APPLICATION OF COMPOUND USING INTRA-CYCLIC PEROXO-BRIDGED SESQUITERPENES AS PARENT NUCLEUS IN METABOLISM-RELATED FATTY LIVER DISEASES

20230226018 · 2023-07-20

Assignee

Inventors

Cpc classification

International classification

Abstract

An application of a compound using intra-cyclic peroxo-bridged sesquiterpenes as a parent nucleus in metabolism-related fatty liver diseases is provided. The compound using intra-cyclic peroxo-bridged sesquiterpenes as the parent nucleus has the structure shown in Formula I, where A denotes O, —OH, OCH3, —OCH.sub.2CH.sub.3, or —OC.sub.4H.sub.5O.sub.3. The compound using intra-cyclic peroxo-bridged sesquiterpenes as the parent nucleus is configured for preparing a drug or a composition for treating metabolism-related fatty liver diseases. The present invention demonstrates that the compound using intra-cyclic peroxo-bridged sesquiterpenes as the parent nucleus can improve the function of mitochondria. in liver cells and enhance the fatty acid β-oxidation capacity thereof and can be used for the treatment of metabolic dysfunction due to mitochondrial dysfunction, as well as the resulting liver fat accumulation, inflammation, and fibrotic lesions.

Claims

1. A method of an application of a compound using intra-cyclic peroxo-bridged sesquiterpenes as a parent nucleus in metabolism-related fatty liver diseases, wherein the compound using the intra-cyclic peroxo-bridged sesquiterpenes as the parent nucleus has a structure shown in Formula I: ##STR00003## wherein A denotes O, —OH, —OCH.sub.3, —OCH.sub.2CH.sub.3, or —OC.sub.4H.sub.5O.sub.3; the compound using the intra-cyclic peroxo-bridged sesquiterpenes as the parent nucleus is configured for preparing a drug or a composition for treating the metabolism-related fatty liver diseases.

2. The method according to claim 1, wherein when A is the —OC.sub.4H.sub.5O.sub.3, the compound using the intra-cyclic peroxo-bridged sesquiterpenes as the parent nucleus is artesunate.

3. The method according to claim 1, wherein the compound using the intra-cyclic peroxo-bridged sesquiterpenes as the parent nucleus has a function of regulating mitochondria in liver cells.

4. The method according to claim 3, wherein the function of regulating the mitochondria in the liver cells is to enhance a fatty acid β-oxidation capacity of the mitochondria.

5. The method according to claim 1, wherein the metabolism-related fatty liver diseases comprise liver lesions caused by a mitochondrial dysfunction and a decreased fatty acid n-oxidation capacity; the liver lesions comprise liver steatosis, inflammation, and fibrosis.

6. A drug comprising the compound with the structure shown in the Formula I according to claim 1 for a prevention or a treatment of the metabolism-related fatty liver diseases.

7. A composition for a prevention or a treatment of the metabolism-related fatty liver diseases comprising the compound with the structure shown in the Formula I according to claim 1 or a pharmaceutically acceptable salt of the compound, as an active ingredient.

8. The composition according to claim 7, further comprising one or more carriers, excipients, or diluents pharmaceutically acceptable.

9. A method of an application of the compound with the structure shown in the Formula I according to claim 1 or a pharmaceutical salt of the compound in a preparation of products for a prevention or a treatment of the metabolism-related fatty liver diseases.

10. The method according to claim 9, the metabolism-related fatty liver diseases are liver lesions caused by a mitochondrial dysfunction and a decreased fatty acid β-oxidation capacity; the liver lesions comprise liver steatosis, inflammation, and fibrosis.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0020] FIG. 1 is a column chart of the content of triglyceride in HepG2 liver cancer cells of a control group, a model group, and an artesunate group.

[0021] FIGS. 2A-2B are diagrams of Nile red staining of lipid droplets, where FIG. 2A is the model group, and FIG. 2B is the artesunate group.

[0022] FIG. 3 shows the mRNA expression results of CIDE series genes related to lipid droplets. CIDE gene expression is related to the size of lipid droplets in cells. Artesunate can reduce the volume of lipid droplets in cells and the content of fatty acids by reducing CIDE gene expression. In FIGS. 3-7, when each group is compared with the model group, *, **, and *** denote that there are significant differences. Among them, * denotes p<0.05,** denotes p<0.01,*** denotes p<0.001, and **** denotes p<0.0001.

[0023] FIG. 4 shows the effect of artesunate on the mRNA expression level of AMPKα. Adenosine 5′-monophosphate (AMP)-dependent protein kinase is a key molecule in regulating bioenergy metabolism. Artesunate increases the expression of AMPKα, indicating that artesunate can activate intracellular energy metabolism and consume excess intracellular fatty acids.

[0024] FIG. 5 shows the effect of artesunate on the pathways of adenosine 5′-monophosphate-activated protein kinase (AMPK)-sterol regulatory element binding protein-1c (SREBP1c)-acetyl coA carboxylase (ACC)-stearoyl-coA desaturase-1 (SCDI)-fatty acid synthase (FAS). SREBP1c-ACC/SCD1/FAS is a key upstream gene of intracellular lipid synthesis. Artesunate can reduce the expression of the genes of the pathways, indicating that artesunate can inhibit lipid synthesis in cells and reduce the lipid content in cells.

[0025] FIG. 6 shows the effect of artesunate on the pathways of AMPK-cluster of differentiation 36 (CD36)-carnitine palmitoyltransferase 1 (CPT1). The CPT1 gene is a key gene for fatty acids transported to mitochondria; artesunate increases the expression of CPT1, which can accelerate mitochondrial fatty acid oxidation and reduce the lipid content in cells.

[0026] FIG. 7 shows the effect of artesunate on the mRNA expressions of PPARα and PPARγ. Artesunate can significantly increase the mRNA expressions of PPARα and PPARγ. Peroxisome proliferator-activated receptor α (PPARα) is an important nuclear receptor that plays an important role in maintaining the homeostasis of body energy metabolism. When a body is in a state of nutrient deficiency, PPARα in the coated plasma will be transferred to the nucleus, and the PPARα entering the nucleus will promote the expression of downstream genes involved in fatty acid oxidation, thereby promoting fatty acid oxidation to ensure the normal energy demand of the body and maintain the homeostasis of liver lipid metabolism.

[0027] FIG. 8 shows pathological sections, stained with HE and Oil red O, respectively, of the livers of high-fat and high-sugar-induced mice. Artemisinin can inhibit liver steatosis induced by a high-fat and high-sugar diet.

[0028] FIGS. 9A-9H show the effects of artemisinin on serum liver enzymes, lobular inflammation, and ballooning of liver cells. FIG. 9A shows the effect on liver index %. FIG. 9B shows the effect on liver steatosis. FIG. 9C shows the effect on inflammation. FIG. 9D shows the effect on ballooning. FIG. 9E shows the effect on alanine aminotransferase (ALT). FIG. 9F shows the effect on aspartate aminotransferase (AST). FIG. 9G shows the effect on tumor necrosis factor α (TNFα). FIG. 9H shows the effect on interleukin 6 (IL-6). In FIGS. 9A-9H, FIGS. 10A-10I, and FIGS. 11A-11G, Con, HFD, and HFD+Art represent a normal group, a high-fat group, and a high-fat plus artemisinin group, respectively. In FIGS. 9A-9H, FIGS. 10A-10I, and FIGS. 11A-11G, * denotes p<0.05, ** denotes p<0.01, *** denotes p<0.001, and **** denotes p<0.0001.

[0029] FIGS. 10A-10I show the expression levels of lipid metabolism-related genes in mice liver; artemisinin intervention can reduce the expression of lipid metabolism-related genes in mice liver, thereby reducing the synthesis of lipids in the liver.

[0030] FIGS. 11A-11G show the expression of autophagy-related proteins in mice liver; artemisinin intervention can restore the level of mitophagy in mice to maintain the quantity and quality of mitochondria in mice liver at the optimal state and inhibit mitochondrial damage and liver lesions induced by high-fat and high-sugar. LC3 represents autophagy microtubule-associated protein light chain 3, and TOR represents the rapamycin target protein.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0031] The technical solution of the present invention is further described by specific embodiments as follows. The following embodiments are further descriptions of the present invention rather than limiting the scope of the present invention. The English abbreviations involved in the present invention are presented in Table 3 at the end of the text.

Embodiment 1

[0032] HepG2 liver cancer cells (purchased from the Cell Bank of the Chinese Academy of Sciences) were selected and used as research materials. HepG2 liver cancer cells are widely used in pharmacological and toxicological studies. They can express many differentiated liver functions, such as plasma protein synthesis and secretion, cholesterol and triglyceride metabolism, lipoprotein metabolism and transport, bile acid synthesis, glycogen synthesis, or insulin signal transduction.

[0033] The addition of free fatty acid (FFA) in a medium can cause the accumulation of lipids in HepG2 liver cancer cells, damage the mitochondrial function, and reduce the fatty acid β-oxidation capacity, thereby resulting in the increase in the number and volume of lipid droplets. After the treatment with artesunate (purchased from Jiangsu Zhangjiagang Weisheng Biomedical Co., Ltd), the content of triglyceride (TG) in HepG2 liver cancer cells significantly decreased (as shown in FIG. 1), and the number of large lipid droplets decreased (as shown in FIGS. 2A-2B). FFA was not added to the medium of the control group, while FFA was added to the mediums of the model group and artesunate group. The addition amount is shown in FIG. 1, The formation of large lipid droplets in the model group is an important marker of steatosis in liver cells.

[0034] Experimental methods: HepG-2 liver cancer cells with passage times less than 20 times were selected and inoculated into a 12-well plate at a density of 3×10.sup.5 cells/mL. Drug treatment was performed after inoculating for 24 h, and the cells were divided into 3 groups with 4 wells in each group. A complete medium containing 1% bovine serum albumin (BSA) was used as the control group. A complete medium containing 1% BSA and 1 mM/L FFA was used as the high-fat model group. A complete medium containing 1% BSA, 1 mM/L FFA, and 5 μM/L, artesunate was used as the artesunate group. After being treated for 24 h, the cells were collected, and RNA was extracted and reverse-transcribed into cDNA. Quantitative real-time PCR (qRT-PCR) was used to detect the expression of CIDE series genes. AMPK signaling pathway-related genes, and PPAR signaling pathway-related genes in the three groups of cells. Primer sequences for the related genes are shown in Table 1.

TABLE-US-00001 TABLE 1 Primers for qRT-PCR reaction (human) Forward primer Reverse primer Primer (5′-3′) (5′-3′) GAPDH TCCCTCAAGATTGTCAGCAA AGATCCACAACGGATACA (SEQ ID NO: 1) (SEQ ID NO: 2) AMPKα TCCTGGAGAAAGATGGCGAC TTCACTTTGCCGAAGGTGCC (SEQ ID NO: 3) (SEQ ID NO: 4) ACC1 TGAAGGCTGTGGTGATGGAT CCGTAGTGGTTGAGGTTGGA (SEQ ID NO: 5) (SEQ ID NO: 6) SCD1 GCGATATGCTGTGGTGCTTA GGAGTGGTGGTAGTTGTGGA ATGC (SEQ ID NO: 7) AGC (SEQ ID NO: 8) FAS TACATCGACTGCATCAGGCA GATACTTTCCCGTCGCA (SEQ ID NO: 9) (SEQ ID NO: 10) CD36 ACTGCAGTGTAGGACTTTCC CCGGTCACAGCCCATTTTTC TG (SEQ ID NO: 11) (SEQ ID NO: 12) CPT-1 GCTGATGACGGCTATGGTGT GTCCATGGTCTCCTCCAAGG (SEQ ID NO: 13) (SEQ ID NO: 14) PPARγ CGAGAGTCAGCCTTTAACGA AGATGCAGGCTCCACTTTGA (SEQ ID NO: 15) (SEQ ID NO: 16) SREBP1c GGCACGGGAGGATGGACT GCTTCTTTGCTGTGAGATGA (SEQ ID NO: 17) CC (SEQ ID NO: 18) PPARα TCCTCGGTGACTTATCCTGT GCGTGGACTCCGTAATGATA GGTC (SEQ ID NO: 19) GCC (SEQ ID NO: 20) SIRT1 GCTCCTACTGGCCTGAGGTT TGCTGCGGAAAGAACAAGGC G (SEQ ID NO: 21) (SEQ ID NO: 22) Cide-A GGAAAGGGCTTGGTGGTACA TGGCTCTGACACATGCACAC (SEQ ID NO: 23) (SEQ ID NO: 24) Cide-B CAGACCCCACCTCAAACACA AATCCCTGCTTTCCTGCCAA (SEQ ID NO: 25) (SEQ ID NO: 26) Cide-C GCCATGAAGTCCCTTAGCCT GGCTTCAGGGTTCCTAGTCT (SEQ ID NO: 27) (SEQ ID NO: 28)

[0035] 1) Expression opf Cell-Death-Inducing DNA-Fragmentation-Factor-Like Effector (CIDE) Series Genes Associated with Lipid Droplets in HepG2 Liver Cancer Cells

[0036] CIDE series genes include the Cide-a gene, the Cide-b gene, and the Cide-c gene. The expression. level of these genes is positively correlated with the size of lipid droplets. By testing the mRNA expression levels of the Cide-a gene, Cide-b gene, and Cide-c gene in the control group, model group, and artesunate group, it was found that the mRNA expression of Cide-a gene and Cide-b gene in the artesunate group were significantly lower than those in the model group, as shown in FIG. 3. Artesunate can reduce the expression of CIDE series genes, suggesting that artesunate can reduce the size of lipid droplets by increasing fatty acid β-oxidation. FIG. 3 shows, assuming the mRNA expression of CIDE series genes in the control group as 1, the relative mRNA expression in other groups compared with the control group.

[0037] 2) Verification of AMPK Signaling Pathway-Related Gene Expression in Cells

[0038] Artesunate can act as an AMPK activator to some extent. Therefore, after artesunate treatment, the mRNA level of AMPKα (PRKAA1) in HepG2 cells in the artesunate group was significantly up-regulated compared with that in the model group (p<0.01), as shown in FIG. 4.

[0039] The effect of artesunate on AMPK-SREBP1c-ACC/SCD1/FAS signaling pathways is shown in FIG. 5, SREBP1c-ACC/SCD1/FAS are genes related to intracellular fatty acid synthesis; artesunate can reduce the expression of those genes related to the pathways, reduce the synthesis of fatty acids in cells, activate AMPK genes, and increase the fatty acid β-oxidation capacity in liver cells.

[0040] Effects of artesunate on AMPK-CD36-CPT1 pathways showed that: After artesunate treatment, the mRNA level of carnitine palmitoyl transferase 1 (CPT-1) in HepG2 cells in the artesunate group was significantly up-regulated compared with that in the model group (p<0.01), as shown in FIG. 6. The increase in the expression of CPT-1 can accelerate the transport of fatty acids into mitochondria for oxidative degradation.

[0041] 3) Expression Levels of PPAR Signaling Pathway-Related Gene in Cells

[0042] After artesunate treatment, the mRNA levels of PPARct. and PPARy in HepG2 cells in the artesunate group were significantly up-regulated compared with those in the model group (p<0.001), as shown in FIG. 7. PPAR is a key gene affecting fatty acid β-oxidation, and the increase in the expression thereof indicates that the fatty acid β-oxidation is accelerated in cells.

Embodiment 2

[0043] C57 mice were selected and fed with feedstuffs that were added with 10% lard and 5% fructose. After 12 weeks, the mice suffered from liver metabolism disruption, generated insulin resistance, and were stuck in mitochondrial dysfunction in liver cells, thus resulting in a decrease in fatty acid β-oxidation capacity and fat accumulation in the liver, and inflammation and fibrosis were produced. Artemisinin was given at a dosage of 100 mg/kg from the 13th week as a treatment for 12 weeks. At the end of the experiment, the mice were dissected to obtain livers. A part of the livers was subjected to HE staining and Oli red O staining to quantify the liver lipids and conduct a pathological scoring of liver steatosis of the mice based on the steatosis activity fibrosis (SAF) scoring system. The results showed that there were obvious fat blebs in the mice's livers after high-fat induction, and large red areas were observed after the Oil red O staining. The fat blebs and Oil red O staining areas in the livers of the mice treated with artemisinin were both closer to those of the mice in the normal group, indicating that artemisinin intervention could significantly improve liver steatosis induced by a high-fat diet, as shown in FIG. 8.

[0044] The serum of each group of mice mentioned above was taken and subjected to serum enzyme detection. The results showed that artemisinin could significantly reduce the elevation of ALT and AST levels in the serum induced by the high-fat diet. Pathological scores based on the SAF scoring system also showed that artemisinin intervention significantly reduced the scores of lobular inflammation and ballooning of liver cells, as shown in FIGS. 9A-9H.

[0045] A part of the livers of the mice in each group mentioned above was taken, RNA and protein were extracted, and the study of the expression of related genes and proteins was conducted to detect the expression levels of lipid metabolism-related genes in liver tissue. The results showed that the upstream gene expression levels of genes related to lipid synthesis were inhibited in mice treated with artemisinin on the high-fat and high-sugar diet. The results suggest that artemisinin can reduce the lipid content in the liver of mice induced by the high-fat and high-sugar diet by reducing the expression of genes related to lipid synthesis, as shown in FIGS. 10A-10I. The primer sequences of the genes are shown in Table 2.

TABLE-US-00002 TABLE 2 Primers for qRT-PCR reaction (mouse) Forward primer Reverse primer Primer (5′-3′) (5′-3′) GAPDH GTTGTCTCCTGCGACTTCA GCCCCTCCTGTTATTATGG (SEQ ID NO: 29) (SEQ ID NO: 30) Slc27a2 ATGGGACAAGCCTTGCTATG CTCAGTCATGGGCACAAATG (SEQ ID NO: 31) (SEQ ID NO: 32) Glut4 GAAGGGTGCTAAACCCGAAA TCTGCTCCCTATATCCGTTC (SEQ ID NO: 33) TT (SEQ ID NO: 34) SCD1 TGGGGCTGCTAATCTCTGGG GGCTTTATCTCTGGGGTGGG TGT (SEQ ID NO: 35) TTTG(SEQ ID NO: 36) FASN AAGTTGCCCGAGTCAGAGAA CGTCGAACTTGGAGAGATCC (SEQ ID NO: 37) (SEQ ID NO.38) CD36 TGGTCAAGCAGCTAGAAA CCCAGTCTCATTTAGCCAC (SEQ ID NO: 39) (SEQ ID NO: 40) CPT-1 GACTCCGCTCGCTCATTCC GGCAGATCTGTTTGAGGGCT (SEQ ID NO: 41) (SEQ ID NO: 42) PPARγ GTGCCAGTTTCGATCCGTAG GGCCAGCATCGTGTAGATGA A (SEQ ID NO: 43) (SEQ ID NO: 44) SRPBP1c CTGGTGAGTGGAGGGACCAT TGCTGCAAGAAGCGGATGTA (SEQ ID NO: 45) (SEQ ID NO: 46) PPARα TGGATGGATTAGATTGGACT TGTTGATGAGCCTGACTTCA G (SEQ ID NO: 47) T (SEQ ID NO: 48)

[0046] Target of rapamycin (TOR) is a key protein in the control of autophagy, which can sense various change signals of cells and strengthen or reduce the occurrence level of autophagy. The above studies on the expression of mice liver proteins revealed that TOR was abnormally activated in the liver of mice having a high-fat and high-sugar diet, and mitopha.gy was significantly inhibited. When the mice fed with a high-fat and high-sugar diet were subjected to the artemisinin intervention, the mice could effectively resist the mitochondrial dysfunction and the decrease in the autophagy level caused by the high-fat and high-sugar diet, thereby reducing steatosis and inflammation in the liver, as shown in FIGS. 11A-11G. LC3II/Actin is marked in FIG. 11C, indicating that the expression level of LC3II protein in the control group (Con), high-fat group (HFD), and high-fat plus artemisinin group (HFD+ART) was homogenized by the ratio of the expression level of LC3II protein to that of the reference protein Actin.

[0047] The animal experiment mentioned above showed that the addition of high-fat and high-sugar in the diet without adding additional chemical inducers can simulate the metabolic dysfunction caused by a long-term poor diet after induction up to 12 weeks, especially mitochondrial dysfunction, decrease in fatty acid β-oxidation capacity, thereby leading to fat accumulation in the liver and secondary inflammation and fibrosis. Artemisinin treatment can significantly improve liver steatosis and inflammation in mice. As the center of energy metabolism in eukaryotic cells, the homeostasis of mitochondria in cells plays an essential role in the normal operation of cells. When mitochondria are senescent or dysfunctional, to maintain the normal operation of cells, on the one hand, the cells will clear the abnormal mitochondria through autophagy, and this mitochondrial clearance mechanism is also commonly defined as mitophagy. On the other hand, if mitochondria with abnormal function cannot be removed in time, that is, when the function of mitopha.gy is defective, a large number of mitochondrial free radicals derived from mitochondria will be produced, leading to inflammation. The induction of high-fat and high-sugar can increase mitochondrial pressure levels, causing swelling and functional damage. Mitophagy is the targeted phagocytosis and destruction of mitochondria. by cellular autophagy devices, which is generally considered to be the main mechanism of mitochondrial quality control. Artemisinin treatment can restore the level of mitophagy in mice induced by a high-fat and high-sugar diet to maintain the quantity and quality of mitochondria in the liver of mice, restore the function of mitochondria, and inhibit the occurrence of liver fatty lesions and inflammation.

TABLE-US-00003 TABLE 3 English abbreviations English abbreviation Full English name AMPK Adenosine 5′-monophosphate (AMP)-activated protein kinase PPAR Peroxisome proliferator-activated receptor FFA Free fatty acid SREBP-1c Sterol regulatory element-binding proteins-1c ABCA1 ATP-binding cassette transporter A1 ABCG1 ATP-binding cassette transporter G1 LXRs Liver X receptors HDL-C High density lipoprotein cholesterol CPT-1 Carnitine palmitoyl transferase 1 SIRT1 Silent mating type information regulation 2 homolog l CD36 cluster of differentiation 36 acyl-CoA Acyl-coenzyme A FAS Fatty acid synthase ACC Acetyl coA carboxylase malonyl Malonyl coenzyme A CoA SCD1 Stearoyl-coA desaturase-1 ACSL1 Long chain fatty acid-CoA ligase 1 PGC-1α peroxisome proliferator-activated receptor γ coactivator 1α mTOR mammalian target of rapamycin TC Total Cholesterol TG Triglyceride CYP7A1 cholesterol 7-alpha hydroxy-lase ALT Alanine aminotransferase AST Aspartate aminotransferase Slc27a2 solute carrier family 27 (fatty acid transporter), member 2 GLU4 solute carrier family 2 (facilitated glucose transporter), member 4

[0048] Preferred specific embodiments of the present invention are described in detail above. It should be understood that the ordinary skilled in the art is capable of performing numerous modifications and variations based on the concept of the present invention without creative labor. Therefore, any technical solution which can be obtained by those skilled in the art based on the concept of the present invention and the prior art by logical analysis, reasoning, or limited experiments shall fall within the scope of protection as determined by the claims.