VESICULAR ADAPTOR AND USES THEREOF IN NUCLEIC ACID LIBRARY CONSTRUCTION AND SEQUENCING

20200080140 ยท 2020-03-12

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided are a vesicular adaptor and a single-chain cyclic library constructed by using the adaptor. The library can be used for RNA sequencing and other sequencing platforms dependent on a single-stranded cyclic library, and has the advantage of high throughput sequencing, high accuracy and simple operations.

Claims

1. A method for constructing a cyclic single-stranded library by use of an oligonucleotide vesicular adaptor, comprising: (a) ligating the oligonucleotide vesicular adaptor with a double-stranded DNA fragment to provide a structure K1-K2-K3, wherein K2 represents the double-stranded DNA fragment, and K1 and K3 each represent an oligonucleotide vesicular adaptor ligated to K2 respectively at two terminals of K2; (b) subjecting the double-stranded structure obtained in (a) to amplification under a pair of primers so as to obtain an amplified double-stranded DNA product; (c) isolating a single-stranded DNA from the amplified double-stranded DNA product obtained in (b); and (d) subjecting the single-stranded DNA obtained in (c) to cyclization in the presence of a cycling single-stranded molecule, so as to obtain the cyclic single-stranded library, wherein the oligonucleotide vesicular adaptor comprises: a 5 paired double-stranded region at a first terminal of the adaptor; a 3 paired double-stranded region at a second terminal of the adaptor, comprising a first strand and a second strand complementary with each other, wherein the first strand of the 3 paired double-stranded region comprises an overhang at the 3 end thereof and the second strand of the 3 paired double-stranded region comprises a phosphorylated base at the 5 end thereof so as to provide a sticky terminal, and a vesicular non-paired region between the 5 paired double-stranded region and the 3 paired double-stranded region, wherein the vesicular non-paired region comprises a first strand and a second strand non-complementary with each other and the first strand of the vesicular non-paired region is of a length longer than that of the second strand of the vesicular non-paired region.

2. The method according to claim 1, wherein K1 and K3 are each ligated to K2 via the sticky terminal of the 3 paired double-stranded region.

3. The method according to claim 2, wherein the sticky terminal of the 3 paired double-stranded region of the oligonucleotide vesicular adaptor has a single base tail.

4. The method according to claim 3, wherein the single base tail is thymine (T).

5. The method according to claim 1, wherein before the step (a), the method further comprises: (e) end-repairing the double-stranded DNA fragment to obtain a double-stranded DNA fragment with blunt terminals; and (f) adding an adenine (A) base to each 3-end of the double-stranded DNA fragment with the blunt terminals obtained in (e), to obtain a double-stranded DNA fragment with an A base at each 3 end thereof.

6. The method according to claim 5, wherein the step (a) is performed by ligating the oligonucleotide vesicular adaptor as defined in claim 1 to each terminal of the double-stranded DNA fragment with the A base at each 3-end thereof obtained in (f) to obtain a double-stranded DNA fragment ligated with the oligonucleotide vesicular adaptor at each terminal thereof.

7. The method according to claim 6, wherein in the step (b), one of the pair of primers is labeled with biotin.

8. The method according to claim 7, wherein the step (c) is performed by isolating a single-stranded DNA labeled with biotin from the amplified double-stranded DNA product obtained in (b) by using beads coated with avidin through avidin-biotin combination, so as to obtain a single-stranded DNA without biotin for cyclization.

9. The method according to claim 1, wherein after the step (d), the method further comprises: (g) digesting uncyclized DNAs obtained in (d) with nucleases specifically digesting linear DNAs to obtain a pre-product; and (h) purifying the pre-product obtained in (g) to obtain the cyclic single-stranded library.

10. The method according to claim 9, wherein the nucleases used in (g) comprise a first exonuclease specifically digesting linear single-stranded DNAs and a second exonuclease specifically digesting linear double-stranded DNAs.

11. The method according to claim 1, wherein the first strand of the vesicular non-paired region is longer than the second strand of the vesicular non-paired region by at least 5 to 30 nt.

12. The method according to claim 1, wherein the 5 paired double-stranded region also has a sticky terminal.

13. The method according to claim 1, wherein the 5 paired double-stranded region has a sticky terminal of 1 to 3 non-complementary bases.

14. The method according to claim 1, wherein the oligonucleotide vesicular adaptor comprises a sense strand and an antisense strand and is of a structure of formula I from the 5 terminal to the 3 terminal:
Y0-Y1-Y2(I) wherein Y0 represents the 5 paired double-stranded region, and is of a length of 10-15 nt; Y1 represents the vesicular non-paired region, the sense strand of the vesicular non-paired region being of a length 5-30 nt longer than that of the antisense strand of the vesicular non-paired region; and Y2 represents the 3 paired double-stranded region.

15. The method according to claim 14, wherein Y0 is of a length of lint.

16. The method according to claim 1, wherein the oligonucleotide vesicular adaptor is of a length of at least 20 nt.

17. The method according to claim 1, wherein the oligonucleotide vesicular adaptor is of a length of 25 to 50 nt.

18. The method according to claim 1, wherein the oligonucleotide vesicular adaptor is of a length of 30 to 45 nt.

19. The method according to claim 1, wherein the pair of primers comprises: a first primer having the same sequence as at least a portion of the first strand of the vesicular non-paired region; and a second primer, specifically pairing with the second strand of the vesicular non-paired region.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0054] FIG. 1 is a flow chart showing the method for constructing a nucleic acid library according to an embodiment of the present disclosure;

[0055] FIG. 2 is a diagram showing the structure of a vesicular adaptor according to an embodiment of the present disclosure;

[0056] FIG. 3 is a diagram showing a result of a concentration of the purified PCR product detected by Agilent 2100 in nucleic acid library construction; and

[0057] FIG. 4 is an electrophoretogram of libraries detected by a 6% TBE denatured gel, where lanes 1 and 2 each represent a cyclic single-stranded library, while lane 3 represents low range ssRNA ladder.

DETAILED DESCRIPTION

[0058] The present inventors have for the first time developed a vesicular adaptor for efficiently constructing a nucleic acid sequencing library with high quality through extensive and in-depth studies and extensive screening. The experimental results show that, compared with sequencing data obtained from other nucleic acid sequencing library construction techniques, the nucleic acid sequencing library constructed with the vesicular adapter of the present disclosure has a higher quality and correlation, which can be used in the CG sequencing platform, thereby obtaining high authentic and reliable data without adverse influence on information analysis. Based on this, the present invention has been completed.

[0059] CG Sequencing Platform

[0060] For the CG sequencing platform, DNA nanoballs are embedded in a chip using high-density DNA nanochip technology, and bases in the sequence are read with combinatorial probe anchor ligation (cPAL) technology.

[0061] Cyclic single-stranded DNAs were obtained after library construction. A DNA nanoball (DNB), including more than 200 copies of cyclic single-stranded DNAs, was formed by rolling circle amplification, and then embedded into a hole in a chip using high-density DNA nanochip technology, with each hole only able to accommodate one DNA nanoball (as one DNA nanoball, once combined with the hole in the chip, will exclude the combination of other DNA nanoballs with the same hole). The occupancy rate of the DNA nanochip was over 90%, and each prepared DNA nanochip may accommodate 180 billion bases for imaging.

[0062] The cPAL technique uses probes marked with four different colors to read bases adjacent to the adaptor by at most 10 consecutive bases for each time. As each sequencing is independent from one another, i.e. the sequencing result is not affected by a previous sequencing result, thus error accumulation is avoided, which results in a high accuracy sequencing result with a base error rate as low as 1/100000. During sequencing, an anchor molecule is added to complementary pair with the adaptor, then the probes marked with four different colors are paired with corresponding bases of the template with the DNA ligases. The types of bases are determined by imaging fluorescent groups. Another advantage of cPAL technology is that, concentrations of probes and enzymes may be greatly reduced as the bases are read using a non-continuous and non-linkage combinatorial probe anchor ligation (cPAL) technology. Different from Sequencing by Synthesis, several bases may be read once in each cycle of cPAL, such that consumptions of sequencing reagents and imaging time may be both greatly reduced. Compared with the current popular next-generation sequencing technology, methods for constructing a library and sequencing the same according to embodiments of the present disclosure may obtain much more data while consuming fewer reagents.

[0063] Method for Constructing a Library

[0064] A RNA sample was digested with DNase I. The digested RNAs were purified with RNA clean magnetic beads. mRNAs from the total RNAs were isolated and purified with Oligo (dT) 25 magnetic beads, followed by fragmentation to obtain fragmented mRNAs. cDNAs were synthesized by reverse transcription of the fragmented mRNAs, and then end-repaired to form DNA fragments with blunt terminals to which were added A bases to obtain DNA fragments each with one A base at the 3-terminal thereof. The obtained DNA fragments each with one A base at the 3-terminal thereof were ligated with vesicular adaptors to obtain DNA fragments each ligated with the vesicular adaptor at each terminal thereof, which were purified with magnetic beads and then amplified through polymerase chain reaction (PCR) where one primer used is marked with biotin. PCR product thus obtained was isolated by magnetic beads coated with streptavidin to obtain PCR single-stranded product, which was cyclized by bridge oligonucleotides and T4 ligases. Uncyclized PCR single-stranded product was enzymatically digested to obtain the cyclic single-stranded library.

[0065] Cyclic Single-Stranded Library

[0066] The present disclosure also provides in embodiments a cyclic single-stranded library, which is suitable for sequencing and constructed by the above-described method for constructing a library.

[0067] In a preferred embodiment of the present disclosure, the present inventors have fully verified the stability, repeatability, and true reliability of the method of the present disclosure by exploring the optimum condition for constructing the library and comparing the results obtained under the optimum condition with that obtained by the other techniques. In addition, it is proved through several experiments with different samples that, the sequencing data obtained by the cyclic single-stranded library of the present disclosure is truly credible.

[0068] The advantages of the present disclosure lie in that:

[0069] (1) The vesicular adaptor for constructing the nucleic acid library is invented for the first time.

[0070] (2) With the use of a vesicular adaptor in embodiments of the present disclosure in the construction of the nucleic acid library, both the ligating efficiency and the efficiency of subsequent PCR are high and follow-up steps are few.

[0071] (3) The nucleic acid library in embodiments of the present disclosure may also be used in a sequencing platform which needs a cyclic single-stranded library.

[0072] (4) The method provided in embodiments the present disclosure is of high sequencing throughput, high accuracy and simple operation.

[0073] (5) The method provided in embodiments the present disclosure is of high stability, repeatability and reliability.

[0074] The present disclosure will be further described in the following with reference to specific embodiments. It should be appreciated that, these embodiments are merely used to illustrate the present disclosure and shall not be construed to limit the scope of the present disclosure. Experimental methods in the following embodiments, not specifying the detailed conditions, will be carried out according to conventional conditions, such as what is described in Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or in accordance with conditions proposed by the manufacturer. Percentages and parts are by weight, unless otherwise stated.

[0075] Materials and Methods

[0076] In the following embodiments, the reagent was prepared as follows: 5 first strand buffer containing: 80-400 mM sodium chloride, 10-80 mM magnesium chloride, 200 mM to 300 mM Tris-HCl, phosphate, and water as solvent, with pH of 8.0-8.5. The standard substance, universal human reference RNA, was purchased from Agilent. Such RNA is a mixture from 10 kinds of human cell lines (breast cells, hepatoma carcinoma cells, cervical cells, embryonic cells, malignant glioma cells, melanoma cells, liposarcoma cells, lymphoma cells, leukemia T cells, and bone marrow B lymphocyte).

[0077] DNA fragments were purified by Ampure XP magnetic beads.

[0078] The materials used in embodiments of the present disclosure are all commercially available, unless specified otherwise.

Embodiment 1

[0079] Construction of RNA library with the use of the vesicular nucleotide adaptor

[0080] The specific procedures were carried out as follows (see the procedures shown in FIG. 1):

[0081] The Specific Procedures:

[0082] 1. mRNA Purification:

[0083] 1) Standard, universal human reference RNA (3 Agilent), was added into an RNase-free tube and diluted into 50 l with DEPC. The obtained mixture was denatured at 65 C. for 5 min subsequent to even mixing to degrade the secondary structure of RNA, then immediately placed on ice to obtain a RNA sample.

[0084] 2) 15 l Dynalbeads Oligo (dT).sub.25 magnetic beads were added into a non-stick-EP tube, washed twice with 100 l binding buffer, then re-suspended in 50 l binding buffer, followed by combining with the RNA sample obtained in 1), and finally stood still for 5 min at room temperature.

[0085] 3) The non-stick-EP tube was placed on MPC (magnetic separator) for 2 min to remove the supernatant. The remaining magnetic beads were washed twice with 200 l washing buffer. 50 l binding buffer was added to a new non-stick-EP tube.

[0086] 4) The EP tube (i.e. non-stick-EP tube in 3) containing magnetic beads was added with 50 l 10 mM Tris-HCl and heated at 80 C. for 2 min to elute the mRNAs from the magnetic beads. Then the non-stick-EP tube was quickly transferred onto the MPC. The mRNAs were transferred into the new non-stick-EP tube containing the binding buffer in 3), the obtained mixture was denatured at 65 C. for 5 min to degrade the secondary structure of mRNAs, then immediately placed on ice. In addition, 200 l washing buffer was immediately added into the tube containing the remaining magnetic beads to wash the magnetic beads twice.

[0087] 5) 100 l mRNA sample was added with magnetic beads washed twice and then stood still for 5 min at room temperature. The EP tube was placed on MPC for 2 min, the supernatant was carefully sucked out, and the remaining magnetic beads were washed twice with 200 l washing buffer.

[0088] 6) The EP tube containing magnetic beads was added with 17 l 10 mM Tris-HCl, then heated at 80 C. for 2 min to elute mRNAs from the magnetic beads. The EP tube was quickly placed on MPC. The eluent containing mRNAs was transferred into a new 200 l PCR tube. About 16 l mRNA was recycled.

[0089] 2. Fragmentation of mRNA and Synthesis of a First Strand

[0090] After combining with 3 L 5 first strand buffer, the eluent obtained in the previous step was firstly incubated at 94 C. for 10 min followed by immediately placing on ice, then combined with 1 l of random primers, and further incubated at 65 C. for 5 min to degrade the second structure followed by placing on ice. A reaction mixture, formulated with 100 mM DTT (2 l), 25 mM dNTP mixture (0.4 l) and RNase inhibitor (0.5 l), was added into the tube containing RNA, followed by mixed to be uniform and then stood still for 2 min at room temperature, then combined with 1 l Superscript II (200 U/l) and water up to 25 PCR reaction was performed in accordance with the following procedures:

TABLE-US-00002 Step 1 25 C. 10 min Step 2 42 C. 50 min Step 3 70 C. 15 min Step 4 4 C. hold

[0091] 3. Synthesis of a Second Strand

[0092] After the above PCR reaction, the resulting reaction system was added to water up to 82.8 l, then mixed with 10 l 5 second strand buffer and 1.2 l 25 mM dNTP mixture in sequence to be uniform, followed by placing on ice for 5 min, and then mixed with 1 l RNaseH and 5 l DNA Pol I to be uniform. Such obtained reaction system for synthesizing a second strand was incubated at 16 C. for 2.5 h.

[0093] After the reaction was completed, the resulting double-stranded product was purified with Ampure XP magnetic beads, and the purified double-stranded product (DNAs) was dissolved in 50 l EB buffer.

[0094] 4. End-Repairing

[0095] 50 l solution containing double-stranded DNAs obtained in the previous step was successively added with 27.4 l water, 10 l 10 end repair buffer, 1.6 l 25 mM dNTP mixture, 5 l T4 DNA polymases, 1 l Klenow DNA polymases and 5 l T4 PNK to form 100 l reaction system which was incubated at 20 C. for 30 min.

[0096] After the reaction was completed, the end-repaired product was purified with Ampure XP magnetic beads and then dissolved in 32 l EB buffer.

[0097] 5. Base a Addition and Adaptor Ligation

[0098] 32 l solution containing end-repaired DNAs obtained in the previous step was successively added with 5 l A-tailing buffer, 10 l 1 mM dATP and 3 l Klenow exo (inhibiting activities of exonucleases for digesting from 3-end to 5-end) to form a reaction system of 50 l, which was incubated at 37 C. for 30 min.

[0099] After the reaction was completed, the base A-added product was purified with Ampure XP magnetic beads and then dissolved in 23 l EB buffer.

[0100] 23 l solution containing base A-added product obtained in the previous step was successively added with 25 l 2 Rapid T4 DNA Ligase Buffer, 1 l vesicular adaptor (with a structure as shown in FIG. 2) mixture (containing the vesicular adaptor in an amount of 50 mol) and 1 l T4 DNA Ligase to form 50 l reaction system, which was incubated at room temperature for 15 min.

[0101] The adaptor sequence was as follows:

TABLE-US-00003 (SEQIDNO.:1) 5-GTCCTAAGACCNGATCGGGCTTCGACTGGAGACTCCGACTT-3 (SEQIDNO.:2) 5-/phos/AGTCGGAGGCCAAGCGGTCTTAGGACAT-3.

[0102] After the reaction was completed, the ligation product was purified with Ampure XP magnetic beads, and then dissolved in 10 l EB buffer.

[0103] 6. PCR Amplification and Purification

[0104] 30 l solution containing adaptor-ligated product obtained in previous step was successively added with 10 l 5 Phusion butter, 1 l PCR Primer F (5-/phos/AGACAAGCTCGATCGGGCTTCGACTGGAGAC)(SEQ ID NO.:3), 1 l PCR Primer R (5-/bio/TCCTAAGACCGCTTGGCCTCCGACT)(SEQ ID No.:4), 0.5 l 25 mM dNTP mixture, 0.5 l Phusion DNA polymases and 7 l water to form 50 l reaction system, which was incubated in the PCR instrument according to the following procedures:

[0105] a. 30 sec, 98 C.

[0106] b. 15 cycles:

[0107] 10 sec, 98 C.

[0108] 30 sec, 65 C.

[0109] 30 sec, 72 C.

[0110] c. 5 min, 72 C.

[0111] d. hold 4 C.

[0112] After the reaction was completed, the amplified PCR product was purified with Ampure XP magnetic beads and then dissolved in 32 l EB buffer. The concentration of the purified PCR product was detected with Agilent 2100, and the results are shown in FIG. 3.

[0113] 7. Isolation of a Single-Stranded Product

[0114] 7.1 Washing magnetic beads coated with streptavidin

[0115] 30 l magnetic beads coated with streptavidin (for each sample) was mixed with 90 l to 150 l 1 magnetic beads binding buffer to be uniform in a non-stick tube, which was then placed on a magnetic separator for still standing and adsorption. The non-stick tube was adjusted to be in such a direction that enables the magnetic beads to move forward and backward in the 1 magnetic beads binding buffer, followed by discarding the supernatant. After the direction adjustment step was repeated once, the non-stick tube was taken out from the magnetic separator, an 30 l 1 magnetic beads binding buffer added, followed by standing still at room temperature.

[0116] 7.2 After combining with water up to 60 l, the purified PCR product obtained in the step 6 was firstly mixed with 20 l 4 magnetic beads binding buffer to be uniform, and then transferred into the non-stick tube obtained in 7.1 which contained magnetic beads dissolved in 30 l 1 magnetic beads binding buffer, followed by mixing to be uniform. Such a resulting 110 l mixture was incubated at room temperature for 15 to 20 min, during which the mixture was flicked gently once to make it distribute evenly.

[0117] 7.3 The non-stick tube after the step 7.2 was placed on the magnetic separator for 3 to 5 min, followed by discarding the supernatant. The remaining magnetic beads were washed twice with 1 ml 1 magnetic beads washing buffer as described in step 7.1.

[0118] 7.4 The magnetic beads after the step 7.3 were evenly mixed with 78 l 0.1M NaOH by blowing up and down to obtain a mixture, followed by standing still for 10 min and then placed on the magnetic separator for 3 to 5 min. 74.5 l supernatant thus obtained was transferred into a new 1.5 ml EP tube.

[0119] 7.5 37.5 l 0.3M MOPS was added into the 1.5 ml EP tube after the step 7.4, followed by mixed to be uniform, thereby obtaining 112 l sample for use.

[0120] 7.6 The 112 l sample can be stored at 20 C.

[0121] 8. Cyclization of the Single-Stranded Product

[0122] 8.1 A primer reaction solution was formulated as follows about 5 min in advance:

TABLE-US-00004 (SEQIDNo.:5) ON1587(TCGAGCTTGTCTTCCTAAGACCGC)

TABLE-US-00005 water 43 l 20 M ON1587 20 l Total volume 63 l

[0123] 8.2 63 l primer reaction solution obtained in the step 8.1 was mixed by shaking thoroughly, centrifuged, and then added into the sample of 112 l obtained in step 7 (the starting amount n of the sample was critical and generally controlled within 100 ngn800 ng).

[0124] 8.3 A ligase reaction solution was formulated as follows about 5 min in advance:

TABLE-US-00006 water 135.3 l 10 TA Buffer (LK1) 35 l 100 mM ATP 3.5 l 600 U/l Ligase 1.2 l total 175 l

[0125] 8.4 175 l ligase reaction solution obtained in step 8.3 was mixed by shaking thoroughly, centrifuged, and then added into the EP tube after step 8.2 which contained the primer reaction solution. A mixture thus obtained in this step was mixed by shaking for 10 s to be uniform, and then centrifuged.

[0126] 8.5 The mixture obtained in step 8.4 was incubated in an incubator for 1.5 h at 37 C.

[0127] 8.6 After the reaction was completed, 10 l resulting sample was detected by electrophoresis detection a 6% denatured gel, and the remaining sample in about 350 l was allowed to the next enzymatic reaction.

[0128] 9. Enzyme Digestion

[0129] 9.1 An enzyme-digesting reaction solution was formulated as follows about 5 min in advance:

TABLE-US-00007 water 1.5 l 10 TA Buffer (LK1) 3.7 l 20 U/l Exo I 11.1 l 200 U/l Exo III 3.7 l total 20 l

[0130] 9.2 20 l enzyme-digesting reaction solution obtained in step 9.1 was mixed by shaking thoroughly, centrifuged, and then added into 350 l sample obtained in the step 8.5 to obtain a mixture.

[0131] 9.3 The mixture obtained in step 9.2 was mixed by shaking for 10 s to be uniform, and centrifuged, and then incubated in the incubator for 30 min at 37 C.

[0132] 9.4 After 30 min, the enzymatic reaction was stopped by adding 15.4 l 500 mM EDTA. 9.5 A sample obtained in step 9.4 was purified with 1.3 PEG32 magnetic beads/Tween 20 (or Ampure XP magnetic beads) as follows:

[0133] The sample obtained in step 9.4 was transferred into a 1.5 ml non-stick tube, and then combined with 500 l PEG32 magnetic beads. The mixture thus obtained was left for binding at room temperature for 15 min, during which the mixture was mixed once by blowing up and down to be uniform.

[0134] 9.6 The non-stick tube after step 9.5 was placed on the magnetic separator for 3 to 5 min, after which the supernatant was discarded, the remaining magnetic beads were washed twice with 700 l 75% ethanol, during each of which the non-stick tube was reversed forward and backward to enable the magnetic beads to move 2 to 3 times in the ethanol.

[0135] 9.7 The magnetic beads after washing were air dried, and then re-dissolved in 40 l 1 TE for 15 min, during which the mixture thus obtained was mixed once to be uniform.

[0136] 9.8 Supernatant from the mixture obtained in the step 9.8 was transferred into a new 1.5 ml EP tube, the final product was quantified with Qubit ssDNA Assay Kit.

[0137] 9.9 5 l sample and 2 l low Range RNA ladder were respectively mixed with 5 l 2 RNA loading buffer to be uniform in different PCR tubes, both of which were incubated at 95 C. for 2 min for denaturation in a PCR instrument, and quickly cooled on ice for 5 min. The resulting samples were detected with a 6% TBE denatured gel. The results are shown in FIG. 4.

[0138] 9.10 Concentration standardization

[0139] The initial amount of the sample prepared with DNA nanoball (DNB) was uniformly adjusted to 7.5 fmol/l in accordance with the concentration at which the single-stranded molecules were quantitatively detected.

Embodiment 2

[0140] Comparison of PCR efficiency of the vesicular adaptor in the library construction with that of other types of adaptors

[0141] The specific steps were as follows:

[0142] Steps same as those described in Embodiment 1 were carried out, where one adaptor was the vesicular adaptor, and the comparison adaptor was a matching adaptor. The PCR amplification and purification as described in step 6 were completed, after which the amount of purified PCR product was detected.

[0143] Concentration of PCR template and recycling concentration were measured with Qubit dsDNA Assay Kit.

[0144] The experimental result is shown in Table

TABLE-US-00008 Matching Vesicular Adaptor adaptor adaptor Amount of PCR template (ng) 10 10 Concentration of recycled product (ng/ul) 5.66 53 Total amount of recycled product (ng) 226.4 2120 PCR efficiency 1.366 1.709 Note: PCR efficiency = (total PCR yield/Initial amount of template) (1/cycles)

[0145] It can be seen from above result that PCR efficiency of the vesicular adaptor is apparently higher than that of the matching adaptor.

[0146] All documents mentioned in the present disclosure are incorporated herein by reference, as if each document were individually recited for reference. Furthermore, it should be appreciated that, those skilled in the art can make various changes and modifications to the present disclosure based on the content described above, and those equivalents also fall into the scope defined by appended claims of the present disclosure.