PROCESS FOR PREPARING L AMINO ACIDS USING IMPROVED STRAINS OF THE ENTEROBACTERIACEAE FAMILY

20200080118 ยท 2020-03-12

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention relates to a recombinant, L-amino acid-secreting microorganism of the Enterobacteriaceae family, comprising an DNA fragment having promoter activity that is functionally linked to a polynucleotide coding for a membrane protein, characterized in that the DNA fragment having promoter activity comprises the SEQ ID NO: 8.

Claims

1. A recombinant L-amino acid-secreting microorganism of the Enterobacteriaceae family, comprising an DNA fragment having promoter activity that is functionally linked to a polynucleotide coding for a membrane protein, wherein the DNA fragment having promoter activity comprises the sequence of SEQ ID NO: 8.

2. The microorganism of claim 1, wherein the DNA fragment having promoter activity is linked at the 3 end to a second DNA fragment carrying a ribosome-binding site.

3. The microorganism of claim 1, wherein the DNA fragment having promoter activity is linked at the 3 end to a second DNA fragment comprising the nucleotide sequence of positions 174 to 204 of SEQ ID NO: 9.

4. The microorganism of claim 1, wherein the DNA fragment having promoter activity is linked at the 3 end to a second DNA fragment having the nucleotide sequence of positions 174 to 204 of SEQ ID NO: 9 which is linked at its 3 end to a polynucleotide coding for the membrane protein.

5. The microorganism of claim 1, wherein the DNA fragment having promoter activity is linked at the 5 end to a DNA fragment having the nucleotide sequence of positions 1 to 138 of SEQ ID NO: 9.

6. The microorganism of claim 1, wherein the membrane protein has the activity of an amino acid transporter.

7. The microorganism of claim 6, wherein the protein having the activity of an amino acid transporter is a protein having the activity of an amino acid exporter.

8. The microorganism of claim 7, wherein the protein having the activity of an amino acid exporter has an amino acid sequence which is at least 90% identical to the sequence of SEQ ID NO: 2.

9. The microorganism of claim 8, wherein the protein having the activity of an amino acid exporter has an amino acid sequence, which is at least 95% identical to the sequence of SEQ ID NO: 2.

10. The microorganism of claim 9, wherein the protein having the activity of an amino acid exporter comprises the amino acid sequence of SEQ ID NO: 2, and/or is encoded by a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1.

11. The microorganism of claim 1, wherein the DNA fragment having promoter activity is present in the chromosome of the microorganism, or, alternatively, the DNA fragment having promoter activity is located on an extrachromosomal replicating vector.

12. The microorganism of claim 1, wherein said microorganism produces L-threonine, L-homoserine, L histidine, L-lysine, L-tryptophan, L valine, L-leucine, and L-isoleucine.

13. The microorganism of claim 4, wherein the DNA fragment having promoter activity is linked at the 5 end to a DNA fragment having the nucleotide sequence of positions 1 to 138 of SEQ ID NO: 9.

14. The microorganism of claim 13, wherein the membrane protein has the activity of an amino acid exporter and comprises the amino acid sequence of SEQ ID NO: 2, and/or is encoded by a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1.

15. A process for preparing L amino acids or feedstuff additives containing L-amino acids, the process comprising: (i) fermenting the microorganism of claim 1 in a medium; (ii) enriching the L-amino acid in the fermentation medium and/or in the cell; and optionally (iii) isolating the L-amino acid.

16. A DNA fragment having promoter activity that is functionally linked to a polynucleotide coding for a membrane protein, wherein the DNA fragment having promoter activity comprises SEQ ID NO.:8.

Description

BRIEF DESCRIPTION OF THE FIGURES

[0244] FIG. 1: Map of expression plasmid pMW219_P(allel)rhtC.

[0245] FIG. 2: Map of gene replacement vector pKO3rhtC-Pmut.

[0246] The base pair numbers stated are approximate values obtained in the context of reproducibility of measurements. The abbreviations and designations used have the following meaning: [0247] BssHII: Cleavage site for the restriction enzyme BssHII [0248] HindIII: Cleavage site for the restriction enzyme HindIII [0249] KpnI: Cleavage site for the restriction enzyme KpnI [0250] NcoI: Cleavage site for the restriction enzyme NcoI [0251] SpeI: Cleavage site for the restriction enzyme SpeI [0252] XbaI: Cleavage site for the restriction enzyme XbaI [0253] Cm: Chloramphenicol resistance gene [0254] Km: Kanamycin resistance gene [0255] lacZ: 5 part of the lacZ gene fragment [0256] lacZ: 3 part of the lacZ gene fragment [0257] oriC: Replication origin [0258] rhtC: Gene for the threonine exporter protein RhtC [0259] sacB: sacB gene [0260] repA: Gene for the replication protein RepA

[0261] Further details can be found in the examples.

[0262] In the following, the invention is illustrated by non-limiting examples and exemplifying embodiments.

EXAMPLES

[0263] The following microorganism was deposited at the German Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig, Germany) as a pure culture on 29 Apr. 1999, wherein deposition was converted into deposition in accordance with the Budapest Treaty on 31 Jul. 2000: [0264] Escherichia coli strain DM1300 as DSM 12791.

[0265] The following microorganism was deposited at the German Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty on 15 Jul. 2004: [0266] Escherichia coli strain MG442 as DSM 16574.

[0267] The minimal media (M9) and complete media (LB) for E. coli are described by J. H. Miller (A short course in bacterial genetics (1992), Cold Spring Harbor Laboratory Press). Isolation of plasmid DNA from E. coli and all the techniques for restriction, Klenow treatment and alkaline phosphatase treatment were performed in accordance with Sambrook et al. (Molecular cloning. A laboratory manual (1989), Cold Spring Harbor Laboratory Press). The transformation of E. coli, unless stated otherwise, was performed in accordance with Chung et al. (Proceedings of the National Academy of Sciences of the United States of America, USA (1989) 86: 2172-2175). The incubation temperature when preparing strains and transformants is 37 C.

Example 1: Preparation of Escherichia coli K-12 Strain DM1180

[0268] DM1180 was prepared in several steps starting with strain VL334 which was purchased as CMIM B-1641 from the Russian National Collection of Industrial Microorganisms (VKPM, Moscow, Russia). The strain CMIM B-1641 is described in U.S. Pat. No. 4,278,765.

[0269] The incubation temperature during preparation of the strain was 37 C. In the case of the gene exchange process according to Hamilton et al., temperatures of 30 C. and 44 C. were used.

1. Transduction of the Scr Gene Locus

[0270] The bacteriophage P1 was multiplied in E. coli wild type strain H155 (Smith and Parsell, Journal of General Microbiology (1975) 87: 129-140) and E. coli K12 strain MG1655 (Guyer et al., Cold Spring Harbor Symp., Quant. Biology (1981) 45: 135-140) was infected with the isolated phage lysate. MG1655 transductants which could use sucrose as a source of carbon were obtained by plating onto sucrose-containing (2 g/l) minimal medium. A P1 lysate was again prepared from a selected clone, called MG1655scr+, and the strain VL334 was transduced with the phage lysate. The strain VL334scr+ was obtained after selection on sucrose-containing minimal medium.

2. Deletion of the Chromosomal Tdh Gene by Targeted Gene Exchange

[0271] To incorporate a deletion in the tdh gene, the method described by Hamilton et al. (Journal of Bacteriology (1989) 171: 4617-4622) was used, this being based on use of the plasmid pMAK705 with a temperature-sensitive replicon. The plasmid pDR121 (Ravnikar and Somerville, Journal of Bacteriology (1987) 169: 4716-4721) contains a 3.7 kilo base pair (kbp) large DNA fragment from E. coli, on which the tdh gene is encoded. To produce deletion of the tdh gene region, pDR121 was cleaved with restriction enzymes Clal and EcoRV and the isolated 5 kbp large DNA fragment was ligated after treatment with the Klenow enzyme. The ligation mixture was transformed in E. coli strain DH5 and plasmid-containing cells were selected on LB agar to which 50 g/ml of ampicillin had been added.

[0272] Successful deletion of the tdh gene could be demonstrated by plasmid DNA isolation and control cleavage with EcoRI. The 1.7 kbp large EcoRI fragment was isolated and ligated with the plasmid pMAK705, which had been partly digested with EcoRI. The ligation mixture was transformed in DH5 and plasmid-containing cells were selected on LB agar to which 20 g/mlof chloramphenicol had been added. Successful cloning was demonstrated by plasmid DNA isolation and cleavage with EcoRI. The pMAK705 derivative produced was called pDM32.

[0273] For gene exchange, VL334scr+ was transformed with the plasmid pDM32. Exchange of the chromosomal tdh gene for the plasmid encoded deletion construct was performed using the selection process described by Hamilton et al. and was verified by standard PCR methods (Innis et al. (1990), PCR protocols. A guide to methods and Applications, Academic Press) using the following oligonucleotide primers:

TABLE-US-00001 Tdh1: (SEQIDNO:15) 5-TCGCGACCTATAAGTTTGGG-3 Tdh2: (SEQIDNO:16) 5-AATACCAGCCCTTGTTCGTG-3

[0274] This strain was called VL334scr+tdh.

3. Construction of the Plasmid pYN7parB

[0275] The plasmid pYN7 was isolated from the strain VL334/pYN7, which is deposited as CMIM B-1684 (U.S. Pat. No. 4,278,765) at the Russian National Collection of Industrial Microorganisms (VKPM, Moscow, Russia).

[0276] A 6.25 kbp long DNA fragment, which contained the thrABC-operon, was isolated from plasmid pYN7 with the aid of the restriction enzymes HindIII and BamHI by preparative agarose gel-electrophoresis.

[0277] The plasmid pBR322 (Bolivar et al., Gene 2, 95-113 (1977)) was purchased from Pharmacia Biotech Co. (Uppsala, Sweden) and treated with the restriction enzymes HindIII and BamHI. The 4.3 kbp long DNA fragment was isolated by preparative agarose gel electrophoresis. The two DNA fragments were mixed, treated with T4-DNA ligase and the strain DH5 was transformed with the ligation mixture. After selection on ampicillin-containing (50 g/ml) LB agar transformants were obtained, which contained a plasmid, the structure of which corresponded to that of the plasmid pYN7.

[0278] The plasmid was isolated from a transformant, partly cleaved with the enzyme EcoRI and fully cleaved with the enzyme HindIII and ligated with the isolated parB gene region. For this, the plasmid pKG1022 (Gerdes, Biotechnology (1988) 6:1402-1405) was cleaved with the enzymes EcoRI and HindIII, the cleavage batch was separated out in 1% agarose gel and the 629 bp large parB fragment was isolated with the aid of the QIAquick Gel Extraction Kit (QIAGEN GmbH, Hilden, Germany). The ligation mixture was used to transform strain VL334scr+tdh. Selection of pYN7parB-containing cells was performed in LB agar to which had been added 50 g/ml of ampicillin. Successful cloning of the parB gene region could be demonstrated by plasmid DNA isolation and control cleavage with EcoRI and HindIII.

4. Isolation of Threonine-Resistant Spontaneous Mutants

[0279] Starting with strain VL334scr+tdh/pYN7parB, spontaneous mutants were isolated on threonine-containing (60 g/l) minimal agar. Selected L-threonine-resistant individual colonies were further multiplied on minimal medium with the following composition: 3.5 g/l Na.sub.2HPO.sub.4*2H.sub.2O, 1.5 g/l KH.sub.2PO.sub.4, 1 g/l NH.sub.4Cl, 0.1 g/l MgSO.sub.4*7H.sub.2O, 2 g/l glucose, 20 g/l agar, 50 mg/l ampicillin.

[0280] A mutant called DM1180 was resistant to 60 g/l of L-threonine after this step, but in further experiments not stable in resistance and productivity. Moreover, no higher L-threonine resistance level could be achieved. DM1180 has many mutations that lead to resistance to -amino--hydrovaleric acid, a mutation in the ilvA gene which causes an optionally partial and compensable L-isoleucine requirement, and a mutation in the tdh gene which causes threonine hydrogenase to be attenuated or switched off, and genes for using sucrose and has one resistance gene to ampicillin. The mutant strain DM1180 obtained was investigated by sequencing.

Example 2: Preparation of Escherichia coli K-12 Strain DM1300

[0281] In order to maintain stable strains in the further course of strain development, threonine resistance was decoupled from threonine synthesis by excluding the plasmid to strengthen threonine biosynthesis.

[0282] After incubation in antibiotic-free complete medium, plasmid-free derivatives were isolated from DM1180.

[0283] On appropriately supplemented minimal agar, those clones were then selected which exhibited an isoleucine and threonine auxotrophy and which were able to multiply on minimal medium which contained 60 g/l of L-threonine. One of these clones was transformed with the plasmid pYN7parB; selection of plasmid-containing cells was performed on ampicillin-containing complete medium. Then, isolation of the transformants took place on minimal medium with the following composition: 3.5 g/l Na.sub.2HPO.sub.4*2H.sub.2O, 1.5 g/l KH.sub.2PO.sub.4, 1 g/l NH.sub.4Cl, 0.1 g/l MgSO.sub.4*7H.sub.2O, 2 g/l glucose, 20 g/l agar, 50 mg/l ampicillin. Mutants with an increased threonine-resistance were then isolated on L-threonine-containing (80 g/l) minimal agar.

[0284] A mutant isolated in this way was called DM1300. This new strain is a L-methionine prototroph having resistance to at least 80 g/l of L-threonine.

Example 3: Threonine Production by Fed Batch Fermentation Using the Strains Escherichia coli DM1180 and DM1300

[0285] In order to compare capacity of the fermentative production of L-threonine an individual colony of the strains Escherichia coli DM1180 and DM1300 was multiplied on minimal agar with the following composition: 3.5 g/l Na.sub.2HPO.sub.4*2H.sub.2O, 1.5 g/l KH.sub.2PO.sub.4, 1 g/l NH.sub.4Cl, 0.1 g/l MgSO.sub.4*7H.sub.2O, 2 g/l sucrose, 20 g/l agar, 50 mg/l ampicillin. The culture was incubated for 5 days at 37 C. 10 ml of preliminary culture with the following composition: 2 g/l yeast extract, 10 g/l (NH.sub.4).sub.2SO.sub.4, 1 g/l KH.sub.2PO.sub.4, 0.5 g/l MgSO.sub.4*7H.sub.2O, 15 g/l CaCO.sub.3, 20 g/l sucrose, 50 mg/l ampicillin, was inoculated with an inoculum and incubated for 16 hours at 37 C. and 180 rpm in an Infors HT Multitron standard incubator shaker from Infors AG (Bottmingen, Switzerland). A volume of 0.5 ml of this first liquid preliminary culture was transferred into 1402 g of preliminary culture medium M1-439 (Table 2). Batch fermentation was performed in 2 l stirred reactor fermenters from Sartorius (Sartorius Stedim Systems GmbH, Guxhagen, Germany, Model Biostat B). Preliminary culture medium M1-439 contained the constituents listed in table 2. The culture was cultivated for 14.25 hours at a temperature of 37 C., with volume-specific aeration of 0.71 wm, an oxygen partial pressure of 10% of air saturation and a pH of 7.0.

[0286] A volume of 0.5 ml of this second liquid preliminary culture was transferred into 1402 g of preliminary culture medium A1-80 (Table 3). Batch fermentation was performed in 2 l stirred reactor fermenters from Sartorius (Sartorius Stedim Systems GmbH, Guxhagen, Germany, Model Biostat B). Preliminary culture medium A1-80 contained the constituents listed in table 3. The culture was cultivated for 9.25 hours at a temperature of 37 C., with volume-specific aeration of 0.71 wm, an oxygen partial pressure of 10% of air saturation and a pH of 7.0.

[0287] In order to inoculate 1223 g of main culture medium M1-246 (Table 4), which was contained in 2 l stirred reactor fermenters from Sartorius (Sartorius Stedim Systems GmbH, Guxhagen, Germany, Model Biostat B), 179 g of the third liquid preliminary culture in A1-80 medium were added. Main culture mediumM1-246 contained the constituents listed in table 4. The culture was cultivated at a temperature of 37 C., with aeration of 1 l/min., a minimum stirrer speed of 800 rpm and a pH of 7.0 and an oxygen partial pressure of 10% of air saturation, until reaching a residual sugar concentration of 5 g/l. The culture was then cultivated for a further 30 hours at a temperature of 37 C., an oxygen partial pressure of 10% of air saturation and a pH of 7.0. During this time, 665 g of a sucrose solution with a concentration of 550.0 g/kg were added.

[0288] At different times, the optical density (OD) was determined with a photometer of the DR 2800 type from Hach Lange GmbH (Berlin, Germany) at a measured wavelength of 660 nm and the concentration of L-threonine formed was determined using a SYKAM S435 amino acid analyser from SYKAM Vertriebs GmbH (Frstenfeldbruck, Germany) by ion-exchange chromatography and detection by post-column reaction with ninhydrin.

[0289] The results of this fermentations are given in table 1.

TABLE-US-00002 TABLE 1 Threonine Cell density Yield Strain g/l OD.sub.660 % DM1180 93.9 35.9 43.1 DM1300 107.2 33.8 47.2

[0290] After 47.5 hours, an L-threonine concentration of 107.2 g/l was detected in the final sample from DM1300 fermentation in comparison to 93.9 g/l in the final sample from DM1180 fermentation.

TABLE-US-00003 TABLE 2 Composition of medium M1-439 Component Concentration (per kg) Sucrose 33.6 g Yeast extract 4.8 g (NH.sub.4).sub.2SO.sub.4 4.8 g K.sub.2HPO.sub.4 1.92 g MgSO.sub.47H.sub.2O 0.38 g FeSO.sub.47H.sub.2O 19 mg MnSO.sub.4H.sub.2O 12 mg Ampicillin 50 mg Structol 0.6 g

TABLE-US-00004 TABLE 3 Composition of medium A1-80 Component Concentration (per kg) Sucrose 33.6 g Yeast extract 8.0 g (NH.sub.4).sub.2SO.sub.4 4.8 g K.sub.2HPO.sub.4 1.92 g MgSO.sub.47H.sub.2O 0.38 g FeSO.sub.47H.sub.2O 19 mg MnSO.sub.4H.sub.2O 12 mg Structol 0.6 g

TABLE-US-00005 TABLE 4 Composition of medium M1-246 Component Concentration (per kg) Sucrose 33.6 g Corn steep liquor 10.0 g (NH.sub.4).sub.2SO.sub.4 8.2 g K.sub.2HPO.sub.4 1.00 g MgSO.sub.47H.sub.2O 0.38 g FeSO.sub.47H.sub.2O 20 mg MnSO.sub.4H.sub.2O 12 mg Structol 0.1 g

Example 4: Sequencing

[0291] The mutant strain DM1300 obtained is investigated by sequencing and the genome sequence is compared to the sequence of DM1180

[0292] In this way a point mutation could be identified in the probable promoter area of the rhtC gene. The sequence of the wildtype promoter region of rhtC (PrhtC WT) is shown in SEQ ID NO: 7. The corresponding sequence of the mutated promoter region of rhtC (PrhtC allele) is shown in SEQ ID NO: 8.

Example 5: Constructing the Expression Plasmids pMW219_P(allel)rhtC and pMW219_P(WT)rhtC

[0293] The E. coli K12 rhtC gene including the upstream region was amplified using the polymerase chain reaction (PCR) and synthetic oligonucleotides. PCR primers were synthesized (Eurofins Genomics GmbH, Ebersberg, Germany) on the basis of the nucleotide sequence of the rhtC gene in E. coli K-12 MG1655 (Accession Number NC_000913.3 (Region: 4007757-4008377), Blattner et al. (Science 277:1453-1474 (1997)):

TABLE-US-00006 PrhtC-1: (SEQIDNO:17) 5-GCATGTTGATGGCGATGACG-3 PrhtC-2: (SEQIDNO:18) 5-CTGTTAGCATCGGCGAGGCA-3.

[0294] The E. coli K-12 MG1655 and the E. coli DM1300 chromosomal DNA used for PCR was isolated using QIAGEN DNeasy Blood & Tissue Kit (QIAGEN GmbH, Hilden, Germany) in accordance with the manufacturers instructions. A DNA fragment of approx. 800 bp in size (SEQ ID NO: 12) was amplified under standard PCR conditions (Innis et al. (1990) PCR Protocols. A Guide to Methods and Applications, Academic Press) using Phusion DNA polymerase (New England Biolabs GmbH, Frankfurt, Germany) and the specific primers.

[0295] The amplified PrhtC fragments were cleaned up with QIAquick PCR Purification Kit (QIAGEN GmbH, Hilden, Germany) and each was then ligated to the low-copy vector pMW219 (Nippon Gene, Toyama, Japan) which has been digested with the enzyme Smal. The E. coli strain DH5 (Grant et al.; Proceedings of the National Academy of Sciences USA 87:4645-4649 (1990)) was transformed with the ligation mixture and plasmid-harboring cells were selected on LB agar containing 50 g of kanamycin/ml.

[0296] The fact that cloning has been successful can be demonstrated, after the plasmid DNA has been isolated, by performing a control cleavage using the enzymes KpnI/Hindlll or BssHII. The plasmids are designated pMW219_P(allel)rhtC (FIG. 1) and pMW219_P(WT)rhtC.

Example 6: Preparing L-Threonine Using the Strains MG442/pMW219_P(allel)rhtC or pMW219_P(WT)rhtC

[0297] The L-threonine-producing E. coli strain MG442 is described in the patent specification U.S. Pat. No. 4,278,765 and is deposited in the Russian national collection of industrial microorganisms (VKPM, Moscow, Russia) as CMIM B-1628 and at the German Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig, Germany) in accordance with the Budapest Treaty as DSM 16574. To test the effect of increasing the copy number of P(allel)rhtC and P(WT)rhtC the strain MG442 was transformed with the expression plasmids pMW219_P(allel)rhtC or pMW219_P(WT)rhtC described in example 5, and with the vector pMW219, and plasmid-harboring cells were selected on LB agar containing 50 g of kanamycin/ml. This resulted in the strains MG442/pMW219_P(allel)rhtC, MG442/pMW219_P(WT)rhtC and MG442/pMW219. Selected individual colonies were then propagated further on minimal medium having the following composition: 3.5 g of Na.sub.2HPO.sub.4.2H.sub.2O/l, 1.5 g of KH.sub.2PO.sub.4/l, 1 g of NH.sub.4Cl/l, 0.1 g of MgSO.sub.4.7H.sub.2O/l, 2 g of glucose/l, 20 g of agar/l, 50 mg of kanamycin/l. The formation of L-threonine was checked in 10 ml batch cultures which were contained in 100 ml Erlenmeyer flasks. For this, a 10 ml preculture medium of the following composition: 2 g of yeast extract/l, 10 g of (NH.sub.4).sub.2SO.sub.4/l, 1 g of KH.sub.2PO.sub.4/l, 0.5 g of MgSO.sub.4.7H.sub.2O/l, 15 g of CaCO.sub.3/l, 20 g of glucose/l, 50 mg of kanamycin/l, was inoculated and incubated, at 37 C. and 180 rpm for 16 hours, on an Infors HT Multitron standard incubator shaker from Infors AG (Bottmingen, Switzerland). In each case 250 l of this preliminary culture were inoculated over into 10 ml of production medium (25 g of (NH.sub.4).sub.2SO.sub.4/l, 2 g of KH.sub.2PO.sub.4/l, 1 g of MgSO.sub.4.7H.sub.2O/l, 0.03 g of FeSO.sub.4.7H.sub.2O/l, 0.018 g of MnSO.sub.4*1H.sub.2O/l, 30 g of CaCO.sub.3/l, 20 g of glucose/l, 50 mg of kanamycin/l) and incubated at 37 C. for 48 hours. After the incubation, the optical density (OD) of the culture suspension was determined at a measurement wavelength of 660 nm using the GENios plate reader from Tecan Group AG (Mnnedorf, Switzerland). A SYKAM S435 amino acid analyser from SYKAM Vertriebs GmbH (Frstenfeldbruck, Germany) was then used to determine, by means of ion exchange chromatography and post-column reaction involving ninhydrin detection, the concentration of the resulting L-threonine in the culture supernatant, which has been sterilized by filtration. The results of the experiment are shown in table 5.

TABLE-US-00007 TABLE 5 OD Strain (660 nm) L-Threonine g/l MG442/pMW219 5.1 1.8 MG442/pMW219_P(WT)rhtC 5.6 4.6 MG442/pMW219_P(allel) rhtC 4.9 5.9

[0298] In the L-threonine-low producer E. coli strain MG442, a significant increase in threonine production is seen through the plasmid-bound overexpression of rhtC, with the allele from DM1300 significantly more than with the WT rhtC.

[0299] The effect is more pronounced than described in EP 1 013 765, example 3. Here an accumulation of 10.2 g/L threonine with strain MG442/pVIC40, pRhtC is described whereas the control strain MG442/pVIC40 (with plasmid-bound increased expression of the thrABC genes) produces 4.9 g/L. The vector pRhtC is a pUC21 derivative that provides a high copy number of the rhtC gene in the bacterial cell, pMW219 derivatives are low copy plasmids. Obviously, a moderate expression level of rhtC is more beneficial for increasing the L-threonine productivity and the point mutation in the probable promoter area of the rhtC gene improves production capacities by further modulating the expression level in a favorable way.

Example 7: Preparing L-Threonine Using the Strains DM1300/pMW219_P(allel)rhtC or pMW219_P(WT)rhtC

[0300] To test the effect of increasing the copy number of the two rhtC gene variants in a high producer strain able to synthesize more than 100 g/L L-threonine, E. coli strain DM1300, described in example 2, was transformed with the expression plasmids pMW219_P(allel)rhtC or pMW219_P(WT)rhtC described in example 5, and with the vector pMW219, and plasmid-harboring cells were selected on LB agar containing 50 g of ampicillin/ml and 50 g of kanamycin/ml. This resulted in the strains DM1300/pMW219_P(allel)rhtC, DM1300/pMW219_P(WT)rhtC and DM1300/pMW219. Selected individual colonies were then propagated further on minimal medium having the following composition: 3.5 g of Na.sub.2HPO.sub.4.2H.sub.2O/l, 1.5 g of KH.sub.2PO.sub.4/l, 1 g of NH.sub.4Cl/l, 0.1 g of MgSO.sub.4.7H.sub.2O/l, 2 g of sucrose/l, 20 g of agar/l, 50 g of ampicillin/ml and 50 mg of kanamycin/l. The formation of L-threonine was checked in 10 ml batch cultures which were contained in 100 ml Erlenmeyer flasks. For this, a 10 ml preculture medium of the following composition: 2 g of yeast extract/l, 10 g of (NH.sub.4).sub.2SO.sub.4/l, 1 g of KH.sub.2PO.sub.4/l, 0.5 g of MgSO.sub.4.7H.sub.2O/l, 15 g of CaCO.sub.3/l, 20 g of sucrose/l, 50 g of ampicillin/ml and 50 mg of kanamycin/l, was inoculated and incubated, at 37 C. and 180 rpm for 16 hours, on an Infors HT Multitron standard incubator shaker from Infors AG (Bottmingen, Switzerland). In each case 250 l of this preliminary culture were inoculated over into 10 ml of production medium (25 g of (NH.sub.4).sub.2SO.sub.4/l, 2 g of KH.sub.2PO.sub.4/l, 1 g of MgSO.sub.4.7H.sub.2O/l, 0.03 g of FeSO.sub.4.7H.sub.2O/l, 0.018 g of MnSO.sub.4*1H.sub.2O/l, 30 g of CaCO.sub.3/l, 20 g of sucrose/l, 50 g of ampicillin/ml and 50 mg of kanamycin/l) and incubated at 37 C. for 48 hours. After the incubation, the optical density (OD) of the culture suspension was determined at a measurement wavelength of 660 nm using the GENios plate reader from Tecan Group AG (Mnnedorf, Switzerland).

[0301] A SYKAM S435 amino acid analyser from SYKAM Vertriebs GmbH (Frstenfeldbruck, Germany) was then used to determine, by means of ion exchange chromatography and post-column reaction involving ninhydrin detection, the concentration of the resulting L-threonine in the culture supernatant, which has been sterilized by filtration. The results of the experiment are shown in table 6.

TABLE-US-00008 TABLE 6 OD Strain (660 nm) L-Threonine g/l DM1180 4.9 8.9 DM1300 5.2 12.6 DM1300/pMW219 4.2 11.2 DM1300/pMW219_P(WT)rhtC 4.3 10.6 DM1300/pMW219_P(allel)rhtC 4.8 10.7

[0302] In general, the expression of a second plasmid decreases L-threonine production in the high producer strain because of the metabolic burden caused by the 2-plasmid system. But interestingly the same overexpression of P(WT)rhtC and P(allel)rhtC (low copy pMW219 derivative as in example 6 with basic producer strain MG442) leads to no improvement or even decrease of L-threonine production in comparison to the empty vector control DM1300/pMW219, the two alleles do not differ here.

[0303] To exclude any plasmid specific effects, we tested a different vector system by expressing the rhtC gene on pSU9parBrhtC, a multi copy derivative with the plasmid stabilizing region parB. This leads to a further reduction of L-threonine production in DM1300: Only 8.2 g/l L-threonine with an OD (660 nm) of 4.8 were produced with the same incubation conditions described above.

[0304] Obviously, too strong expression of rhtC is detrimental in a high producer strain.

Example 8: Construction of the Exchange Vector PKO3_P(allele)rhtC

[0305] The PrhtC allele was amplified using the polymerase chain reaction (PCR) and synthetic oligonucleotides. Based on the nucleotide sequence of the PrhtC gene in E. coli K12 MG1655 (accession number NC_000913.3, range: 4007757-4008377, Blatter et al. (Science 277:1453-1462 (1997)) PCR primers were synthesized (Eurofins Genomics GmbH, Ebersberg, Germany).

Primer Design and PCR

[0306]

TABLE-US-00009 reqQ_1 (SEQIDNO:19) 5 GCCGTTGTCTGGAAGAGAAG3 rht1r (SEQIDNO:20) 5 ATCAATCCACTTCGCCAGAC3

[0307] The chromosomal E. coli DM1300 DNA used for PCR was isolated according to manufacturers data with QIAGEN DNeasy Blood & Tissue Kit (QIAGEN GmbH, Hilden, Germany). With the two specific primers regQ_1 and rht1r the fragment P(allele)RhtC Insert was amplified by PCR under standard PCR conditions (Innis et al.: PCR protocols. A guide to methods and applications, 1990, Academic Press) with the Phusion DNA polymerase (Thermo Fisher Scientific, Wattham, Mass. USA).

[0308] The resulting product P(allele)RhtC_Insert has a length of 1412 bp.

Cloning of the Insert into pKO3

[0309] The amplified P(allele)RhtC_Insert was ligated to the vector pCR-Blunt II-TOPO (Zero Blunt TOPO PCR Cloning Kit, Thermo Fisher Scientific, Wattham, Mass. USA) in accordance with the manufacturers instructions and transformed into the E. coli strain TOP10. Plasmid-harboring cells were selected on LB Agar containing 50 g of kanamycin/ml. After the plasmid DNA has been isolated, the vector was cleaved with the enzyme NcoI and, after the cleavage has been checked in a 0.8% agarose gel, designated pCRBI-rhtC-Pmut.

[0310] The vector pCRBI-rhtC-Pmut was then cleaved with the enzymes XbaI and SpeI and the rhtC fragment was separated in a 0.8% agarose gel; it was then isolated from the gel (QIAguick Gel Extraction Kit, QIAGEN GmbH, Hilden, Germany) and ligated to the gene replacement vector pKO3 (Link et al, 1997, J. Bacteriol., 179, 20, 6228-6237).

[0311] The vector pKO3 was also cut with XbaI and at the same time dephosphorylated with alkaline Phosphatase. The digestion was purified by QIAguick PCR Purification Kit (QIAGEN GmbH, Hilden, Germany).

[0312] For ligation, vector and insert were ligated in the molar ratio of 1:3 with T4 ligase. Chemically competent cells of the E. coli strain NEB5alpha were transformed with 1 ml of the ligation mix and plated on LB agar with 20 mg/l Chloramphenicol. The plates were incubated 40 h at 30 C.

Control of Plasmids Successful cloning is demonstrated by digesting the plasmid pKO3rhtC-Pmut with the restriction enzyme NcoI.

[0313] 10 colonies were picked and cultivated overnight in 10 ml LB+20 mg/l Chloramphenicol at 30 C./180 rpm.

[0314] The next day 2 ml of the cultures were centrifuged and DNA preparations were made from the pellets. The ligation product can contain the insert in two orientations. Whether and in what orientation it is present can be checked with an NcoI-restriction digestion: [0315] Insert in orientation A: fragments 1250 bp and 5912 BP [0316] Insert in orientation B: fragments 930 BP and 6232 bp [0317] pKO3 empty vector: Fragment 5681 bp (linearized)

[0318] The 10 plasmid clones were cut with NcoI and the products were separated on a 0.8% TAE agarose gel. A clone that contains the insert in orientation A was selected and referred to as pKO3rhtC-Pmut.

[0319] The insert of this clone was sequenced with the primers pKO3-L and PKO3-R.

TABLE-US-00010 PKO3-L (SEQIDNO:21) 5 AGGGCAGGGTCGTTAAATAGC3 PKO3-R (SEQIDNO:22) 5 TTAATGCGCCGCTACAGGGCG3

[0320] The DNA sequence of the amplified fragment P(allele) RhtC_Insert was determined using the primer pKO3-L and PKO3-R (Eurofins Genomics GmbH, Ebersberg, Germany). The expected sequence of the PrhtC allele has been confirmed and the cloned fragment is shown in SEQ ID NO: 14.

[0321] The created exchange vector pKO3rhtC-Pmut is shown in FIG. 2.

Example 9: Exchange of the rhtC Wild Type Promoter of MG442 Against the PrhtC Allele

[0322] To introduce the PrhtC allele into the chromosome of E. coli L-threonine production strains the following method can be applied and is described exemplary with the location-specific mutagenesis of PrhtC in the E. coli strain MG442 (example 6).

[0323] For the exchange of the chromosomal rhtC promoter against the plasmid-encoded mutation construct, MG442 was transformed with the plasmid pKO3rhtC-Pmut. The gene exchange is performed using the selection procedure described by Link et al. (Journal of Bacteriology 179:6228-6237 (1997)) and has been verified by sequencing.

[0324] After the exchange, the PrhtC allele in MG442 shows the in SEQ ID NO: 7 represented form (sequencing by Eurofins Genomics GmbH, Ebersberg, Germany). The obtained strain is referred to as MG442_P(allele)RhtC.

Example 10: Preparing L-Threonine Using the Strain MG442_P(Allele)RhtC

[0325] Selected individual colonies of MG442_P(allele)RhtC and MG442 can be propagated on minimal medium having the following composition: 3.5 g of Na.sub.2HPO.sub.4.2H.sub.2O/l, 1.5 g of KH.sub.2PO.sub.4/l, 1 g of NH.sub.4Cl/l, 0.1 g of MgSO.sub.4.7H.sub.2O/l, 2 g of glucose/l, 20 g of agar/l. The formation of L-threonine can be checked in 10 ml batch cultures which are contained in 100 ml Erlenmeyer flasks. For this, a 10 ml preculture medium of the following composition: 2 g of yeast extract/l, 10 g of (NH.sub.4).sub.2SO.sub.4/l, 1 g of KH.sub.2PO.sub.4/l, 0.5 g of MgSO.sub.4.7H.sub.2O/l, 15 g of CaCO.sub.3/l, 20 g of glucose/l, can be inoculated and incubated, at 37 C. and 180 rpm for 16 hours, on an Infors HT Multitron standard incubator shaker from Infors AG (Bottmingen, Switzerland). In each case 250 l of this preliminary culture can be inoculated into 10 ml of production medium (25 g of (NH.sub.4).sub.2SO.sub.4/l, 2 g of KH.sub.2PO.sub.4/l, 1 g of MgSO.sub.4.7H.sub.2O/l, 0.03 g of FeSO.sub.4.7H.sub.2O/l, 0.018 g of MnSO.sub.4*1H.sub.2O/l, 30 g of CaCO.sub.3/l, 20 g of glucose/l) and incubated at 37 C. for 48 hours. After the incubation, the optical density (OD) of the culture suspension can be determined at a measurement wavelength of 660 nm using the GENios plate reader from Tecan Group AG (Mnnedorf, Switzerland).

[0326] A SYKAM S435 amino acid analyser from SYKAM Vertriebs GmbH (Frstenfeldbruck, Germany) then can be used to determine, by means of ion exchange chromatography and post-column reaction involving ninhydrin detection, the concentration of the resulting L-threonine in the culture supernatant, which has been sterilized by filtration.

[0327] All references cited herein are fully incorporated by reference. Having now fully described the invention, it will be understood by those of skilled in the art that the invention may be practiced within a wide and equivalent range of conditions, parameters and the like, without affecting the spirit or scope of the invention or any embodiment thereof.

[0328] The following sequences are contained in the sequence protocol:

TABLE-US-00011 SEQ ID No.: Description: 1 Nucleotide sequence of the Escherichia coli rhtC gene 2 Amino acid sequence of the Escherichia coli RhtC protein 3 Nucleotide sequence of the Escherichia coli thrA gene 4 Amino acid sequence of the Escherichia coli ThrA protein 5 Nucleotide sequence of the Serratia marcescens thrA gene 6 Amino acid sequence of the Serratia marcescens ThrA protein 7 Nucleotide sequence of the wild type Escherichia coli rhtC promoter 8 Nucleotide sequence of the mutated Escherichia coli rhtC promoter 9 Nucleotide sequence of the wild type Escherichia coli rhtC promoter with naturally occurring 5-flanking region 10 Nucleotide sequence of the rhtC gene of Escherichia coli, including the upstream and downstream nucleotide sequences 11 Amino acid sequence of the Escherichia coli RhtC protein 12 Nucleotide sequence of the DNA sequence 0.8 kbp long containing the rhtC gene (here with mutation) 13 Amino acid sequence of the RhtC protein 14 Nucleotide sequence of the DNA sequence 1.4 kbp long containing the allelic rhtC exchange fragment 15 Nucleotide sequence of the primer Tdh1 16 Nucleotide sequence of the primer Tdh2 17 Nucleotide sequence of the primer PrhtC-1 18 Nucleotide sequence of the primer PrhtC-2 19 Nucleotide sequence of the primer reqQ_1 20 Nucleotide sequence of the primer rht1r 21 Nucleotide sequence of the primer PKO3-L 22 Nucleotide sequence of the primer PKO3-R