SIMPLE SINGLE-STEP POROUS POLYMER MONOLITH FOR DNA EXTRACTION
20200078764 ยท 2020-03-12
Inventors
Cpc classification
B01J20/28042
PERFORMING OPERATIONS; TRANSPORTING
B01J20/265
PERFORMING OPERATIONS; TRANSPORTING
International classification
B01J20/28
PERFORMING OPERATIONS; TRANSPORTING
Abstract
A method and microfluidic device with a porous polymer monolith in a channel of the device with capture affinity element (such as an oligonucleotide complementary to a DNA target from the KPC antibiotic resistance gene) on the monolith surface.
Claims
1. A method for creating a monolith in a void space of a microfluidic device, comprising: filling the internal void spaces of the monolith with a polymerization mixture comprising one or more photopolymerizable monomers, a photo initiator, and a capture affinity element; masking microfluidic device to prevent light from reaching the internal void spaces with the exception of a gap to allow light to reach a preselected portion of the void spaces; exposing the microfluidic device to light to polymerize polymerization solution in the preselected portion to form in the preselected portion a porous polymer monolith with capture affinity element on a polymer monolith surface, and with the polymer monolith anchored on a device surface within the preselected portion; rinsing unpolymerized polymerization solution from the internal void spaces.
2. The method of claim 1 wherein the capture affinity element is a capture oligonucleotide.
3. The method of claim 1 wherein the polymerizable mixture comprises one or more photopolymerizable acrylate monomers.
4. The method of claim 1 wherein the microfluidic device is exposed to ultra-violet light.
5. The method of claim 1 wherein the filling, masking, exposing, and rinsing steps are conducted once in a single step.
6. The method of claim 3 wherein the acrylate monomers are one or more from the group of PEGDA and EDMA.
7. The method of claim 2 wherein the capture oligonucleotide is complementary to a target DNA sequence.
8. The method of claim 2 wherein the capture oligonucleotide is complementary to a target from a gene from a microorganism.
9. The method of claim 2 wherein the capture oligonucleotide is complementary to a target from a gene from DNA of a bacterium.
10. The method of claim 2 wherein the capture oligonucleotide is complementary to a target from an antibiotic resistance gene.
11. The method of claim 10 wherein the capture oligonucleotide is complementary to portion of the KPC gene, or NDM gene, or VIM gene.
12. The method of claim 1 wherein the microfluidic device is of polypropylene.
13. The method of claim 1 wherein the preselected void space is a channel.
14. A microfluidic device comprising: a porous polymer monolith in a preselected void within the device with capture oligonucleotide on a surface, and anchored to a surface in the preselected void.
15. The device of claim 15 wherein the porous polymer is an acrylate polymer.
16. A method for immobilizing a molecule including a DNA target: directing a fluid containing the molecule into a channel of a microfluidic device, and through a porous polymer monolith anchored in the channel and with capture oligonucleotide complementary to the DNA target on a monolith surface.
17. The method of claim 16 wherein the porous polymer is an acrylate polymer.
18. A method as in claim 16 for PCR analysis additionally comprising capture for purification or enrichment, denaturation, PCR and detection.
19. A method as in claim 16 additionally comprising capture for purification or enrichment, fluorescent labeling, denaturation, and detection by single-particle counting.
20. A method as in claim 16 for detecting presence of a molecule with a DNA target in a fluid comprising: directing fluid to be tested for the molecule into a channel of a microfluidic device, and through a acrylate polymer monolith anchored in the channel and with capture oligonucleotide complementary to the DNA target on a monolith surface to immobilize the molecule on the monolith surface, fluorescent labeling, eluting the labeled molecule from the monolith surface, and passing the labeled molecule through a channel to a detector for quantitation.
21. A method as in claim 16 for detecting presence of a molecule with a DNA target in a fluid comprising: directing fluid to be tested for the molecule into a channel of a microfluidic device, and through a acrylate polymer monolith anchored in the channel and with capture oligonucleotide complementary to the DNA target on a monolith surface to immobilize the molecule on the monolith surface, capture for purification or enrichment, denaturation, PCR and detection.
22. A method as in claim 16 for detecting presence of a molecule with a DNA target in a fluid comprising: directing fluid to be tested for the molecule into a channel of a microfluidic device, and through an acrylate polymer monolith anchored in the channel and with capture oligonucleotide complementary to the DNA target on a monolith surface to immobilize the molecule on the monolith surface, capture for purification or enrichment, fluorescent labeling, denaturation, detection by single-particle counting.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
DETAILED DESCRIPTION
[0041] Materials and Methods
[0042] 1 Chemicals
[0043] Tris hydrochloride, Tris base, sulfuric acid, sodium hydroxide, sodium dodecylsulfate, sodium bicarbonate, ethylenediaminetetraacetic acid (EDTA), sodium chloride, magnesium chloride, sodium periodate, glycidyl methacrylate (GMA), ethylene dimethacrylate (EDMA), poly(ethyleneglycol) diacrylate (PEGDA, MW 575), 2-hydroxyethyl methacrylate (HEMA), 1-propanol, n-dodecanol, 1,4-butanediol, benzoin methyl ether (BME), guanidine hydrochloride, sodium cyanoborohydride, 2-propanol and ethanol were obtained from Sigma-Aldrich (St. Louis, Mo.), Merck (Darmstadt, Germany) or Fisher Scientific (Pittsburgh, Pa.). SYBR Green II and Quant-iT OliGreen were obtained from ThermoFisher Scientific (Waltham, Mass.). All chemicals were analytical grade purity or higher.
[0044] 2. Sequence Design Methods
[0045] For extracting and detecting DNA sequences associated with antibiotic resistance, the KPC gene was selected. The capture sequence was designed by querying GenBank (National Center for Biotechnology Information, NIH) for coding sequences for the KPC gene. At least 50 sequences were downloaded and analyzed using the MUSCLE algorithm for multiple sequence alignment in MEGA 5.1 (Molecular Evolutionary Genetics Analysis). A consensus sequence for the gene was constructed and used for capture and labeling probe sequence design using PrimerQuest (Integrated DNA Technologies, Coralville, Iowa). The putative capture sequence was evaluated for optimum theoretical sensitivity and specificity using BLAST (National Center for Biotechnology Information, NIH). The oligonucleotides used in these experiments (see Table 1) were obtained from Eurofins Scientific (Louisville, Ky.)
[0046] 3. Device and Monolith Fabrication
[0047] Fluidic microdevices with the design shown in
[0048] Monoliths fabricated by the single-step method were prepared by filling a device with polymerization mixture containing 18.5% poly(ethylene glycol) diacrylate (PEGDA), 18.5% ethylene glycol dimethylacrylate (EDMA), 14% 2-propanol, 41.5% n-dodecanol, 4.5% 500 pM acrd-KPC (in 1:1 2-propanol:water) and 3% BME photoinitiator (all w/w). The device was masked using black tape leaving a 5 mm gap close to the device outlet and exposed to UV light using a SunRay 600 UV lamp (Uvitron International, West Springfield, Mass.) for 12 min at 100 mW/cm.sup.2. After the polymerization step, the device was rinsed with 2-propanol for 15 min and water for 10 min. A photograph of a finished device after monolith formation is given in
[0049] For comparative Schiff-base immobilization of DNA, the monolith was fabricated as described in [18]. In brief, the device was filled with a polymerization mixture containing 24% GMA, 16% PEGDA, 40% 1-propanol and 20% 1,4-butanediol with 3% BME photoinitiator (all w/w). The microfluidic device was exposed to UV light as described above, and rinsed with 2-propanol and water. The monolith was treated with sulfuric acid (0.5 M, 24 h) followed by sodium periodate (0.1 M, 12 h) in order to immobilize amine-terminated capture probe (NH.sub.2-KPC).
[0050] Scanning electron microscopy (SEM) images of monoliths and devices were taken using a Phillips XL30 environmental scanning electron microscope (Hillsboro, Oreg.).
[0051] 4. Lysis of Bacteria
[0052] The bacterial lysate was obtained from a bacteria-spiked blood sample following a previously published procedure [19,20]. In brief, 8 mL of whole blood (obtained from healthy human donors via an IRB-approved protocol) was spiked with 100 L of diluted E. coli, producing a concentration of 10.sup.6 CFU/mL; 7 mL of bacteria-spiked blood was then pipetted into a hollow spinning disk. After a sedimentation process with controlled rotation of the disk, the cell-free plasma layer with concentrated bacteria was collected. Bacteria were lysed using 6 M guanidine HCl and 0.5% (w/v) SDS in 10 mM Tris-HCl for 5 minutes at room temperature, and then DNA was extracted using silica-coated superparamagnetic beads (Spherotech, Lake Forest, Ill.). Beads were collected using a magnet, washed with a solution containing 4 M guanidine HCl, 20 mM Tris-HCl and 40% 2-propanol, and eluted into 100 L of hybridization buffer.
[0053] 5. Device Operation and Instrumental Setup
[0054] The setup used is the same setup as in reference [18]. Briefly, monolith-modified devices were connected to a Fluigent (Lowell, Mass.) pressure-driven pumping and valving system. A flow rate of 15 L/min was used, requiring 2 bar of pressure from the pump. Heating of the monolith section of the device was performed with a thermoelectric module (TE-23-1.0-1.3P, TE Technology, Traverse City, Mich.) operated by a temperature controller (TC-48-20, TE Technology) and equipped with control thermistors (MP-2444, TE Technology). Device temperature was approximated from the previously observed difference between the heater thermistor temperature and a thermistor on the opposite side of the device [18]. The confocal laser-induced fluorescence setup probed a point 2 mm beyond the monolith as described in prior publications [18,22] and shown in
[0055] 6 Supplementary Materials and Methods
[0056] DNA Extraction from Bacterial Lysate
[0057] The following solutions were used during DNA extraction; all reagents were acquired from Sigma Aldrich (St. Louis, Mo.). TE buffer: 10 mM Tris-HCl (pH 8.0) and 1 mM EDTA. Lysis solution: 6 M guanidine HCl, 0.5% (w/v) SDS, and 10 mM Tris-HCl. Washing solution: 4 M guanidine HCl, 20 mM Tris-HCl and 40% 2-propanol.
[0058] The filtered bacteria solution was centrifuged at 8000g for 10 minutes, resuspended in 200 L of TE buffer and transferred by pipette to a sterile microcentrifuge tube. Then, 400 L of the lysis solution was mixed with bacterial suspension and vortexed for 30 seconds. The mixture was allowed to incubate for 5 minutes at room temperature. Then, 50 L of silica-coated superparamagnetic beads (Spherotech, Lake Forest, Ill.) were added to the mixture and vortexed for 30 seconds. A magnet was applied to one side of the microcentrifuge tube and the supernatant removed by pipette and discarded. Then 500 L of the wash solution was added and the magnet removed. The tube was vortexed for 15 seconds and allowed to incubate for 1 min at room temperature after being vortexed. The magnet was reapplied and the supernatant removed and discarded. The magnet was then removed and the beads were then allowed to air dry for 5 min. Then, 100 L of hybridization buffer (20 mM Tris-HCl pH 8 with 500 mM NaCl and 50 mM MgCl.sub.2) was added and the mixture vortexed for 2 min and allowed to incubate for 1 additional minute at room temperature. The magnet was reapplied and the supernatant removed for further processing and measurement.
[0059] The extracted DNA was then quantitated by fluorometry. Following the Quant-iT Picogreen assay protocol (ThermoFisher Scientific, Waltham, Mass.) and using a 600 L PCR tube (Axygen, Fisher Scientific, Pittsburgh, Pa.), 5 L of the extracted DNA was mixed with 95 L of TE buffer followed by the addition of 100 L of Picogreen and the mixture briefly vortexed. The tube was then placed in a TBS-300 fluorometer (Turner BioSystems, Sunnyvale, Calif.) and the fluorescence intensity read. The concentration of dsDNA (ng/L) was determined using a calibrated Picogreen standard, which correlates the concentration of dsDNA with fluorescence intensity.
[0060] Amplicon Preparation from Bacterial Isolates
[0061] The bacterial isolate used in this study was acquired from the Centers for Disease Control and Prevention (CDC). The isolate was grown on Luria-Bertani agar at 37 C. for 18-24 hours prior to DNA extraction. Total genomic DNA was extracted from each isolate by suspending cells grown on Luria-Bertani agar plates in 510 L of TE buffer containing 1.8 g/L lysozyme, and incubating for 45 minutes at 37 C. To this tube, 540 L of bacterial lysis buffer and 100 L proteinase K were added, after which it was incubated for 10 minutes at 65 C. followed by an automated DNA extraction performed with a Roche MagNa Pure LC system (Roche Diagnostics), using the Roche MagNa Pure LC DNA Isolate Kit III as recommended by the manufacturer. DNA was tested for biological growth by plating 10% of DNA sample volume on Luria-Bertani agar at 37 C. for 3 days. When DNA samples passed sterility, DNA concentrations were measured with a TBS-380 Fluorometer (Promega) using the Quant-iT PicoGreen dsDNA assay kit P7589 (Invitrogen).
[0062] DNA sequences unique to K. pneumoniae containing the carbapenemase gene K. pneumoniae carbapenemase (KPC) were obtained from NCBI Genbank (http://www.ncbi.nlm.nih.gov/genbank). The gene was analyzed and only part of the gene was used to create a 250 bp amplicon. The primers were designed using PrimerQuest algorithms from Integrated DNA Technologies (IDT). (http://www.idtdna.com/primerquest/Home/Index). The primer sequences were selected for the proper GC content, optimal annealing temperatures, and lack of hairpin structures (see Table S1). Sanger sequencing was also done to confirm that the correct portion of the gene was amplified with the primers.
[0063] PCR Reaction and KPC Amplicon
[0064] Extracted bacterial DNA was amplified using PCR. Parameters were optimized by looking at the number of cycles, cycle temperatures and the length of annealing and elongation steps. A total reaction volume of 25 L was prepared with the following: 13 L of 1AmpliTaq Gold 360 Master Mix (Applied Biosystems), 3 L of target DNA, forward and reverse primers at 500 nM and PCR H.sub.2O to 25 L. The PCR was performed using a ProFlex PCR System (Applied Biosystems). The optimized procedure used for PCR was 95 C. initial denaturation for 120 s followed by 40 cycles of 95 C. for 15 s, then 58 C. for 30 s, followed by 72 C. for 180 s. The PCR product was run on an agarose gel to confirm amplicon size. PCR product was quantified using a NanoDrop absorbance spectrometer (ThermoFisher Scientific.
[0065] Real-time PCR Reactions
[0066] Parameters for qPCR such as the number of cycles, cycle temperatures, and length of annealing were all optimized. Primers were first evaluated with SYBR Green to optimize cycle temperatures and times. For every reaction, a master mix of 25 L was prepared using 2SYBR Select Master Mix (Applied Biosystems) and the following: forward and reverse primers at 500 nM, 3 L target DNA, 13 L SYBR Green at 2concentration and PCR H.sub.2O to 25 L. The mixtures were loaded into 25 L Cepheid PCR tubes, and PCR was performed using a SmartCycler II (Cepheid). The optimized procedure identified and used for the assay was 95 C. initial denaturation for 120 s followed by 40 cycles of 95 C. for 15 s, then 58 C. for 30 s. These reactions were also carried out using an ABI 7900HT (Applied Biosystems) and 96 well plates. The reaction amounts and PCR conditions for the ABI were the same as for the SmartCycler II.
[0067] Results and Discussion
[0068] 1. Single-Step Fabrication of Monoliths with a Capture Sequence
[0069] Several factors were considered in developing a procedure for single-step preparation of monoliths with a capture DNA sequence. Previously published single-step methods for preparation of porous polymers with copolymerized functionalities were based on hybrid organic-inorganic monoliths [13,14]. These monoliths are prepared by a sol-gel process that usually requires hours to prepare a column [13,14], which is not suitable for fast fabrication of a column in a disposable device. Therefore, photoinitiated polymerization was chosen to prepare the monoliths.
[0070] For selecting the composition of the polymerization mixture, the most limiting factor is the solubility of DNA, which requires polar solvents to dissolve sufficient concentrations. A 1:1 mixture of 2-propanol:water was chosen as the solvent for acrd-KPC (500 M). The presence of water in the polymerization mixture limits the choice of monomers and porogens that are miscible yet still provide a porous structure after polymerization. Based on previous studies [18,23,24], it was decided to use PEGDA and HEMA together with acrd-KPC, dissolved in 1:1 2-propanol:water and n-dodecanol as porogenic solvents. However, unsatisfactory porosity was obtained using these components. In order to simplify the polymerization mixture, HEMA was omitted. An advantage of using only crosslinkers (PEGDA and EDMA) as the structural monomers is that polymerization kinetics for diacrylates are faster than those for monoacrylates [25], increasing the probability of localization of acrd-KPC on the polymer surface.
[0071] Use of polypropylene microfluidic channels presents a challenge with anchoring of monoliths. Previously it was found that a sufficient concentration of BME photoinitiator anchors the monolith to the channel wall in a single step without channel pretreatment [18]. When PEGDA alone was used as the structural monomer, the resulting monolith had poor anchoring due to shrinking after cleaning the monolith with 2-propanol. Therefore EDMA was introduced into the mixture in order to promote adhesion of the monolith to the polypropylene surface due to better wettability since EDMA is more hydrophobic than PEGDA. A 1:1 mixture of EDMA and PEGDA was found to provide the most reproducible results.
[0072] The amount of capture sequence in the polymerization mixture was studied.
[0073] The final composition of the polymerization mixture for column preparation was 18.5% PEGDA, 18.5% EDMA, 14% 2-propanol, 41.5% n-dodecanol, 4.5% 500 M acrd-KPC (in 1:1 2-propanol:water) and 3% BME. SEM images of monoliths in a microchip are shown in
[0074] Columns prepared by the single-step method and columns modified by the Schiff-base method were compared for binding capacity by extracting 5 nM FI-KPC, as shown in
[0075] 3.2. Optimizing Synthetic Oligonucleotide Capture and Capacity Testing
[0076] In previous work, capture and release of a short, 24-base complementary DNA strand to an immobilized capture sequence on the monolith was studied [18]. In order to capture clinically relevant DNA strands, a 90-mer, representing a longer synthetically available oligonucleotide was used for process optimization.
[0077] Temperature has been found to have a significant impact on DNA hybridization and its selectivity in microarrays [26,27]. Higher temperature reduces intramolecular binding and secondary structure that can limit successful hybridization to the capture sequence on the solid support. For testing the effects of temperature on capture efficiency, a previously used branched Y shape channel design [18] was utilized.
[0078] 3.3. On-chip DNA Labeling
[0079] Fluorescent labeling of DNA is the most common approach used for detection and sensitive quantification [28]. Some methods rely on dyes that become fluorescently active upon interaction with DNA, providing non-selective labeling, which is generally used for staining DNA in free solution or gels. Here was tested SYBR Green II and Quant-iT OliGreen for labeling of a 90-mer hybridized to the capture sequence on the monolith. Two different methods were tested: fluorescent dye was loaded and rinsed off the column, or dye was present in the buffer used in the elution step. With either approach unsatisfactory and poorly repeatable results were obtained, possibly due to weak interaction of the dyes with DNA at the high temperature (70 C.) used for elution.
[0080] Hybridization probes are another frequently used way to introduce fluorophores on a DNA sequence of interest; they provide selective labeling through hybridization to the target [28,29]. A standard design, called a molecular beacon (MB), consists of the 5 end modified with a fluorophore and the 3 end modified with a quencher matching the spectral properties of the fluorophore. The base sequence of the probe is designed with a stem structure bringing the fluorophore and quencher in close proximity, and making the system fluorescently inactive. Upon hybridization, the stem opens separating the fluorophore and quencher and enabling the fluorescent signal from the MB to be recorded [29].
[0081] Similar to the capture sequence, a site for a hybridization probe was determined for selective labeling of the KPC gene (see Materials and methods, Section 2). When 50 L of 100 nM hybridization probe with one fluorescein (MP1) was loaded on the monolith after capturing FI-KPC, an increase in signal was recorded in the elution peak over signal provided from just FI-KPC as shown in
[0082] The MP1 design was modified by removing the bases at each end responsible for stem formation and replaced BHQ1 with 6-FAM at the 3 end, resulting in a probe with 2 fluorophores (MP2). Testing MP2 under the same conditions as MP1 provided an increase in the observed signal of the eluted peak, as shown in
[0083] The labeling process was optimized regarding probe hybridization temperature (see
[0084] MP2 labeling of 1 nM and 100 pM KPC oligo (unlabeled) was then used, and the fluorescence traces along with the temperature profile of the column heater during capture, labeling and elution are shown in
[0085] 3.4. On-chip DNA Denaturing
[0086] Genomic DNA from bacteria involved in sepsis is typically present as dsDNA; denaturing is required to create ssDNA that can hybridize to the capture strands. DNA can be denatured chemically using low or high pH [30], chaotropic agents [31] or by raising the temperature higher than the melting point of the hybrid [32,33]. Because chemical denaturing creates conditions that are unsuitable for subsequent hybridization of target to the capture sequence, thermal denaturing was chosen for this example. On-chip DNA denaturing has been utilized in many applications including PCR [7,8,33] and DNA hybridization arrays [10,32]. Arrays have been successfully applied in detection and enrichment of nucleic acids; however, poor hybridization efficiency and long incubation times are drawbacks of microarrays. Back hybridization of target to its complement in solution was shown to be an important cause of low microarray efficiency [10]. Repeated sample recirculation in a closed loop through a denaturing chamber was demonstrated to improve efficiency [10]; however, this strategy is time consuming and requires additional pumping elements on the chip.
[0087] In order to implement denaturing capabilities in a microfluidic device, a design was used with a serpentine channel section having a 10 L volume over which a denaturing heater was placed (
[0088] Denaturing of dsDNA was tested on a synthetic 90-mer dsDNA with FI-KPC as one of the strands. 50 L of 100 pM dsDNA was passed through the denaturing section of the channel and onto the column. Results are shown in
[0089] To determine the denaturing efficiency, single- and double-stranded FI-KPC (100 pM) were loaded through the denaturing section, onto the monolith, and then eluted. Comparing the areas of the eluted peaks in
[0090] 5. Capture and Labeling of dsDNA in Bacterial Lysate
[0091] For testing the extraction and labeling process on a target that mimics clinical samples, a part of the KPC gene was PCR amplified in order to provide a controlled concentration of a longer dsDNA (see Section 6 in Materials and methods). Tested were KPC amplicons with concentrations from 100 pM to 3 nM for on-chip denaturing, capture and labeling. The elution traces are shown in
[0092] The present approach to detection of bacterial pathogens in blood involves treatment of the sample by separating and concentrating the bacteria [19,20], followed by lysis and DNA extraction (see Materials and methods, Section 4 for details). Purified DNA (0.4 ng/L) from lysed bacteria was spiked with a PCR amplicon from the KPC gene and processed in the present microchip. DNA denaturation, capture of target and labeling with MP2 were done, and
[0093] In order to verify the presence of KPC amplicon in the eluent collected from the outlet of the device, real-time qPCR was used for quantification of the amplicon (see Materials and Methods, Section 6 for details). Dilution attributed to the dead volume of the connectors, flow meter and tubing between the monolithic column and the outlet decreases amplicon concentration in the 3 L collected fraction.
[0094] While this invention has been described with reference to certain specific embodiments and examples, it will be recognized by those skilled in the art that many variations are possible without departing from the scope and spirit of this invention, and that the invention, as described by the claims, is intended to cover all changes and modifications of the invention which do not depart from the spirit of the invention.
TABLE-US-00001 TABLE1 oligoname sequence(5.fwdarw.3) acrd-KPC Acrd-SP18-TATCGCCGTCTAGTTCTGCTGTCTTG NH.sub.2-KPC NH.sub.2-SP18-TATCGCCGTCTAGTTCTGCTGTCTTG F1-KPC F1-CATTCAAGGGCATCTTTCCGAGATGGGTGACCA CGGAACCAGCGGATGCCCATGCCCTATCAGTCAAGA CAGCAGAACTAGACGGCGATA KPC CATTCAAGGGCATCTTTCCGAGATGGGTGACCACGG AACCAGCGGATGCCCATGCCCTATCAGTCAAGACAG CAGAACTAGACGGCGATA comp-KPC TATCGCCGTCTAGTTCTGCTGTCTTGACTGATAGGG CATGGGCATCCGCTGGTTCCGTGGTCACCCATCTCG GAAAGATGCCCTTGAATG MP1 FAM-GGGCATCCGCTGGTTCCGTGGTCACCCATCT CGGAAAGATGCCC-BHQ1 MP2 FAM-TATCCGCTGGTTCCGTGGTCACCCATCTCGG AAAGATC-FAM KPCamplicon GCGCTGAGGAGCGCTTCCCACTGTGCAGCTCATTC AAGGGCTTTCTTGCTGCCGCTGTGCTGGCCAAGAC AGCAGAACTAGACGGCGATATGGACACACCCATCC GTTACGGCAAAAATGCGCTGGTTCCGTGGTCACCC ATCTCGGAAAAATATCTGACAACAGGCATGACGGT GGC DNA oligonucleotide sequences. Acrd = acrydite, NH.sub.2 = aminohexyl, SP18 = 18 carbon atom spacer, Fl = fluorescein, FAM = 6-carboxyfluorescein, BHQ1 = Black Hole Quencher 1.
TABLE-US-00002 TABLES1 SequencesofprimersforKPCamplicon. Primer Sequence(5.fwdarw.3) Forward CTCGAACAGGACTTTGGCGGCTC Reverse GCCACCGTCATGCCTGTTGTCAG
TABLE-US-00003 TABLE S2 Ct values obtained from real time PCR amplification in FIG. 10. collected eluent calibration standards 1 nM KPC 1 nM 10 nM 1 nM 100 pM 10 pM in buffer KPC in Ct value 10.6 16.6 21.7 26.4 19.6 20.4
TABLE OF CITED REFERENCES
[0095] [1] I. E. Robledo, E. E. Aquino, G. J. Vazquez, Detection of the KPC Gene in Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Acinetobacter baumannii during a PCR-Based Nosocomial Surveillance Study in Puerto Rico, Antimicrob. Agents Chemother 55 (2011) 2968-2970. [0096] [2] S. Bratu, P. Tolaney, U. Karumudi U, J. Quale, M. Mooty, S. Nichani, D. Landman, Carbapenemase-producing Klebsiella pneumoniae in Brooklyn, N.Y.: molecular epidemiology and in vitro activity of polymyxin B and other agents, J. Antimicrob. Chemother 56 (2005) 128-132. [0097] [3] K. F. Anderson, D. R. Lonsway, J. K. Rasheed, J. Biddle, B. Jensen, L. K. McDougal, R. B. Carey, A. Thompson, S. Stocker, B. Limbago, J. B. Patel, Evaluation of Methods To Identify the Klebsiella pneumoniae Carbapenemase in Enterobacteriaceae, J. Clin. Microbiol. 45 (2007) 2723-2725. [0098] [4] R. S. Arnold, K. A. Thom, S. Sharma, M. Phillips, J. K. Johnson, D. J. Morgan, Emergence of Klebsiella pneumoniae Carbapenemase (KPC)-Producing Bacteria, South Med. J. 104 (2011) 40-45. [0099] [5] A. Raghunathan, L. Samuel, R. J. Tibbetts, Evaluation of a Real-Time PCR Assay for the Detection of the Klebsiella pneumoniae Carbapenemase Genes in Microbiological Samples in Comparison With the Modified Hodge Test, Am. J. Clin. Pathol. 135 (2011) 566-571. [0100] [6] M. W. Pletz, N. Wellinghausen, T. Welte, Will polymerase chain reaction (PCR)-based diagnostics improve outcome in septic patients? A clinical view, Intensive Care Med. 37 (2011) 1069-1076. [0101] [7] M. C. Giuffrida, G. Spoto, Integration of isothermal amplification methods in microfluidic devices: Recent advances, Biosens. Bioelectron. 90 (2017) 174-186. [0102] [8] Y. Zhang, H.-R. Jiang, A review on continuous-flow microfluidic PCR in droplets: Advances, challenges and future, Anal. Chim. Acta 914 (2016) 7-16. [0103] [9] R. Bumgarner, DNA microarrays: Types, Applications and their future, Curr. Protoc. Mol. Biol. 22 (2013) 22.1. [0104] [10] E. Servoli, H. Feitsma, B. Kaptheijns, P. J. van der Zaag, R. Wimberger-Friedl, Improving DNA capture on microarrays by integrated repeated denaturing, Lab Chip 12 (2012) 4992-4999. [0105] [11] R. Knob, V. Sahore, M. Sonker, A. T. Woolley, Advances in monoliths and related porous materials for microfluidics, Biomicrofluidics 10 (2016) 032901. [0106] [12] J. C. Masini, F. Svec, Porous monoliths for on-line sample preparation: A review, Anal. Chim. Acta 964 (2017) 24-44. [0107] [13] M.-L. Hsieh, L.-K. Chau, Y.-S. Hon, Single-step approach for fabrication of vancomycin-bonded silica monolith as chiral stationary phase, J. Chromatogr. A 1358 (2014) 208-216. [0108] [14] H. Lyu, H. Zhao, W. Qin, Z. Xie, Preparation of a long-alkyl-chain-based hybrid monolithic column with mixed-mode interactions using a one-pot process for pressurized capillary electrochromatography, J. Sep. Sci. 40 (2017) 4521-4529. [0109] [15] Q. Zhang, J. Guo, F. Wang, J. Crommen, Z. Jiang, Preparation of a -cyclodextrin functionalized monolith via a novel and simple one-pot approach and application to enantioseparations, J. Chromatogr. A, 1325 (2014) 147-154. [0110] [16] R. A. Zangmeister, M. J. Tarlov, UV Graft Polymerization of Polyacrylamide Hydrogel Plugs in Microfluidic Channels, Langmuir 19 (2003) 6901-6904. [0111] [17] A. Chan, U. J. Krull, Capillary electrophoresis for capture and concentrating of target nucleic acids by affinity gels modified to contain single-stranded nucleic acid probes, Anal. Chim. Acta 578 (2006) 31-42. [0112] [18] R. Knob, D. B. Nelson, R. A. Robison, A. T. Woolley, Sequence-specific DNA solid-phase extraction in an on-chip monolith: Towards detection of antibiotic resistance genes, J. Chromatogr. A 1523 (2017) 309-315. [0113] [19] M. Alizadeh, R. L. Wood, C. M. Buchanan, C G. Bledsoe, M. E. Wood, D. S. McClellan, R. Blanco, T. V. Raysten, G. A. Hussein, C. L. Hickey, R. A. Robison, W. G. Pitt, Rapid separation of bacteria from bloodChemical aspects, Colloids Surf. B Biointerfaces 154 (2017) 365-372. [0114] [20] C. M. Buchanan, R. L. Wood, T. R. Hoj, M. Alizadeh, C. G. Bledsoe, M. E. Wood, D. S. McClellan, R. Blanco, C. L. Hickey, T. V. Raysten, G. A. Husseini, R. A. Robison, W. G. Pitt, Rapid separation of very low concentrations of bacteria from blood, J. Microbiol. Methods 139 (2017) 48-53. [0115] [21] T. Wall, J. McMurray, G. Meena, V. Ganjalizadeh, H. Schmidt, A. R. Hawkins, Optofluidic Lab-on-a-Chip Fluorescence Sensor Using Integrated Buried ARROW (bARROW) Waveguides, Micromachines 8 (2017) 252. [0116] [22] M. Sonker, R. Yang, V. Sahore, S. Kumar, A. T. Woolley, On-chip fluorescent labeling using reversed-phase monoliths and microchip electrophoretic separations of selected preterm birth biomarkers, Anal. Methods 8 (2016) 7739-7746. [0117] [23] Y. Li, H. D. Tolley, M. L. Lee, Poly[hydroxyethyl acrylate-co-poly(ethylene glycol) diacrylate] Monolithic Column for Efficient Hydrophobic Interaction Chromatography of Proteins, Anal. Chem. 81 (2009) 9416-9424. [0118] [24] P. Hemstrm, A. Nordborg, K. Irgum, F. Svec, J. M. Frchet, Polymer-based monolithic microcolumns for hydrophobic interaction chromatography of proteins, J. Sep. Sci. 29 (2006) 25-32. [0119] [25] I. Nischang, Porous polymer monoliths: Morphology, porous properties, polymer nanoscale gel structure and their impact on chromatographic performance, J. Chromatogr. A 1287 (2013) 39-58. [0120] [26] M. Glazer, J. A. Fidanza, G. H. McGall, M. O. Trulson, J. E. Forman, A. Suseno, C. W. Frank, Kinetics of oligonucleotide hybridization to photolithographically patterned DNA arrays, Anal. Biochem. 358 (2006) 225-238. [0121] [27] H. Koltai, C. Weingarten-Baror, Specificity of DNA microarray hybridization: characterization, effectors and approaches for data correction, Nucleic Acids Res. 36 (2008) 2395-2405. [0122] [28] K. Rombouts, K. Braeckmans, K. Remaut, Fluorescent Labeling of Plasmid DNA and mRNA: Gains and Losses of Current Labeling Strategies, Bioconjugate Chem. 27 (2016) 280-297. [0123] [29] J. Huang, X. Yang, X. He, K. Wang, J. Liu, H. Shi, Q. Wang, Q. Guo, D. He, Design and bioanalytical applications of DNA hairpin-based fluorescent probes, Trends Anal. Chem. 53 (2014) 11-20. [0124] [30] A. K. Raap, J. G. J. Marijnen, J. Vrolijk, M. van der Ploeg, Denaturation, Renaturation, and Loss of DNA During In Situ Hybridization Procedures, Cytometry 7 (1986) 235-242. [0125] [31] Y. Gao, L. K. Wolf, R. M. Georgiadis, Secondary structure effects on DNA hybridization kinetics: a solution versus surface comparison, Nucleic Acids Res. 34 (2006) 3370-3377. [0126] [32] G. Rizzi, J.-R. Lee, P. Guldberg, M. Dufva, S. X. Wang, M. F. Hansen, Denaturation strategies for detection of double stranded PCR products on GMR magnetic biosensor array, Biosens. Bioelectron. 93 (2017) 155-160. [0127] [33] J. J. Chen, M. H. Liao, K. T. Li, C. M. Shen, One-heater flow-through polymerase chain reaction device by heat pipes cooling, Biomicrofluidics 9 (2015) 014107.