BIS PHENYL HEXA TRIEN DERIVATIVES, PREPARATION METHOD THEREOF, AND COMPOSITION FOR SKIN WHITENING CONTAINING THE SAME AS AN ACTIVE INGREDIENT

20200078279 ยท 2020-03-12

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to a bis phenyl hexa triene derivative, a preparation method thereof and a composition for skin whitening comprising the same as an active ingredient. The said derivative inhibits the expression of tyrosinase, TRP 1 (tyrosinase-related protein 1), TRP 2 (tyrosinase-related protein 2) or MITF (microphthalmia-associated transcription factor) gene which produces a precursor necessary for the generation of melanin, suppresses the activity of tyrosinase, eventually inhibits the biosynthesis of melanin, is safe due to low cytotoxicity, and has less side effects and excellent antioxidative effect, so that it can be effectively used as a composition for skin whitening.

    Claims

    1. A compound represented by formula 1 below, an optical isomer thereof or a pharmaceutically acceptable salt thereof: ##STR00019## (In formula 1, R.sup.1 and R.sup.2 are independently straight or branched C.sub.1-6 alkyl).

    2. The compound, the optical isomer thereof or the pharmaceutically acceptable salt thereof according to claim 1, wherein R.sup.1, R.sup.2, R.sup.3 and R.sup.4 are independently straight or branched C.sub.1-3 alkyl.

    3. The compound, the optical isomer thereof or the pharmaceutically acceptable salt thereof according to claim 1, wherein the compound represented by formula 1 is the compound represented by formula 2 below: ##STR00020##

    4. A preparation method of a compound represented by formula 1 of claim 1 comprising a step of preparing a compound represented by formula 1 by reacting a compound represented by formula 3 with a compound represented by formula 4 as shown in reaction formula 1 below: ##STR00021## (In reaction formula 1, R.sup.1 and R.sup.2 are as defined in formula 1 of claim 1).

    5. A pharmaceutical composition for skin whitening comprising a compound of claim 1 represented by formula 1 below, an optical isomer thereof or a pharmaceutically acceptable salt thereof as an active ingredient: ##STR00022## (In formula 1, R.sup.1 and R.sup.2 are independently straight or branched C.sub.1-6 alkyl).

    6. The pharmaceutical composition for skin whitening according to claim 5, wherein the compound represented by formula 1 characteristically inhibits the expression of tyrosinase gene.

    7. The pharmaceutical composition for skin whitening according to claim 5, wherein the compound represented by formula 1 characteristically inhibits the expression of TRP 1 (tyrosinase-related protein 1) or TRP 2 (tyrosinase-related protein 2).

    8. The pharmaceutical composition for skin whitening according to claim 5, wherein the compound represented by formula 1 characteristically inhibits the expression of MITF (melanogenesis associated transcription factor) gene.

    9. The pharmaceutical composition for skin whitening according to claim 5, wherein the compound represented by formula 1 characteristically inhibits melanin synthesis.

    10. The pharmaceutical composition for skin whitening according to claim 5, wherein the compound represented by formula 1 characteristically has antioxidative effect.

    11. A cosmetic composition for skin whitening comprising a compound of claim 1 represented by formula 1 below, an optical isomer thereof or a pharmaceutically acceptable salt thereof as an active ingredient: ##STR00023## (In formula 1, R.sup.1 and R.sup.2 are independently straight or branched C.sub.1-6 alkyl).

    12. The cosmetic composition for skin whitening according to claim 11, wherein the composition represented by formula 1 characteristically inhibits the expression of tyrosinase gene.

    13. The cosmetic composition for skin whitening according to claim 11, wherein the compound represented by formula 1 characteristically inhibits the expression of TRP 1 (tyrosinase-related protein 1) or TRP 2 (tyrosinase-related protein 2).

    14. The cosmetic composition for skin whitening according to claim 11, wherein the compound represented by formula 1 characteristically inhibits the expression of MITF (melanogenesis associated transcription factor) gene.

    15. The cosmetic composition for skin whitening according to claim 11, wherein the compound represented by formula 1 characteristically inhibits melanin synthesis.

    16. An antioxidative composition comprising a compound of claim 1 represented by formula 1 below, an optical isomer thereof or a pharmaceutically acceptable salt thereof as an active ingredient: ##STR00024## (In formula 1, R.sub.1 and R.sup.2 are independently straight or branched C.sub.1-6 alkyl).

    17. A health functional food for skin whitening comprising a compound of claim 1 represented by formula 1 below, an optical isomer thereof or a pharmaceutically acceptable salt thereof as an active ingredient: ##STR00025## (In formula 1, R.sup.1 and R.sup.2 are independently straight or branched C.sub.1-6 alkyl).

    18. A method for whitening skin comprising: topically applying an effective amount of the skin whitening composition of claim 5.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0032] FIG. 1 is a schematic diagram illustrating the process of in vivo melanin biosynthesis.

    [0033] FIG. 2 is a graph illustrating the inhibitory effect of the compound of the present invention on tyrosinase gene expression, evaluated in Experimental Example 1 (vertical axis: relative expression level).

    [0034] FIG. 3 is a graph illustrating the inhibitory effect of the compound of the present invention on MITF gene expression, evaluated in Experimental Example 2 (vertical axis: relative expression level).

    [0035] FIG. 4 is a set of graphs illustrating the inhibitory effect of the compound of the present invention on TRP 1 and TRP 2 gene expression, evaluated in Experimental Example 3 (vertical axis: relative expression level). FIG. 4a: TRP 1, FIG. 4b: TRP 2

    [0036] FIG. 5 is a graph illustrating the antioxidative effect of the compound of the present invention, evaluated in Experimental Example 4 (vertical axis: radical scavenging activity, horizontal axis: concentration).

    [0037] FIG. 6 is a graph illustrating the cytotoxicity of the compound of the present invention, evaluated in Experimental Example 5 (vertical axis: cell viability).

    [0038] FIG. 7 is a set of graphs illustrating the inhibitory effect of the compound of the present invention on the production of melanin, evaluated in Experimental Example 6 (vertical axis: melanin content (compared to control), Media: cell culture fluid, -MSH: alpha-melanocyte-stimulating hormone (10 nM), RES: melanin synthesis inhibitor (Resveratrol, 10 M)).

    [0039] FIG. 8 is a graph illustrating the inhibitory effect of the compound of the present invention on the activity of tyrosinase, evaluated in Experimental Example 7 (vertical axis: tyrosinase activity (% of control), horizontal axis: concentration).

    DESCRIPTION OF THE PREFERRED EMBODIMENTS

    [0040] Hereinafter, the present invention is described in detail.

    [0041] In an aspect of the present invention, the present invention provides a compound represented by formula 1 below, an optical isomer thereof or a pharmaceutically acceptable salt thereof:

    ##STR00007##

    [0042] (In formula 1,

    [0043] R.sup.1 and R.sup.2 are independently straight or branched C.sub.1-6 alkyl).

    [0044] The said R.sup.1 and R.sup.2 can be independently straight or branched C.sub.1-3 alkyl.

    [0045] Examples of the compounds represented by formula 1 according to the present invention include the compounds represented by the following formula 2:

    ##STR00008##

    [0046] The compound represented by formula 1 of the present invention can be used as a form of a pharmaceutically acceptable salt, in which the salt is preferably acid addition salt formed by pharmaceutically acceptable free acids. The acid addition salt herein can be obtained from inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, nitrous acid, and phosphorous acid; non-toxic organic acids such as aliphatic mono/dicarboxylate, phenyl-substituted alkanoate, hydroxy alkanoate, alkandioate, aromatic acids, and aliphatic/aromatic sulfonic acids; or organic acids such as acetic acid, benzoic acid, citric acid, lactic acid, maleic acid, gluconic acid, methanesulfonic acid, 4-toluenesulfonic acid, tartaric acid, and fumaric acid. The pharmaceutically non-toxic salts are exemplified by sulfate, pyrosulfate, bisulfate, sulphite, bisulphite, nitrate, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate, chloride, bromide, iodide, fluoride, acetate, propionate, decanoate, caprylate, acrylate, formate, isobutylate, caprate, heptanoate, propiolate, oxalate, malonate, succinate, suberate, cabacate, fumarate, maliate, butyne-1,4-dioate, hexane-1,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate, hydroxybenzoate, methoxybenzoate, phthalate, terephthalate, benzenesulfonate, toluenesulfonate, chlorobenzenesulfonate, xylenesulfonate, phenylacetate, phenylpropionate, phenylbutylate, citrate, lactate, -hydroxybutylate, glycolate, malate, tartrate, methanesulfonate, propanesulfonate, naphthalene-1-sulfonate, naphthalene-2-sulfonate, and mandelate.

    [0047] The acid addition salt in this invention can be prepared by the conventional method known to those in the art. For example, the derivative represented by formula 1 is dissolved in an organic solvent such as methanol, ethanol, acetone, dichloromethane, and acetonitrile, to which organic acid or inorganic acid is added to induce precipitation. Then, the precipitate is filtered and dried to give the salt. Or the solvent and the excessive acid are distillated under reduced pressure, and dried to give the salt. Or the precipitate is crystallized in an organic solvent to give the same.

    [0048] A pharmaceutically acceptable metal salt can be prepared by using a base. Alkali metal or alkali earth metal salt is obtained by the following processes: dissolving the compound in excessive alkali metal hydroxide or alkali earth metal hydroxide solution; filtering non-soluble compound salt; evaporating the remaining solution and drying thereof. At this time, the metal salt is preferably prepared in the pharmaceutically suitable form of sodium, potassium, or calcium salt. And the corresponding silver salt is prepared by the reaction of alkali metal or alkali earth metal salt with proper silver salt (ex; silver nitrate).

    [0049] In addition, the present invention includes not only the compound represented by formula 1 but also a pharmaceutically acceptable salt thereof, and a solvate, an optical isomer, or a hydrate possibly produced from the same.

    [0050] In another aspect of the present invention, the present invention provides a preparation method of a compound represented by formula 1 comprising a step of preparing a compound represented by formula 1 by reacting a compound represented by formula 3 with a compound represented by formula 4 as shown in reaction formula 1 below:

    ##STR00009##

    [0051] (In reaction formula 1,

    [0052] R.sup.1 and R.sup.2 are as defined in formula 1 above).

    [0053] Hereinafter, the preparation method shown in reaction formula 1 is described in more detail.

    [0054] The preparation method shown in reaction formula is a method for preparing the compound represented by formula 1, which is only one example of the various synthesis methods of the compound represented by formula 1, but the preparation of the compound represented by formula 1 is not limited thereto.

    [0055] Particularly, the preparation method above is a method to prepare the compound represented by formula 1 by reacting (E)-tetraethylbut-2-ene-1,4-diyldiphosphonate compound represented by formula 3 with benzaldehyde compound represented by formula 4 in order to form triene.

    [0056] Specific examples thereof are illustrated in the following examples, and the examples are just examples for carrying out the preparation method above, and the reaction conditions are not limited to the examples.

    [0057] In another aspect of the present invention, the present invention provides a cosmetic composition for skin whitening comprising a compound represented by formula 1 below or a pharmaceutically acceptable salt thereof as an active ingredient:

    ##STR00010##

    [0058] (In formula 1,

    [0059] R.sup.1 and R.sup.2 are independently straight or branched C.sub.1-6 alkyl).

    [0060] To investigate the skin whitening effect of the compound represented by formula 1 according to the present invention, the inhibitory effect of the compound on the expression of tyrosinase, TRP 1 (tyrosinase-related protein 1), TRP 2 (tyrosinase-related protein 2) or MITF (microphthalmia-associated transcription factor) gene was measured.

    [0061] As a result, the compound represented by formula 1 of the present invention was confirmed to have an excellent inhibitory effect on the expression of tyrosinase, TRP 1 (tyrosinase-related protein 1), TRP 2 (tyrosinase-related protein 2) or MITF (microphthalmia-associated transcription factor) gene which produces a precursor necessary for the generation of melanin even at a low concentration, indicating that the compound above had an excellent skin whitening effect (see Experimental Examples 13 and FIGS. 24).

    [0062] The antioxidative effect of the compound represented by formula 1 of the present invention was measured. As a result, the compound represented by formula 1 of the present invention was confirmed to have an excellent antioxidative effect even at a low concentration (see Experimental Example 4 and FIG. 5).

    [0063] The cytotoxicity of the compound represented by formula 1 of the present invention was measured. As a result, the compound represented by formula 1 of the present invention was confirmed to have a low cytotoxicity (see Experimental Example 5 and FIG. 6).

    [0064] The inhibitory effect of the compound represented by formula 1 of the present invention on the production of melanin was measured. As a result, the compound represented by formula 1 of the present invention was confirmed to inhibit the production of melanin significantly even at a low concentration (see Experimental Example 6 and FIG. 7).

    [0065] The inhibitory effect of the compound represented by formula 1 of the present invention on the activity of tyrosinase was measured. As a result, the compound represented by formula 1 of the present invention was confirmed to inhibit the activity of tyrosinase significantly even at a low concentration (see Experimental Example 7 and FIG. 8).

    [0066] In the pharmaceutical composition according to the present invention, the compound represented by formula 1 or the pharmaceutically acceptable salt thereof can be administered orally or parenterally in various formulations at the time of clinical administration. More preferably, they can be parenteral formulations. The compound represented by formula 1 or the pharmaceutically acceptable salt thereof can be prepared for oral or parenteral administration by mixing with generally used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents and surfactant. Solid formulations for oral administration are tablets, pills, powders, granules and capsules. These solid formulations are prepared by mixing the compound represented by formula 1 or the pharmaceutically acceptable salt thereof of the present invention with one or more suitable excipients such as starch, calcium carbonate, sucrose or lactose, gelatin, etc. Except for the simple excipients, lubricants, for example magnesium stearate, talc, etc, can be used. Liquid formulations for oral administrations are suspensions, solutions, emulsions and syrups, and the above-mentioned formulations can contain various excipients such as wetting agents, sweeteners, aromatics and preservatives in addition to generally used simple diluents such as water and liquid paraffin. Formulations for parenteral administration are sterilized aqueous solutions, water-insoluble excipients, suspensions, and emulsions. Water insoluble excipients and suspensions can contain, in addition to the active compound or compounds, propylene glycol, polyethylene glycol, vegetable oil like olive oil, injectable ester like ethylolate, etc.

    [0067] The present invention also provides a skin external application for skin whitening comprising the compound represented by formula 1 above as an active ingredient.

    [0068] When the compound represented by formula 1 is used as a skin external application, it can include one or more additional supplements generally used in the field of skin science such as fatty substance, organic solvent, resolvent, concentrate, gelling agent, softener, antioxidant, suspending agent, stabilizer, foaming agent, odorant, surfactant, water, ionic or non-ionic emulsifying agent, filler, sequestering agent, chelating agent, preserving agent, vitamin, blocker, moisturing agent, essential oil, dye, pigment, hydrophilic or hydrophobic activator, lipid vesicle or other components generally used in the field of skin science. The said components can be included in the amounts generally used in the field of skin science.

    [0069] When the compound represented by formula 1 is provided as a skin external application formulation, it can be ointments, patches, gels, creams or sprays, but not always limited thereto.

    [0070] Preferably, the pharmaceutical composition of the present invention can be provided as a parenteral preparation. For example, the pharmaceutical composition of the present invention can be prepared as a skin external application by mixing homogeneously suitable pharmaceutically acceptable bases such as vaseline, stearyl alcohol and the like; suitable pharmaceutically acceptable surfactants such as polysorbate, sorbitan sesquioleate and the like; suitable pharmacologically acceptable moisturizing agents such as glycerin and the like; suitable pharmaceutically acceptable solvents; flavors; coloring agents; stabilizers; and viscosifying agents according to the conventional method for producing a skin external application.

    [0071] When the compound represented by formula 1 of the present invention is used as a medicine, it can include one or more additional active ingredients which have the same or similar functions to the active ingredient. For example, a well known skin whitening component can be included. When an additional skin whitening component is included in the composition of the present invention, the skin whitening effect of the composition is expected to be increased.

    [0072] In the case of adding additional ingredients, skin safety, easiness in formulation and stability of active ingredients are considered for combination use. In a preferred embodiment of the present invention, the composition can additionally include one or more ingredients selected from the group consisting of tyrosinase activity inhibitors such as kojic acid and arbutin, hydroquinone, vitamin-C (L-ascorbic acid), derivatives thereof and various plant extracts as known whitening components. The additional ingredient is preferably included in the composition at the concentration of 0.0001 weight % 10 weight % by the total composition. The concentration above can be adjusted according to requirements such as skin safety and easiness of formulation of the compound represented by formula 1, etc.

    [0073] The pharmaceutical composition of the present invention can provide a preferable skin whitening effect when it contains an effective dose of the compound represented by formula 1. In this invention, the term effective dose indicates the amount of a compound capable of exhibiting a skin whitening effect.

    [0074] The effective dose of the compound represented by formula 1 included in the composition of the present invention can vary according to the form of the formulation, the method by which the compound is applied to the skin and the time on the skin. For example, when the composition of the present invention is formulated as a medicine, the concentration of the compound represented by formula 1 in the composition is higher than when it is formulated as a cosmetic composition to be applied on the skin. Therefore, the daily dose of the compound represented by formula 1 can be 0.1100 mg/kg, preferably 3080 mg/kg, and more preferably 5060 mg/kg, and the administration frequency is preferably 16 times a day.

    [0075] The formulations for oral administration are exemplified by tablets, pills, hard/soft capsules, solutions, suspensions, emulsions, syrups, granules, and elixirs, etc. These formulations can include diluents (for example, lactose, dextrose, sucrose, mannitol, sorbitol, cellulose, and/or glycine) and lubricants (for example, silica, talc, stearate and its magnesium or calcium salt, and/or polyethylene glycol) in addition to the active ingredient. Tablets can include binding agents such as magnesium aluminum silicate, starch paste, gelatin, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrolidone, and if necessary disintegrating agents such as starch, agarose, alginic acid or its sodium salt or azeotropic mixtures and/or absorbents, coloring agents, flavours, and sweeteners can be additionally included thereto.

    [0076] In another aspect of the present invention, the present invention provides a cosmetic composition for skin whitening comprising a compound represented by formula 1 below, an optical isomer thereof or a pharmaceutically acceptable salt thereof as an active ingredient:

    ##STR00011##

    [0077] (In formula 1,

    [0078] R.sup.1 and R.sup.2 are independently straight or branched C.sub.1-6 alkyl).

    [0079] To investigate the skin whitening effect of the compound represented by formula 1 according to the present invention, the inhibitory effect of the compound on the expression of tyrosinase, TRP 1 (tyrosinase-related protein 1), TRP 2 (tyrosinase-related protein 2) or MITF (microphthalmia-associated transcription factor) gene was measured. As a result, the compound represented by formula 1 according to the present invention was confirmed to have excellent skin whitening effect because it was excellent in inhibiting the expression of tyrosinase, TRP 1 (tyrosinase-related protein 1), TRP 2 (tyrosinase-related protein 2) or MITF (microphthalmia-associated transcription factor) gene producing a precursor of melanin biosynthesis even at a low concentration (see Experimental Examples 13 and FIGS. 2-4).

    [0080] The antioxidative effect of the compound represented by formula 1 according to the present invention was also measured. As a result, the compound represented by formula 1 of the present was confirmed to have excellent antioxidative effect even at a low concentration (see Experimental Example 4 and FIG. 5).

    [0081] The cytotoxicity of the compound represented by formula 1 according to the present invention was also measured. As a result, the compound represented by formula 1 of the present was confirmed to have low cytotoxicity (see Experimental Example 5 and FIG. 6).

    [0082] The degree of inhibition of melanin synthesis by the compound represented by formula 1 according to the present invention was also measured. As a result, the compound represented by formula 1 of the present invention was confirmed to be excellent in inhibiting melanin synthesis even at a low concentration (see Experimental Example 6 and FIG. 7).

    [0083] In addition, the inhibitory effect of the compound represented by formula 1 according to the present invention on the activity of tyrosinase was measured. As a result, the compound represented by formula 1 of the present was confirmed to have excellent inhibitory effect on the activity of tyrosinase even at a low concentration (see Experimental Example 7 and FIG. 8).

    [0084] In the preparation of a composition for improving skin condition comprising a compound represented by formula 1 or a pharmaceutically acceptable salt thereof, the compound represented by formula 1 or the pharmaceutically acceptable salt thereof is preferably added to the composition for improving skin condition at the concentration of 330 weight part and preferably 520 weight part.

    [0085] The cosmetic composition of the present invention can include, in addition to the compound represented by formula 1 or the pharmaceutically acceptable salt thereof of the present invention, a supplement generally used in the field of skin science such as fatty substance, organic solvent, resolvent, concentrate, gelling agent, softener, antioxidant, suspending agent, stabilizer, foaming agent, odorant, surfactant, water, ionic or non-ionic emulsifying agent, filler, sequestering agent, chelating agent, preserving agent, vitamin, blocker, moisturing agent, essential oil, dye, pigment, hydrophilic or hydrophobic activator, lipid vesicle or other components generally used in the field of skin science.

    [0086] The said components can be included in the amounts generally used in the field of skin science.

    [0087] The cosmetic composition of the present invention can be formulated in any form that can be accepted in the art, which is exemplified by solution, external ointment, cream, foam, nutritive lotion, skin, pack, makeup base, essence, soap, liquid detergent, bath preparation, sun screen cream, sun oil, suspension, emulsion, paste, gel, lotion, powder, surfactant-containing cleansing, oil, powdered foundation, emulsified foundation, wax foundation, patch and spray, but not always limited thereto.

    [0088] In addition, the cosmetic composition of the present invention can additionally include one or more cosmetically acceptable carriers. As a general component, oil, water, surfactant, moisturizer, lower alcohol, thickener, chelating agent, coloring agent, antiseptic, perfume, and the like can be properly blended.

    [0089] The cosmetically acceptable carrier to be included in the cosmetic composition of the present invention varies depending on the formulations. In the case that the cosmetic composition is formulated as ointment, paste, cream or gel, the proper carrier can be selected from the group consisting of animal oil, vegetable oil, wax, paraffin, starch, tragacanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, zinc oxide and mixtures thereof.

    [0090] In the case that the cosmetic composition is formulated as powder or spray, the proper carrier can be selected from the group consisting of lactose, talc, silica, aluminum hydroxide, calcium silicate polyamide powder and mixtures thereof, and in particular if the composition of the present invention is formulated as spray, a propellant such as chlorofluorohydrocarbon, propane/butane or dimethyl ether can be additionally included.

    [0091] In the case that the cosmetic composition is formulated as liquid or emulsion, the proper carrier can be selected from the group consisting of solvent, solubilizer and emulsifier, which is exemplified by water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol and fatty acid ester of sorbitan.

    [0092] In the case that the cosmetic composition is formulated as suspension, the proper carrier can be selected from the group consisting of liquid diluent such as water, ethanol or propylene glycol, suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, microcrystalline cellulose, aluminum methahydroxide, bentonite, agar, and tragacanth.

    [0093] In the case that the cosmetic composition is formulated as soap, the proper carrier can be selected from the group consisting of alkali metal salt of fatty acid, hemiester salt of fatty acid, protein hydrolizate of fatty acid, isethionate, lanolin derivative, aliphatic alcohol, vegetable oil, glycerol, and sugar.

    [0094] The present invention also provides a method of skin whitening comprising a step of applying the compound represented by formula 1 to the skin of a subject. The subject includes, without limitation, mammals including rats, livestock, humans, and the like.

    [0095] In another aspect of the present invention, the present invention provides an antioxidative composition comprising a compound represented by formula 1 below, an optical isomer thereof or a pharmaceutically acceptable salt thereof as an active ingredient:

    ##STR00012##

    [0096] (In formula 1,

    [0097] R.sup.1 and R.sup.2 are independently straight or branched C.sub.1-6 alkyl).

    [0098] The antioxidative effect of the compound represented by formula 1 according to the present invention was measured. As a result, the compound represented by formula 1 of the present was confirmed to have excellent antioxidative effect even at a low concentration (see Experimental Example 4 and FIG. 5).

    [0099] The cytotoxicity of the compound represented by formula 1 according to the present invention was also measured. As a result, the compound represented by formula 1 of the present was confirmed to have low cytotoxicity (see Experimental Example 5 and FIG. 6).

    [0100] In another aspect of the present invention, the present invention provides a health functional food for skin whitening comprising a compound represented by formula 1 below, an optical isomer thereof or a pharmaceutically acceptable salt thereof as an active ingredient:

    ##STR00013##

    [0101] (In formula 1,

    [0102] R.sup.1 and R.sup.2 are independently straight or branched C.sub.1-6 alkyl).

    [0103] In this description, the term health functional food indicates the food prepared by adding the compound represented by formula 1 to food materials such as beverages, tea, spices, gums and snacks or the food prepared in such forms as capsule, powder and suspension with the compound which can bring a beneficiary effect on health. Unlike general medicines, their raw materials are food ingredients so that they have no side effects for a long term administration. The health functional food of the present invention obtained as the above can be taken daily, so that it is expected to bring excellent skin whitening effect, indicating that the health functional food is very useful.

    [0104] The compound represented by formula 1 or the pharmaceutically acceptable salt thereof of the present invention can be added as it is or as mixed with other food components according to the conventional method. The mixing ratio of active ingredients can be regulated according to the purpose of use (prevention or amelioration). In general, to produce a health functional, the compound is added preferably by 0.190 weight part. However, if long term administration is required for health and hygiene or regulating health condition, the content can be lower than the above but higher content can be accepted as well since the compound has been proved to be very safe.

    [0105] The composition for health beverages of the present invention can additionally include various flavors or natural carbohydrates, etc, like other beverages in addition to the compound. The natural carbohydrates above can be one of monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xilytole, sorbitol and erythritol. Besides, natural sweetening agents (thaumatin, stevia extract, for example rebaudioside A, glycyrrhizin, etc.) and synthetic sweetening agents (saccharin, aspartame, etc.) can be included as a sweetening agent. The content of the natural carbohydrate is preferably 120 g and more preferably 512 g in 100 g of the composition of the present invention.

    [0106] In addition to the ingredients mentioned above, the compound represented by formula 1 or the pharmaceutically acceptable salt thereof of the present invention can include in variety of nutrients, vitamins, minerals (electrolytes), flavors including natural flavors and synthetic flavors, coloring agents and extenders (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acid, protective colloidal viscosifiers, pH regulators, stabilizers, antiseptics, glycerin, alcohols, carbonators which used to be added to soda, etc. The compound represented by formula 1 or the pharmaceutically acceptable salt thereof of the present invention can also include natural fruit juice, fruit beverages and/or fruit flesh addable to vegetable beverages.

    [0107] The compound represented by formula 1 according to the present invention is excellent in inhibiting the expression of tyrosinase, TRP 1 (tyrosinase-related protein 1), TRP 2 (tyrosinase-related protein 2) or MITF (microphthalmia-associated transcription factor) gene which produces a precursor necessary for the generation of melanin even at a low concentration and is also excellent in suppressing the activity of tyrosinase, so that it eventually inhibits the production of melanin. In addition, the cell survival rate is maintained at about 80% even when the concentration of the compound according to the present invention is increased, that is, the compound has a significantly low cytotoxicity indicating that the compound is safe, and has low side effects and excellent antioxidative effects. Therefore, the compound of the present invention can be effectively used as a pharmaceutical composition for skin whitening, a cosmetic composition for skin whitening, a health functional food for skin whitening, and an antioxidative composition.

    [0108] Practical and presently preferred embodiments of the present invention are illustrative as shown in the following Examples.

    [0109] However, it will be appreciated that those skilled in the art, on consideration of this disclosure, may make modifications and improvements within the spirit and scope of the present invention.

    EXAMPLE 1

    Preparation of (1E,3E,5E)-1,6-bis(2,3-dimethoxyphenyl)hexa-1,3,5-triene

    [0110] ##STR00014##

    Step 1

    Preparation of (E)-tetraethyl but-2-ene-1,4-diylphosphonate

    [0111] Triethylphosphite (4 mL) solution containing trans-1,4-dibromobutene (2.0 g, 9.35 mmol) was refluxed for 5 hours. The reaction solution was cooled down and the solvent was eliminated. The residue was purified by silica gel column chromatography (eluent=hexane/ethylacetate=) and as a result, (E)-tetraethyl but-2-ene-1,4-diyldiphosphonate (3.12 g, 99%) was obtained.

    [0112] .sup.1H NMR (300 MHz, DMSO) 5.58-5.46 (m, 2H), 4.08-3.91 (m, 8H), 2.65 (ddd, J=17.5, 10.0, 7.2 Hz, 4H), 1.21 (q, J=7.1 Hz, 12H).

    Step 2

    Preparation of (1E,3E,5E)-1,6-bis(2,3-dimethoxyphenyl)hexa-1,3,5-triene

    [0113] Tetrahydrofuran (THF) solution containing (E)-tetraethyl but-2-ene-1,4-diyldiphosphonate (0.5 g, 1.52 mmol, 0.6 eq) obtained in step 1 above and 2,3-dimethoxybenzaldehyde (1 eq) was added to THF solution in which NaH (1.5 eq) was suspended. The reaction mixture was stirred at room temperature for 25 hours, followed by extraction with methylene chloride and NH.sub.4Cl aqueous solution. The organic layer was dried and filtered, and the solvent was evaporated. The residue was purified by silica gel column chromatography (eluent=hexane/ethylacetate=2/1) and as a result, a target compound (0.30 g, yield 56%) was obtained.

    [0114] .sup.1H NMR (300 MHz, DMSO) 7.21-7.17 (m, 2H), 7.11-6.97 (m, 3H), 7.04-6.81 (m, 5H), 6.64-6.57 (m, 2H), 3.93 (s, 6H) , 3.89 (s, 6H).

    COMPARATIVE EXAMPLE 1

    Preparation of 4,4-((1E,3E,5E)-hexa-1,3,5-triene-1,6-diyl)bis(2-methoxyphenol)

    [0115] ##STR00015##

    Step 1

    Preparation of 4-(tert-butyldimethylsilyloxy)-3-methoxybenzaldehyde

    [0116] Tert-butyldimethylsilyl chloride (1.25 eq) was added to THF solution containing 4-hydroxy-3-methoxybenzaldehyde (1.0 eq) and imidazole (2.5 eq). The reaction mixture was stirred at room temperature, followed by extraction with methylene chloride and NH.sub.4Cl aqueous solution. The organic layer was dried and filtered, and the solvent was evaporated. The residue was purified by silica gel column chromatography (eluent=hexane/ethylacetate=50/1) and as a result, a target compound was obtained.

    Step 2

    Preparation of (1E,3E,5E)-1,6-bis(4-(tert-butyldimethylsilyloxy)-3-methoxyphenyl)hexa-1,3,5-triene

    [0117] (1E,3E,5E)-1,6-bis(4-(tert-butyldimethylsilyloxy)-3-methoxyphenyl)hexa-1,3,5-triene was obtained (yield 55%) by the same manner as described in step 2 of Example 1 except 4-(tert-butyldimethylsilyloxy)-3-methoxybenzaldehyde obtained in step 1 above was used instead of 2-methoxybenzaldehyde.

    Step 3

    Preparation of 4,4-((1E,3E,5E)-hexa-1,3,5-triene-1,6-diyl)bis(2-methoxyphenol)

    [0118] Tetra-n-butylammonium fluoride (TBAF, 2.05 eq) was added to THF solution containing (1E,3E,5E)-1,6-bis(4-(tert-butyldimethylsilyloxy)-3-methoxyphenyl)hexa-1,3,5-triene (0.050 g, 0.0904 mmol), followed by stirring at room temperature for 5 hours. Then, THF was eliminated in vacuum condition. The residue was diluted in ethyl acetate (100 mL). The ethyl acetate layer was washed with water (50 ml*2) and the organic layer was dried over anhydrous sodium sulfate. The solvent was eliminated in vacuum condition, followed by silica gel column chromatography (10% EA/Hx) for purification. As a result, a target compound was obtained (yield 99%).

    [0119] .sup.1H NMR (500 MHz, CDCl.sub.3) 6.96 (d, J=7.6 Hz, 4H), 6.90 (d, J=8.2 Hz, 2H), 6.80-6.73 (m, 2H), 6.55 (s, 1H), 6.51 (s, 1H), 6.49 (dd, J=7.0, 3.0 Hz, 2H), 5.66 (s, 2H), 3.96 (s, 6H).

    COMPARATIVE EXAMPLE 2

    Preparation of (E)-4-((4-methoxyphenylimino)methyl)benzene-1,3-diol

    [0120] ##STR00016##

    [0121] 2,4-Dihydroxybenzaldehyde (200 mg) and p-anisidine (1.0 eq.) were added to ethyl alcohol (4 mL) solvent. The mixture was stirred at room temperature for 30 minutes. Water was added thereto, the reaction mixture was maintained at 0 C. The resulting precipitate was filtered and washed with water. As a result, a target compound was obtained.

    [0122] .sup.1H NMR (300 MHz, DMSO-d.sub.6) 10.18 (br s, 1H), 8.77 (s, 1H), 7.41-7.31 (m, 3H), 7.04-6.98 (m, 2H), 6.39 (dd, J=9.0, 3.0 Hz, 1H), 6.29 (d, J=3.0 Hz, 1H), 3.78 (s, 3H).

    COMPARATIVE EXAMPLE 3

    Preparation of 4,4-((1E,3E,5E)-hexa-1,3,5-triene-1,6-diyl)diphenol

    [0123] ##STR00017##

    [0124] (E)-tetraethyl but-2-ene-1,4-diyldiphosphonate solution (0.6 eq.) dissolved in THF solvent and TBS(tert-butyldimethylsil)-protected 4-hydroxybenzaldehyde solution (1.0 eq.) dissolved in THF solvent were added to NaH (1.5 eq.) suspension dissolved in THF (tetrahydrofuran), followed by stirring at room temperature for 25 hours. The reaction mixture was distributed between methylene chloride and NH.sub.4Cl aqueous solution. The organic layer was dried, filtered and evaporated. The residue was purified by silica gel column chromatography using hexane and ethyl acetate (EtOAc) (2:1). As a result, triene was obtained. 12 N HCl was added to triene solution in THF and methanol (4:1) solvent. The reaction mixture was stirred at room temperature for overnight. The reaction mixture was distributed between ethyl acetate (EtOAc) and water. The organic layer was washed with NaHCO.sub.3 aqueous solution. The organic layer was dried, filtered and evaporated. The residue was purified by silica gel column chromatography and as a result, a target compound was obtained.

    [0125] .sup.1H NMR (300 MHz, DMSO-d.sub.6) 9.59 (br s, 2H) , 7.31 (d, J=9 Hz, 4H) , 6.83-6.72 (m, 6H) , 6.54-6.44 (m, 4H).

    COMPARATIVE EXAMPLE 4

    Preparation of 5,5-((1E,3E,5E)-hexa-1,3,5-triene-1,6-diyl)bis(2-methoxyphenol)

    [0126] ##STR00018##

    [0127] (E)-tetraethyl but-2-ene-1,4-diyldiphosphonate solution (0.6 eq.) dissolved in THF solvent and TBS(tert-butyldimethylsil)-protected 3-hydroxy-4-methoxy benzaldehyde solution (1.0 eq.) dissolved in THF solvent were added to NaH (1.5 eq.) suspension dissolved in THF (tetrahydrofuran), followed by stirring at room temperature for 5 hours. The reaction mixture was distributed between methylene chloride and NH.sub.4Cl aqueous solution. The organic layer was dried, filtered and evaporated. The residue was purified by silica gel column chromatography using hexane and ethyl acetate (EtOAc) (2:1). As a result, triene was obtained. 12 N HCl was added to triene solution in THF and methanol (4:1) solvent. The reaction mixture was stirred at room temperature for overnight. The reaction mixture was distributed between ethyl acetate (EtOAc) and water. The organic layer was washed with NaHCO.sub.3 aqueous solution. The organic layer was dried, filtered and evaporated. The residue was purified by silica gel column chromatography and as a result, a target compound was obtained.

    [0128] .sup.1H NMR (300 MHz, DMSO-d.sub.6) 8.97 (br s, 2H) , 7.42-7.32 (m, 1H), 7.12-6.78 (m, 7H), 6.55-6.47 (m, 2H), 6.26-6.12 (m, 2H), 3.85 (dd, J=9.0, 3.0 Hz, 6H).

    EXPERIMENTAL EXAMPLE 1

    Evaluation of Inhibition of Tyrosinase Gene Expression

    [0129] The following experiment was performed to evaluate the tyrosinase gene expression inhibition by the compound of example of the present invention.

    [0130] B16F10 melanoma cells were distributed in a 6-well plate, to which -MSH (10 nM) (melanin synthesis inducing substance, alpha-melanocyte-stimulating hormone) and the compounds of example and comparative examples 14 were treated at the concentration of 2 M each, followed by exposure-culture for 72 hours. Then, the cells were harvested and total RNA of the cells was extracted using RNeasy mini kit (Qiagen). CDNA was synthesized by using M-MLV reverse transcriptase, 5X first-strand butter, dNTP mix and oligo(dT) primer (Thermo Fisher Scientific). The cDNA product, the primers of each gene and LightCycler MultiplexMasters (Roche) were mixed, followed by SYBR Green-based real-time PCR using LightCycler NanoInstrument (Roche). To relatively evaluate the level of tyrosinase mRNA expression, the expression was corrected based on the level of -actin mRNA expression. The PCR conditions for gene amplification are as follows.

    [0131] Denaturation: 95 C., 10 seconds

    [0132] Annealing: melting point of each primer, 10 seconds

    [0133] Extension/Detection: 72 C., 20 seconds

    [0134] Total cycle number: 45 cycles

    [0135] Information on the primers used for the amplification of tyrosinase gene expression and information on the primers for -actin used as a correction gene are as follows.

    TABLE-US-00001 (SEQ ID NO. 1) bACT-F: ACTATTGGCAACGAGCGGTT (SEQ ID NO. 2) bACT-R: ATGGATGCCACAGGATTCCA (SEQ ID NO. 3) TYR-F: CCTCCTGGCAGATCATTTGT (SEQ ID NO. 4) TYR-R: GGCAAATCCTTCCAGTGTGT

    [0136] FIG. 2 is a graph illustrating the inhibitory effect of the compound of the present invention on tyrosinase gene expression, evaluated in Experimental Example 1 (vertical axis: relative expression level).

    [0137] As shown in FIG. 2, the compound of example of the present invention was excellent in inhibiting tyrosinase gene expression. On the other hand, the group treated with the compound of comparative example 1 showed similar level of gene expression as the untreated group, indicating that the compound of comparative example 1 hardly had inhibitory effect on the expression of tyrosinase gene. The compounds of comparative examples 24 also displayed lower inhibitory effect than the compound of example of the present invention, indicating that the compound of example of the present invention was most excellent in inhibiting tyrosinase gene expression.

    EXPERIMENTAL EXAMPLE 2

    Evaluation of Inhibition of MITF (Microphthalmia-Associated Transcription Factor) Gene Expression

    [0138] The following experiment was performed to evaluate the MITF (microphthalmia-associated transcription factor) gene expression inhibition by the compound of example of the present invention.

    [0139] Evaluation of MITF gene expression was performed by the same manner as described in the evaluation of tyrosinase gene expression in experimental example 1. Information on the primers used for the amplification of MITF gene expression is as follows.

    TABLE-US-00002 (SEQ ID NO. 5) MITE-F: AGGACCTTGAAAACCGACAG (SEQ ID NO. 6) MITF-R: GTGGATGGGATAAGGGAAAG

    [0140] FIG. 3 is a graph illustrating the inhibitory effect of the compound of the present invention on MITF gene expression, evaluated in Experimental Example 2 (vertical axis: relative expression level)

    [0141] As shown in FIG. 3, the compound of example of the present invention was excellent in inhibiting MITF gene expression. On the other hand, the groups treated with the compounds of comparative examples 14 showed higher level of MITF gene expression (23 times) than the group treated with the compound of example of the present invention, indicating that the compounds of comparative examples 14 hardly had inhibitory effect on the expression of MITF gene.

    EXPERIMENTAL EXAMPLE 3

    Evaluation of Inhibition of TRP 1 (Tyrosinase-Related Protein 1) and TRP 2 (Tyrosinase-Related Protein 2) Gene Expression

    [0142] The following experiment was performed to evaluate the TRP 1 (tyrosinase-related protein 1) and TRP 2 (tyrosinase-related protein 2) gene expression inhibition by the compound of example of the present invention.

    [0143] Evaluation of TRP 1 and TRP 2 gene expression was performed by the same manner as described in the evaluation of tyrosinase gene expression. Information on the primers used for the amplification of TRP 1 and TRP 2 gene expression is as follows.

    TABLE-US-00003 (SEQ ID NO. 7) TRP1-F, CTTGGAGGTCCGTGTATTTG (SEQ ID NO. 8) TRP1-R, GACCGCATCAGTGAAAGTGT (SEQ ID NO. 9) TRP2-F, TACCATCTGTTGTGGCTGGA (SEQ ID NO. 10) TRP2-R, CAAGCTGTCGCACACAATCT

    [0144] FIG. 4 is a set of graphs illustrating the inhibitory effect of the compound of the present invention on TRP 1 and TRP 2 gene expression, evaluated in Experimental Example 3 (vertical axis: relative expression level). FIG. 4a: TRP 1, FIG. 4b: TRP 2

    [0145] As shown in FIG. 4, the compound of example of the present invention was excellent in inhibiting TRP1 and TRP2 gene expression. On the other hand, the groups treated with the compounds of comparative examples 14 showed higher level of TRP1 and TRP2 gene expression (1.22 times) than the group treated with the compound of example of the present invention. In particular, the groups treated with the compounds of comparative examples 1, 3 and 4 showed similar level of TRP 2 gene expression as the untreated group, indicating that the compounds of comparative examples had significantly low inhibitory effect on the expression of TRP 1 and TRP 2 gene.

    EXPERIMENTAL EXAMPLE 4

    Evaluation of Antioxidative Effect

    [0146] The following experiment was performed to evaluate antioxidative effect of the compound of example of the present invention.

    [0147] The antioxidative effect was evaluated by 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging activity test.

    [0148] Dimethyl sulfoxide (DMSO), vitamin C and the compounds of example and comparative examples 14 were added to a 96-well plate at each designated concentration, and 200 L of 200 M DPPH methanolic solution was added to each well. The plate was shaken gently to mix them all, followed by reaction at 37 C. for 30 minutes. Then, OD.sub.515 was measured. DMSO was used as the control for the measurement of antioxidative effect and vitamin C was used as the positive control for the measurement of antioxidative effect.

    [0149] FIG. 5 is a graph illustrating the antioxidative effect of the compound of the present invention, evaluated in Experimental Example 4 (vertical axis: radical scavenging activity, horizontal axis: concentration).

    [0150] As shown in FIG. 5, the compound of example of the present invention displayed excellent antioxidative effect at the concentration of about 25 M, compared with the compounds of comparative examples 13. Compared with the compounds of comparative examples 14, the compound of example of the present invention displayed excellent antioxidative effect at the concentration of 40 M.

    EXPERIMENTAL EXAMPLE 5

    Evaluation of Cytotoxicity

    [0151] The following experiment was performed to evaluate cytotoxicity of the compound of example of the present invention.

    [0152] B16F10 melanoma cells were distributed in a 96-well plate at the density of 210.sup.3 cells/well. The cells were cultured in DMEM supplemented with 10% fetal bovine serum (FBS) at 37 C. in 5% CO.sub.2 for 24 hours. The cells were exposed on the compounds of example and comparative examples 14 at the set concentration each for 48 hours. MTT assay was performed to evaluate cytotoxicity. To perform MTT assay, MTT solution was added to the cells, followed by reaction for 2 hours. Then, DMSO was added thereto to dissolve formazan crystals, followed by measurement of OD.sub.570.

    [0153] FIG. 6 is a graph illustrating the cytotoxicity of the compound of the present invention, evaluated in Experimental Example 5 (vertical axis: cell viability).

    [0154] As shown in FIG. 6, despite increasing the concentration of the compound of example of the present invention from 5 M to 15 M, the cell survival rate was maintained at 80% or more. That is, the compound of the present invention exhibited excellent skin whitening effect and at the same time displayed no cytotoxicity, so that it had both pharmacological effect and safety, and has an effect of reducing side effects caused by toxicity.

    [0155] On the other hand, the compounds of comparative examples 14 displayed lower skin whitening effect than the compound of example of the present invention. In particular, the compounds of comparative examples 1, 3 and 4 demonstrated strong cytotoxicity at the concentration of 10 M or more, indicating that the safety was low and thereby side effects were predicted.

    EXPERIMENTAL EXAMPLE 6

    Evaluation of Melanin Synthesis Inhibition

    [0156] The following experiment was performed to evaluate the inhibitory effect of the compound of example of the present invention on melanin synthesis.

    [0157] B16F10 melanoma cells were distributed in a 96-well plate at the density of 310.sup.5 cells/well. The cells were cultured in DMEM supplemented with 10% FBS at 37 C. in 5% CO.sub.2 for 24 hours. The cells were treated with -MSH (10 nM) and the compounds of example and comparative examples 14 at the concentration of 2 M each, followed by culture for 72 hours. The cells were harvested, followed by dissolving in 1 N NaOH by heating at 80 C. for 20 minutes. Then, OD.sub.490 was measured. The melanin synthesis inhibition rate was calculated as follows.

    [0158] Melanin inhibition rate (%)=[(CS)/C]100

    [0159] C: OD when -MSH alone was treated.

    [0160] S: OD when each sample was treated.

    [0161] FIG. 7 is a set of graphs illustrating the inhibitory effect of the compound of the present invention on the production of melanin, evaluated in Experimental Example 6 (vertical axis: melanin content (compared to control), Media: cell culture fluid, -MSH: alpha-melanocyte-stimulating hormone (10 nM), RES: melanin synthesis inhibitor (Resveratrol, 10 M)).

    [0162] As shown in FIG. 7, the compound of example of the present invention was confirmed to have inhibitory effect on melanin synthesis. Particularly, when the cells were treated with the compound of example of the present invention at the concentration of 1 M, the melanin content was lower in both media and cells than when the cells were treated with the compounds of comparative examples 14. In particular, the melanin content in the cells treated with the compound of example was significantly lower than the cells treated with the compounds of comparative examples, indicating that the compound of the present invention had excellent inhibitory effect on melanin synthesis.

    EXPERIMENTAL EXAMPLE 7

    Evaluation of Tyrosinase Activity Inhibition

    [0163] The following experiment was performed to evaluate the inhibitory effect of the compound of example of the present invention on tyrosinase activity and the results are shown in FIG. 8.

    [0164] Samples were dissolved in an organic solvent such as ethanol, which were diluted in a proper buffer such as 100 mM phosphate buffer (pH 7.0). Those samples diluted at a proper concentration in order to inhibit the activity to DOPA oxidation reaction were used as the sample solutions for the experiment. 850 L of 100 mM phosphate buffer (pH 7.0), 50 L of the sample solution and 50 L of mushroom tyrosinase (2000 U/ml) were loaded in a test tube in that order, followed by reaction at 37 C. for 5 minutes. 50 L of 0.06 mM L-DOPA (L-3,4-dihydroxyphenylalanine) solution was added thereto, and then OD.sub.47.5 was measured using a microplate reader. After reacting the solution at 37 C. for 15 minutes, OD.sub.47.5 was measured again. DMSO was used as the control and Kojic acid was used for the positive control.

    [0165] Tyrosinase activity inhibition rate (%)=[(A-B)/A]100

    [0166] A: difference of OD in the control group (OD after the reactionOD before the reaction)

    [0167] B: difference of OD in the experimental group (OD after the reactionOD before the reaction)

    [0168] FIG. 8 is a graph illustrating the inhibitory effect of the compound of the present invention on the activity of tyrosinase, evaluated in Experimental Example 7 (vertical axis: tyrosinase activity (% of control), horizontal axis: concentration).

    [0169] As shown in FIG. 8, the compound of example of the present invention was confirmed to have inhibitory effect on tyrosinase activity. Particularly, when the compound of example of the present invention was treated to the cells at the concentration of 6.25 M, the tyrosinase activity therein was reduced approximately 20%. Compared with that the compounds of comparative examples 2 and 3 treated to the cells at an equal concentration to the above did not show inhibitory effect on tyrosinase activity, the compound of example of the present invention was confirmed to have excellent inhibitory effect on tyrosinase activity.

    [0170] Therefore, the compound represented by formula 1 of the present invention is excellent in inhibiting the expression of tyrosinase, TRP 1 (tyrosinase-related protein 1), TRP 2 (tyrosinase-related protein 2) or MITF (microphthalmia-associated transcription factor) gene which produces a precursor necessary for the generation of melanin even at a low concentration and is also excellent in suppressing the activity of tyrosinase, so that it eventually inhibits the production of melanin. In addition, the cell survival rate is maintained at about 80% even when the concentration of the compound according to the present invention is increased, that is, the compound has a significantly low cytotoxicity indicating that the compound is safe, and has low side effects and excellent antioxidative effects. Therefore, the compound of the present invention can be effectively used as a pharmaceutical composition for skin whitening, a cosmetic composition for skin whitening, a health functional food for skin whitening, and an antioxidative composition.

    MANUFACTURING EXAMPLE 1

    Preparation of Powders

    [0171]

    TABLE-US-00004 Compound represented by formula 1 2 g Lactose 1 g

    [0172] Powders were prepared by mixing all the above components, which were filled in airtight packs according to the conventional method for preparing powders.

    MANUFACTURING EXAMPLE 2

    Preparation of Tablets

    [0173]

    TABLE-US-00005 Compound represented by formula 1 100 mg Corn starch 100 mg Lactose 100 mg Magnesium stearate 2 mg

    [0174] Tablets were prepared by mixing all the above components by the conventional method for preparing tablets.

    MANUFACTURING EXAMPLE 3

    Preparation of Capsules

    [0175]

    TABLE-US-00006 Compound represented by formula 1 100 mg Corn starch 100 mg Lactose 100 mg Magnesium stearate 2 mg

    [0176] Capsules were prepared by mixing all the above components, which were filled in gelatin capsules according to the conventional method for preparing capsules.

    MANUFACTURING EXAMPLE 4

    Preparation of Injectable Solutions

    [0177]

    TABLE-US-00007 Compound represented by formula 1 100 mg Mannitol 180 mg Na.sub.2HPO.sub.42H.sub.2O 26 mg Distilled water 2974 mg

    [0178] Injectable solutions were prepared by incorporating all the above components in the prescribed amounts according to the conventional method for preparing injectable solutions.

    MANUFACTURING EXAMPLE 5

    Preparation of Ointments

    [0179]

    TABLE-US-00008 Compound represented by formula 1 5 g Cetyl Palmitate 20 g Cetanol 40 g Stearyl Alcohol 40 g Myristanisopropyl 80 g Polysorbate 60 g Propyl -hydroxybenzoate 1 g Methyl -hydroxybenzoate 1 g

    [0180] Phosphoric acid and purified water proper amount ointments were prepared by incorporating all the above components in the prescribed amounts according to the conventional method for preparing ointments.

    MANUFACTURING EXAMPLE 6

    Preparation of Health Functional Food

    [0181]

    TABLE-US-00009 Compound represented by formula 1 500 ng Vitamin complex proper amount Vitamin A acetate 70 mg Vitamin E 1.0 mg Vitamin B1 0.13 mg Vitamin B2 0.15 mg Vitamin B6 0.5 mg Vitamin B12 0.2 mg Vitamin C 10 mg Biotin 10 mg Nicotinic acid amide 1.7 mg Folic acid 50 mg Calcium pantothenate 0.5 mg Minerals proper amount Ferrous sulfate 1.75 mg Zinc oxide 0.82 mg Magnesium carbonate 25.3 mg Potassium phosphate monobasic 15 mg Potassium phosphate dibasic 55 mg Potassium citrate 90 mg Calcium carbonate 100 mg Magnesium chloride 24.8 mg

    [0182] Vitamins and minerals were mixed according to the preferable composition rate for health functional food. However, the composition rate can be adjusted. The constituents were mixed according to the conventional method for preparing health functional food and then the composition for health functional food was prepared according to the conventional method.

    MANUFACTURING EXAMPLE 7

    Preparation of Health Beverages

    [0183]

    TABLE-US-00010 Compound represented by formula 1 500 ng Citric acidcustom-character 1000 mg Oligosaccharide 100 g Maesil (Prunus mume) extract 2 g Taurine 1 g Purified water 900 ml

    [0184] The above constituents were mixed according to the conventional method for preparing health beverages. The mixture was heated at 85 C. for 1 hour with stirring and then filtered. The filtrate was loaded in sterilized containers, which were sealed and sterilized again, stored in a refrigerator until they would be used for the preparation of a composition for health beverages.

    [0185] The constituents appropriate for favorite beverages were mixed according to the preferred mixing ratio but the composition ratio can be adjusted according to regional and national preferences, etc.

    MANUFACTURING EXAMPLE 8

    Preparation of Composition For Skin Beauty

    8-1 Preparation of Cream

    [0186]

    TABLE-US-00011 Compound represented by formula 1 4.6 weight part Setearylalcohol 2.8 weight part Bees Wax 2.6 weight part Stearic acid 1.4 weight part Lipophilic glycerylstearate 2 weight part PEG-100 stearate 1 weight part Sesquioleic acid sorbital 1.4 weight part Jojoba oil 4 weight part Squalan 3.8 weight part Polysorbate 60 1.1 weight part Macadamia oil 2 weight part Tocopherol acetate 0.2 weight part Methyl polysiloxane 0.4 weight part Ethylparaben 0.1 weight part Propylparaben 0.1 weight part Euxyl K-400 0.1 weight part 1,3-butylene glycol 7 weight part Methylparaben 0.05 weight part Glycerin 6 weight part d-panthenol 0.2 weight part Triethanolamine 0.2 weight part pt 41891 0.2 weight part p-H.sub.2O 46.05 weight part

    8-2 Preparation of Lotion

    [0187]

    TABLE-US-00012 Compound represented by formula 1 3.5 weight part Setearylalcohol 1.6 weight part Stearic acid 1.4 weight part Lipophilic glycerylstearate 1.8 weight part PEG-100 stearate 2.6 weight part Sesquioleic acid sorbital 0.6 weight part Squalene 4.8 weight part Macadamia oil 2 weight part Jojoba oil 2 weight part Tocopherol acetate 0.4 weight part Methyl polysiloxane 0.2 weight part Ethylparaben 0.1 weight part Propylparaben 0.1 weight part 1,3-butylene glycol 4 weight part Methylparaben 0.1 weight part Xanthan gum 0.1 weight part Glycerin 4 weight part d-panthenol 0.15 weight part Allantoin 0.1 weight part Carbomer(2% aq. Sol) 4 weight part Triethanolamine 0.15 weight part Ethanol 3 weight part pt 41891 0.1 weight part p-H.sub.20 48.3 weight part

    8-3 Preparation of Skin

    [0188]

    TABLE-US-00013 Compound represented by formula 1 0.2 weight % Ethanol 10.0 weight % Polylauric acid polyoxyethylenesorbitan 1.0 weight % Methyl -hydroxybenzoate 0.2 weight % Glycerin 5.0 weight % 1,3-butyl glycol 6.0 weight % Flavor proper amount Pigment proper amount Purified water proper amount Total 100

    8-4 Preparation of Nutritive Toner

    [0189]

    TABLE-US-00014 Compound represented by formula 1 0.1 weight % Vaseline 2.0 weight % Sesquioleic acid sorbitan 0.8 weight % Polyoxyethyleneoleylethyl 1.2 weight % Methyl -hydroxybenzoate proper amount Propylene glycol 5.0 weight % Ethanol 3.2 weight % Carboxyvinylpolymer 18.0 weight % Pigment proper amount Flavor proper amount Purified water proper amount Total 100

    8-5 Preparation of Essence

    [0190]

    TABLE-US-00015 Compound represented by formula 1 5.0 weight % Propylene glycol 10.0 weight % Glycerin 10.0 weight % Sodium hyaluronate solution (1%) 5.0 weight % Ethanol 3.2 weight % Polyoxyethylene hydrogenated caster oil 1.0 weight % Methyl -hydroxybenzoate 0.1 weight % Flavor proper amount Purified water proper amount Total 100

    8-6 Preparation of Pack

    [0191]

    TABLE-US-00016 Compound represented by formula 1 0.5 weight % Glycerin 5.0 weight % Propylene glycol 4.0 weight % Polyvinylalcohol 15.0 weight % Ethanol 8.0 weight % Polyoxyethyleneoleylethyl 1.0 weight % Methyl -hydroxybenzoate 0.2 weight % Flavor proper amount Pigment proper amount Purified water proper amount Total 100

    [0192] The constituents were mixed according to the preferred mixing ratio but the composition ratio can be adjusted according to regional and national preferences such as demand class, demand country and purpose of use, etc.