Data are shown as bar graphs with mean+SD (floating, ramp: n=10 from 4 independent experiments; static: n=6 from 2 independent experiments). Statistical analysis was performed using Kruskal-Wallis test and Dunn's multiple comparisons test (*p<0.05, **p<0-01. ***p<0.001).

EXAMPLES

[0102] In the present examples, the present invention is illustrated by investigating a preferred embodiment of the present invention: a fibrin-based construct. The present examples investigate the generation of fibrin hydrogels with aligned Schwann cells applied either alone or as a novel intraluminal filler for nerve guidance conduits to speed up peripheral nerve regeneration. Therefore, two different cell types were compared: on the one hand, Schwann cells were directly isolated from rat sciatic nerves, while on the other hand, rat ASC were isolated and subsequently differentiated towards the Schwann cell lineage. To generate the peripheral nerve constructs, cells were embedded in ring-shaped fibrin hydrogels and different seeding densities ranging from 250,000 to 5,000,000 cells were compared. Based on the results of these preliminary experiments, the following experiments focused on the use of primary Schwann cells. Finally, the impact of different strain regimes (static vs. cyclic vs. ramp strain using the MagneTissue bioreactor) on Schwann cell alignment as well as gene expression was evaluated.

[0103] Materials and Methods

[0104] If not stated otherwise, all reagents were purchased from Sigma Aldrich (Vienna, Austria).

1. Schwann Cell Isolation and Culture

1.1 Preparation of Culture Surfaces

[0105] To improve Schwann cell adhesion and proliferation, culture surfaces were coated with poly-L-lysine and laminin. Therefore, the required culture plates were incubated with 0.01% poly-L-lysine solution for 10 min at room temperature. After incubation, the solution was collected for reuse and surfaces were washed twice with distilled water. After drying, culture surfaces were incubated with 0.01% (v/v) laminin diluted in phosphate buffered saline (PBS; Lonza) for at least 30 min at 37° C. Afterwards, culture surfaces were washed twice with PBS prior to cell seeding.

1.2 Sciatic Nerve Dissociation and Seeding

[0106] Rat sciatic nerves isolated from male Sprague Dawley rats were gratefully received from the Ludwig Boltzmann Institute of Experimental and Clinical Traumatology (Vienna, Austria) and the Medical University of Vienna (Center of Biomedical Research, Vienna, Austria). To isolate Schwann cells, the epineurial connective tissue was first removed using fine-pointed forceps under a stereo microscope, so that nerve fascicles with their characteristic white stripes can be observed. These fascicles were then teased with a needle and enzymatically digested in 10 ml of 0.05% collagenase type I solution (Table 2) per pair of nerves at 37° C. and 5% CO.sub.2 for 60-90 min, depending on tissue dissociation. At the end of collagenase incubation, residual non-digested tissue was mechanically dissociated using a glass Pasteur pipette and the cell suspension was filtered through a 70 μm cell strainer. Cell suspension was centrifuged at 400×g for 6 min and the cell pellet was resuspended in Dulbecco's Modified Eagle's Medium (DMEM; Lonza) containing 10% fetal calf serum (FCS; GE Healthcare), 1% Penicillin/Streptomycin (P/S) and 1% L-glutamine. After centrifugation at 400×g for 6 min, the cell pellet was resuspended in Schwann cell isolation medium, consisting of DMEM D-valine (Cell Culture Technologies) supplemented with 10% FCS, 1% P/S, 1% L-Glutamine, 250 ng/ml Amphotericin B, 10 μg/ml bovine pituitary extract (PEX), 1×N2 supplement (ThermoFisher Scientific), 10 ng/ml recombinant human heregulin β1 (PeproTech) and 2 μM forskolin. Eventually, the cell suspension obtained from 1 pair of sciatic nerves was seeded into two 6-wells that have been sequentially coated with poly-L-lysine and laminin and incubated in a humidified atmosphere at 37° C. and 5% CO.sub.2. This primary cell culture was referred to as passage 0 (p0). After 7 days, 1 ml of fresh Schwann cell culture medium was added and cells were incubated 3 to 4 more days. On day 10 or 11, half of the medium was replaced with fresh Schwann cell medium, followed by 50% partial media exchanges every 2 to 3 days until confluence was reached.

TABLE-US-00002 TABLE 2 Preparation of Collagenase I solution for enzymatic digestion Collagenase solution DMEM, serum-free (Lonza) 10 ml 0.05% Collagenase I (Sigma Aldrich) 5 mg 1% P/S (Lonza) 100 μl 250 ng/ml Amphotericin B (Lonza) 10 μl

1.3 Schwann Cell Expansion

[0107] Primary Schwann cell cultures typically reached confluence from day 10 onwards. For further expansion, cells were enzymatically detached using trypsin, centrifuged at 400×g for 6 min, the cell pellet was resuspended in fresh Schwann cell culture medium (DMEM D-valine supplemented with 10% FCS, 1% P/S, 1% L-Glutamine, 10 ng/ml recombinant human heregulin (1 and 2 μM forskolin) and cells were seeded in a 1:2 dilution onto poly-L-lysine-coated culture plates. A splitting ratio of 1:2 to 1:4 was maintained until a sufficient cell number was reached for Schwann cell characterization and mechanical stimulation experiments.

1.4 Freezing and Thawing

[0108] For each successful isolation, Schwann cells at approximately 80% confluence were harvested for cryopreservation. Cells were washed twice with PBS and detached with trypsin. Detached cells were pelleted by centrifugation at 400×g for 6 min and subsequently frozen in 50 μl dimethyl sulfoxide (DMSO) and 950 μl FCS.

[0109] For thawing of frozen cells, 6 ml medium was pre-warmed at 37° C., 5% CO.sub.2 in 10 cm dishes coated with poly-L-lysine and laminin. The cryo vial was thawed in a water bath at 37° C. and cell suspension was immediately transferred to a Falcon tube containing 4 ml pre-warmed medium. After centrifugation at 400×g for 6 min to remove DMSO, cells were resuspended in growth medium and transferred to the prepared 10 cm dishes to be cultivated in a humidified atmosphere at 37° C. and 5% CO.sub.2.

2. Isolation of Rat Adipose-Derived Stem Cells

[0110] Rat adipose-derived stem cells (rASC) were isolated from epididymal fat pads received from the Ludwig Boltzmann Institute of Experimental and Clinical Traumatology (Vienna, Austria). Fat tissue was washed twice with PBS containing 1% PS and 250 ng/μl Amphotericin B and cut into small pieces using a scalpel. Subsequently, minced epididymal fat tissue was enzymatically digested using 20 ml PBS supplemented with 1.5% Collagenase Type I, 2% bovine serum albumin (BSA) and 25 mM HEPES for approximately 3 hours at 37° C. with continuous shaking. After filtration through a 100 μm cell strainer to remove any residual undigested tissue, the cell suspension was centrifuged at 400×g for 7 minutes. The supernatant, containing mature adipocytes, was discarded and the pellet was washed with PBS, followed by centrifugation for 7 minutes at 400×g. The pellet, containing rASC, was resuspended in growth medium (DMEM supplemented with 10% FCS, 1% P/S and 1% L-glutamine) and cells were seeded into a T175 flask. Medium was exchanged every 2-3 days and cells were split when reaching approximately 80% confluence.

3. Differentiation of Rat Adipose-Derived Stem Cells into Schwann Cell-Like Cells

[0111] Rat ASC were differentiated into Schwann cell-like cells as described elsewhere (Schuh et al., Cells Tissues Organs 200 (2014), 287-299; Dezawa et al., Eur. J. Neurosci. 14 (2001), 1771-1776). Briefly, rASC were seeded into T75 flasks at a density of 500 cells/cm.sup.2 in growth medium. After 48 hours, medium was discarded and incubated in growth medium supplemented with 1 mM β-mercaptoethanol for 24 hours (FIG. 1; DM1). Then, the cells were washed three times with PBS and incubated in growth medium supplemented with 35 ng/ml all-trans retinoic acid for 72 hours (FIG. 1; DM2). Afterwards, cells were again washed three times with PBS and cultured in Schwann cell-like differentiation medium, consisting of growth medium supplemented with 10 ng/ml recombinant rat basic fibroblast growth factor (bFGF; PeproTech), 5 ng/ml recombinant murine platelet-derived growth factor (PDGF; PeproTech), 200 ng/ml recombinant human heregulin 131 (PeproTech) and 14 μM forskolin (FIG. 1; DM3). Schwann cell-like differentiation medium was exchanged every third day and cells were split when reaching confluence.

4. Schwann Cell Characterization

[0112] To evaluate isolation efficiency and verify Schwann cell identity, isolated and differentiated cells were analysed by flow cytometry as well as immunofluorescence stainings.

4.1 Flow Cytometry

[0113] For flow cytometric analysis, cells were detached with accutase to preserve surface marker expression, centrifuged at 400×g for 6 min and subsequently fixed in 1% formaldehyde (PFA; Roth) in PBS for 15 min on ice. Afterwards, 2 ml of PBS were added, cells were pelleted by centrifugation at 400×g for 6 min and resuspended in 1% (w/v) BSA in PBS, hereafter referred to as PBS/BSA. Cells were then either stored at 4° C. or stained immediately for flow cytometry.

[0114] For immunostaining, 100 μl of cell suspension were transferred to each flow cytometry tube. For staining with the intracellular marker S100, cell membranes were first permeabilized by adding 900 μl methanol dropwise to the cell suspension under gentle vortexing and subsequent incubation on ice for 30 min. Permeabilized cell suspensions were washed with 1 ml PBS/BSA and resuspended in 100 μl PBS/BSA. For labelling, rabbit polyclonal S100 primary antibody was added 1:400, cells were vortexed shortly and incubated on ice for 30 min. To remove unbound antibodies, 1 ml PBS/BSA, was added and cell suspensions were centrifuged at 400×g for 6 min. The supernatants were carefully discarded and the washing step was repeated with 1 ml PBS/BSA. After decanting the supernatants, goat anti-rabbit AlexaFluor 488 secondary antibody diluted 1:400 in 100 μl PBS/BSA was added, tubes were shortly vortexed and incubated for 30 min on ice in the dark to avoid bleaching of the fluorophores. Following secondary antibody incubation, cells were washed with 1 ml PBS/BSA and centrifuged at 400×g for 6 min. Supernatants were discarded and the washing step was repeated to remove residual unbound antibodies. Cells were then resuspended in 300 μl PBS/BSA and analysed with a BD FACS Canto II (Becton Dickson Biosciences, Franklyn, USA) flow cytometer. Unstained cells as well as cells stained only with the secondary antibody served as controls. Data were analysed using FlowJo Version 10.4.2 (Tree Star, Ashland, USA).

4.2 Immunofluorescence

[0115] In addition to flow cytometry analysis, Schwann cells cultured in 12-well plates (CytoOne) coated with PLL and laminin were fixed with 4% PFA for 15 min at room temperature, washed twice with PBS for 5 min each and subsequently blocked and permeabilized in blocking solution, consisting of PBS supplemented with 1% (w/v) BSA, 5% (v/v) FCS and 0.2% (v/v) Triton X-100 for 1 hour on an orbital shaker. Afterwards, cells were washed twice with PBS and incubated for 1 hour with rabbit polyclonal S100 primary antibody diluted 1:200 in blocking solution. Prior to incubation with goat anti-rabbit AlexaFluor 488 secondary antibody (1:400 in blocking solution), cells were washed 3 times with PBS in order to remove unbound primary antibody. After secondary antibody incubation for 1 hour, cells were washed three times with PBS and subsequently counterstained for approximately 5 min with 4′,6-diamidino-2-phenylindole (DAPI) diluted 1:1000 in blocking solution. Cells were washed another time with PBS and visualized on a Leica DMI 6000b epifluorescence microscope (Leica Microsystems, Germany).

5. Generation of Ring-Shaped Schwann Cell-Enclosed Fibrin Hydrogels

[0116] In order to assess the impact of mechanical stimulation on Schwann cell alignment and putative phenotypic changes, cells were embedded in ring-shaped fibrin hydrogels using the Tissucol Duo fibrin kit (Baxter AG, Vienna, Austria). Fibrinogen was diluted in Schwann cell medium to a working concentration of 40 mg/ml. Thrombin was diluted to a concentration of 4 IU/ml in 40 mM calcium chloride, followed by further dilution in Schwann cell suspension to the working concentration of 1.25 IU/ml. Fibrin scaffolds were cast using ring-shaped polyoxymethylene (POM) molds (FIG. 2A) by mixing 250 μl of the diluted fibrinogen solution with 250 μl of the thrombin/cell suspension solution, resulting in final concentrations of 20 mg/ml fibrin and 0.625 IU/ml thrombin. After polymerization for one hour at 37° C., fibrin rings were retrieved from the molds (FIG. 2B), mounted on the MagneTissue spool/hook system and cultured in Snap-Cap tubes (FIG. 2C) containing 9 ml Schwann cell medium supplemented with 100 KIU/ml aprotinin. Rings floating in growth medium inside Snap-Cap tubes (BD Biosciences) served as controls. Medium was exchanged every two to three days.

5.1 Mechanical Stimulation of Schwann Cell Hydrogels Using the MagneTissue Bioreactor

[0117] Mechanical stimulation was applied to 3D cell-enclosed fibrin hydrogels using the MagneTissue bioreactor system via magnetic force transmission (Heher et al., Acta Biomater. 24 (2015), 251-265). Therefore, scaffolds are mounted onto a spool-hook system and placed into SnapCap tubes as described above (FIG. 2C). The bioreactor consists of an upper sample holder row and a bottom plate with integrated magnets (FIG. 2D), which exert an attraction force when interacting with the magnets integrated into the hooks. Mechanical stimulation is exerted via magnetic force transmission by movement of this bottom plate via a stepper motor (Heher et al., 2015).

[0118] For mechanical stimulation, three different strain regimes were employed in addition to a control group consisting of rings floating in the tubes (FIG. 3). During the first two days after ring casting, all scaffolds were cultivated unstrained to provide a recovery time from the casting procedure. Starting from day 2, three different strain regimes were compared. One group was subjected to 10% constant static strain for 48 hours, which was increased to 12% for the remaining 72 hours (FIG. 3A). The second stimulation protocol consisted of a ramp strain, where static strain was increased for 2% every day, starting at 10% static strain on day 2 and ending at a maximum of 20% static strain on day 7 (FIG. 3B). In the third group, 10% constant static strain was first applied for 48 hours starting on day 2, followed by a switch to a more dynamic protocol of two repetitions of (i) 0-12% cyclic strain for 6 hours at 250 mHz and (ii) 6 hours “resting phase” at 0-3% cyclic strain (250 mHz) per day until day 7 (FIG. 3C).

6. Analysis of the Impact of Mechanical Stimulation on Schwann Cell Behaviour

[0119] To evaluate the impact of mechanical stimulation on gene expression as well as cellular alignment, qPCR analyses and immunofluorescence (IF) stainings were performed.

6.1 Immunofluorescence

[0120] To visualize Schwann cell alignment after mechanical stimulation, fibrin rings were fixed in 4% PFA for either two hours at room temperature or at 4° C. overnight. Afterwards, scaffolds were washed three times with distilled water, incubated in 50% ethanol for 30 min and then stored in 70% ethanol at 4° C. for a maximum of 1 week until immunofluorescence staining was performed. Prior to staining, ethanol was removed and scaffolds were washed twice with PBS. Afterwards, scaffolds were first incubated in 0.1% (v/v) Triton X-100 in Tris-buffered saline (TBS/T) and then in PBS containing 0.1% (v/v) Triton X-100 (PBS/T) for 15 min each at room temperature to permeabilize the cells. Subsequently, scaffolds were blocked using PBS supplemented with 1% (w/v) BSA, 5% (v/v) FCS and 0.2% (v/v) Triton X-100 for 1 hour at room temperature. Afterwards, cells were washed three times with PBS/T and incubated in a 1:400 dilution of S100 in PBS/T-1% BSA at 4° C. in Eppendorf tubes on an orbital shaker overnight. The next day, scaffolds were washed three times with PBS/T and incubated with an AlexaFluor 488 goat anti-rabbit (Invitrogen, California, USA) secondary antibody diluted 1:400 in PBS/T-1% BSA at 37° C. for one hour. After three washing steps with PBS followed by another washing step with PBS/T, scaffolds were incubated in 0.1 M glycine for 5 min to reduce the background. For visualization of nuclei, cells were counterstained with a 1:1000 dilution of DAPI in PBS/T-BSA for 10 min in the dark. Scaffolds were washed with PBS and subsequently with water to remove salt residues, and embedded in Mowiol mounting medium (Table 3) on glass cover slides (VWR, Vienna, Austria) to preserve the immunofluorescence staining. Slides were analysed on a Zeiss LSM700 confocal microscope and stored at 4° C. in the dark.

TABLE-US-00003 TABLE 3 Formulation of mowiol mounting medium for preservation of immunofluorescence stained scaffolds on glass slides. Mowiol mounting medium 6 g glycine 2.6 g Mowiol 4-88 6 ml ddH.sub.2O 12 ml Tris/HCl pH 8.5

6.2 Trizol Isolation of RNA

[0121] For isolation of RNA, fibrin rings were snap-frozen in liquid nitrogen and either stored at −80° C. or processed immediately. Therefore, frozen rings were washed three times with PBS, subsequently snap frozen in opened 2 ml Eppendorf tubes in liquid nitrogen and immediately crunched using special tweezers for homogenization. Afterwards, 1 ml peqGOLD TriFast (hereafter referred to as trizol; VWR, Vienna, Austria) was added and tubes were vortexed for 10 min. After 15 min of incubation at room temperature, chloroform was added 1:5 of initial trizol used, tubes were shook vigorously for 15 seconds and incubated for approximately 10 min at room temperature until density gradient formation was observable. Tubes were then centrifuged for 15 min at 12,000×g and 4° C., and the upper aqueous phase containing RNA was transferred to fresh Eppendorf tubes with caution to not disturb the interphase and phenol-phase. Afterwards, it was either proceeded immediately with RNA isolation, or samples were frozen at −20° C.

[0122] To precipitate RNA in the aqueous phase, isopropanol was added 1:2 of initial trizol used and samples were incubated on ice for 15 min. After centrifugation at 12,000×g for 10 min, the RNA pellet was washed with 75% ethanol, vortexed shortly and centrifuged at 12,000×g for 10 min. The supernatant was decanted, the washing step was repeated and RNA pellets were allowed to air-dry in open and inverted tubes for 20 min at room temperature. Eventually, the RNA pellet was dissolved in 15 μl RNase-free water and concentration as well as A260/A280 ratio determined on a NanoDrop photometer (Thermo Fischer, Vienna, Austria).

6.3 qPCR

[0123] Reverse transcription of isolated mRNA into cDNA was performed using the EasyScript cDNA synthesis kit (abm, Richmond, Canada). A master mix of all reagents (Table 4) was prepared for all samples and the amount of RNA used per reaction was adjusted to the sample with the lowest concentration measured, using at least 140 μg RNA per reaction. 7.5 μl master mix per reaction were pipetted into 0.2 ml PCR reaction tubes and 12.5 μl RNA diluted in RNase-free dH.sub.2O were added to reach a final volume of 20 μl per reaction. cDNA synthesis was performed using an Eppendorf PCR thermocycler with the following conditions:

[0124] 25° C. for 10 min for primer extension

[0125] 42° C. for 60 min for reverse transcription

[0126] 85° C. for 5 min for inactivation of reverse transcriptase

[0127] 4° C. until further processing.

TABLE-US-00004 TABLE 4 Composition of cDNA synthesis master mix per reaction Reagent Volume per reaction [μl] Master 5 xRT buffer 4 Mix Oligo(dT) [10 μM] 1 dNTPs [10 mM] 1 RNase Off Inhibitor [40 U/μl] 0.5 Reverse Transcriptase 1 RNA + RNase-free water 12.5 Total volume 20

[0128] For gene expression analysis via qPCR, all samples were analysed in triplicates, and non-template controls were included for each gene of interest. Template cDNA samples were diluted to a working concentration of 3.33 ng/μl to obtain a total amount of 10 ng cDNA per reaction, which was advanced to a 96-well PCR plate (StarLab, Hamburg, Germany). A master mix of all reagents was prepared per gene of interest, containing PerfeCTa SYBR Green FastMix (Quanta Biosciences, Gaithersburg, Md., USA), primers diluted to concentrations 400 nM (200 nM for the housekeeper) and RNase-free water (Table 5), and 17 μl were added to each reaction. qPCR was performed using a Stratagene Mx3005P cycler (Agilent, California, USA) with a normal-2-step thermal profile setup. Target genes normalized to the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were compared to either floating control or 2D samples, and fold changes were calculated using the ΔΔC.sub.T method. Primer sequences are shown in Table 6.

TABLE-US-00005 TABLE 5 Composition of a qPCR reaction with the KAPA SYBR Fast master mix. Per reaction, 2 ng cDNA was used and primers were diluted to 200 or 400 nM. Primer concentration Reagent 200 nM 400 nM PerfeCTa SYBR Green FastMix 10 μl 10 μl Primer forward 0.4 μl 0.8 μl Primer reverse 0.4 μl 0.8 μl RNase-free dH.sub.2O 6.2 μl 5.4 μl cDNA [0.5 ng/μl] 3 μl 3 μl

TABLE-US-00006 TABLE 6 Primer sequences for qPCR. Primers were purchased from Microsynth (Switzerland) and used at a final concentration of 400 nM, except for GAPDH, which was used at 200 nM concentration. Target gene Forward (5′-3′) Reverse (5′-3′) BDNF TCTACGAGACCAAGTGTAATCCCA CTTATGAACCGCCAGCCAAT Sox10 TGCCAAAGCCCAGGTGAAGA AGACTGAGGGAGGTGTAGGCGAT MBP GAAGTCGCAGAGGACCCAAGA CTGCCTCCGTAGCCAAATCC GAPDH CCGTATCGGACGCCTGGTTA CCGTGGGTAGAGTCATACTGGAAC

7. Statistical Analysis

[0129] Statistical evaluation was performed using the GraphPad Prism 6 software (GraphPad Software Inc., San Diego, USA). First, Grubbs' outlier analysis was performed to identify and exclude potential outliers. Shapiro-Wilk normality test was used to assess whether data are normally distributed. Nonparametric data were analysed using Kruskal-Wallis's test with Dunn's multiple comparison test. Level of significance was set at p<0.05.

Results

1. ASC can be Transdifferentiated Towards a Schwann Cell-Like Phenotype

[0130] Since ASC demonstrate numerous beneficial characteristics for cell-based therapies in tissue engineering and regenerative medicine, they have also gained immense interest as a popular source for clinical applications in peripheral nerve repair. These cells can not only be easily isolated from adipose tissue with great yields devoid of donor-site morbidity and expanded rapidly in vivo, but they are also immunoprivileged and can be differentiated towards multiple lineages, including the Schwann cell lineage. Hence, ever since the first report of successful transdifferentiation of mesenchymal stem cells into Schwann cell-like cells (Dezawa et al., 2001), the regenerative potential and clinical eligibility was exploited for treatment of peripheral nerve injuries.

[0131] In the examples performed for the present invention, ASC were isolated from rat epididymal fat pads and passage 2 cells were subsequently pre-conditioned in medium supplemented with 1 mM mercaptoethanol for 24 hours, followed by addition of 35 ng/ml all-trans retinoic acid for 72 hours. Differentiation was induced using medium supplemented with heregulin, forskolin, PDGF and bFGF for a minimum of 19 days (FIG. 1). Prior to differentiation as well as after the pre-conditioning phase, ASC exhibited a flattened and fibroblast-like morphology (FIG. 4A). Starting from day 7 after the initiation of differentiation, ASC started to progressively remodel their cytoskeleton and adopted an elongated bi- or tripolar morphology with a small but prominent cell body and long protrusions by day 20 (FIG. 4B).

2. Mechanical Stimulation Induces Alignment of Putative

[0132] Schwann cell-like cells embedded in fibrin hydrogels One central approach in peripheral nerve tissue engineering is the generation of aligned constructs that can subsequently be used as guidance structures by regenerating axons to bridge the nerve gap. To analyse whether Schwann cell-like cells can be aligned, rat adipose-derived stem cells transdifferentiated into Schwann cell-like cells were embedded in fibrin hydrogels at a density of 250,000 cells per ring and subjected to either 10% static strain for 6 hours or 24 hours a day. Rings cultivated floating inside SnapCap tubes served as controls and were oriented randomly inside the fibrin matrix (FIG. 5A, B). In contrast, especially cells exposed to 10% constant static strain clearly aligned along the axis of strain (FIGS. 5E and F). This effect was not as pronounced in scaffolds strained for only 6 hours a day, although minor alignment was observable in this group as well (FIGS. 5C and D). However, putative Schwann cell-like cells were stained with phalloidin, which visualizes F-actin filaments and does not confirm Schwann cell-like cell identity. Consequently, whether these cells truly are Schwann cell-like cells or cells de-differentiated to rASC remains elusive.

3. Achievement of Highly Pure Schwann Cell Cultures from Freshly Isolated Adult Rat Tissue

[0133] Since primary Schwann cells are furthermore a more suitable cell type compared to Schwann cell-like cells to gain insight into the molecular processes of glial cells during peripheral nerve regeneration, Schwann cells were used for further mechanical stimulation experiments. To exploit the therapeutic potential of Schwann cells for peripheral nerve regeneration, the ability to isolate highly pure Schwann cells is of utmost importance.

[0134] In the examples of the present invention, Schwann cells were successfully isolated based on a recently published protocol (Kaewkhaw et al., Nat. Protoc. 7 (2012), 1994-2004). The most important component of the isolation procedure is the use of DMEM supplemented with D-valine, which is a non-essential amino acid and can be preferentially metabolized by Schwann cells via the enzyme D-amino acid oxidase (DAAO) into the essential amino acid L-valine required for cellular proliferation and survival. Fibroblasts, in contrast, do not have this ability and therefore die after a few days in culture (Kaewkhaw et al., 2012).

[0135] Schwann cells were isolated from rat adult sciatic nerves due to their large size and easy harvesting. The skin was incised along the thigh to the knee and sciatic nerves were carefully separated from the surrounding connective tissue and muscle (FIG. 6A). The outermost layer of the nervous connective tissue, the epineurium, was removed meticulously (FIG. 6B) as this is the major source of potential fibroblast contamination. After epineurial removal, the individual nerve fascicles became visible, and the tissue was enzymatically dissociated.

[0136] Typically, cellular outgrowth could be observed from day 5 on, with initially both fibroblasts (FIG. 7A, arrowhead) and Schwann cells (FIG. 7A, arrow) being present. Fibroblasts failed to proliferate and died over time, resulting in highly pure Schwann cell cultures (FIG. 7B). The typical bipolar Schwann cell morphology is marked by a prominent but tiny and usually shiny cell body with two long protrusions, while fibroblasts display a flattened and polymorphic shape. When reaching confluency, cells exhibited a swirling pattern (FIG. 7C), which is a characteristic of Schwann cell behaviour (Kaewkhaw et al., 2012).

[0137] To confirm Schwann cell identity after isolation, cells were immunolabeled with the glial marker S100, which is specific for Schwann cells but should not stain fibroblasts, and counterstained with DAPI to visualize nuclei. The vast majority of cells obtained after isolation were stained positively for S100, which was, however, expressed at different intensities and localized in both the nuclei as well as in the cytoplasm. Only few cells stained positive for DAPI only, indicating the presence of non-glial cells (FIG. 8).

[0138] In addition to immunostaining of cells, Schwann cell purity and identity was quantitatively evaluated by flow cytometry. FIG. 9A shows a representative flow cytometry dot plot. A gate was set to include the majority of live Schwann cells (here 90.7%), as determined by their size and granularity, but excluded cellular debris, dead cells and duplets. Events inside this gate were then further used for analysis of the S100 fluorescent staining. S100 flow cytometry histogram of gated cells displayed a rather broad fluorescence intensity profile (FIG. 9B), indicating a highly differential S100 marker expression among Schwann cells. This, in turn, is in accordance with the results obtained from immunostaining (FIG. 8). Remarkably, all Schwann cell isolations always yielded purities over 90% (FIG. 9C), and on average, isolation efficiency resulted in Schwann cell purities of 97±2.4% after several passages from initial Schwann cell isolation (FIG. 9D).

4. Schwann Cell Numbers as Well as the Application of Different Strain Regimes Strongly Influence the Capacity to Form Bands of Büngner-Like Structures Using Mechanical Stimulation

[0139] After verification of Schwann cell identity via flow cytometry, cells from all donors were expanded for mechanical stimulation experiments. Therefore, cells between passages 5 and 7 were embedded in ring-shaped fibrin hydrogels to create a 3D environment and subjected to tensile strain. In the first experiment, fibrin rings with 250,000 cells and 500,000 cells (FIG. 10) or 2×10.sup.6 cells (FIG. 11) were cast and subsequently subjected to 10% constant static strain or cultured as floating controls. Since the findings obtained with Schwann cell-like cells revealed that subjecting cells to constant static strain 24 hours a day without resting phases, this was the strain regime of choice for first mechanical stimulation experiments using primary Schwann cells. While floating control hydrogels showed random distribution of Schwann cells (FIG. 10A; FIG. 11A), cells subjected to static tensile strain aligned along the axis of strain and furthermore appeared elongated (FIG. 10B, C; FIG. 11B, C).

[0140] In addition to the static strain regime evaluated before, also a more dynamic stimulation protocol was used. In this cyclic strain regime, 3×10.sup.6 cells were first subjected to 10% constant static strain for 48 hours to induce alignment of both the fibrin hydrogels as well as of Schwann cells, and subsequently, stimulation was switched to 6 hours of 12% cyclic strain at 250 mHz followed by a resting phase of 3% cyclic strain for 6 hours each day. This cyclic protocol was repeated twice a day for a total of three days. Compared to cells exposed to 10% constant static strain, the cellular alignment obtained with the cyclic stimulation protocol was not as pronounced and defined, and cells furthermore did not appear elongated as is the case in the static group (FIG. 12C-F). However, there still is minor alignment even in the cyclic strain group when compared with the floating control group (FIG. 12A, B).

[0141] Moreover, a third tensile stress stimulation protocol was investigated. Since it was hypothesized that the effect of constant strain is no longer present once the fibrin hydrogels adapted to the stretch they are exposed to and become worn out, a ramp style of static strain was employed to ensure the sustained provision of mechanical stress to the scaffolds. Therefore, cells are subjected to 10% constant static strain starting on day 2, and the strain is subsequently increased by 2% per day, resulting in a maximum strain of 20% on day 7. Indeed, results showed slightly better alignment of Schwann cells along the axis of strain (FIG. 12G, H) compared to the static strain group (FIG. 12E, F). Furthermore, cells subjected to the ramp strain profile appeared more elongated than cells exposed to constant static strain. In addition to that, the use of 3×10.sup.6 Schwann cells resulted in improved capacity to form bands of Büngner-like structures than the lower cell numbers tested before (compare FIGS. 10 and 11).

[0142] Hence, we aimed to further evaluate if the formation of bands of Büngner-like structures, which could potentially guide axonal regrowth in vivo, can be further optimized when using even higher cell numbers. Consequently, cell numbers of 3×10.sup.6, 4×10.sup.6 and 5×10.sup.6 cells per scaffold were compared in further MagneTissue experiments to evaluate the optimal cell concentration required to appropriately resemble the formation of bands of Büngner-like structures (FIG. 13). Based on these experiments, it was decided to use 4×10.sup.6 cells for all further experiments. Again, cells subjected to ramp strain treatment showed superior alignment along the axis of strain (FIG. 13).

5. Impact of Mechanical Stimulation of Primary Schwann Cells on Gene Expression Levels qPCR analysis was performed to analyse potential effects of static and ramp strain on the expression of both, pro-regenerative as well as myelin-associated genes. GAPDH was used as a housekeeping gene. Expression of the myelin gene MBP was significantly downregulated in all experimental groups compared to d0 controls, while downregulation of Sox10 was only significant in constructs cultured as floating controls as well as constructs exposed to ramp strain. In contrast, the expression of the pro-regenerative marker was significantly upregulated (3.6-fold) only in samples subjected to ramp strain (FIG. 14).

DISCUSSION

[0143] Since the currently available approaches to treat peripheral nerve injuries are limited and mostly unsatisfactory in terms of functional recovery, peripheral nerve tissue engineering has recently gained immense interest in the scientific community. Especially the establishment of nerve guidance conduits is intensively being investigated, aiming at improving their potential to regenerate larger nerve gaps and to ultimately surpass autologous nerve grafts, which are the current gold standard. The present invention aims to provide novel peripheral nerve constructs consisting of aligned Schwann cell-embedded fibrin matrices using mechanical stimulation. Therefore, the impact of different strain parameters on Schwann cell alignment and gene expression was evaluated. These highly aligned Schwann cell constructs pose novel intraluminal fillers for NGCs to potentially speed up peripheral nerve regeneration by providing guidance cues for regenerating axons. The present invention, for the first time, provides aligned Schwann cell constructs via direct mechanical stimulation of the cells themselves embedded in matrices.

[0144] Several studies investigated the potential of different cell types inside NGCs to improve regeneration of nerve lesions, including mainly primary Schwann cells, mesenchymal stem cells and Schwann cell-like cells. Since the use of ASC presents several advantages in certain embodiments, such as simple harvesting of ASC from fat tissue, high proliferation rates in vitro and their immunoprivilege due to lack of MHCII expression, it is not surprising that their differentiation potential into Schwann cell-like cells is currently being exploited for peripheral nerve regeneration approaches. Therefore, the applicability of Schwann cell-like cells for the generation of aligned fibrin scaffolds was investigated. For this purpose, ASC isolated from rat epididymal fat were transdifferentiated into Schwann cell-like cells using three different differentiation media (FIG. 1). Differentiation into Schwann cell-like cells was characterized by a transformation from the flattened polymorphic shape of rASC (FIG. 4A) into an elongated, mostly bipolar morphology characteristic of Schwann cells (FIG. 4B). For mechanical stimulation experiments using the MagneTissue bioreactor, 250,000 Schwann cell-like cells were embedded in ring-shaped fibrin hydrogels and subjected to 10% static strain either constantly, or for 6 hours a day. Additionally, scaffolds floating in growth medium served as controls. While cells cultivated as floating controls oriented randomly inside the fibrin matrices, especially cells subjected to 10% constant static strain showed a high degree of alignment along the axis of strain (FIG. 5). However, one issue of this finding is that cells inside the fibrin scaffolds were not stained with a Schwann cell-specific marker, such as S100, but rather with phalloidin, which visualizes a cell's F-actin filaments.

[0145] In order to exploit the therapeutic potential of Schwann cells, isolation of highly pure Schwann cell cultures from adult tissue and efficient expansion in vitro is important. Since co-isolation of fibroblasts, which rapidly outgrow slowly proliferating Schwann cells, is a major obstacle, a popular approach to eliminate these cells is the use of antimitotic agents, such as cytosine arabinoside. However, these agents are not very selective and consequently also impair Schwann cell proliferation, resulting in low yields of Schwann cells. In the examples of the present invention, based on the protocol published by Kaewkhaw et al., 2012, DMEM formulated with D-valine was used instead of L-valine. Being an essential amino acid, L-valine is usually required by most cells for proliferation and survival. Schwann cells, however, have the ability to metabolize D-valine via the enzyme DAAO into L-valine, while fibroblasts do not have this ability and die after a few days in culture (FIG. 7). This way, outstanding Schwann cell purities of 96±2.38% could be obtained as quantified by S100 flow cytometry analysis (FIG. 9).

[0146] Since it has been reported before that moderate tensile stress promotes peripheral nerve, it was investigated whether aligned Schwann cells resembling the formation of bands of Büngner can be obtained using mechanical stimulation, with the ultimate goal to assess whether these constructs are capable to accelerate the regenerative process taking place upon implantation. Therefore, isolated primary Schwann cells were expanded and embedded in fibrin hydrogels at different densities for mechanical stimulation experiments using the MagneTissue bioreactor system. In particular, the effect of three different strain protocols on Schwann cell alignment and gene expression was assessed. Based on the findings obtained in experiments conducted with Schwann cell-like cells, it was decided to expose the cells to constant static strain in two of these protocols, as constant strain resulted in superior alignment compared to scaffolds strained for only 6 hours a day (FIG. 5). All these stimulation protocols started with a resting phase during the first two days, in which scaffolds were kept at 0% strain. In the constant static strain regime, cells were subsequently strained at 10% constant static strain for 2 days, followed by an increase to 12% strain until day 7 (FIG. 3A). In the second protocol, cells were also first subjected to 10% constant static strain for 24 hours, followed by an increase in strain by 2% each day, reaching a final stain of 20% on day 7 (FIG. 3B). The third protocol consisted of an initial phase of 10% constant static strain, after which the stimulation was switched to a more dynamic protocol of 2 repetitions of 0-12% cyclic strain at 250 mHz for 6 hours, followed by a resting phase at 0-3% cyclic strain per day (FIG. 3C).

[0147] In the examples of the present invention, it was shown that application of constant static strain promoted alignment of Schwann cells in fibrin matrices using as little as 250,000 cells per scaffold (FIG. 10). Nevertheless, cell densities of 250,000 and 500,000 cells may not be sufficient to induce the formation of bands of Büngner-like structures, whereas fibrin constructs prepared with a minimum of 3×10.sup.6 cells produced Schwann cell tracks of adequate densities and lengths (FIG. 12). Furthermore, Schwann cells seemed to elongate in length and furthermore fuse with neighbouring Schwann cells, thereby forming continuous cellular tracks that could potentially serve as axonal guidance cues (FIG. 12E, F, G, H; FIG. 13). Of note, the use of 4×10.sup.6 cells (FIG. 13) as well as the application of an incremental static strain profile (ramp strain) was found to be superior to constant static strain, as it further improved the generation of aligned Schwann cell constructs (FIG. 12G, H; FIG. 13). The rationale behind this strain regime was to constantly strain the fibrin scaffold by increasing tensile stress by 2% each day, since the effect of constant strain could vanish once fibrin hydrogels adapt to the stretch they are exposed to and become worn out. In contrast, cyclic strain impaired cellular alignment compared with the static protocols (FIG. 12C, D), although minor alignment is still achievable when compared to floating controls (FIG. 12A, B). Moreover, total Schwann cell length was shorter and the protrusions rather diffusely oriented (FIG. 12C, D). These findings are novel and unexpected, since direct mechanical stimulation of Schwann cells embedded in matrices to engineer aligned cellular constructs has never been investigated before, and can therefore significantly contribute to future progressions made in the field of peripheral nerve regeneration. However, some studies investigated the effects of mechanical stimulation applied to cells grown in 2D on gene expression, which will be discussed below.

[0148] To analyse the effects of mechanical stimulation on gene expression, qPCR analysis was performed. The most prominent changes were present in expression of the pro-regenerative marker BDNF, which was upregulated approximately 3.6-fold on day 7 when subjected to ramp strain compared to day 0. Concomitantly, the expression of myelin-associated genes Sox10 and MBP was downregulated after 7 days of cultivation (FIG. 14). Moreover, gene expression of Schwann cells embedded in fibrin were also compared in the course of the present invention with Schwann cells grown as a monolayer. Results showed very high gene expression changes in almost all genes between 2D and 3D samples, showing that cells cultured in a monolayer do not represent the optimal reference group.

[0149] To conclude, the examples of the present invention showed that highly aligned Schwann cell-fibrin constructs can be engineered using mechanical stimulation. First, it was shown that rASCs can be differentiated towards a Schwann cell-like phenotype and that these differentiated cells can be aligned using constant static strain. Subsequently, it was shown that highly pure Schwann cell cultures can be isolated from rat sciatic nerves. Mechanical stimulation experiments using primary Schwann cells revealed that highly aligned Schwann cell constructs can be obtained. However, the examples of the present invention also showed that the degree of alignment strongly depends on the type of mechanical stimulation applied. In particular, especially a ramp strain profile, but also static strain yielded superior alignment of Schwann cells along the axis of strain and induced elongation of cells, while cyclic strain, in contrast, only induced minor alignment of cells. Ultimately, gene expression analysis showed that expression of the pro-regenerative marker BDNF was upregulated after 7 days of cultivation especially in the ramp strain group. However, the exact effects of mechanical stimulation on signal transduction in Schwann cells can be further investigated. Taken together, these highly aligned Schwann cell matrices are promising intraluminal fillers for nerve guidance conduits to accelerate and improve peripheral nerve regeneration.

[0150] The present invention therefore discloses the following embodiments:

1. Method for producing a cell construct comprising Schwann cells or Schwann cell-like cells and a biocompatible matrix, wherein Schwann cells or Schwann cell-like cells or precursor cells of Schwann cells or Schwann cell-like cells are contacted with the biocompatible matrix and subjected to cultivation, wherein cultivation is at least partially performed by administering mechanical stimulation on the cells in contact with the biocompatible matrix.
2. Method according to embodiment 1, wherein the biocompatible matrix is selected from synthetic biomaterials, preferably polyglycolic acid (PGA), poly (D,L-lactic-co-glycolic) acid (PLGA), and poly L-lactic acid (PLLA); proteins, preferably extracellular matrix proteins, especially collagen, gelatin, fibrin, keratin, fibronectin, laminin, or silk fibroin; and polysaccharides, preferably heparin sulfate, hyaluronic acid chondroitin sulfate, alginate or chitosan; and mixtures thereof.
3. Method according to embodiment 1 or embodiment 2, wherein the cultivation is performed in a bioreactor.
4. Method according to any one of embodiments 1 to 3, wherein the method comprises the steps of: [0151] providing a cell construct of a biocompatible matrix with Schwann cells or Schwann cell-like cells or precursor cells of Schwann cells or Schwann cell-like cells in a bioreactor, [0152] cultivation of the cell construct in the bioreactor [0153] exposing the cell construct to a mechanical stimulation in the bioreactor during cultivation by fixing the cell construct to a mechanical apparatus which applies strain onto the construct.
5. Method according to any one of embodiments 1 to 4, comprising differentiation of the precursor cells into Schwann cell-like cells, wherein differentiation is at least partially performed during stimulation in the bioreactor.
6. Method according to any one of embodiments 1 to 5, wherein the biocompatible matrix is present in a three-dimensional form, preferably with a support structure resembling the three-dimensional form, especially wherein the three-dimensional form is a three-dimensional cylinder form, a three-dimensional cuboid form, a three-dimensional sheet form or a three-dimensional ring form.
7. Method according to any one of embodiments 1 to 6, wherein the biocompatible matrix is provided finally as a three-dimensional cell construct in an oblongness shape, preferably in the form of a cylinder or a cuboid.
8. Method according to any one of embodiments 1 to 7, wherein the cell construct is a three-dimensional cell construct with a length, defined as the longest extension of the three-dimensional construct, and a diameter or thickness, defined as the longest extension of an axis which lies normal to the length of the construct, wherein the ratio of length to diameter or thickness is from 2:1 to 100:1, preferably from 4:1 to 40:1, especially from 5:1 to 20:1.
9. Method according to any one of embodiments 1 to 8, wherein cultivation is performed for a duration of 3 to 60 days, preferably for a duration of 7 to 42 days, especially for a duration of 14 to 28 days.
10. Method according to any one of embodiments 1 to 9, wherein the mechanical stimulation on the cells in contact with the biocompatible matrix during cultivation is performed for a duration of 1 to 60 days, preferably for a duration of 3 to 42 days, especially for a duration of 5 to 14 days; and/or wherein the mechanical stimulation on the cells in contact with the biocompatible matrix during cultivation is performed at least for the time of a single mechanical deformation step to 24 h, preferably from 30 min to 12 h, especially from 1 to 6 h, at least once a day for a duration of 1 to 60 days, preferably for a duration of 3 to 42 days, especially for a duration of 5 to 42 days.
11. Method according to any one of embodiments 1 to 10, wherein the mechanical stimulation on the cells is performed by a non-cyclic mechanical treatment, preferably by a static strain treatment or a ramp strain treatment, especially by a ramp strain treatment.
12. Method according to any one of embodiments 1 to 11, wherein the mechanical stimulation is performed as a strain treatment of 1 to 50%, preferably of 2 to 30%, especially of 3 to 20%, or as a treatment corresponding to a strain treatment of 1 to 50%, preferably of 2 to 30%, especially of 3 to 20%.
13. Method according to any one of embodiments 1 to 12, wherein the cell construct is at least partially exposed to electrical stimulation during cultivation, preferably by applying 10 to 200 mV/mm, more preferably 25 to 150 mV/mm, especially 50 to 125 mV/mm, for 1 to 24 h, more preferably from 2 to 12 h, especially from 3 to 8 h.
14. Method according to any one of embodiments 1 to 13, wherein cultivation and mechanical stimulation are performed until bands of Büngner-like structures have formed.
15. Method according to any one of embodiments 1 to 14, wherein the cell construct is subjected to washing and/or formulation steps for adapting the cell construct to surgical use, preferably by removing the cell construct from a bioreactor after cultivation and stimulation and placing the cell construct in a pharmaceutically acceptable medium.
16. Method according to any one of embodiments 1 to 15, wherein the cell construct is transferred to a transport medium after cultivation and stimulation subjected.
17. Method according to any one of embodiments 1 to 16, wherein the cell construct is brought into a storage-stable form after cultivation and stimulation, preferably by freezing or lyophilizing the cell construct.
18. Method according to any one of embodiments 1 to 17, wherein the cell construct is cultivated in a serum free medium or transferred into a serum free medium after cultivation and stimulation.
19. Method according to any one of embodiments 1 to 18, wherein cultivation and stimulation are performed under aseptic conditions.
20. Method according to any one of embodiments 1 to 19, wherein cell densities of 250,000 cells/mL to 30,000,000 cells/mL, preferably from 1,000,000 cells/mL to 20,000,000 cells/mL, especially from 2,000,000 cells/mL to 10,000,000 cells/mL, and/or 250,000 to 15,000,000 cells, preferably from 500,000 to 10,000,000 cells, especially from 1,000,000 to 5,000,000 cells, are contacted with the biocompatible matrix and subjected to cultivation.
21. Method according to any one of embodiments 1 to 20, wherein the mechanical stimulation is performed as an extrinsic elongation deformation (strain) of 1 to 50%, preferably of 2 to 30%, especially of 3 to 20%, or as a treatment corresponding to an elongation deformation of 1 to 50%, preferably of 2 to 30%, especially of 3 to 20%.
22. Method according to any one of embodiments 1 to 21, wherein the mechanical stimulation is performed as an extrinsic elongation deformation (strain) of at least 2%, preferably of at least 3%, especially of at least 5%, or as an elongation deformation of at least 2%, preferably of at least 3%, especially of at least 5%.
23. Method according to any one of embodiments 1 to 22, wherein the mechanical stimulation is performed as an extrinsic elongation deformation (strain) of at least 8%, preferably of at least 10%, especially of at least 15%, or as an elongation deformation of at least 8%, preferably of at least 10%, especially of at least 15%.
24. Method according to any one of embodiments 1 to 23, wherein the cell construct has a length, defined as the longest extension of the three-dimensional construct, of 1 mm to 30 cm, preferably of 0.3 cm to 10 cm, especially of 0.5 cm to 5 cm.
25. Method according to any one of embodiments 1 to 24, wherein the mechanical stimulation is performed on a construct with a Young's modulus of 5 to 50 kPa, preferably with a Young's modulus of 8 to 30 kPa, especially with a Young's modulus of 10 and 20 kPa.
26. Method according to any one of embodiments 1 to 25, wherein the mechanical stimulation is performed as an extrinsic deformation expressed as a percentual change of length in the load axis of 1 to 50%, preferably of 2 to 30%, especially of 3 to 20%.
27. Method according to any one of embodiments 1 to 26, wherein the mechanical stimulation is performed as an extrinsic deformation expressed as a percentual change of length in the load axis of at least 2%, preferably of at least 3%, especially of at least 5%.
28. Method according to any one of embodiments 1 to 27, wherein the mechanical stimulation is performed as an extrinsic deformation expressed as a percentual change of length in the load axis of at least 8%, preferably of at least 10%, especially of at least 15% and/or wherein the mechanical stimulation is performed as an extrinsic deformation expressed as a percentual change of length in the load axis of at least 8%, preferably of at least 10%, especially of at least 15%.
29. Method according to any one of embodiments 1 to 28, wherein more than one, preferably at least five, especially at least 10 cell constructs are combined to obtain a stacked cell construct.
30. Method according to any one of embodiments 1 to 29, wherein the biocompatible matrix comprises of at least 5 dry w/w %, preferably of at least 30 dry w/w %, especially of at least 50 dry w/w %, fibrin or consist of fibrin.
31. Cell construct obtainable by a method according to any one of embodiments 1 to 30.
32. Cell construct comprising Schwann cells or Schwann cell-like cells and a biocompatible matrix, wherein the cell construct has a bands of Büngner structure.
33. Cell construct according to embodiment 31 or 32, wherein the construct is a nerve guidance graft, especially alone or in combination with a nerve guidance conduit, preferably comprising a pharmaceutically acceptable carrier or being manufactured for neurosurgical use.
34. Cell construct according to any one of embodiments 31 to 33, wherein the construct has a three-dimensional cylinder form, a three-dimensional cuboid form, a three-dimensional sheet form or a three-dimensional ring form; and wherein the construct has a diameter or thickness of the cylinder or the ring or the longest extension of the cuboid or sheet of 0.5 mm to 25 mm, preferably of 1 mm to 10 mm, especially of 2 mm to 5 mm.
35. Cell construct according to any one of embodiments 31 to 34, wherein the construct and/or the biocompatible matrix is a non-auxetic material, preferably a material with a positive Poisson's ratio at the macroscale, especially a material with a Poisson's ratio at the macroscale of 0.1 to 0.5.
36. Cell construct according to any one of embodiments 31 to 35, for use in a therapeutic treatment, preferably for use in neurosurgery, especially for use in the treatment of nerve injuries.
37. Cell construct according to any one of embodiments 31 to 36 for use in neurapraxia, axonotmesis, and neurotmesis, preferably in neurotmesis.
38. Cell construct according to any one of embodiments 31 to 37 for use in the treatment of Degree I to V injuries, preferably of Degree III to V injuries.