SELF-LIMITING CAS9 CIRCUITRY FOR ENHANCED SAFETY (SLICES) PLASMID AND LENTIVIRAL SYSTEM THEREOF

Abstract

The present invention describes a Self-Limiting Cas9 circuitry for Enhanced Safety (SLiCES) which consists of an expression unit for the Streptococcus pyogenes Cas9 (SpCas9), a first Cas9 self-targeting sgRNA and a second sgRNA targeting a chosen genomic locus. The self limiting circuit, by controlling Cas9 levels, results in increased genome editing specificity. For its in vivo utilization, SLiCES was integrated into a lentiviral delivery system (lentiSLiCES) via circuit inhibition to achieve viral particle production. Following its delivery into target cells, the lentiSLiCES circuit is switched on to edit the intended genomic locus while simultaneously stepping up its own neutralization through SpCas9 inactivation. By preserving target cells from residual nuclease activity, the present hit and go system increases safety margins for genome editing.

Claims

1. A CRISPR/CAS9 Self-Limiting Cas9 circuitry for Enhanced Safety (SLiCES) plasmid comprising: an expression cassette for a Cas9 molecule; a nucleotide sequence that encodes for a sgRNA targeting the Cas9 molecule (anti-Cas9 sgRNA); and a nucleotide sequence that encodes for sgRNA targeting a chosen genomic locus (target sgRNA); wherein at least one intron is present into the open reading frame (ORF) of the expression cassette for said Cas9 molecule to form an expression cassette divided in two or more exons, and/or at least one intron is present into the nucleotides sequence encoding for the mature transcript of said anti-Cas9 sgRNA being said intron into the transcribed sequence encoding an expression cassette divided in two or more exons; and/or the expression cassette for the Cas9 molecule and/or the sequence encoding for anti-cas9 sgRNA is preceded by a sequence including an inducible promoter.

2. The plasmid according to claim 1, wherein the anti-Cas9 sgRNA is encoded by a sequence of 17-23 nucleotide preferably.

3. The plasmid according to claim 2, wherein anti-Cas9 sgRNA encoding sequence is a sequence having at least a 60% homology with a sequence selected in the group consisting of SEQ ID N. 1-6.

4. The plasmid according to claim 1, wherein the expression cassette for a Cas9 molecule and/or the nucleotide sequence that encodes for an anti-Cas9 sgRNA comprises at least an intron; and the expression cassette for the Cas9 molecule and/or the sequence encoding for anti-cas9 sgRNA is preceded by a sequence including an inducible promoter.

5. The plasmid according to claim 1, wherein the expression cassette for the Cas9 molecule and the sequence encoding for anti-cas9 sgRNA are both preceded by a sequence including an inducible promoter.

6. A genetically-modified micro-organism comprising the plasmid according to claim 1.

7. A cell transfected with the plasmid according to claim 1.

8. A viral or artificial delivery system comprising the plasmid according to claim 1.

9. (canceled)

10. A method of treating a monogenic disorder, high cholesterol, antitrypsin deficiency, cancer, diabetes, infective bacterial disease or viral disease comprising administering the plasmid according to claim 1 to a subject in need thereof.

11. (canceled)

12. A pharmaceutical composition comprising the plasmid according to claim 1 and at least another pharmaceutically acceptable ingredient.

13. A process for preparing the viral system according to claim 8, the process comprising transforming a bacterium with the plasmid according to claim 1, said bacterium wherein the expression of Cas9 and/or sgRNA is prevented by the presence of the intron or by the expression of a repressor specific for the inducible promoter or by another system apt to prevent Cas9 and/or sgRNA expression; and/or transfecting a cell with the plasmid, said cell expressing a repressor specific for the inducible promoter or said cell comprising another system for regulating Cas9 and/or anti-Cas9 gRNA expression.

14. A method for preventing the mature expression of a toxic transcript in a bacterium, said method comprising introducing at least one intron in the nucleotide sequence encoding for said toxic transcript; being said intron into the transcribed sequence encoding an expression cassette divided in two or more exons.

15. The method according to claim 14, where the toxic transcript functions as a guide RNA, or part of it, for a nuclease.

16. (canceled)

17. A method for detecting Cas9 off-targets in in vitro cultured cells or in in vivo animal models, said method comprising introducing the plasmid according to claim 1 into the in vitro cultured cells or in vivo animal models, wherein the plasmid is introduced directly or in the form of a non-integrating vector.

18. The plasmid according to claim 1, wherein the anti-Cas9 sgRNA is encoded by a sequence of 17-23 nucleotides starting with G.

19. A pharmaceutical composition comprising the viral or artificial system according to claim 8 and at least another pharmaceutically acceptable ingredient.

20. A method of treating a monogenic disorder, high cholesterol, antitrypsin deficiency, cancer, diabetes, infective bacterial disease or viral disease comprising administering the viral or artificial system according to claim 8 to a subject in need thereof.

Description

BRIEF DESCRIPTION OF THE FIGURES

[0099] FIG. 1. Long term expression of Cas9 delivered through a lentiviral vector correlates with the accumulation of off-target cleavages. (a) Time course curves of the percentages of 293-iEGFP non-fluorescent cells obtained by the transduction with a lentiviral vector (lentiCRISPR) expressing SpCas9 together with either a perfectly matching sgRNA (sgGFP-W) or two different sgRNAs containing one or two mismatches with the target sequence (sgGFP-M and -MM, respectively). A vector expressing an irrelevant sgRNA was used as control (sgCtr). (b) As in (a) using a lentiviral vector expressing a SpCas9 variant with increased fidelity (eSpCas9(1.1)). (c) DNA modification specificity, defined as on-target/off-target indels frequency ratio, after long term SpCas9 expression with sgRNAs targeting the VEGFA and ZSCAN endogenous loci. Percent modification of previously validated off-target sites was quantified by TIDE analysis after one week and 21 days post-transduction. For all the experiments, cells were selected with puromycin in order to eliminate the non-transduced cells. In panels (a-c) data presented as means.e.m. for n=2 independent experiments.

[0100] FIG. 2. The SLiCES circuit. (a) Scheme of the SLiCES circuit. SpCas9 is expressed together with sgRNAs directed to its own open reading frame (ORF) for self-limiting activity and to a selected target sequence. (b) Regulation of SpCas9 and EGFP target gene expression by the SLiCES circuit. Western blot analysis of 293T cells co-transfected with plasmids expressing EGFP, SpCas9 and sgRNAs fully (sgGFP-W) or partially matching (sgGFP-M) the EGFP coding sequence in combination with three sgRNAs targeting the SpCas9 ORF (sgCas-a, -b, -c) or a control sgRNA (sgCtr), as indicated. Lane (-) corresponds to a reference sample containing the non-targeting sgCtr only. Transfection efficiency was normalized using roTag tagged MHC-la expression plasmid (Transf-ctr). SpCas9 was detected using an anti-FLAG antibody. Lower graph reports the ratio of the percentages of decreased EGFP levels obtained using sgGFP-W (on-target) over the percentages obtained with sgGFP-M (off-target) in the presence of sgCas-a, -b, -c as indicated. (c) Target specificity of SpCas9 activity using different SLiCES circuits. On/off ratios were obtained from the percentage of EGFP negative cells after targeting a single chromosomal EGFP gene copy (293-iEGFP cells) with sgGFP-W (on-target) relative to sgGFP-M (off-target) in combination with different SLiCES circuits (sgCas-a, -b or -c) or a non-targeting (sgCtr) sgRNA, as indicated in the graph. (d) Target specificity of SpCas9 activity expressed as on/off ratios as in (c) using optimized sgRNAs, as indicated in the graph. (e) Target specificity of SpCas9 activity expressed as on/off ratios using different self-limiting circuits applied to a gene substitution model. On/off ratios were obtained from the percentage of EGFP positive cells generated by SpCas9 homology-directed repair of the EGFP-Y66S mutation with the sgGFP-M (on-target) relative to the sgGFP-W (off-target) sgRNAs in combination with a DNA donor plasmid (carrying wild-type EGFP sequence) in 293-iY66S cells containing a single mutated EGFP gene copy. (f) Indels formation induced by the SLiCES circuit (sgCas-a-opt) targeting the VEGFA, ZSCAN2, EMX1 loci and their respective validated off-target sites. Fold increase (F.I.) of the on/off ratio with the sgCasa-opt relative to the sgCtr is reported below the graphs for each off-target. Percent modification was quantified by TIDE analysis. Error bars represent s.e.m. for n2.

[0101] FIG. 3. Regulation of SpCas9 and EGFP-Y66S expression by the SLiCES circuit. Western blot of cells co-transfected with plasmids expressing EGFP-Y66S, SpCas9, sgRNAs perfectly matching (sgGFP-M) or containing one mismatch (sgGFP-W) with the EGFP-Y66S target sequence together with sgRNAs specific for the SpCas9 ORF (sgCas-a, -b, -c) or a control sgRNA (sgCtr), as indicated. Lane (-) corresponds to a reference sample containing the non-targeting sgCtr only. Transfection efficiency was normalized using roTag tagged MHC-la expression plasmid (Transf-ctr). SpCas9 was detected using an anti-FLAG antibody. Lower graph reports the ratio of the percentages of decreased EGFP-Y66S levels obtained using sgGFP-M (on-target) over the percentages obtained with sgGFP-W (off-target) in the presence of sgCas-a, -b, -c, as indicated.

[0102] FIG. 4. EGFP disruption by SLiCES circuits. (a) Percentage of nonfluorescent 293-iEGFP cells obtained after expression of different self-limiting SpCas9 circuits. Cells were transfected with sgRNAs perfectly matching (sgGFP-W) or containing one mismatch (sgGFP-M) with the EGFP ORF together with three sgRNAs targeting the SpCas9 ORF (sgCas-a, -b, -c) or a control sgRNA (sgCtr), as indicated. The dashed line represents the average background of EGFP negative cells. Error bars represent s.e.m. for n=2. Data presented as means.e.m. for n=2 independent experiments. (b) Representative T7 Endonuclease assay from cells expressing different SLiCES circuits. The on/off specificity ratio was calculated by measuring indels formation in the EGFP gene in the presence of sgGFP-W or sgGFP-M together with a control sgRNA or the three sgRNAs targeting the SpCas9 ORF (sgCas-a, -b, -c). Lane (-) corresponds to a reference sample containing the non-targeting sgCtr only. (*) Indicates the expected band obtained by T7 endonuclease activity.

[0103] FIG. 5. Effect of sgRNAs optimization on SLiCES circuit. (a) Percentage of non-fluorescent 293-iEGFP cells obtained after transfection of SpCas9 with sgRNAs targeting EGFP (sgGFP-W or sgGFP-W-opt, if optimized) or containing a single mismatch (sgGFP-M or sgGFP-M-opt, if optimized) together with the sgCas-a. The optimized version of the SLiCES sgRNA (sgCas-a-opt) was tested with both standard and optimized sgRNAs targeting EGFP, as indicated. Data presented as means.e.m. for n=2 independent experiments. (b) Percentage of non-fluorescent 293-iEGFP cells obtained after transfection of SpCas9 with sgRNAs targeting EGFP (sgGFP-W) or containing a single mismatch (sgGFP-M) together with the sgCas-c or sgCas-c-opt, if optimized. data presented as means.e.m. for n=2 independent experiments. (c) Western blot analysis of 293T cells co-transfected with SpCas9 and sgCas9-a or sgCas-a-opt and sgCas9-c or sgCas-c-opt. SpCas9 was detected using an anti-FLAG antibody. Transfection efficiency was normalized using roTag tagged MHC-la expression plasmid (Transf-ctr).

[0104] FIG. 6. Specificity of homology-directed repair mediated by SLiCES. Percentage of fluorescent 293-iY66S cells obtained after transfection with a donor DNA plasmid (carrying a non-fluorescent fragment of wt-EGFP), SpCas9 together with sgRNAs matching (sgGFP-M) or containing one mismatch with the EGFP-Y66S target sequence (sgGFP-W) and the three sgRNAs targeting the SpCas9 ORF (sgCas-a, -b, -c or sgCas-a-opt) or a control sgRNA (sgCtr), as indicated. Data presented as means.e.m. for n=2 independent experiments. Homology-directed repair in the absence of sgGFP-M or sgGFP-W was about 0.01%.

[0105] FIG. 7. Activity of SLiCES with Streptococcus thermophiles CRISPR1/Cas9. (a) Schematic representation of the SV5-GFP-based NHEJ reporter. The target sequence recognized by the sgRNA of interest is inserted between the SV5 tag and the EGFP coding sequences, with the EGFP ORF positioned out of frame with respect to the starting ATG codon for the SV5 tag ORF. A stop codon has been added to the SV5 frame, immediately after the target sequence, to stop its translation. After SpCas9-mediated cleavage of the target sequence and repair by NHEJ, indel mutations are inserted randomly at the breakpoint, allowing the shift of the EGFP ORF in the same frame of the SV5 tag ORF. The expression of the SV5-EGFP is analyzed by fluorescence detection or by western blot analysis. (b) Evaluation of St1Cas9 activity expressed through the SLiCES system. Western blot of 293T cells transfected with St1Cas9, the NHEJ reporter carrying either a target sequence that fully base pairs with the sgRep-SV5 (NHEJ-Rep.W) or including one mismatch (NHEJ-Rep.M), the sgRNA sgRep-SV5 and three different St1Cas9 targeting sgRNAs (sgCas-St1, -2, -3). St1Cas9 mediated cleavages are detected by frameshift of the EGFP ORF and SV5-EGFP expression by the NHEJ reporter as described in (a). Lane (sgCtr) corresponds to a sample transfected with a non-self-targeting sgRNAs; lane (-) corresponds to a sample transfected with a non-targeting sgRNA. St1Cas9 was detected using an anti-FLAG antibody. Western blot is representative of n=2 independent experiments. (c) Modulation of St1Cas9 expression by self-limiting circuits increases on target specificity. On/off target ratios calculated from levels of SV5-EGFP expression obtained from cells transfected with NHEJRep. W or NHEJ-Rep.M together with sgRep-SV5 in combination with St1Cas9 targeting sgRNAs (sgCas-St1, -2, -3) or a non-self-targeting sgRNAs sgCtr as in (b). Data presented as means.e.m. for n=2 independent experiments.

[0106] FIG. 8. The lentiSLiCES system. (a) Graphical representation of lentiSLiCES viral vector. (b) Steps required for the production of the lentiSLiCES viral vectors. SpCas9 expression is prevented in bacterial cells to allow plasmid amplification through the introduction of a mammalian intron within the SpCas9 open reading frame. Production of lentiSLiCES viral particles is obtained in cells stably expressing the Tetracycline Repressor (TetR) to prevent SpCas9 and sgCas self-limiting sgRNA expression driven by Tet repressible promoters. In target cells the absence of the TetR allows the expression of the lentiSLiCES circuit leading to target genome editing and simultaneous SpCas9 downregulation.

[0107] FIG. 9. lentiSLiCES circuit behaviour in viral vector packaging cells. Western blot analysis of 293TR cells transfected with EGFP and self-limiting or nonself-limiting transfer vectors carrying sgGFP-W (lentiSLiCES-W or lentiCtr-W, respectively) or with lentiSLiCES carrying a non-targeting sgRNA (lentiSLiCES-Ctr). Cultures were treated as indicated with doxycycline to upregulate expression of SpCas9 and of the self-targeting sgCas-a. SpCas9 was detected using an anti-FLAG antibody. Western blot is representative of n=2 independent experiments.

[0108] FIG. 10. Genome editing with lentiSLiCES vectors. (a) EGFP knock-down by lentiSLiCES vectors. Time course curves of the percentages of EGFP negative 293-multiEGFP cells, following transduction with lentiviral vector carrying self-targeting (lentiSLiCES) or non-self-targeting (lentiCtr) sgRNAs in combination with either sgGFP-W (on-target) or sgGFP-M (off-target) sgRNAs, as indicated in the graph. (b) Target specificity of SpCas9 delivered through the lentiSLiCES. On/off ratios were calculated from the percentages of EGFP negative cells reported in (a). Below the graphs is reported the fold increase (F.I.) of specificity calculated from the on/off ratios at each time point. (c) Indels formation induced by lentiSLiCES vectors at the ZSCAN and VEGFA loci and at their validated off-target sites. Percent modification was quantified by TIDE analysis on genomic DNA collected 20 days post-transduction and selection with blasticidin. Values indicate the on/off ratios calculated from indels obtained with each off target. (d) Expression levels of SpCas9 at the indicated time points after transduction with lentiSLiCES or with lentiCtr. SpCas9 was detected using an anti-FLAG antibody. (e) SpCas9 activity monitored by SV5-EGFP protein levels produced by the NHEJ-reporter plasmid transfected in 293-multiEGFP cells before or 28 days after transduction and detected at 2 days or 30 days post-transduction, as indicated, with lentiSLICES targeting (lentiSLiCES-W) or non-targeting EGFP (lentiSLiCES-Ctr). The activity of the non-self-limiting lentiCtr-W vector targeting EGFP was monitored at the same time points for comparison. Error bars represent s.e.m. for n=2.

EXPERIMENTAL SECTION

[0109] Discussion

[0110] To evaluate the off-target activity produced by long term expression of SpCas9, 293-iEGFP cells were transduced carrying a single chromosomal copy of EGFP with a lentiviral vector expressing SpCas9 together with sgRNAs that can fully (sgGFP-W) or partially (sgGFP-M or sgGFP-MM) anneal to EGFP. The tolerance of SpCas9 for single (sgGFP-M) or double (sgGFP-MM) mismatches in cleaving EGFP allows for the quantification of the nuclease specificity. While the percentage of EGFP negative cells obtained with the on target sgRNA quickly reached a plateau at 10 days post-infection, the two mismatched sgRNAs generated unspecific EGFP knock-outs which accumulated over time (FIG. 1a). The delivery of the recently developed more specific eSpCas9(1.1) variant (Slaymaker, I. M. et al. Science 2016, 351, 84-88) guided by the same sgRNAs only partially reverses the time dependent accumulation of off-target cleavages (FIG. 1b). Consistently, the analysis of two genomic loci (ZSCAN and VEGFA) and related off-target sites (Kleinstiver, B. P. et al. Nature 2016, doi:10.1038/nature16526), indicated that the on/off ratios decreased over time, thus confirming increased off-target cleavages (FIG. 1c). These results clearly show that the delivery of SpCas9 through a conventional lentiviral system correlates with increased off-target activity and this is particularly evident over time due to prolonged SpCas9 expression.

[0111] To generate a transient SpCas9 activity peak in target cells according to the present invention it was developed a Self-Limiting Cas9 circuitry for Enhanced Safety (SLiCES) (schematized in FIG. 2a). The self-limiting SpCas9 circuitry was set up in EGFP expressing cells by using three different sgRNAs targeting three regions of the SpCas9 coding sequence (sgCas-a, -b and -c) (see Supplementary Discussion below) which were shown to efficiently downregulate SpCas9 levels when co-expressed with SpCas9 (FIG. 2b, upper panel). Co-expression of any of the three self-targeting sgRNAs (sgCas-a,-b or -c) together with a sgRNA that fully base pairs with the EGFP target sequence (sgGFP-W) reduced intracellular EGFP to levels (4-10% of residual protein) similar to the EGFP content detected in cells co-transfected with the same sgGFP-W and a control sgRNA (sgCtr) (FIG. 2b). These results demonstrate that DNA editing activity is not impaired when SpCas9 is inactivated through the SLiCES circuitry. A similar experiment performed using a sgRNA targeting EGFP with a single mismatch within the seed region at the last nucleotide before the PAM (protospacer adjacent motif) sequence (sgGFPM) showed non-specific EGFP downregulation, with almost 60% decrease of EGFP intracellular levels. This effect was less pronounced (25-55% reduction) in cells where SpCas9 expression was downregulated through the self-limiting Cas9 circuitry (sgCas-a, -b or -c) (FIG. 2b). The different levels of non-specific EGFP downregulation closely reflected the ability of individual sgRNA to decrease the intracellular levels of SpCas9: sgCas-a, which generated the lowest non-specific EGFP downregulation (73% residual EGFP, FIG. 2b), showed the highest SpCas9 disruption activity (FIG. 2b, upper panel). Similar results were obtained with a reciprocal experiment where cells were transiently transfected with a mutated EGFP target characterized by a single nucleotide substitution (EGFP-Y66S) that fully matched the sgGFP-M sequence (FIG. 3). The improved target specificity of about 2-3 fold (FIG. 1b, lower panel) as defined by the ratio between SpCas9 activity in cells targeted by the perfectly matched sgRNA over the mismatched sgRNA carried by SLiCES, was also confirmed in 293-iEGFP cells carrying a single chromosomal copy of the EGFP gene (5-fold improvement) (FIG. 2c and FIG. 4). To test whether the optimization of the sgRNAs may further improve the on-target specificity, the sgRNAs were structurally modified to increase their transcription and interaction with SpCas9 (Chen, B. et al. Cell 2013, 155, 1479-1491). The optimization of the sgRNA targeting SpCas9, which enhances the efficiency of nuclease removal, produced a significant improvement in cleavage specificity (FIG. 2d and FIG. 5a) of about 9-fold. Consistently, the optimization of the least active self-inactivating SpCas9 sgRNA (sgCas-c) resulted in reduced off-target activity paralleled by a further decrease in SpCas9 intracellular levels (FIGS. 5b and c). Conversely, the optimization of the sgRNA towards the target site (sgGFP-W-opt and sgGFP-M-opt) did not increase specificity in combination with sgCas9-a or sgCas9-a-opt (FIG. 2d and FIG. 5a). Presumably the enhanced downregulation of EGFP driven by the sgGFP-W-opt, which also correlated with increased off-target cleavages induced by the sgGFP-M-opt sgRNA, could not be counteracted by sufficiently rapid SpCas9 downregulation mediated by both versions of the self-limiting SpCas9 sgRNA (FIG. 2d and FIG. 5a).

[0112] In conclusion, the SLiCES circuitry produced the highest on target specificity when composed of a sgRNA optimized towards SpCas9 (sgCas-a-opt) efficiently downregulating SpCas9, in combination with a non-optimized sgRNA targeting the site of interest (sgGFP-W/M). A parallel experiment aimed at validating the on-target specificity of the SpCas9 self-limiting circuitry was performed in cells carrying a single chromosomal copy of a non-fluorescent EGFP (Y66S). In these cells, 293-iY66S, SpCas9 activity was measured by the recovery of EGFP fluorescence following the substitution of the mutated gene with a wild-type allele through SpCas9 mediated homology-directed repair in the presence of a co-transfected donor plasmid carrying a non-fluorescent fragment of wild-type EGFP. Compared to the conventional SpCas9 approach (sgCtr), the target specificity for EGFP homology-directed repair was improved by using the SLiCES circuitry (sgCas-a) by 4-fold (FIG. 2e and FIG. 6). Further improvement (7,5-fold) was obtained with the optimized version of sgCas-a (sgCas-a-opt) (FIG. 2e and FIG. 6), as previously observed in knock-out experiments.

[0113] To demonstrate that the SLiCES methodology is readily transferrable to other RNA-guided nucleases, SLiCES was adapted to Cas9 from Streptococcus thermophilus (St1Cas9) by using specific sgRNAs (sgCas-St1-1, -2 and -3) to induce St1Cas9 downregulation (FIG. 7). Next, the target specificity of the conventional SpCas9 and the SLiCES circuit (sgCas-a) towards endogenous sequences was comparatively analyzed. Four genomic sites (VEGFA, ZSCAN and two targets in the EMX1 locus) and two previously validated off target sites (Kleinstiver, B. P. et al. Nature 2016, doi:10.1038/nature16526) for each sgRNA were analyzed by tracking indels by decomposition (TIDE) (Brinkman, E. K., et al., Nucleic Acids Res. 2014, 42, e168) revealing that the SLiCES approach improved cleavage specificity by approximately 1.5-2.5 fold (FIG. 2f).

[0114] The self-limiting SpCas9/sgRNA circuitry with the best selected self-limiting sgRNA (sgCas-a-opt) was then transferred to a lentiviral system (FIG. 8) to generate lentiSLiCES. To avoid the leaky expression of SpCas9, and the consequent degradation of DNA during plasmid preparation in bacteria, an intron was introduced into the SpCas9 open reading frame to form an expression cassette divided in two exons (exon 1 and 2, schematized in FIG. 8). As splicing does not occur in bacteria, the transcripts produced are translated in bacteria as a catalytically inactive SpCas9 fragment. Next, to circumvent the self-cleavage activity during lentiviral vector production, Tetracycline inducible (TetO) promoters were introduced to regulate both SpCas9 and the self-targeting sgRNAs expression. The TetO promoter is negatively regulated by a specific repressor, TetR, which is expressed in producing cells and, in the absence of doxycycline, inhibits transcription through binding to tetracycline operator sequences located within the promoter region (schematized in FIG. 8b). The drop in SpCas9 intracellular levels in producing cells observed with the activation of the self-limiting circuitry with doxycycline demonstrates the strict requirement of the repressible promoters at viral production steps in order to obtain un-altered lentiSLiCES particles (FIG. 9). To evaluate the on/off target activity of the lentiSLiCES, the percentage of EGFP negative 293-multiEGFP cells was followed at different time points after transduction with self-limiting lentiviral vectors either carrying the specific sgRNA sgGFP-W (lentiSLiCES-W) or the mismatched sgGFP-M (lentiSLiCES-M) and compared with the effect obtained with non-self-limiting lentiviral vectors carrying the same sgRNAs towards EGFP (lentiCtr-W or -M). Both lentiCtr-W and lentiSLICES-W showed similarly stable on-target activity at all the time points within a 3 weeks period (FIG. 10a). Conversely, the percentage of EGFP cells unspecifically targeted by the sgGFP-M increased in time with the lentiCtr delivery system; this event was not observed with the same sgRNA delivered through lentiSLiCES throughout the 3 weeks period (FIG. 10a). Therefore, lentiSLiCES generated no off-target accumulation in time (compare day 7 and day 21, FIG. 10b). Consistently, at the end-point we observed the largest difference between the ratios of the EGFP negative cells obtained with the sgGFP-W over the sgGFP-M delivered either through the lentiSLICES (on/off ratio 5) or the lentiCtr systems (on/off ratio 2) (FIG. 10b). In agreement with these results the target specificity of the lentiSLiCES towards endogenous sequences (ZSCAN and VEGFA loci) showed significant improvement as compared to the non-self-limiting lentiCtr (approximately 2-4 fold) (FIG. 10c).

[0115] These data suggest that the decreased expression of SpCas9 obtained through the SLiCES circuit improves editing specificity. Indeed, at early time points (2 days post-transduction) SpCas9 protein was already much less present in cells treated with the lentiSLiCES than in cells treated with the non-self-limiting lentiviral control (lentiCtr) (FIG. 10d). Notably, in lentiCtr treated cells the levels of SpCas9 remained stable and higher than in lentiSLiCES treated cells where no nuclease could be detected at any later time point. To functionally assess the level of SpCas9 activity delivered through the lentiSLiCES, a non-homologous end joining (NHEJ) reporter plasmid (NHEJ-Rep.W) expressing the simian virus-5 tag fused with EGFP (SV5-EGFP) upon targeted nuclease activity (schematized in FIG. 7a) was employed. The NHEJ-Rep.W revealed that SpCas9 delivered through the lentiCtr was active at all time points following transduction, while the activity of SpCas9 carried by the lentiSLiCES was detected 2 days after transduction, but could not be observed at later time points (30 days) (FIG. 10e).

[0116] The limitations of in vivo SpCas9 applications clearly emerge from data of the present invention showing that long term nuclease expression delivered through lentiviral systems results in the accumulation of unwanted cleavages. This detrimental effect could not be overcome even with the recently developed, more specific SpCas9 variant, eSpCas9(1.1) (Slaymaker, I. M. et al. Science 2016, 351, 84-88). The self-limiting circuitry strategy, lentiSLiCES, of the present invention exploits the efficiency of viral based delivery and simultaneously limits the amount of SpCas9 post transduction and viral integration. By limiting in time and abundance Cas9 expression, SLiCES avoids the accumulation of off-target cleavages that instead are observed with the use of conventional Cas9 delivery approaches. To further improve the SLiCES strategy, Integrase Defective Lentiviral Vectors (IDLV) (Chick, H. E. et al. Hum. Gene Ther. 2012, 23, 1247-1257) could be used to maintain the viral-based efficiency in cellular delivery, while enhancing the transient peak-like nature of Cas9 expression. A variety of Cas9 applications, such as the regulation of gene expression obtained by the combination with transcriptional activation domains (Konermann, S. et al., Nature 2015, 517, 583-588; Mali, P. et al., Nat. Biotechnol. 2013, 31, 833-838; Hilton, I. B. et al., Nat. Biotechnol. 2015, 33, 510-517) might be significantly improved through their adaptation to lentiSLiCES. In fact, these approaches as well as the refined modulation of gene expression obtained with a genetic kill-switch circuit (Moore, R. et al., Nucleic Acids Res. 2015, 43, 1297-1303; Kiani, S. et al. Nat. Methods 2015, 12, 1051-1054) could be potentiated by a tunable self-limiting approach to restrict in time Cas9-mediated induction of the targeted cellular promoters. Finally, SLiCES may significantly improve some recently developed Cas9 genome engineering procedures that are susceptible to continuous nuclease activity. For instance, current techniques to efficiently substitute genomic sequences use Cas9 to increase the rate of homology-directed repair; nevertheless, these techniques are often limited by the continuous re-cleavage of the newly substituted genomic sequence by Cas9 (Paquet, D. et al., Nature 2016, 533, 125-129), which could be easily overcome by nuclease inactivation.

[0117] Supplemenary Discussion

[0118] Cas9 origin from prokaryotic cells, even after human codon optimization, allows to easily select several possible non-repetitive sgRNAs (as sgCas-a, -b, -c) with very few possible off-targets into the eukaryotic genome This implies that the possibility of generating potential new off-targets given the presence of a second sgRNA could be considered almost negligible.

[0119] As demonstrated by the improved performance obtained with St1Cas9 integrated within the self-limiting circuit, the SLiCES is proven to be easily adapted to the new emerging variants of nucleases (Esvelt, K. M. et al. Nat. Methods 2013, 10, 1116-1121; Zetsche, B. et al. Cell 2015, 163, 759-771; Ran, F. A. et al. Nature 2015, 520, 186-191; Kleinstiver, B. P. et al. Nature 2016, doi:10.1038/nature16526; Slaymaker, I. M. et al. Science 2016, 351, 84-88) and sgRNAs (Fu, Y., et al. Nat. Biotechnol. 2014, 32, 279-284) for safer genome editing.

[0120] The SLiCES system can be potentially applied also to others viral vectors used for delivering RNA guided nucleases, stepping up the specificity of genome editing through different delivery systems. An example are AAV vectors exploited for small Cas9 variants (such as SaCas9) (Friedland, A. E. et al. Genome Biol. 2015, 16, 257) for which an all-in-one AAV-SLiCES approach is conceivable simply by transferring the technologies developed for lentiSLiCES. Taking in account the high propensity of AAV vectors to transduce cells with high multiplicity of infection (Ruozi, G. et al. Nat. Commun. 2015, 6, 7388), it is possible to design a delivery strategy for the SLiCES system for large size nucleases, such as SpCas9, StCas9 or AsCpf1, based on a mixture of two AAVs: one for delivering the nuclease only and a second vector carrying the self-limiting and the targeting gRNAs. This approach would be similar to the multiple plasmid system presented in FIG. 2.

[0121] Methods

[0122] Plasmids and Oligonucleotides.

[0123] The 3XFLAG-tagged S. pyogenes Cas9 was expressed from the pX-Cas9 plasmid, which was obtained by removal of an Ndel fragment including the sgRNA expression cassette from pX330 (a gift from Feng Zhang, Addgene #42230) (Cong, L. et al., Science 2013, 339, 819-823). The sgRNAs were transcribed from a U6 promoter driven cassette, derived from px330 and cloned into pUC19. sgRNA oligos were cloned using a double Bbsl site inserted before the sgRNA constant portion by a previously published cloning strategy (Cong, L. et al., Science 2013, 339, 819-823). Plasmids expressing FLAG-tagged S. thermophilus Cas9 (pJDS246-CMV-St1-Cas9) and S. thermophilus gRNA (pMLM3636-U6-+103gRNA_St1Cas9) were a gift of Claudio Mussolino (Mller, M. et al. Mol. Ther. J. Am. Soc. Gene Ther. 2016, 24, 636-644). S. thermophilus sgRNAs oligos were cloned into pMLM3636-U6-+103gRNA_St1Cas9 using BsmBI and transcribed from a U6 promoter. The list of sgRNAs and target sites employed in this study is available in Table 1.

TABLE-US-00001 SpCas9 name protospacer(*) target(**) GFPW gCTCGTGACCACCCTGACCTA accCTCGTGACCACCCTGACCTACGGcgt (SEQIDN.11) (SEQIDN.12) Rep.SV5 agcCTCGTGACCACCCTGACCTACGGagt (SEQIDN.13) GFPM [00001] GFPMM [00002] VEGFA GGTGAGTGAGTGTGTGCGTG gtgGGTGAGTGAGTGTGTGCGTGTGGggt (SEQIDN.16) (SEQIDN.17) VEGFAOT1 [00003] VEGFAOT2 [00004] ZSCAN GTGCGGCAAGAGCTTCAGCC catGTGCGGCAAGAGCTTCAGCCGGGgct (SEQIDN.20) (SEQIDNO.21) ZSCANOT1 [00005] ZSCANOT2 [00006] EMX1-k GAGTCCGAGCAGAAGAAGAA cctGAGTCCGAGCAGAAGAAGAAGGGctc (SEQIDN.24) (SEQIDN.25) EMX1-kOT2 [00007] EMX1-kOT1 [00008] EMX1-r GGCCTCCCCAAAGCCTGGCCA cagGCCTCCCCAAAGCCTGGCCAGGGagt (SEQIDN.28) (SEQIDN.29) EMX1-rOT1 [00009] EMX1-rOT2 [00010] Cas-a gTACGCCGGCTACATTGACGG ggcTACGCCGGCTACATTGACGGcgg (SEQID1) (SEQIDN.32) Cas-b GATCCTTGTAGTCTCCGTCG catGATCCTTGTAGTCTCCGTCGTGGtcc (SEQID2) (SEQIDN.33) Cas-c GGCTACGCCGGCTACATTGA aacGGCTACGCCGGCTACATTGACGGcgg (SEQID3) (SEQIDN.34) control GGGTCTTCGAGAAGACCT (SEQIDN.35) STh1Cas9 NHEJ-Rep.W GTCCCCTCCACCCCACAGTG agaGTCCCCTCCACCCCACAGTGCAAGAAAtcc (SEQIDN.36) (SEQIDN.37) NHEJ-Rep.M [00011] STh1-1 GGCAGAAGGCTGACCCGGCG cagGGCAGAAGGCTGACCCGGCGGAAGAAAcac (SEQID4) (SEQIDN.39) STh1-2 gGCCTACAGAAGCGAGGCCC agcGCCTACAGAAGCGAGGCCCTGAGAATcct (SEQID5) (SEQIDN.40) STh1-3 gAGACTAACGAGGACGACGA cgcGAGACTAACGAGGACGACGAGAAGAAAgcc (SEQID6) (SEQIDN.41) control GAGACGATTAATGCGTCTC (SEQIDN.42) (*) Lowercase indicates non-matching additional 5g. [00012]

[0124] pcDNA5-FRT-TO-EGFP plasmid was obtained by subcloning EGFP from pEGFP-N1 in a previously published vector (Vecchi, L., et al. J. Biol. Chem. 2012, 287, 20007-20015) derived from pcDNA5-FRT-TO (Invitrogen). pcDNA5-FRT-TO-EGFP-Y66S was obtained by site directed mutagenesis of pcDNA5-FRT-TO-EGFP. A sgRNA resistant, non-fluorescent truncated EGFP fragment (1-T203K-stop), obtained by site directed mutagenesis of the pcDNA5-FRT-TO-EGFP plasmid, was amplified by PCR and inserted in place of EGFP in the pcDNA5-FRT-TO-EGFP plasmid, yielding the donor pcDNA5-FRT-TO-rEGFP(1-T203K-stop) plasmid. The SV5-EGFP-based NHEJ reporters employed in this application (Rep. SV5, NHEJ-REP.W and NHEJ-Rep.M) were generated by cloning into the Nhel/BspEl sites dsDNA oligos corresponding to the complete target sequence (including PAM) recognized by a sgRNA of interest. The target is inserted between the SV5 tag and EGFP coding sequences, with the EGFP sequence positioned out of frame with respect to the starting ATG codon of the SV5 tag open reading frame (ORF). A stop codon is inserted in the SV5 frame, immediately after the target sequence. The pcDNA3 MHC-I-roTag plasmid is described in Petris, G., et al., PloS One 2014, 9, e96700. Information on plasmids DNA sequences produced for experiments described in this application are found in Supplementary Sequences and Sequence Listing.

[0125] Cell Culture and Transfections. 293T/17 cells were obtained from ATCC. 293TR cells, constitutively expressing the Tet repressor (TetR), were generated by lentiviral transduction of parental 293T/17 cells using the pLenti-CMV-TetR-Blast vector (a gift from Eric Campeau, Addgene #17492) (Campeau, E. et al. P/oS One 2009, 4, e6529) and were pool selected with 5 g/ml of blasticidin (Life Technologies). 293-multiEGFP cells were generated by stable transfection of pEGFP-IRES-Puromicin and selected with 1 g/ml of puromicin. 293-iEGFP and 293-iY66S cells (Flp-In T-REx system; Life Technologies) were generated by Flp-mediated recombination using the pcDNA5-FRT-TO-EGFP or the pcDNA5-FRT-TO-EGFP-Y66S as donor plasmids, respectively, in cells carrying a single genomic FRT site and stably expressing the tetracycline repressor (293 T-Rex Flp-In, cultured in selective medium containing 15 g/ml blasticidin and 100 g/ml zeocin-Life Technologies). 293-iEGFP and 293-iY66S were cultured in selective medium containing 15 g/ml blasticidin and 100 g/ml hygromycin (Life Technologies). 293-iEGFP and 293-iY66S selected clones were checked for integration specificity by loss of zeocin resistance. All cell lines were cultured in DMEM supplemented with 10% FBS, 2 mM L-Gln, 10 U/ml penicillin, and 10 g/ml streptomycin and the appropriate antibiotics indicated above. 293T, 293-iEGFP or 293-iY66S cells were transfected in 12 or 24 multi wells with 250-500 ng of pX-Cas9 and 250-500 ng of the desired pUC19-sgRNA plasmid using TranslT-LT1 (Mirus Bio), according to manufacturer's instructions. Cells were collected 2-4 days after transfection or as indicated.

[0126] In 293-iEGFP and 293-iY66S cells the expression of EGFP was induced by treatment with 100 ng/ml doxycycline (Cayman Chemical) for 20 h before fluorescence measurement.

[0127] lentiSLiCES Vectors.

[0128] lentiSLiCES was prepared from lentiCRISPRv1 transfer vector by substituting the EFS-SpCas9-2A-Puro cassette with a SpCas9(intron)-IRES-Blasticidin fragment together with a CMV-TetO promoter. The intron introduced in SpCas9 (see Supplementary sequence information) derives from the mouse immunoglobulin heavy chain precursor V-region intron (GenBank ID: M12880.1), previously used with different flanking exons (Vecchi, L., et al., J. Biol. Chem. 2012, 287, 20007-20015; Petris, G., et al., PloS One 2014, 9, e96700; Li, E. et al. Protein Eng. 1997, 10, 731-736). The EMCV-IRES regulating the translation of a blasticidin resistance gene was cloned downstream of SpCas9 to allow the antibiotic selection of transduced cells, even after the generation of frameshift mutations following Cas9 self-cleavage of the integrated vector.

[0129] The sgCtr-opt or the sgCas9-a-opt were assembled with an H1-TetO promoter within the pUC19 plasmid, PCR amplified and then cloned into a unique EcoRl site in lentiCRISPRv1 and selected for the desired orientation. The sgRNAs targeting the chosen locus were cloned into the lentiCRISPRv1 sgRNA cassette using the two BsmBI sites, following standard procedures (Brinkman, E. K., et al., Nucleic Acids Res. 2014, 42, e168).

[0130] Information on DNA sequences of lentiSLiCES can be found in Supplementary Supplementary Sequences and Sequence Listing.

[0131] Lentiviral Vector Production.

[0132] Lentiviral particles were produced by seeding 410.sup.6 293 T or 293TR cells into a 10 cm dish, for lentiCRISPR or lentiSLiCES production, respectively. The day after the plates were transfected with 10 g of each transfer vector together with 6.5 g pCMV-deltaR8.91 packaging vector and 3.5 g pMD2.G using the polyethylenimine (PEI) method (Casini, A., etal., J. Virol. 2015, 89, 2966-2971). After an overnight incubation, the medium was replaced with fresh complete DMEM and 48 hours later the supernatant containing the viral particles was collected, spun down at 500g for 5 minutes and filtered through a 0.45 m PES filter.

[0133] After collection, lentiSLiCES viral vectors were concentrated using polyethylene glycol (PEG) 6000 (Sigma). Briefly, a 40% PEG 6000 solution in water was mixed in a 1:3 ratio with the vector-containing supernatant and incubated for 3 hours to overnight at 4 C. Subsequently, the mix was spun down for 45 minutes at 2000g in a refrigerated centrifuge. The pellets were then resuspended in a suitable volume of DMEM complete medium. lentiCRISPR vectors were used unconcentrated. The titer of the lentiviral vectors (reverse transcriptase units, RTU) was measured using the product enhanced reverse transcriptase (PERT) assay (Francis, A. C. et al. AIDS Res. Hum. Retroviruses 2014, 30, 717-726).

[0134] Infections and EGFP Fluorescence Detection.

[0135] One day before transduction 10.sup.5 293 T, 293-iEGFP or 293-multiEGFP cells were seeded in a 24-well plate. For lentiSLiCES vectors, cells were transduced by centrifuging 2 RTU/well for 2 hours at 1600g at 16 C., and then leaving the vectors incubating with the cultures for an overnight. Starting from 24 hours post transduction onwards the cultures were selected with 5 g/ml of blasticidin, where needed. For lentiCRISPR vectors, 0.5 RTU/well were used following the same transduction protocol and cells were selected with 0.5 g/ml of puromycin.

[0136] When targeting genomic EGFP sequences, cells were collected and analyzed using a FACSCanto flow cytometer (BD Biosciences) to quantify the percentage of EGFP loss or induction (gene substitution experiments).

[0137] Western Blots.

[0138] Cells were lysed in NEHN buffer (20 mM HEPES pH 7.5, 300 mM NaCl, 0.5% NP40, NaCl, 1 mM EDTA, 20% glycerol supplemented with 1% of protease inhibitor cocktail (Pierce)). Cell extracts were separated by SDS-PAGE using the PageRuler Plus Protein Standards as the standard molecular mass markers (Thermo Fisher Scientific). After electrophoresis, samples were transferred to 0.22 m PVDF membranes (GE Healthcare). The membranes were incubated with mouse anti-FLAG (Sigma) for detecting SpCas9 and St1Cas9, mouse anti--tubulin (Sigma), rabbit anti-GFP (Santa Cruz Biotechnology), mouse anti-roTag mAb (Petris, G., et al., PloS One 2014, 9, e96700) and with the appropriate HRP conjugated goat anti-mouse (KPL) or goat anti-rabbit (Santa Cruz Biotechnology) secondary antibodies for ECL detection. Images were acquired and bands were quantified using the UVltec Alliance detection system.

[0139] Detection of Cas9-Induced Genomic Mutations.

[0140] Genomic DNA was isolated at 72 h post-transfection or as indicated for transduction experiments, using the DNeasy Blood & Tissue kit (Qiagen). PCR reactions to amplify genomic loci were performed using the Phusion High-Fidelity DNA polymerase (Thermo Fisher). Samples were amplified using the oligos listed in Table 2. Purified PCR products were analyzed either by sequencing and applying the TIDE tool (Chen, B., etal. Cell 2013, 155, 1479-1491) or by T7 Endonuclease 1 (T7E1) assay (New England BioLabs). In the latter case PCR amplicons were denatured and re-hybridized before digestion with T7E1 for 30 min at 37 C. Digested material was separated using standard agarose gel and quantified using the ImageJ software. Indel formation was calculated according to the following equation: % gene modification=100(1(1fraction cleaved).sup.1/2).

TABLE-US-00002 TABLE2 SequencesoftheoligosusedtoamplifyEGFP,thegenomicloci(VEGF- A,ZSCAN,EMX)andrelativeofftargetsites. locus oligo1 oligo2 GFP ACCATGGTGAGCAAGGGCGAGGA AGCTCGTCCATGCCGAGAGTGATC (SEQIDN.43) (SEQIDN.44) VEGFA GCATACGTGGGCTCCAACAGGT CCGCAATGAAGGGGAAGCTCGA (SEQIDN.45) (SEQIDN.46) VEGFAOT1 CAGGCGCCTTGGGCTCCGTCA CCCCAGGATCCGCGGGTCAC (SEQIDN.47) (SEQIDN.48) VEGFAOT2 AGTCAGCCCTCTGTATCCCTGGA GAGATATCTGCACCCTCATGTTCAC (SEQIDN.49) (SEQIDN.50) ZSCAN GACTGTGGGCAGAGGTTCAGC TGTATACGGGACTTGACTCAGACC (SEQIDN.51) (SEQIDN.52) ZSCANOT1 CACGACTGCAGGCTCATGAGC GAAGCGCTTACCACACACATCAC (SEQIDN.53) (SEQIDN.54) ZSCANOT2 AGTCACATGCTGCCTGGATTGAC GTGGAGGAGATTTCTCTAGGAGAG (SEQIDN.55) (SEQIDN.56) EMX1 CTGCCATCCCCTTCTGTGAATGT GGAATCTACCACCCCAGGCTCT (SEQIDN.57) (SEQIDN.58) EMX1-kOT2 CTGCTGTTTCCTGAAGCTGCCACT CTGCCATGGAAATTCCAGAGGGAAC (SEQIDN.59) (SEQIDN.60) EMX1-kOT1 TGTGGGGAGATTTGCATCTGTGGA TTGAGACATGGGGATAGAATCATGAAC (SEQIDN.61) (SEQIDN.62) EMX1-rOT1 TGAACGAATCAGGTCTGAGAGGATC GAGCTTCACTCCAGAGAGGCTGT (SEQIDN.63) (SEQIDN.64) EMX1-rOT2 TGCTACTGCTGGCTGCAGAGATG GCATTCGTTTTGGGAGGCAGAGGA (SEQIDN.65) (SEQIDN.66)

[0141] Supplementary sequences

[0142] A subset of new plasmids produced for this manuscript: [0143] Rep. SV5-EGFP (SEQ ID N.67) [0144] Donor pcDNA5-FRT-TO-rEGFP(1-T203K-stop) (SEQ ID N.68) [0145] LentiSLiCES (SEQ ID N.10)

[0146] Rep. SV5-EGFP (Nhel and BspEl restriction sites to clone target sequence are underlined, in frame stop condon is in bold).

[0147] SV5, , linker, [this EGFP CDS, resistant to specific sgRNAs targeting EGFP (sgGFP-W, -M) for which the target sequences were initially cloned into the reporter target region, was obtained by introducing the synonymous mutations that are indicated in lowercase bold to prevent its targeting]

TABLE-US-00003 SEQIDN.67: [00013]

[0148] Donor pcDNA5-FRT-TO-rEGFP(1-T203K-stop) plasmid

[0149] rEGFP(1-T203K-stop) donor, synonymous codons employed to prevent sgRNA retargeting after homologous recombination are highlighted in lowercase bold, the key nucleotide change to restore EGFP fluorescence by reverting the Y66S mutation is underlined. The end of then 410 bp 3-homology arm (corresponding to T203K-stop) is highlighted in .

TABLE-US-00004 ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCT GGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCG GCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTC ATCTGCACCACaGGaAAaCTcCCtGTcCCtTGGCCaACtCTgGTcAC tACaCTtACaTaCGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACA TGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTC CAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCG CGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGC TGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAG CTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAA GCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCG AGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCC [00014] LentiSLiCES [00015] GGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCA AGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCC TCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGA ACAGGGACTTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGC AGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCG ACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGA GAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCG CGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAA ATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAG TTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTG GGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATC ATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAG AGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAA AACAAAAGTAAGACCACCGCACAGCAAGCGGCCGCTGATCTTCAGAC CTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAA TATAAAGTAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGC AAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAG CTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCA GCGTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTAT AGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGC ATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGA ATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGAT TTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTGCCTTGGA ATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACACG ACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAAT ACACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAAC AAGAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTT AACATAACAAATTGGCTGTGGTATATAAAATTATTCATAATGATAGT AGGAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTATAG TGAATAGAGTTAGGCAGGGATATTCACCATTATCGTTTCAGACCCAC CTCCCAACCCCGAGGGGACCCAGGAGGCCTATTTCCCATGATTCCTT CATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATT AATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAG AAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTA AAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTC [00016] [00017] CTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAA AAAGTGGCACCGAGTCGGTGCTTTTTTGaattctagtagaattgagg [00018] ACAAATGGCAGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTG GGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGAC ATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTT TCGGGTTTATTACAGGGACAGCAGAGATCCACTTTGGCGCCGGCtcg agGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGG GGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTT ACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATT GACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTT TCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTG GCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGT CAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCT TATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCT ATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATA GCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCA ATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGT CGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACG GTGGGAGGTCTATATAAGCAGAGCTCTCCCTATCAGTGATAGAGATC TCCCTATCAGTGATAGAGATCGTCGACGAGCTCGTTTAGTGAACCGT CAGATCGCCTGGAGAggatcCGCCACCATGGATTACAAAGACGATGA CGATAAGATGGCCCCAAAGAAGAAGCGGAAGGTCGGTCGGTATCCAC GGAGTCCCAGCAGCCGACAAGAAGTACAGCATCGGCCTGGACATCGG CACCAACTCTGTGGGCTGGGCCGTGATCACCGACGAGTACAAGGTGC CCAGCAAGAAATTCAAGGTGCTGGGCAACACCGACCGGCACAGCATC AAGAAGAACCTGATCGGAGCCCTGCTGTTCGACAGCGGCGAAACAGC CGAGGCCACCCGGCTGAAGAGAACCGCCAGAAGAAGATACACCAGAC GGAAGAACCGGATCTGCTATCTGCAAGAGATCTTCAGCAACGAGATG GCCAAGGTGGACGACAGCTTCTTCCACAGACTGGAAGAGTCCTTCCT GGTGGAAGAGGATAAGAAGCACGAGCGGCACCCCATCTTCGGCAACA TCGTGGACGAGGTGGCCTACCACGAGAAGTACCCCACCATCTACCTG AGAAAGAAACTGGTGGACAGCACCGACAAGGCCGACCTGCGGCTGAT CTATCTGGCCCTGGCCCACATGATCAAGTTCCGGGGCCACTTCCTGA TCGAGGGCGACCTGAACCCCGACAACAGCGACGTGGACAAGCTGTTC ATCCAGCTGGTGCAGACCTACAACCAGCTGTTGAGGAAAACCCCATC AACGCCAGCGGCGTGGACGCCAAGCCATCCTGTCTGCCAGACTGAGC AAGAGCAGACGGCTGGAAAATCTGATCGCCCAGCTGCCCGGCGAGAA GAAGAATGGCCTGTTCGGCAACCTGATTGCCCTGAGCCTGGGCCTGA CCCCCAACTTCAAGAGCAACTTCGACCTGGCGAGGATGCCAAACTGC AGCTGAGCAAGGACACCTACGACGACGACCTGGACAACCTGCTGGCC CAGATCGGCGACCAGTACGCCGACCTGTTTCTGGCCGCCAAGAACCT GTCCGACGCCATCCTGCTGAGCGACATCCTGAGAGTGAACACCGAGA TCACCAAGGCCCCCCTGAGCGCCTCTATGATCAAGAGATACGACGAG CACCACCAGGACCTGACCCTGCTGAAAGCTCTCGTGCGGCAGCAGCT GCCTGAGAAGTACAAAGAGATTTTCTTCGACCAGAGCAAGAACGGCT ACGCCGGCTACATTGACGGCGGAGCCAGCCAGGAAGAGTTCTACAAG TTCATCAAGCCCATCCTGGAAAAGATGGACGGCACCGAGGAACTGCT CGTGAAGCTGAACAGAGAGGACCTGCTGCGGAAGCAGCGGACCTTCG ACAACGGCAGCATCCCCCACCAGATCCACCTGGGAGAGCTGCACGCC ATTCTGCGGCGGCAGGAAGATTTTTACCCATTCCTGAAGGACAACCG GGAAAAGATCGAGAAGATCCTGACCTTCCGCATCCCCTACTACGTGG GCCCTCTGGCCAGGGGAAACAGCAGATTCGCCTGGATGACCAGAAAG AGCGAGGAAACCATCACCCCCTGGAACTTCGAGGAAGTGGTGGACAA GGGCGCTTCCGCCCAGAGCTTCATCGAGCGGATGACCAACTTCGATA AGAACCTGCCCAACGAGAAGGTGCTGCCCAAGCACAGCCTGCTGTAC GAGTACTTCACCGTGTATAACGAGCTGACCAAAGTGAAATACGTGAC CGAGGGAATGAGAAAGCCCGCCTTCCTGAGCGGCGAGCAGAAAAAGG CCATCGTGGACCTGCTGTTCAAGACCAACCGGAAAGTGACCGTGAAG CAGCTGAAAGAGGACTACTTCAAGAAAATCGAGTGCTTCGACTCCGT GGAAATCTCCGGCGTGGAAGATCGGTTCAACGCCTCCCTGGGCACAT ACCACGATCTGCTGAAAATTATCAAGGACAAGGACTTCCTGGACAAT GAGGAAAACGAGGACATTCTGGAAGATATCGTGCTGACCCTGACACT GTTTGAGGACAGAGAGATGATCGAGGAACGGCTGAAAACCTATGCCC ACCTGTTCGACGACAAAGTGATGAAGCAGCTGAAGCGGCGGAGATAC ACCGGCTGGGGCAGGCTGAGCCGGAAGCTGATCAACGGCATCCGGGA CAAGCAGTCCGGCAAGACAATCCTGGATTTCCTGAAGTCCGACGGCT TCGCCAACAGAAACTTCATGCAGCTGATCCACGACGACAGCCTGACC [00019] CATTGCCAATCTGGCCGGCAGCCCCGCCATTAAGAAGGGCATCCTGC AGACAGTGAAGGTGGTGGACGAGCTCGTGAAAGTGATGGGCCGGCAC AAGCCCGAGAACATCGTGATCGAAATGGCCAGAGAGAACCAGACCAC CCAGAAGGGACAGAAGAACAGCCGCGAGAGAATGAAGCGGATCGAAG AGGGCATCAAAGAGCTGGGCAGCCAGATCCTGAAAGAACACCCCGTG GAAAACACCCAGCTGCAGAACGAGAAGCTGTACCTGTACTACCTGCA GAATGGGCGGGATATGTACGTGGACCAGGAACTGGACATCAACCGGC TGTCCGACTACGATGTGGACCATATCGTGCCTCAGAGCTTTCTGAAG GACGACTCCATCGACAACAAGGTGCTGACCAGAAGCGACAAGAACCG GGGCAAGAGCGACAACGTGCCCTCCGAAGAGGTCGTGAAGAAGATGA AGAACTACTGGCGGCAGCTGCTGAACGCCAAGCTGATTACCCAGAGA AAGTTCGACAATCTGACCAAGGCCGAGAGAGGCGGCCTGAGCGAACT GGATAAGGCCGGCTTCATCAAGAGACAGCTGGTGGAAACCCGGCAGA TCACAAAGCACGTGGCACAGATCCTGGACTCCCGGATGAACACTAAG TACGACGAGAATGACAAGCTGATCCGGGAAGTGAAAGTGATCACCCT GAAGTCCAAGCTGGTGTCCGATTTCCGGAAGGATTTCCAGTTTTACA AAGTGCGCGAGATCAACAACTACCACCACGCCCACGACGCCTACCTG AACGCCGTCGTGGGAACCGCCCTGATCAAAAAGTACCCTAAGCTGGA AAGCGAGTTCGTGTACGGCGACTACAAGGTGTACGACGTGCGGAAGA TGATCGCCAAGAGCGAGCAGGAAATCGGCAAGGCTACCGCCAAGTAC TTCTTCTACAGCAACATCATGAACTTTTTCAAGACCGAGATTACCCT GGCCAACGGCGAGATCCGGAAGCGGCCTCTGATCGAGACAAACGGCG AAACCGGGGAGATCGTGTGGGATAAGGGCCGGGATTTTGCCACCGTG CGGAAAGTGCTGAGCATGCCCCAAGTGAATATCGTGAAAAAGACCGA GGTGCAGACAGGCGGCTTCAGCAAAGAGTCTATCCTGCCCAAGAGGA ACAGCGATAAGCTGATCGCCAGAAAGAAGGACTGGGACCCTAAGAAG TACGGCGGCTTCGACAGCCCCACCGTGGCCTATTCTGTGCTGGTGGT GGCCAAAGTGGAAAAGGGCAAGTCCAAGAAACTGAAGAGTGTGAAAG AGCTGCTGGGGATCACCATCATGGAAAGAAGCAGCTTCGAGAAGAAT CCCATCGACTTTCTGGAAGCCAAGGGCTACAAAGAAGTGAAAAAGGA CCTGATCATCAAGCTGCCTAAGTACTCCCTGTTCGAGCTGGAAAACG GCCGGAAGAGAATGCTGGCCTCTGCCGGCGAACTGCAGAAGGGAAAC GAACTGGCCCTGCCCTCCAAATATGTGAACTTCCTGTACCTGGCCAG CCACTATGAGAAGCTGAAGGGCTCCCCCGAGGATAATGAGCAGAAAC AGCTGTTTGTGGAACAGCACAAGCACTACCTGGACGAGATCATCGAG CAGATCAGCGAGTTCTCCAAGAGAGTGATCCTGGCCGACGCTAATCT GGACAAAGTGCTGTCCGCCTACAACAAGCACCGGGATAAGCCCATCA GAGAGCAGGCCGAGAATATCATCCACCTGTTTACCCTGACCAATCTG GGAGCCCCTGCCGCCTTCAAGTACTTTGACACCACCATCGACCGGAA GAGGTACACCAGCACCAAAGAGGTGCTGGACGCCACCCTGATCCACC AGAGCATCACCGGCCTGTACGAGACACGGATCGACCTGTCTCAGCTG GGAGGCGACAAGCGTCCTGCTGCTACTAAGAAAGCTGGTCAAGCTAA [00020] [00021] TCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGG CGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGG CTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCGTC CTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGA CGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCT TCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCT TCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCGTC GACTTTAAGACCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACT [00022]