ANTICANCER APTAMERS AND USES THEREOF
20230227832 · 2023-07-20
Assignee
Inventors
- Vittorio DE FRANCISCIS (Rome (RM), IT)
- Gerolama CONDORELLI (Rome (RM), IT)
- Silvia CATUOGNO (Rome (RM), IT)
- Carla Lucia ESPOSITO (Rome (RM), IT)
- Cristina QUINTAVALLE (Rome (RM), IT)
- Francesco INGENITO (Rome (RM), IT)
Cpc classification
C12N15/115
CHEMISTRY; METALLURGY
International classification
C12N15/115
CHEMISTRY; METALLURGY
C12N15/10
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a nucleotide aptamer or a variant thereof, or a functional fragment thereof, the medical or diagnostic use thereof, the related pharmaceutical composition and a method for selecting a nucleotide aptamer which specifically binds to exosomes isolated from target cells. The present invention further relates to a kit and nucleic acid coding for the aptamer.
Claims
1. A nucleotide aptamer or a variant thereof, wherein said aptamer comprises the sequence: TABLE-US-00007 (SEQ ID No. 1) 5′ GGGAAGAGAAGGACAUAUGAUCGUGAUAGCUGUGGCAGUUAAGAAU AGAUCUUCGCUGCGAUUGACUAGUACAUGACCACUUGA 3′ in which the underlined sequence (SEQ ID No. 2) CGUGAUAGCUGUGGCAGUUAAGAAUAGAUCUUCGCUGCGA can be replaced with (SEQ ID No. 3) UGGCGGCUCGUUGAAGGUCGUCUCACGGGCUAGGAAUGCG or with (SEQ ID No. 4) ACGGCUGUUGCUUCGAAUGAACCAAGGUUCCUCGGCGCAA or a functional fragment thereof in which said fragment comprises the sequence (SEQ ID No. 2) CGUGAUAGCUGUGGCAGUUAAGAAUAGAUCUUCGCUGCGA or (SEQ ID No. 3) UGGCGGCUCGUUGAAGGUCGUCUCACGGGCUAGGAAUGCG or (SEQ ID No. 4) ACGGCUGUUGCUUCGAAUGAACCAAGGUUCCUCGGCGCAA.
2. The aptamer or variant thereof or a functional fragment thereof according to claim 1, wherein pyrimidine residues are replaced with 2′-fluoropyrimidine or wherein said aptamer or variant thereof or a functional fragment thereof is conjugated to at least one anticancer agent.
3. The aptamer or variant thereof or a functional fragment thereof according to claim 1 which comprises or consists of the sequence TABLE-US-00008 (SEQ ID No. 9) 5′ UGUGGCAGUUAAGAAUAGAUCUUCGCUGCGAUU 3′.
4. (canceled)
5. A method for the treatment and/or prevention of a tumor comprising administering the aptamer or variant thereof or a functional fragment thereof of claim 1 to a patient in need thereof.
6. A method for selecting a nucleotide aptamer or a variant thereof comprising the steps of: a) incubating a library of synthetic nucleotide oligomers with exosomes isolated from control cells, allowing the oligomers to bind thereto; b) recovering a first series of nucleotide oligomers not bound to the exosomes isolated from control cells; c) incubating said first series of nucleotide oligomers with exosomes isolated from target cells, allowing the first series of nucleotide oligomers to bind thereto; d) recovering a second series of nucleotide oligomers bound to exosomes isolated from target cells; e) amplifying said second series of nucleotide oligomers; f) repeating steps a), b), c) and d) at least once and g) selecting and sequencing nucleotide oligomers bound to exosomes isolated from target cells; wherein said nucleotide aptamer or a variant thereof binds specifically to exosomes isolated from target cells.
7. The method according to claim 6, wherein the synthetic nucleotide oligomers are labelled.
8. The method according to claim 6, wherein the nucleotide oligomers are oligoribonucleotides or modified nuclease-resistant oligoribonucleotides.
9. The method according to claim 6, wherein the exosomes are conjugated to magnetic beads.
10. The method according to claim 6, wherein the target cell is a tumor cell, or a breast cancer cell.
11. The method according to claim 6, wherein the library used in step a) is a complex library, or a library comprising at least 10.sup.14 oligonucleotides.
12. The method according to claim 6, wherein the library used in step a) is a RNA library prepared from the corresponding DNA library.
13. The method according to claim 6, wherein the library used in step a) is a RNA library comprising a pool of RNAs modified with 2′Fluoro-pyrimidines (2′F-Py).
14. The method according to claim 6, wherein in step a) oligomers bind to exosomes in a time comprised between 5 and 30 minutes.
15. The method according to claim 6, wherein said exosomes are whole exosomes.
16. The method according to claim 6, wherein said selected nucleotide aptamer or a variant thereof binds specifically to surface antigens of said exosomes isolated from target cells.
17. A nucleotide aptamer or a variant thereof obtainable by the method according to claim 6.
18. A pharmaceutical composition comprising the aptamer or the variant thereof of claim 1, said composition optionally further comprising another therapeutic agent.
19. A method for diagnosing a tumor in a patient from whom a sample was obtained, comprising: incubating the sample with the aptamer or the variant thereof according to claim 1; measuring the binding of the aptamer to the sample, wherein said sample is optionally a blood, serum or saliva sample, a biopsy, urine or cerebrospinal fluid.
20. A kit for diagnosing a tumor comprising a nucleotide aptamer or the variant thereof according to claim 1.
21. A nucleic acid coding for the aptamer or the variant thereof according to claim 1.
Description
[0064] The present invention will be illustrated with the aid of non-limiting examples referring to the following figures and tables.
TABLE-US-00003 TABLE 1 SELEX cycle conditions Table 1. SELEX conditions. The amount of RNA, incubation time, number of washes after positive selection, cell lines used as a source of exosomes and the presence of competitor during the different cycles of Exo-SELEX are indicated. Comp.: competitor (t-RNA, 0.1 mg/mL). RNA Time Counter- Positive # (pmoles) (min) Washes selection selection Comp. 1 800 30 1 Pt. 100; Pt. 101 Pt. 46 (HER.sup.+) NO 2 800 30 2 Pt. 100; Pt. 101 Pt. 46 (HER.sup.+) NO 3 600 30 3 Pt. 72 Pt. 46 (HER.sup.+); NO Pt. 170 (TNBC) 4 800 30 4 Pt. 72; Pt. 44 Pt. 46 (HER.sup.+); NO Pt. 37 (HER.sup.+) 5 800 30 5 Pt. 72; Pt. 46 (HER.sup.+); NO Pt. 100; Pt. 101 Pt. 170 (TNBC) 6 800 30 5 Pt. 72; Pt. 44 Pt. 46 (HER.sup.+); Yes Pt. 37 (HER.sup.+) 7 800 30 5 Pt. 72; Pt. 44 Pt. 46 (HER.sup.+); Yes Pt. 37 (HER.sup.+) 8 800 30 5 Pt. 72; Pt. 44 Pt. 46 (HER.sup.+); Yes Pt. 37 (HER.sup.+)
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
DETAILED DESCRIPTION OF THE INVENTION
Examples
[0072] Materials and Methods
[0073] Commercial cell lines, cell lines derived from patient samples, and patient blood were used. The patients involved in the study were informed and we requested informed consent. The ethics committee of the University of Naples approved the recruitment and sampling protocols (study no. 119/15ES1).
[0074] Cell Cultures and Exosome Isolation
[0075] Primary cultures of primary BC or normal epithelial cells (derived from normal breast hyperplasia) were prepared from surgical samples of human biopsies (provided by Clinica Mediterranea S.p.a) as previously reported (Donnarumma E, et al. Oncotarget. 2017). The cells were maintained in DMEM/Nutrient F12-Ham growth medium (DMEM-F12) (Sigma-Aldrich).
[0076] The continuous cell lines were purchased from ATCC (standard LG, Milan, Italy) and grown in the following mediums: BC cells T47D, BT549 and MDA-MB-231, NSCLC cells A549 and H460: Roswell Park Memorial Institute (RPMI); BC MCF-7 cells, NSCLC Calu-1 cells, GBM U87MG and U251MG cells: DMEM; LN-229 GBM cells: DMEM-advanced; MCF10A cells: DMEM/F12 supplemented with EGF (20 ng/ml), hydrocortisone (0.5 μg/ml), cholera toxin (100 ng/ml), insulin (10 μg/ml), horse serum (5%). All the mediums were supplemented with 10% fetal bovine serum (FBS, Sigma-Aldrich.
[0077] For the exosome preparation, the cells were grown in medium with 10% FBS-Exo.sup.− (exosome depleted, SBI) in 150 mm plates (15 ml volume). The exosomes were isolated from the growth medium using the ExoQuick-TC™ kit (SBI) according to the protocol in the instructions.
[0078] RNA Preparation and In Vitro Transcription
[0079] For the SELEX procedure, we used a 2′-F-Py modified RNA library which was prepared from the corresponding DNA library (from TriLink Biotech) with a degenerated central region of 40 nucleotides flanked by two constant sequences required for amplification and transcription. The library or single long sequences were amplified by means of PCR using the following primers: forward (with T7-RNA polymerase promoter): 5′-TTCAGGTAATACGACTCACTATAGGGAAGAGAAGGACATATGAT-3′ (SEQ ID No. 5); reverse: 5′-TCAAGTGGTCATGTACTAGTCAA-3′ (SEQ ID No. 6). The program used was: 10 cycles of: 30 seconds at 95° C., 30 seconds at 64° C. and 1 minute at 72° C.
[0080] The in vitro transcription of the library or individual sequences was performed in the presence of 1 mM 2′-F-Py using a mutant form of T7 RNA polymerase (Epicentre Biotechnologies). The DNA template was incubated at 37° C. o.n. in a transcription mixture containing: 1× transcription buffer, 1 mM 2′F-Py (2′F-2′-dCTP and 2′F-2′-dUTP, TriLink Biotech, San Diego, Calif.), 1 mM ATP, 1 mM GTP (Thermo scientific), 10 mM dithiothreitol (Thermo scientific), 0.5 u μl RNAse inhibitors (Roche), 5 μg/ml inorganic pyrophosphatase (Roche) and 1.5 u/μl T7-RNA polymerase. After transcription, the remaining DNA was removed by means of DNase I digestion (Roche) and the resulting sequences were recovered with phenol:chloroform extraction and ethanol precipitation. The RNAs were purified over 8% acrylamide/7 M urea denaturing gel.
[0081] The short aptamers were purchased from Tebu-bio srl.
[0082] Exosome-SELEX
[0083] For the SELEX strategy, the exosomes were isolated from the cell growth medium (15 ml medium), quantified by means of Bradford (Bio-rad) and 40 μg were conjugated with magnetic beads containing anti-CD81 antibodies (ThermoFisher Scientific) at 4° C. o.n. Prior to each SELEX cycle, the pool of 2′F-Py RNA was diluted in PBS and subjected to denaturation/renaturation steps of 85° C. for 5 minutes, ice for 2 minutes, 37° C. for 10 minutes. The library was first incubated for 30 minutes at room temperature with exosomes derived from normal cells (NE) bound to the magnetic beads with gentle rotation (counter-selection step). The unassociated RNAs were recovered using a magnetic separator (Millipore) and incubated with exosomes derived from cancer cells conjugated with the beads for 30 minutes with gentle rotation (selection step). The aptamer-exosome complexes were recovered with the magnetic separator, washed with PBS and suspended in euroGOLD TriFast (Euroclone) for the RNA extraction. The recovered RNA was amplified by means of RT-PCR and transcribed for the following SELEX cycle (see Table 1 for the conditions). When exosomes from multiple lines were included in the cycle, an equal amount of exosomes (for a total of 40 μg) from each sample was pooled and used as a target.
[0084] The reverse-transcription was performed using the enzyme M-MuLV (Roche). The product obtained was then amplified by means of error-prone PCR in the presence of high concentrations of MgCl2 (7.5 mM) and dNTP (1 mM) in order to introduce random mutations. The PCR program used was: 30 seconds at 95° C., 1 minute at 64° C. and 30 seconds at 72° C.
[0085] Isolation of Individual Aptamers
[0086] The individual sequences were obtained by means of cloning the final pool with the kit TOPO-TA (Invitrogen), according to the manufacturer's protocol. The transformation was performed with Escherichia coli DH5α (Invitrogen). Individual white clones were recovered, the DNA was extracted with the MINIPREP kit (Qiagen) and sequenced by Eurofins Genomics by means of T7 primer. To derive the shortened sequence, the secondary structure of the aptamer was analyzed with RNAFold (http://rna.tbi.univie.ac.at).
[0087] The sequences of long aptamers are:
TABLE-US-00004 Ex-50: (SEQ ID No. 1) 5′ GGGAAGAGAAGGACAUAUGAUCGUGAUAGCUGUGGCAGUUAAGAAU AGAUCUUCGCUGCGAUUGACUAGUACAUGACCACUUGA 3′ Ex-55: (SEQ ID No. 7) 5′ GGGAAGAGAAGGACAUAUGAUUGGCGGCUCGUUGAAGGUCGUCUCA CGGGCUAGGAAUGCGUUGACUAGUACAUGACCACUUGA 3′ Ex-56: (SEQ ID No. 8) 5′ GGGAAGAGAAGGACAUAUGAUACGGCUGUUGCUUCGAAUGAACCAA GGUUCCUCGGCGCAA UUGACUAGUACAUGACCACUUGA 3′
[0088] The central variable region is underlined.
[0089] The sequence of ex-50.T is:
TABLE-US-00005 (SEQ ID No. 9) 5′ UGUGGCAGUUAAGAAUAGAUCUUCGCUGCGAUU 3′
[0090] Binding Test by Means of RT-qPCR
[0091] For the binding assays, the RNA sequences were diluted in PBS, subjected to denaturation/renaturation steps and incubated at a concentration of 200 nM with exosomes bound (13 μg) to magnetic beads for 30 minutes with slight rotation at room temperature. The unassociated RNAs were removed with the magnetic separator by washing 4 times with PBS. The associated RNAs were recovered from TRIzole containing 0.5 pmol/mL of an unrelated aptamer (CL4:
TABLE-US-00006 (SEQ ID No. 10) 5′-GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC-3′
[0092] used as an internal reference and amplified. Briefly, the recovered RNAs were reverse-transcribed using the reverse primer with the following protocol: 65° C. for 5 minutes, 22° C. for 5 minutes, 42° C. for 30 minutes, 48° C. for 30 minutes, 95° C. for 5 minutes. The RT reaction products were amplified with iQ SYBR Green Supermix (Bio-Rad, Hercules, Calif.) with the following protocol: initial heating step at 95° C. for 2 minutes, followed by 40 cycles of 95° C. for 30 s, 55° C. for 30 s, 60° C. for 30 s. The amounts of RNA recovered were calculated in relation to a standard curve of known RNA concentrations and normalized with respect to the internal reference CL4.
[0093] ELONA-Based Test
[0094] For ELONA, wells of a 96-well High Binding microplate (Nunc MaxiSorp) were left uncoated or coated with exosomes (4 μg) o.n. All the subsequent steps were performed at room temperature. Following incubation, the plate was blocked with 300 μl 3% BSA (AppliChem) in PBS for 2 hours and incubated with 100 μL biotinylated aptamers (Tebu-bio), dissolved in PBS for 2 hours. Then the plate was washed three times with 300 μl PBS and streptavidin-HPR dissolved in 100 μl PBS (Sigma Aldrich) was added with dilution 1:10000. After 1 hour of incubation, the plate was washed three times before the addition of the TMB developing solution. The reaction was stopped with 0.16 M sulfuric acid and signal strength was analyzed by measuring absorbance at 450 nm with a microplate reader (Thermo Scientific).
[0095] MDA-MB-231-derived exosomes and increasing concentrations of aptamer (ex-50.T or control) were used to calculate the binding affinity. The Kd was determined by means of GraphPad Prism. To verify the binding on human serum alumina (HSA), the plate coating was performed at 30 nM HSA (Sigma Aldrich).
[0096] Serum Sample Exosome Binding Assay
[0097] On the day patients underwent surgery to remove the tumor mass, serum samples (yellow cap Vacutainer) were collected and subsequently stored at −80° C. The exosomes were extracted with the Norgen Biotek Corporation serum/plasma isolation kit. 13 μg of exosomes were conjugated to anti-CD81 magnetic beads o.n. at 4° C. The binding was measured by means of RT-qPCR as described above. Six normal serum samples and six serum samples from patients with BC were selected. No age difference was found in the group (mean normal vs. tumor SD, 43.8±5.26 vs. 50.5±7.31).
[0098] Serum Stability
[0099] To verify the serum stability, that aptamer was incubated at a concentration of 4 μM in 85% human serum (from (human serum type AB, Euroclone) from 1 to 96 hours. At each time interval, the RNA (16 pmols) was recovered and incubated for 1 h at 37° C. with proteinase K in order to remove the serum proteins prior to electrophoretic migration in 15% denaturing polyacrylamide gel. The gel was stained with ethidium bromide and viewed by means of exposure to UV rays. The bands were quantified with the program Image J NIH.
[0100] Immunofluorescence
[0101] The MDA-MB-231 cells were cultured on glass slides in 24-well plates in exosome-free 10% FBS medium. The exosomes isolated from MDA-MB-231 were labeled with PKH26, a fluorescent cell membrane dye with red emission (Sigma-Aldrich). For the labeling, the exosomes were incubated for 5 min at room temperature with PKH26 (diluted 1:1000 in PBS) and then an equal volume of 1% BSA was added to stop the reaction. To recover the labeled exosomes, the samples were ultracentrifuged for 70 min at 100,000×g at 4° and washed with 4 ml of PBS. The pellet containing labeled exosomes was resuspended in FBS-free culture medium and quantified by means of Bradford (Bio-rad). The exosomes (40 μg for each test point) were incubated in the dark with denatured aptamers (400 nM) for 30 minutes with gentle rotation at room temperature. The cells were treated for 3 hours with exosomes pre-incubated or not with aptamers, washed three times with PBS, fixed with a mixture of Methanol/Acetone (1:1) for 10 minutes at −20° C. The slides were washed twice with PBS and mounted with Gold antifade reagent with DAPI (Invitrogen) and viewed by means of confocal microscopy.
[0102] Wound Healing Test
[0103] MCF-7 breast cancer cells (2×105) were plated in 24-well multiwells in DMEM with exosome-free 10% FBS. After 24 h, the cells were scraped to induce a wound, washed with PBS and treated with 50 μg MDA-MB-231-derived exosomes pre-incubated or not with aptamers in serum-free DMEM. Photos were taken immediately after wound creation and after 24 hours.
[0104] Migration Test by Means of Boyden Chamber
[0105] MCF10A cells (5×10.sup.4 cells) were plated in the upper chamber of a 24-well transwell (Corning Incorporate, Corning, N.Y.) in DMEM/F12 with exosome-free 0.5% FBS containing 20 μg MDA-MB-231-derived exosomes pre-incubated or not with the aptamer ex-50.T or CtrlApt (400 nM). The medium 10% FBS was used as chemo attractor. After 48 hours, the migrated cells were stained with 0.1% crystal violet in 25% methanol. The percentage of migrated cells was evaluated by means of the program Image J NIH.
[0106] Pulldown Experiments
[0107] Protein identification was performed with an adapted protocol described previously by Berezovski et al. (Berezovski M. V., Lechmann M., Musheev M. U., Mak T. W., Krylov S. N. Aptamer-facilitated biomarker discovery (AptaBiD) J. Am. Chem. Soc. 2008) and Affinito et al (Affinito A, Quintavalle C, Esposito C L, Targeting Ephrin Receptor Tyrosine Kinase A2 with a Selective Aptamer for Glioblastoma Stem Cells. Mol Ther Nucleic Acids. 2020 Jun. 5; 20:176-185. doi: 10.1016/j.omtn.2020.02.005. Epub 2020 Feb. 13. PMID: 32169805; PMCID: PMC7068199.). To isolate protein, cells or exosomes were lysed with sodium deoxycholate (Sigma-Aldrich) at 0.1% (w/v) in 10 mM PBS with Ca2+, Mg2+(Sigma-Aldrich) and incubated with a biotinylated-scrambled at 200 nM for 30 min at room temperature, as a counterselection step. Then, lysates were incubated with streptavidin MagneSphere paramagnetic particles (Promega, Milan, Italy) for 30 min at 4° C. Afterward, unbound proteins were incubated with biotinylated A40s (TriLinK Biotechnologies) at 200 nM for 30 min at room temperature. Ex.50.T-protein complexes were incubated with streptavidin MagneSphere paramagnetic particles (Promega) for 30 min at 4° C. Collected beads were washed twice with cold 10 mM PBS with Ca2+, Mg2+(Sigma-Aldrich). Thus, incubation with 8 M urea for 1 h at 4° C. led to protein denaturation and release from the aptamer and magnetic beads. Pull-down proteins were analysed by mass spectrometry or separated by SDS-PAGE (12% polyacrylamide gel), transferred to nitrocellulose membranes (Millipore, Bedford, Mass., USA), and immunoblotted for GREM1 antibody (Cell Signalling Technology).
[0108] Western Blot
[0109] Exosomes or cells were lysed in RIPA buffer (Thermo Scientific, Pierce RIPA buffer 89900) containing Protease Inhibitor (Roche, Protease inhibitor cocktail tablets 11836145001) and Phosphatases inhibitor (Sigma, Phosphatase inhibitor cocktail 3) for 2 hours in ice and the protein concentration was determined by the Bradford assay (Bio-Rad, Protein Assay Dye Reagent Concentrate 500-0006). Then, 16 μg of protein was separated by 10% SDS-PAGE and blotted onto a nitrocellulose membrane (GE Healthcare). The membranes were stained with a Ponceau S solution (Sigma) and then washed with Tris-buffered saline containing 0.1% Tween-20 (T-TBS). After blocking with 5% No Fat Dry Milk in T-TBS, the membranes were incubated at 4° C. overnight with the following primary antibodies: anti-b-Actin (Sigma Aldrich) and anti-PDGFR-b (Cell signalling) and anti GREM1 (Cell Signalling Technology). Detection was performed by peroxidase-conjugated secondary antibodies using the ultra-enhanced chemiluminescence system (Thermo Scientific).
[0110] KD Determination
[0111] The KD for the ex50.T-recombinant human GREM1 complex was determined by performing an aptamer-based ELONA, as previously described. Fitting curves were designed by using GraphPad Prism 6 software.
[0112] Statistical Analysis
[0113] The statistics were analysed with the t test for comparisons between two groups as indicated.
[0114] Results
[0115] In order to generate aptamers capable of selectively binding BC exosomes, a new and innovative differential SELEX procedure, referred to as exo-SELEX, was developed.
[0116] The procedure uses exosomes as selection targets. To have a simple manner to recover the bound aptamers, the whole exosomes were conjugated to magnetic beads. Such a technique therefore extends the use of magnetic beads hitherto applied to the immobilization of purified proteins, to the capture of whole exosomes while preserving the physiological structure thereof. The selection approach is able to combine the simplicity of SELEX on protein with the maintenance of the physiological state of the typical SELEX cell targets.
[0117] Specifically, exosomes derived from normal primary epithelial or tumor cells are used as targets for counter-selection and selection, respectively. A pool of RNAs modified with 2′Fluoro-pyrimidines (2′F-Py) was used as the starting library to increase nuclease resistance. At each exo-SELEX cycle (
[0118] After performing 8 cycles of exo-SELEX (at least 8 cycles, at least 10 cycles), the final library effectively enriched with aptamers capable of binding BC exosomes (
[0119] Among the sequences, the best binding properties were identified for the aptamer ex-50. The ability of ex-50 to effectively discriminate BC exosomes was confirmed by means of binding assays on exosomes derived from other BC patients (
[0120] The aptamer ex-50 was then optimized by deriving a short version (ex-50.T) of 33 mer (
[0121] In addition to recognizing BC exosomes, ex-50.T is also endowed with an inhibitory action, being able to block the uptake thereof and inhibit exosome-dependent cell migration (
[0122] Ex50.T showed excellent binding affinity for BC exosomes, good serum stability and non-binding to human serum albumin (
[0123] Furthermore ex.50.T showed a good ability in an ELONA assay to discriminate exosomes derived from serum of breast cancer patients compared to exosome derived from serum of control patients (
[0124] The selection protocol described herein concerns the SELEX methodology applied to intact tumor exosomes. It offers a new, innovative and simple differential approach to isolate aptameric molecules specifically capable of recognizing exosomes derived from cells of interest. The strategy therefore shows a wide applicability to different types of tumors, as well as to different clinical problems, including cardiovascular diseases and neurological disorders, which may benefit from exosome targeting.
[0125] The molecule obtained represents a specific aptamer for BC exosomes. So far, protocols for detecting exosomes employing oligonucleotides against known targets (such as CD63 and EpCAM) have been described (Zhang K, et al. ACS Sens. 2019; Wang L et al. ACS Appl Mater Interfaces. 2020; Xie X et al Nat Commun. 2019). The use of the aptamer of the invention allows a highly specific (not currently present) recognition necessary for the clinical applicability of these detection systems.
[0126] The aptamer of the invention is an example of an aptamer against tumor exosomes having inhibitory function and capable of blocking the uptake of BC exosomes. Recently, exosomes have been shown to be important mediators of communication between tumor cells and the stroma, playing a key role in tumor progression. Therefore, the inhibition of tumor exosome uptake by surrounding tissues is an effective strategy for interfering with tumor spread and development (Sun W et al. Acta Pharmacol Sin. 2018). By virtue of the functional properties of ex-50 T, it represents a useful molecule for blocking tumor spread and cell transformation.
[0127] Therefore, ex50.T shows high potential for the development of new non-invasive methods for the early detection of BC and innovative personalized therapeutic approaches for this tumor. The high flexibility of the molecule also makes it suitable for further chemical modifications aimed at improving the pharmacodynamic and pharmacokinetic properties thereof, as well as for the use thereof in molecular diagnosis techniques.
BIBLIOGRAPHIC REFERENCES
[0128] 1. Harbeck N, Gnant M. Breast cancer. Lancet. 2017; 18(389): 1134-50. [0129] 2. Rugo H S, Olopade O I, DeMichele A, Yau C, van't Veer L J, Buxton M B, et al. Adaptive randomization of veliparib-carboplatin treatment in breast cancer. N Engl J Med. 2016; 375(1): 23-34. [0130] 3. Joyce D P, Kerin M J, Dwyer R M. Exosome-encapsulated microRNAs as circulating biomarkers for breast cancer. Int J Cancer. 2016; 139(7): 1443-8. [0131] 4. Hannafon B N, Ding W Q. Intercellular communication by exosome-derived microRNAs in cancer. Int J Mol Sci. 2013; 14(7): 14240-69. [0132] 5. Lowry M C, Gallagher W M, O'Driscoll L. The role of exosomes in breast cancer. Clin Chem. 2015; 61(12): 1457-65. [0133] 6. Chia B S, Low Y P, Wang Q, Li P, Gaoa Z. Advances in exosome quantification techniques Trends Anal. Chem. 2017; 86: 93-106. [0134] 7. Rashed M H, Bayraktar E, Helal G K, Abd-Ellah M F, Amero P, Chavez-Reyes A, et al.
[0135] Exosomes: From Garbage Bins to Promising Therapeutic Targets Int J Mol Sci. 2017; 18(3): 538. [0136] 8. Hoshino A, Costa-Silva B, Shen T L, Rodrigues G, Hashimoto A, Tesic Mark M, et al. Tumour exosome integrins determine organotropic metastasis. Nature. 2015; 527(7578): 329-35. [0137] 9. Donnarumma E, Fiore D, Nappa M, Roscigno G, Adamo A, Iaboni M, et al. Cancer-associated fibroblasts release exosomal microRNAs that dictate an aggressive phenotype in breast cancer. Oncotarget. 2017; 8(12): 19592-608. [0138] 10. Bliss S A, Sinha G, Sandiford O A, Williams L M, Engelberth D J, Guiro K, et al.
[0139] Mesenchymal stem cell-derived exosomes stimulate cycling quiescence and early breast cancer dormancy in bone marrow. Can Res. 2016; 76(19): 5832-44. [0140] 11. Huang M B, Gonzalez R R, Lillard J, Bond V C. Secretion modification region derived peptide blocks exosome release and mediates cell cycle arrest in breast cancer cells. Oncotarget. 2017; 8(7): 11302-15. [0141] 12. Taylor D D, Gercel-Taylor C. Exosomes/microvesicles: mediators of cancer associated immunosuppressive microenvironments. Semin. Immunopathol. 2011; 33: 441-54. [0142] 13. Wang M, Ji S, Shao G, Zhang J, Zhao K, Wang Z, et al. Effect of exosome biomarkers for diagnosis and prognosis of breast cancer patients Clin Transl Oncol. 2018; 20(7): 906-11. [0143] 14. Cheng N, Du D, Wang X, Liu D, Xu W, Luo Y, et al. Recent Advances in Biosensors for Detecting Cancer-Derived Exosomes. Trends in Biotechnology 2019; 37(11): 1236-54. [0144] 15. Wu X, Chen J, Wu M, Zhao J X. Aptamers: Active Targeting Ligands for Cancer Diagnosis and Therapy. Theranostics 2015; 5(4): 322-44. [0145] 16. Catuogno S, Esposito C L. Aptamer Cell-Based Selection: Overview and Advances. Biomedicines. 2017; 5(3): E49. [0146] 17. Maimaitiyiming Y, Hong F, Yang C, Naranmandura H. Novel insights into the role of aptamers in the fight against cancer. J Cancer Res Clin Oncol. 2019; 145(4): 797-810. [0147] 18. Zhou Y, Xu H, Wang H, Ye B C. Detection of breast cancer-derived exosomes using the horseradish peroxidase-mimicking DNAzyme as an aptasensor. Analyst. 2019; 145(1):107-114. [0148] 19. Zou J, Shi M, Liu X, Jin C, Xing X, Qiu L, Tan W. Aptamer-Functionalized Exosomes: Elucidating the Cellular Uptake Mechanism and the Potential for Cancer-Targeted Chemotherapy. Anal Chem 2019; 91 (3): 2425-2430. [0149] 20. Park S M, Aalipour A, Vermesh O, Yu J H, Gambhir S S. Towards clinically translatable in vivo nanodiagnostics. Nat Rev Mater. 2017; 2(5): 17014. [0150] 21. Jafari S H, Saadatpour Z, Salmaninejad A, Momeni F, Mokhtari M, Nahand J S, et al. Breast cancer diagnosis: Imaging techniques and biochemical markers. J Cell Physiol. 2018; 233(7): 5200-13. [0151] 22. Zhang K, Yue Y, Wu S, Liu W, Shi J, Zhang Z. Rapid Capture and Nondestructive Release of Extracellular Vesicles Using Aptamer-Based Magnetic Isolation. ACS Sens. 2019; 4(5): 1245-51. [0152] 23. Wang L, Pan Y, Liu Y, Sun Z, Huang Y, Li J, et al. Fabrication of an Aptamer-Coated Liposome Complex for the Detection and Profiling of Exosomes Based on Terminal Deoxynucleotidyl Transferase-Mediated Signal Amplification. ACS Appl Mater Interfaces. 2020; 12(1): 322-9. [0153] 24. Xie X, Nie H, Zhou Y, Lian S, Mei H, Lu Y, et al. Eliminating blood oncogenic exosomes into the small intestine with aptamer-functionalized nanoparticles. Nat Commun. 2019; 10(1):5476. [0154] 25. Quintavalle C. et al.: “Aptamer-mediated exosomes detection for early breast cancer identification”, Annals of Oncology, vol. 30, no. suppl 5 Oct. 2019, page v804 [0155] 26. Ana Diaz-Fernández, Ramón Lorenzo-Gómez, Rebeca Miranda-Castro, Noemí de-Los-Santos-Álvarez, María Jesús Lobo-Castańón. Electrochemical aptasensors for cancer diagnosis in biological fluids—A review. Review Anal Chim Acta, 2020 Aug. 8; 1124:1-19. doi: 10.1016/j.aca.2020.04.022. [0156] 27. Yu An, Rui Li, Fan Zhang, Pingang He. Magneto-Mediated Electrochemical Sensor for Simultaneous Analysis of Breast Cancer Exosomal Proteins Anal Chem 2020 Apr. 7; 92(7):5404-5410. doi: 10.1021/acs.analchem.0c00106. [0157] 28. Hassn Eman M. et al. «Recent advances in cancer early detection and diagnosis: role of nucleic acid based aptasensors”, Trac Trends in analytical chemistry, vol. 124, 9 Jan. 2020. Doi:10.1016/j.trac.2020.115806 [0158] 29. Rongrong Huang, Lei He, Yanyan Xia, Hongpan Xu, Chang Liu, Hui Xie, Su Wang, Lijun Peng, Yufeng Liu, Yuan Liu, Nongyue He, Zhiyang Li. A Sensitive Aptasensor Based on a Hemin/G-Quadruplex-Assisted Signal Amplification Strategy for Electrochemical Detection of Gastric Cancer Exosomes. Small 2019 May; 15(19):e1900735. doi: 10.1002/smll.201900735. [0159] 30. Tassilo Hornung, Heather A O'Neill, Stephen C Logie, Kimberly M Fowler, Janet E Duncan, Matthew Rosenow, Aniket S Bondre, Teresa Tinder, Varun Maher, Jelena Zarkovic, Zenyu Zhong, Melissa N Richards, Xixi Wei, Mark R Miglarese, Gunter Mayer, Michael Famulok, David Spetzler. ADAPT identifies an ESCRT complex composition that discriminates VCaP from LNCaP prostate cancer cell exosomes Nucleic Acids Res. 2020 May 7; 48(8):4013-4027. doi: 10.1093/nar/gkaa034.31. [0160] 31. Yifan Liu, Guang Chen, Dihua Shangguan, Liqin Zhang, Shuo Wan, Yuan Wu, Hui Zhang, Lian Duan, Chao Liu, Mingxu You, Jie Wang, Weihong Tan. Generating Cell Targeting Aptamers for Nanotheranostics Using Cell-SELEX. Theranostics. 2016 Jun. 15; 6(9):1440-52. doi: 10.7150/thno.15666.