MICROSATELLITE INSTABILITY DETERMINING METHOD AND SYSTEM THEREOF

20230230661 · 2023-07-20

    Inventors

    Cpc classification

    International classification

    Abstract

    A method and a system used to determine microsatellite instability (MSI) status utilizing Next-Generation Sequencing (NGS) and a machine learning model are disclosed. The present disclosure further provides a method and a system for identifying a treatment based on the computed MSI status data for the human subject.

    Claims

    1. A computer-implemented method of generating a model for predicting a microsatellite instability (MSI) status, comprising: (a) collecting a clinical sample and an estimated MSI status data thereof; (b) sequencing, through next-generation sequencing (NGS), at least six microsatellite loci of the clinical sample so as to generate a sequencing data; (c) extracting a MSI feature from the sequencing data; (d) training a machine learning model by mapping a MSI feature data with the estimated MSI status data; and (e) outputting a trained machine learning model.

    2. The computer-implemented method of claim 1, wherein the MSI feature data is calculated by a baseline.

    3. The computer-implemented method of claim 2, wherein the baseline is established from a mean of each the MSI feature of each SSR region across normal samples.

    4. The computer-implemented method of claim 2, wherein the baseline is established from a mean peak width of each SSR region across normal samples.

    5. The computer-implemented method of claim 1, wherein the estimated MSI status data is retrieved from a cancer patient through an assay, comprising MSI-PCR assay, IHC or NGS-based MSI testing.

    6. The computer-implemented method of claim 1, wherein the machine learning model comprises a logistic regression model, a random forest model, an extremely randomized trees model, a polynomial regression model, a linear regression model, a gradient descent model, or an extreme gradient boost model.

    7. The computer-implemented method of claim 1, wherein the trained machine learning model comprises a defined weight of each microsatellite locus, and is predictive of the MSI status.

    8. The computer-implemented method of claim 1, wherein the trained machine learning model comprises a defined weight of the MSI feature in each microsatellite locus and is predictive of the MSI status.

    9. The computer-implemented method of claim 1, wherein the trained machine learning model has a cutoff value of 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, or 0.5.

    10. The computer-implemented method of claim 1, wherein the estimated MSI status data indicates microsatellite stability (MSS) or microsatellite instability-high (MSI-H).

    11. A computer-implemented method for determining a MSI status, comprising: (a) collecting a clinical sample from a subject; (b) sequencing, through NGS, at least six microsatellite loci of the clinical sample so as to generate a sequencing data; (c) extracting a MSI feature from the sequencing data; (d) inputting a MSI feature data into the trained machine learning model of claim 1; and (e) generating a computed MSI status.

    12. The computer-implemented method of claim 11, further comprising step (f): outputting the computed MSI status data to an electronic storage medium or a display.

    13. The computer-implemented method of claim 11, further comprising a step of identifying a treatment based on the computed MSI status data of the subject.

    14. The computer-implemented method of claim 13, further comprising a step of administering a therapeutically effective amount of the treatment to the subject.

    15. The computer-implemented method of claim 13, wherein the treatment comprises surgery, individual therapy, chemotherapy, radiation therapy, or immunotherapy.

    16. The computer-implemented method of claim 15, wherein the immunotherapy comprises a step of administering a drug selected from the group consisting of pembrolizumab, nivolumab, MEDI0680, durvalumab and ipilimumab.

    17. The computer-implemented method of claim 11, wherein the computed MSI status data indicates MSS or MSI-H.

    18. The computer-implemented method of claim 1 or 11, wherein the microsatellite loci is at least 7, 10, 15, 20, 30, 40, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550 or 600 loci.

    19. The computer-implemented method of claim 1 or 11, wherein the microsatellite loci with low coverage, unstable peak call, high variability in peak width or low weight are excluded.

    20. The computer-implemented method of claim 19, wherein the microsatellite loci with low coverage has a read depth lower than 5x, 10x, 15x, 20x, 25x, 30x, 35x, 40x, 45x or 50x from a sample on a locus.

    21. The computer-implemented method of claim 19, wherein the microsatellite loci with high variability in peak width has a peak width greater than 2 in 5 replicate runs, 3 in 6 replicate runs, 3 in 7 replicate runs, 3 in 8 replicate runs, 3 in 9 replicate runs, or 4 in 10 replicate runs.

    22. The computer-implemented method of claim 1 or 11, wherein the MSI feature comprises peak width, peak height, peak location, simple sequence repeat (SSR) type or any combination thereof.

    23. The computer-implemented method of claim 22, wherein the SSR type comprises mononucleotide with at least 10 repeats, dinucleotide with at least 6 repeats, trinucleotide with at least 5 repeats, tetranucleotide with at least 5 repeats, pentanucleotide with at least 5 repeats, and a complex nucleotide type of SEQ ID NOs: 1-37.

    24. The computer-implemented method of claim 1 or 11, wherein the clinical sample originates from cell line, biopsy, primary tissue, frozen tissue, formalin-fixed paraffin-embedded (FFPE), liquid biopsy, blood, serum, plasma, buffy coat, body fluid, visceral fluid, ascites, paracentesis, cerebrospinal fluid, saliva, urine, tears, seminal fluid, vaginal fluid, aspirate, lavage, buccal swab, circulating tumor cell (CTC), cell-free DNA (cfDNA), circulating tumor DNA (ctDNA), DNA, RNA, nucleic acid, purified nucleic acid, purified DNA, or purified RNA.

    25. The computer-implemented method of claim 1 or 11, wherein the clinical sample originates from a patient having cancer, solid tumor, hematologic malignancy, rare genetic disease, complex disease, diabetes, cardiovascular disease, liver disease, or neurological disease.

    26. The computer-implemented method of claim 1 or 11, wherein a tumor purity of the clinical sample is at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100%.

    27. A system for determining a MSI status, comprising: a data storage device storing instructions for determining characteristics of MSI status; and a processor configured to execute instructions to perform a method including: (a) training a machine learning model by mapping a training MSI feature data with a training estimated MSI status data; (b) collecting a clinical sample from a subject; (c) sequencing, through NGS, at least six microsatellite loci of the clinical sample so as to generate a sequencing data; (d) computing, by using a trained machine learning model having a MSI feature data extracting from the sequencing data, an estimated MSI status data; (e) generating a computed MSI status data; and (f) outputting the computed MSI status data.

    28. The system of claim 27, wherein the method further comprises step (g): identifying a treatment for the human subject based on the computed MSI status.

    29. The system of claim 28, wherein the method further comprises step (h): administering a therapeutically effective amount of a treatment to the human subject.

    Description

    BRIEF DESCRIPTION OF DRAWINGS

    [0040] One or more embodiments are illustrated by ways of example, and not by limitation, in the figures of the accompanying drawings, wherein elements are having the same reference numeral designations represent like elements throughout. The drawings are not to scale unless otherwise disclosed.

    [0041] FIGS. 1(a)-(c) are schematic diagrams illustrating the parameters used to characterize microsatellite instability.

    [0042] FIG. 2 is a ROC curve of the MSI model.

    [0043] FIG. 3 is Box plot of the MSI score in the validation data set.

    [0044] The drawings are only schematic and are non-limiting. In the drawings, the size of some of the elements may be exaggerated and not drawn on scale for illustrative purposes. The dimensions and the relative dimensions do not necessarily correspond to actual reductions to the practice of the disclosure.

    DETAILED DESCRIPTION OF THE INVENTION

    [0045] The making and using of the embodiments of the disclosure are discussed in detail below. It should be appreciated, however, that the embodiments provide many applicable inventive concepts that can be embodied in a wide variety of specific contexts. The specific embodiments discussed are merely illustrative of specific ways to make and use the embodiments and do not limit the scope of the disclosure.

    [0046] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by a person skilled in the art to which this disclosure belongs. As used herein, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise.

    [0047] As used herein, “microsatellite” means a tract of repetitive DNA in which certain DNA motifs are repeated. “Microsatellite loci” refers to the regions of the microsatellite. The terms “microsatellite” and “SSR,” as well as “microsatellite loci” and “SSR region” are used interchangeably, respectively, where the context allows. In some embodiments of the disclosure, type of microsatellite loci or SSR region refers to mono-, di-, tri-, tetra, or pentanucleotide repeats or certain complex nucleotide type in a nucleotide sequence. Preferably, type of the microsatellite loci or SSR region refers to mononucleotide with at least ten repeats, dinucleotide with at least six repeats, trinucleotide with at least five repeats, tetranucleotide with at least five repeats, pentanucleotide with at least five repeats, and the complex nucleotide type including but not limited to SEQ ID NOs: 1-37.

    [0048] As used herein, “MSI status” or “MMR status” refers to the presence of “MSI” or “unstable microsatellite (loci),” a clonal or somatic change in the number of repeated DNA nucleotide units in microsatellites. The present disclosure estimates the MSI status as MSS or MSI-H. “MSI-H” refers to those in which the number of repeats present in microsatellite loci differs significantly from the number of repeats that are in the DNA of a normal cell. “MSS” refers to those who have no functional defects in DNA MMR and have no significant differences between tumor and normal cell in microsatellite loci.

    [0049] As used herein, “cutoff value” or “threshold” refers to a numerical value or other representation whose value is used to arbitrate between two or more states of classification for a biological sample. In some embodiments of the disclosure, the cutoff value is set according to the training result of the machine learning model and is used to distinguish between MSI-H and MSS. If the MSI score is greater than the cutoff value, the MSI status is determined as MSI-H; or if the MSI score is less than the cutoff value, the MSI status is determined as MSS.

    [0050] As used herein, “peak” refers to a microsatellite distribution pattern in the microsatellite loci. The peak may be analyzed using data generated by next-generation sequencing, where the number of allele repeat length within each microsatellite locus is considered as peak width, the read counts of the most frequently observed allele is referred to as peak height, and the location difference between the peak height in each microsatellite locus of tumor tissue and reference genome is referred to as peak location. In some embodiments of the disclosure, peak width, peak height, or peak location are used as MSI features to estimate the MSI status.

    [0051] As shown in FIGS. 1(a) to 1(c), each locus is a short sequence repeat. When detected by PCR followed by Sanger sequencing or by Next-Generation Sequencing (NGS) methods, each microsatellite locus shows a pattern of a peak. A peak can be characterized by its peak width, peak height, and peak location. When a microsatellite locus becomes unstable, the peak width, peak height, and/or peak location may change. Here, the x-axis shows the alleles for each peak signal. For example, in FIG. 1(a), the first signal shows an allele with eight repeats of nucleotide A at that microsatellite locus. This peak has a peak width of 5, peak height of about 35%, and peak location at 11 A. Peak location can also be described by its chromosome position, such as chr4:55598211. The y-axis shows the percentage of reading count for a given peak signal as compared to the other peak signals. Therefore, the sum of peak height for a given peak is one. FIG. 1(a) shows the peak distribution when the peak width is widened from 5 to 8 when this locus becomes unstable. FIG. 1(b) shows that when a peak is unstable, the peak height may become lower. In this example, it went from 50% to 25%. FIG. 1(c) shows that when a peak is unstable, the peak location may change. In this example, it changed from 10 As to 12 As.

    [0052] Generally, to understand the MSI status, a matched paired analysis would be performed to identify microsatellite loci in the tumor that are different compared to matched normal tissue. “Matched normal tissue” or “normal pair tissue” as used herein refers to normal tissue from the same patient. However, in some embodiments of the disclosure, the machine learning model detects MSI status from NGS data without matched normal tissue. A pooled normal sample is used to establish the mean of each the MSI feature of each SSR region across the normal population as a baseline for MSI detection. Data from individual clinical tumor tissue will be compared to the peak pattern of the baseline data to determine microsatellite status for each SSR region in that sample.

    [0053] As used herein, “tumor purity” is the proportion of cancer cells in a tumor sample. Tumor purity impacts the accurate assessment of molecular and genomics features as assayed with NGS approaches. In some embodiments of the disclosure, the clinical sample has a tumor purity at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100%. Preferably, the present disclosure disclosure identifies the sample within the tumor purity at least 20%.

    [0054] As used herein, “depth” or “total depth” refers to the number of sequencing reads per location. “Mean depth,” “mean total depth,” or “total mean depth” refers to the average number of reads across the entire sequencing region. Generally, the total mean depth has an impact on the performance of the NGS assay. The higher the mean total depth, the lower the variability in the variant frequency of the variant. In some embodiments of the disclosure, the mean depth of the sample across the entire sequencing region is at least 200x, 300x, 400, 500x, 600x, 700x, 800x, 900x, 1000x, 2000x, 3000x, 4000x, 5000x, 6000x, 8000x, 10000x, or 20000x. Preferably, the mean depth of the sample across the entire sequencing region is at least 500x.

    [0055] As used herein, “coverage” refers to the total depth at a given locus and can be used interchangeably with “depth.” In some embodiments of the disclosure, “low coverage” means the read depth lower than 5x, 10x, 15x, 20x, 25x, 30x, 35x, 40x, 45x, or 50x from a sample on a locus.

    [0056] As used herein, “target base coverage” refers to the percentage of the sequenced region that is sequenced at a depth above a predefined value. Target base coverage needs to specify the depth at which it is evaluated. In some embodiments, the target base coverage at 100x is 85%. That means 85% of the target sequenced bases is covered by at least 100x depth of sequencing reads. In some embodiments, the target base coverage at 30x, 40x, 50x, 60x, 70x, 80x, 90x, 100x, 125x, 150x, 175x, 200x, 300x, 400x, 500x, 750x, 1000x is above 70%, 75%, 80%, 85%, 90%, or 95%.

    [0057] As used herein, “human subject” refers to those with formally diagnosed disorders, those without formally recognized disorders, those receiving medical attention, those at risk of developing the disorders, etc.

    [0058] As used herein, “treat,” “treatment,” and “treating” includes therapeutic treatments, prophylactic treatments, and applications in which one reduces the risk that a subject will develop a disorder or other risk factor. Treatment does not require the complete curing of a disorder and encompasses embodiments in which one reduces symptoms or underlying risk factors.

    [0059] As used herein, “therapeutically effective amount” means an amount of a therapeutically active molecule needed to elicit the desired biological or clinical effect. In preferred embodiments of the disclosure, “a therapeutically effective amount” is the amount of drug needed to treat cancer patients with MSI-H.

    [0060] The present disclosure is further illustrated by the following Examples, which are provided for the purpose of demonstration rather than limitation.

    EXAMPLE 1

    Training a Machine Learning Model for Detection of MSI Status

    [0061] Formalin-fixed paraffin-embedded (FFPE) samples were prepared from cancer patients through surgical or needle biopsy samples. Genomic DNA was extracted using QIAamp DNA FFPE Tissue Kit (QIAGEN, Hilden, Germany). Eighty nanograms of DNA were amplified using multiplexed PCR targeting a panel of 440 genes and 1.8 Mbps. The samples were sequenced by using Ion Proton or Ion S5 Prime (Thermo Fisher Scientific, Waltham, Mass.) system with the Ion PI or 540 Chip (Thermo Fisher Scientific, Waltham, Mass.) following manufacturer recommended protocol. Raw sequence reads were processed by the manufacturer-provided software Torrent Variant Caller (TVC) v5.2, and .bam and .vcf files were generated.

    [0062] (1) Candidate Loci Selection

    [0063] Using the MIcroSAtellite identification tool (MISA, Beier, Thiel, Munch, Scholz, & Mascher,

    [0064] 2017), SSR regions in the chromosomal regions covered by the ACTOnco Panel assay were identified. A total of 600 SSR regions, including mononucleotide with at least ten repeats, dinucleotide with at least six repeats, trinucleotide with at least five repeats, tetranucleotide with at least five repeats, pentanucleotide with at least five repeats, and complex nucleotide type, were identified by MISA. The sequences of the complex SSR regions are provided in Table 1.

    TABLE-US-00001 TABLE 1 Complex microsate11ite loci SEQ ID Size NO Microsatellite sequence (bp) 1 (A)11(T)10 21 2 (CA)10ctctctctct(CA)6ctcagt(CA)13 74 3 (AC)7atacttc(T)12 33 4 (TA)12(T)21 45 5 (A)19caaac(A)11 35 6 (T)16(TG)8 32 7 (A)10(AT)9 28 8 (AT)6tcttttctctatacatttatgcaaactt 77 g(T)10catttgatgacatcatattttgcagg 9 (T)10ctttttc(T)12 29 10 (TG)9(AG)9acagagac(AG)6 56 11 (T)10acaagaccatttttcattatgaatttg 68 taccatgtgtcagcacc(T)14 12 (GATG)10(GACG)5 60 13 (CAC)5catgc(CCA)6 38 14 (CAG)7caa(CAG)7 45 15 (A)12c(A)12 25 16 (AC)14(CA)7 42 17 (A)11g(A)10 22 18 (CT)8ata(TG)6(TA)6 43 19 (TG)9(AG)11 40 20 (TG)7tatgtatgtg(TA)7tc(TA)6gat 79 (ATAG)6 21 (A)13gaaaaag(A)11 31 22 (TA)11(T)10 32 23 (T)10caatccattcagacaactt(TTG)6ttt 75 tgtgtttttcggtg(T)11 24 (GCT)7gaagttgctgttgctgttgca(GCT)5 57 25 (ATG)8ataatgatgatagct(ATG)6 57 26 (A)12t(TA)11tttcgtggcaa(T)19 65 27 (T)11caaactttctc(T)14 36 28 (A)14gggaatagatact(A)14 41 29 (T)12cc(T)13 27 30 (T)27(GA)6 39 31 (TG)9(T)25 43 32 (T)11(A)11 22 33 (A)12g(A)10gaa(AAG)7 47 34 (AC)6(GC)6(AC)16 56 35 (TCTG)5(TC)10(TA)8 56 36 (GA)10ggg(AAAT)11 67 37 (TG)11tttttt(C)11(T)11 50
    Note: The uppercase sequences in parenthesis are the sequences being repeated by the number of times indicated by the number following it. Lowercase sequences not in parenthesis are sequences between two repetition regions within one identified loci.

    [0065] We first examined the chromosomal location of each SSR region. A total of 34 SSR loci were found located on the X chromosome and were excluded.

    [0066] In order to develop a robust MSI prediction algorithm for ACTOnco assay, we plan to include only SSR regions from the remaining 566 candidate loci, which shows reproducible peak patterns in clinical FFPE samples in the prediction model. To identify SSRs with good reproducibility across different sequencing runs, we examined the coverage and peak pattern of the 566 SSR regions in a set of 10 FFPE clinical samples across six replicate runs.

    [0067] In order to include only highly confident reads on each SSR region for the prediction model, a minimum read depth of 30x from a sample on a locus was required. Additionally, to determine the total number of repeats of different lengths (peak width) on a SSR region, a minimum of 5% of allele frequency for a repeated length was required to be included. For example, for a sample on a locus with segments of mononucleotide repeats, if the allele frequencies are detected as 2% for 15 bases, 10% for 16 bases, 20% for 17 bases, 30% for 18 bases, 20% for 19 bases, 10% for 20 bases, and 8% for 21 bases, the total number of repeats of different lengths (peak width) will be 6 with the length of 15 bases uncounted.

    [0068] We excluded 138 SSR regions due to their low coverage (<30 reads for the SSR region), unstable peak call (missing peak width data in any sequencing run), high variability in peak width (variation in peak width greater than 3 in 6 replicate runs) or low weight (the MSI feature data around the last 5% contributions to the prediction model). The remaining 428 microsatellite loci were used for the subsequent baseline establishment and model training.

    [0069] (2) Baseline Establishment

    [0070] Population baseline for all 428 loci was established. The mean peak width of 77 normal samples sequenced in the Ion Proton sequencer was used to establish a baseline. The mean peak width of 81 normal samples sequenced in the Ion S5 Prime sequencer was used to establish another baseline. The MSI baseline was established from the mean peak width of each SSR region across the normal population. The standard deviation of peak width was also calculated for each candidate locus. For a given locus, it is considered unstable if the difference in peak width between a given clinical sample and the baseline falls outside of two times the standard deviation. The total unstable loci percentage is calculated by dividing the number of unstable loci by the total number of loci used.

    [0071] (3) MSI Prediction Model and Model Validation

    [0072] A total of 122 colorectal cancer (FFPE samples) sequenced on Ion Proton and Ion S5 Prime were used in training the machine learning model. Of those samples, 76 are MSS, and 46 are MSI-H samples based on a 5-marker MSI-PCR detection system (Promega MSI Analysis System, version 1.2). For each sample, the loci with read depth less than 30x were not considered in model training and were reported as missing information. Additionally, to determine the peak width on a SSR region, a minimum of 5% of allele frequency for a repeated length (allele) was required to be included in training the model. The difference in the peak width between the MSS baseline and clinical samples were used for calculation in the following logistic regression model:

    [0073] MSI status (MSS/MSI-H)=β0+β1loci1+β2loci2+β3loci3+ . . . +β428loci428 where β is a weight.

    [0074] We divided 122 training data by 7:3 ratio for training and testing and randomly assigned samples to train and test the data for 1000 iterations. Due to the small sample size, all 122 training data were used to set the cutoff value. The MSI score used for setting the cutoff value is calculated by selecting the median MSI score for each sample when it is selected as testing data during the 1000 iterations. The ROC curve for the model performance is shown in FIG. 2. According to analysis results, we decided to select 0.15 as the cutoff value of the MSI prediction model to achieve high sensitivity (100%) and specificity (100%).

    EXAMPLE 2

    Using the MSI Model to Determine the MSI Status of Cancer Samples

    [0075] We next used an independent set of 439 clinical FFPE samples, including 30 MSI-H and 409 MSS samples, to validate the MSI model. Samples include but are not limited to lung cancer, colorectal cancer, breast cancer, ovarian cancer, pancreatic cancer, cholangiocarcinoma, gastric cancer, glioblastoma, sarcoma, cervical cancer, leiomyosarcoma, and liposarcoma. These samples were processed using the same method as described in Example 1 to sequence the 428 loci region to a mean sequencing depth of at least 500x and 85% of the target region reaching a target base coverage of 100x.

    [0076] FIG. 3 shows the resulting MSI scores of the MSI-H and MSS samples are clearly distinguished. The results of model validation demonstrate that the positive percent agreement (PPA) and negative percent agreement (NPA) of this model are 93.3% and 98.5%, respectively. The validation results are provided in Tables 2-5.

    TABLE-US-00002 TABLE 2 MSI detection of clinical samples Target base Sample Tumor Mean coverage MSI MSI Status Unstable MSI status ID Cancer type purity depth at 100x score by MSI model Loci % by 5-loci PCR F00173 Lung cancer NA 1877 0.97 0.01 MSS 3.49 MSS F00212 Oesophagus cancer 50% 900.7 0.94 0.01 MSS 3.94 MSS F01597 Pancreatic cancer 60% 1488 0.95 0.01 MSS 3.59 MSS F02095 Adenocarcinoma NA 1155 0.96 0.02 MSS 5.01 MSS F01143 Lung cancer 40% 1127 0.96 0.06 MSS 3.4 MSS F01407 Unknown primary  5% 1355 0.96 0 MSS 4.81 MSS E00708 Adenoid cystic carcinoma 50% 1454 0.94 0.01 MSS 4.99 MSS F01911 Adenoid cystic carcinoma 45% 983.3 0.96 0.01 MSS 3.33 MSS F02161 Adenoid cystic carcinoma 40% 1238 0.97 0 MSS 3.86 MSS F01464 Adrenal cortical carcinoma 40% 1174 0.96 0.01 MSS 5.57 MSS F00249 Ampulla Vater cancer 25% 1097 0.96 0.01 MSS 2.21 MSS F01517 Appendix cancer 90% 1441 0.96 0 MSS 4.07 MSI-L F00507 Brain cancer 25% 1142 0.96 0.03 MSS 3.5 MSS F02040 Brain cancer 30% 2237 0.99 0.05 MSS 5.8 MSS F01581 Basal ganglia glioma 70% 794.5 0.92 0.01 MSS 3.57 MSS F01530 Brain tumor glioma 40% 2411 0.97 0.01 MSS 4.58 MSS F02387 Breast cancer NA 1640 0.98 0 MSS 10.52 MSI-L F02197 Breast cancer 20% 1226 0.95 0.02 MSS 5.14 MSS E00086 Breast cancer 55% 1064 0.94 0.01 MSS 7.1 MSS E00494 Breast cancer 30% 1479 0.96 0.02 MSS 7.09 MSS E00557 Breast cancer 40% 1525 0.94 0.02 MSS 5.14 MSS F02573 Breast cancer 45% 674.4 0.92 0.01 MSS 6.73 MSS F02092 Breast cancer 40% 753 0.94 0 MSS 6.2 MSS F00107 Breast cancer 20% 1054 0.95 0.02 MSS 5.44 MSS F01141 Breast cancer 70% 844.1 0.92 0.01 MSS 5.53 MSS F01409 Breast cancer 70% 641.4 0.93 0 MSS 8.08 MSS F01898 Breast cancer 35% 1264 0.96 0.01 MSS 4.07 MSS E00086 Breast cancer 55% 828.7 0.93 0 MSS 7.81 MSS F02386 Breast cancer 55% 1391 0.96 0.01 MSS 8.38 MSS D01394 Breast cancer 45% 1003 0.94 0.01 MSS 5.18 MSS F02385 Breast cancer 50% 1666 0.97 0.3 MSS 10.28 MSS D01491 Breast cancer 65% 1206 0.95 0 MSS 5.63 MSS F00564 Breast cancer 80% 1309 0.97 0 MSS 4.63 MSS F00201 Breast cancer 80% 1518 0.96 0.02 MSS 3.56 MSS F01424 Breast cancer 10% 1247 0.96 0 MSS 3.69 MSS F00486 Breast cancer 85% 1605 0.98 0.04 MSS 3.62 MSS F01178 Breast cancer 25% 1334 0.96 0.01 MSS 3.33 MSS F01459 Breast cancer 40% 1265 0.95 0.02 MSS 4.31 MSS F01333 Breast cancer 60% 1414 0.97 0.02 MSS 4.03 MSS F00110 Breast cancer 70% 1812 0.97 0.02 MSS 6.42 MSS F00678 Breast cancer 50% 1936 0.98 0 MSS 3.27 MSS F01362 Breast cancer 85% 1634 0.94 0.03 MSS 5.79 MSS F01468 Breast cancer 60% 1009 0.93 0.01 MSS 7.29 MSS F00817 Breast cancer NA 2227 0.97 0.01 MSS 4.36 MSS F01130 Breast cancer 40% 2128 0.98 0 MSS 3.09 MSS F01933 Breast cancer 15% 1042 0.94 0.06 MSS 6.12 MSS F02365 Breast cancer 60% 1498 0.98 0.01 MSS 5.63 MSS F02208 Buccal cancer 40% 861.3 0.94 0.01 MSS 4.26 MSS D01571 Bladder cancer 65% 886.3 0.95 0.02 MSS 5.46 MSS E00495 Colon cancer 55% 1574 0.88 0.01 MSS 10.3 MSS F00369 Oesophageal cancer 50% 2115 0.96 0.01 MSS 2.8 MSS F00716 Prostate cancer 75% 2231 0.97 0.04 MSS 5.81 MSI-L F01155 Rectum cancer 60% 708.6 0.92 0.01 MSS 4.17 MSS E00705 Gastric Cancer 40% 1045 0.94 0.04 MSS 6.94 MSS F00426 Uterine sarcoma 90% 1122 0.94 0.01 MSS 4.91 MSS D01878 Cervical cancer 60% 1302 0.95 0.01 MSS 6.62 MSS D01878 Cervical cancer 60% 1671 0.95 0.03 MSS 6.17 MSS D01870 Cervical cancer 40% 876.5 0.94 0.01 MSS 10.31 MSS D01870 Cervical cancer 40% 969.7 0.95 0 MSS 5.76 MSS E00208 Cervical cancer 55% 840.8 0.94 0.01 MSS 11.47 MSS F01426 Cervical cancer 70% 991.8 0.94 0 MSS 4.73 MSS F01287 Cervical cancer 25% 1663 0.96 0.02 MSS 3.33 MSS E01827 Cholangiocarcinoma 25% 1217 0.96 0.11 MSS 6.57 MSS F00381 Cholangiocarcinoma 60% 1498 0.96 0.03 MSS 6.25 MSS E00224 Cholangiocarcinoma 60% 883.4 0.94 0 MSS 5.12 MSS F00137 Cholangiocarcinoma 50% 1021 0.96 0.01 MSS 3.89 MSS F01536 Cholangiocarcinoma 60% 1068 0.95 0 MSS 4.1 MSS F02049 Cholangiocarcinoma 15% 1348 0.96 0.01 MSS 4.49 MSS F02132 Cholangiocarcinoma 10% 1949 0.98 0.01 MSS 6.38 MSS F02086 Chondrosarcoma 60% 764.2 0.94 0.01 MSS 6.45 MSS E00167 Brain cancer 85% 541.1 0.88 0 MSS 7.25 MSI-L F00844 Ovarian cancer 90% 1100 0.97 0 MSS 3.34 MSS F02495 Colon cancer 30% 1360 0.97 0.01 MSS 4.38 MSS F02346 Colon cancer 15% 2403 0.98 0 MSS 9.65 MSS D01774 Colon cancer 60% 706.8 0.94 0.03 MSS 5.48 MSS D01124 Colon cancer NA 1488 0.95 0.02 MSS 4.11 MSS F00409 Colon cancer 15% 1215 0.96 0.01 MSS 3.73 MSS F00556 Colon cancer 50% 1227 0.95 0.01 MSS 3.36 MSS F00003 Colon cancer 35% 1349 0.95 0.02 MSS 7.12 MSS F01115 Colon cancer 30% 1727 0.96 0.04 MSS 4.39 MSS F02580 Colon cancer 15% 1487 0.95 0.01 MSS 3.59 MSS F01402 Colon cancer 10% 2262 0.98 0.03 MSS 4.14 MSS F02414 Colon cancer 35% 1600 0.98 0.01 MSS 4.37 MSS F02071 Colon cancer  5% 1430 0.95 0.02 MSS 6.45 MSS D00846 NA NA 511.8 0.93 1 MSI-H 24.47 MSI-H D00923 NA NA 608.8 0.94 1 MSI-H 17.92 MSI-H D00854 NA NA 674.8 0.94 0.99 MSI-H 18.3 MSI-H D00927 NA NA 712.1 0.94 1 MSI-H 19.81 MSI-H D00932 NA NA 716.2 0.95 0.99 MSI-H 20.57 MSI-H D00938 NA NA 755.2 0.95 1 MSI-H 25.18 MSI-H D00868 NA NA 768.1 0.95 0.96 MSI-H 18.66 MSI-H D00881 NA NA 788.4 0.95 1 MSI-H 17.57 MSI-H D00848 NA NA 803.9 0.95 1 MSI-H 17.2 MSI-H D00900 NA NA 815.9 0.95 0.02 MSS 6.21 MSI-H D00849 NA NA 821.8 0.96 1 MSI-H 26.77 MSI-H D00895 NA NA 828.2 0.95 0.97 MSI-H 17.29 MSI-H D00864 NA NA 864.1 0.95 1 MSI-H 20.08 MSI-H D00918 NA NA 906.7 0.96 1 MSI-H 13.6 MSI-H D00847 NA NA 979.4 0.96 1 MSI-H 18.6 MSI-H D00893 NA NA 986.2 0.96 0.99 MSI-H 18.48 MSI-H D00879 NA NA 1054 0.96 0.99 MSI-H 12.45 MSI-H D00926 NA NA 1116 0.97 0.99 MSI-H 20.11 MSI-H D00915 NA NA 1330 0.95 0.79 MSI-H 20.98 MSI-H D00878 NA NA 1377 0.96 0.87 MSI-H 14.44 MSI-H D00873 NA NA 1498 0.96 0.16 MSS 10.17 MSI-H D00909 NA NA 1575 0.96 0.05 MSS 13.73 MSI-H D00853 NA NA 1995 0.97 0.76 MSI-H 9.26 MSI-L F00124 Colorectal cancer 90% 1058 0.94 0.01 MSS 4.58 MSI-L F01012 Colorectal cancer 10% 592.7 0.94 0.01 MSS 6.49 MSS F01495 Colorectal cancer 40% 857.8 0.96 0 MSS 7.28 MSS F01460 Colorectal cancer 35% 1731 0.97 0.01 MSS 5.44 MSS F01944 Colorectal cancer 15% 3667 0.98 0.01 MSS 3.99 MSI-L F01080 Rectal cancer 60% 1735 0.98 0 MSS 3.27 MSS F02388 Cystic duct carcinoma 40% 1328 0.98 0.01 MSS 7.35 MSS F01194 Dedifferentiated liposarcoma 85% 1144 0.94 0 MSS 4.17 MSS F00950 Desmoid 50% 1675 0.97 0.01 MSS 2.92 MSS F00211 Diffuse midline glioma 70% 945.6 0.95 0.07 MSS 4.31 MSS F00713 Endometrial carcinoma 50% 1006 0.95 0.01 MSS 4.49 MSS F00318 Endometrial cancer 60% 2074 0.97 0.06 MSS 1.83 MSS F01480 Endometrial cancer 30% 948.9 0.94 0.23 MSS 11.22 MSI-L F01425 Esophageal cancer 20% 965.4 0.93 0.02 MSS 4.1 MSS F01313 Esophageal cancer 25% 629 0.94 0.03 MSS 11.74 MSS F00145 Esophagus cancer 10% 1452 0.94 0.02 MSS 4.19 MSS F01089 Esophageal cancer 75% 1146 0.93 0.01 MSS 5.74 MSS F01383 Extraskeletal chondroblastic 65% 1708 0.95 0 MSS 3.74 MSS osteosarcoma F01410 Eyelid sebaceous carcinoma 40% 1019 0.96 0.09 MSS 3.53 MSS E02217 Fallopian tube cancer 85% 1394 0.95 0.43 MSS 6.18 MSI-H F01537 Gallbladder cancer 40% 1317 0.95 0.09 MSS 3.74 MSS D00304 Gastric cancer 13% 836.6 0.95 0.03 MSS 9.21 MSS F02397 Gastric cancer 15% 1326 0.98 0.01 MSS 7.4 MSS F00108 Gastric cancer 15% 1571 0.97 0.02 MSS 7.26 MSS F00292 Gastric cancer 20% 1809 0.98 0.04 MSS 5.47 MSS F01291 Gastric cancer 55% 1156 0.97 0.05 MSS 4.77 MSS E00545 Glioblastoma multiforme 70% 2408 0.96 0 MSS 4.22 MSS F01907 Glioblastoma multiforme 40% 1389 0.97 0 MSS 5.08 MSS F01781 Glioblastoma multiforme 45% 1370 0.95 0.01 MSS 5.66 MSI-L F00041 Glioblastoma Multiforme 65% 1169 0.95 0.08 MSS 3.62 MSS F00766 Glioblastoma Multiforme 80% 648.3 0.93 0.02 MSS 5.38 MSS F01073 Glioblastoma multiforme 50% 1138 0.95 0.02 MSS 2.62 MSS F00345 Glioblastoma multiforme 60% 1715 0.96 0 MSS 4.1 MSS F00120 Glioblastoma multiforme 45% 1318 0.96 0.01 MSS 4.81 MSI-L F02320 Gastrointestinal stromal tumor 70% 1114 0.95 0 MSS 5.61 MSS F00620 Gastrointestinal stromal 65% 602.6 0.88 0.01 MSS 7.75 MSS tumors (GIST) F02142 Gastrointestinal stromal 80% 1187 0.96 0.01 MSS 5.24 MSS tumor E00413 Hepatocellular carcinoma 70% 1461 0.96 0.01 MSS 2.59 MSS F00052 Hepatocellular carcinoma 90% 1240 0.96 0.03 MSS 3.68 MSS F01560 Hepatocellular carcinoma 60% 1723 0.97 0.02 MSS 2.93 MSS F00881 Hepatocellular carcinoma 35% 789.9 0.93 0.02 MSS 5.02 MSS F00882 Cholangiocarcinoma 40% 835.6 0.94 0.03 MSS 5.7 MSS E00787 High grade glioma 40% 729.1 0.93 0.01 MSS 3.85 MSS E00421 Intima sarcoma 90% 1097 0.95 0.01 MSS 3.2 MSS E00421 Intima sarcoma 90% 840.8 0.94 0.01 MSS 5.33 MSS F02066 Invasive ductal carcinoma 50% 1065 0.96 0.02 MSS 5.6 MSS F01380 Kidney cancer 85% 1627 0.97 0.03 MSS 4.92 MSS E01811 Leiomyosarcoma 45% 1627 0.97 0.01 MSS 12.84 MSS F02519 Leiomyosarcoma 90% 1298 0.96 0 MSS 9.94 MSS E00237 Leiomyosarcoma 85% 1108 0.94 0.01 MSS 10.19 MSS F02519 Leiomyosarcoma 90% 1298 0.96 0 MSS 9.94 MSS F02065 Leiomyosarcoma 75% 1016 0.97 0.03 MSS 5.51 MSS F00988 Leiomyosarcoma 90% 544.3 0.93 0.07 MSS 9.47 MSS D00546 Liposarcoma 98% 1090 0.96 0.01 MSS 11.5 MSS F02026 Liposarcoma 90% 1234 0.97 0 MSS 6.04 MSS F00942 Liposarcoma 75% 1152 0.96 0.05 MSS 4.82 MSS F00805 Liposarcoma 40% 1260 0.96 0.03 MSS 6.36 MSS F00962 Liposarcoma 90% 1511 0.96 0 MSS 3.56 MSS F01154 Liver cancer NA 1929 0.96 0.01 MSS 3.53 MSS F02019 Liver angiosarcoma  5% 964.5 0.95 0.02 MSS 4.17 MSS F01489 Liver cancer 55% 1219 0.97 0.01 MSS 3.49 MSS E00811 Lung cancer 10% 660.2 0.95 0 MSS 5.93 MSS E00695 Lung cancer  5% 861.3 0.94 0.01 MSS 5.47 MSS F00593 Lung cancer 40% 948.3 0.95 0 MSS 9.51 MSS F00679 Lung cancer  0% 1137 0.95 0.05 MSS 7.87 MSS E00704 Lung Cancer 60% 1415 0.96 0.01 MSS 7.02 MSS F01960 Lung cancer  3% 1474 0.96 0.22 MSS 8.67 MSI-H E00561 Lung cancer 85% 1522 0.96 0.01 MSS 4.25 MSS E01825 Lung cancer 35% 1598 0.97 0 MSS 6.49 MSS F01282 Lung cancer 50% 1840 0.96 0.01 MSS 3.11 MSS F02483 Lung cancer 10% 1297 0.96 0.01 MSS 9.29 MSS F00269 Lung cancer  2% 811.8 0.95 0.03 MSS 7.33 MSI-L F00815 Lung cancer 60% 1410 0.96 0.01 MSS 4.28 MSS F02497 Lung cancer 10% 1491 0.96 0.01 MSS 3.56 MSS F00758 Lung cancer 60% 1154 0.95 0.2 MSS 17.29 MSS F01494 Lung cancer 15% 1329 0.96 0.01 MSS 6.2 MSI-L F02514 Lung cancer 40% 2222 0.97 0.02 MSS 3.49 MSS F01321 Lung cancer 80% 1498 0.97 0.04 MSS 5.45 MSS F01196 Lung cancer 35% 1639 0.96 0.04 MSS 8.52 MSS F01151 Lung cancer 15% 1813 0.96 0.03 MSS 2.79 MSI-L F02043 Lung cancer 30% 1162 0.97 0.07 MSS 7.08 MSS F02483 Lung cancer 10% 1297 0.96 0.01 MSS 9.29 MSS F02096 Lung cancer 55% 1710 0.95 0.02 MSS 6.24 MSS D01492 Lung cancer 65% 714.5 0.93 0.02 MSS 5.56 MSS F01782 Lung cancer 20% 2187 0.96 0 MSS 6.15 MSS E00639 Lung cancer 45% 1619 0.96 0.01 MSS 4.34 MSS F00946 Lung cancer 35% 757.1 0.93 0.06 MSS 8.66 MSS F00251 Lung cancer 60% 871.1 0.97 0.11 MSS 5.19 MSS F00762 Lung cancer 30% 543.8 0.93 0.02 MSS 5.96 MSS F00159 Lung cancer 70% 1085 0.95 0.02 MSS 3.93 MSS F00317 Lung cancer 50% 1142 0.96 0.01 MSS 4.07 MSS F00790 Lung cancer 10% 742.8 0.95 0.04 MSS 6.65 MSS F00141 Lung cancer 45% 1302 0.96 0 MSS 4.26 MSI-L F00892 Lung cancer 40% 1213 0.95 0.06 MSS 4.51 MSS F00895 Lung cancer 30% 1256 0.96 0.08 MSS 4.98 MSS F00286 Lung cancer 15% 1416 0.95 0.13 MSS 4.84 MSS F00654 Lung cancer 35% 1471 0.95 0.01 MSS 3.37 MSS F00114 Lung cancer 25% 1499 0.97 0.01 MSS 5.74 MSS F00479 Lung cancer 55% 1511 0.95 0 MSS 5.45 MSS F01596 Lung cancer 60% 921.1 0.94 0.01 MSS 4.34 MSI-L F00408 Lung cancer 60% 1636 0.96 0.01 MSS 4.41 MSS F00994 Lung cancer 30% 911.5 0.94 0.01 MSS 4.18 MSS F00038 Lung cancer 20% 1930 0.98 0.01 MSS 3.24 MSS F00675 Lung cancer 15% 1836 0.97 0.01 MSS 3.48 MSS F00610 Lung cancer 50% 1613 0.98 0.01 MSS 3.26 MSS F00509 Lung cancer 40% 1872 0.96 0 MSS 4.24 MSS F00559 Lung cancer 20% 1947 0.98 0.12 MSS 3.43 MSS F02212 Lung cancer 25% 697.5 0.94 0.03 MSS 9.35 MSS F00856 Lung cancer 85% 1557 0.96 0.03 MSS 5.36 MSS F00413 Lung cancer 35% 1998 0.98 0.03 MSS 4.55 MSS F01404 Lung cancer 25% 927.3 0.96 0 MSS 6.65 MSS F02060 Lung cancer 20% 857 0.96 0 MSS 6.48 MSS F01116 Lung cancer 10% 1303 0.95 0 MSS 3.36 MSS F01290 Lung cancer  8% 1284 0.96 0.01 MSS 5.52 MSS F00412 Lung cancer 25% 2380 0.98 0.05 MSS 4.71 MSS F00894 Lung cancer  5% 1863 0.96 0.08 MSS 2.99 MSS F00725 Lung cancer 40% 2578 0.99 0.03 MSS 4.68 MSS F02579 Lung cancer 30% 1345 0.96 0.01 MSS 3.02 MSS F02296 Lung cancer 10% 1670 0.96 0 MSS 5.91 MSS F01125 Lung cancer 65% 2208 0.97 0.02 MSS 4.03 MSS F01109 Lung cancer 80% 1961 0.96 0.01 MSS 2.77 MSS F01163 Pancreatic cancer 10% 1497 0.96 0.01 MSS 6.33 MSS E00784 Sarcomatoid Carcinoma 10% 1339 0.95 0.02 MSS 4.1 MSS F00712 Melanoma 80% 1611 0.97 0.01 MSS 14.18 MSS F00712 Melanoma 80% 720.3 0.94 0.01 MSS 3.01 MSS F00040 Meningioma 85% 2058 0.98 0.01 MSS 2.89 MSS F02202 Ovarian cancer NA 1683 0.97 0.08 MSS 4.04 MSS E00674 Breast Cancer 40% 3108 0.95 0.06 MSS 4.11 MSS E00674 Breast Cancer 40% 1168 0.95 0 MSS 3.72 MSS F02451 Epithelioid rhabdomyosarcoma 75% 1211 0.97 0.02 MSS 4.66 MSS F02478 Melanoma 25% 1808 0.96 0.02 MSS 3.9 MSS F01075 Pancreatic cancer 20% 2340 0.98 0.03 MSS 2.52 MSS F00793 Tonsil cancer 35% 670.8 0.92 0.02 MSS 5.71 MSS F01305 Metastasis of unknown 35% 1654 0.98 0.01 MSS 2.53 MSS origin (MUO) F01576 Metastasis of unknown 10% 1042 0.95 0.02 MSS 3.38 MSS origin (MUO) F00585 Nasopharyngeal cancer 50% 1482 0.96 0.02 MSS 7.42 MSS F01438 Nasopharyngeal carcinoma 30% 1519 0.97 0.01 MSS 5.63 MSS F02024 Lung cancer  3% 1718 0.97 0 MSS 9.44 MSS F02429 Adenocarcinoma 40% 672.9 0.95 0.05 MSS 6.03 MSS F02329 Lung cancer 35% 1508 0.94 0 MSS 7.9 MSS F00414 NSCLC adenocarcinoma 85% 1062 0.97 0 MSS 4.39 MSS F00673 NSCLC, adenocarcinoma 65% 995 0.93 0.04 MSS 6.8 MSS E00744 Oesophageal Cancer 25% 1974 0.96 0 MSS 9.26 MSS F00288 Oropharyngeal cancer 50% 838.3 0.95 0.03 MSS 4.29 MSS F01785 Osteosarcoma 35% 1004 0.91 0 MSS 3.68 MSS F02155 Ovarian cancer 40% 2518 0.99 0.03 MSS 3.93 MSS D01410 Ovarian cancer 70% 757.5 0.94 0.38 MSS 15.75 MSI-H F01265 Ovarian cancer 60% 1101 0.96 0.02 MSS 5.02 MSS E00608 Endometrial cancer 40% 1611 0.96 0.04 MSS 2.41 MSS F02083 Ovarian cancer 50% 837.3 0.94 0.01 MSS 5.64 MSS F00893 Ovarian cancer 35% 759.7 0.94 0.01 MSS 5.63 MSS F02494 Ovarian cancer 85% 1540 0.97 0.02 MSS 5.12 MSS F01200 Ovarian cancer 50% 1174 0.94 0.01 MSS 4.73 MSS F01145 Ovarian cancer 95% 2072 0.96 0.01 MSS 2.43 MSS F02390 Ovarian cancer 35% 1081 0.94 0.11 MSS 9.04 MSS D00944 Clear cell carcinoma 85% 1506 0.96 0.01 MSS 5.59 MSI-L F00298 Ovarian cancer 60% 1001 0.96 0.05 MSS 3.7 MSS F00698 Ovarian cancer 60% 834.9 0.95 0.03 MSS 7.52 MSS F00724 Ovarian cancer 20% 1259 0.97 0.01 MSS 3.88 MSS F00920 Ovarian cancer 75% 1483 0.97 0.04 MSS 6.42 MSS F00983 Ovarian cancer 60% 764.5 0.96 0.01 MSS 8.6 MSS F01090 Ovarian cancer 90% 1260 0.96 0.01 MSS 5.45 MSS F02070 Ovarian cancer 15% 1281 0.96 0.01 MSS 4.08 MSS F01467 Ovarian cancer 35% 1523 0.97 0.01 MSS 5.28 MSI-L F01763 Ovarian cancer NA 1624 0.95 0.03 MSS 4.1 MSS F01400 Ovarian cancer 70% 2197 0.98 0.01 MSS 5.1 MSS F02059 Ovarian cancer 75% 1710 0.98 0.01 MSS 4.52 MSS F02010 Ovarian cancer 70% 854.9 0.94 0 MSS 4.75 MSS F02194 Ovarin cancer 70% 1051 0.95 0 MSS 5.28 MSS F00898 Ovarian cancer 80% 841.6 0.92 0 MSS 5.8 MSS F00955 Ovarian cancer 45% 1547 0.97 0.02 MSS 5.84 MSS F00900 Ovarian cancer 40% 1771 0.96 0.05 MSS 5.22 MSS F02517 Ovary cancer 70% 1774 0.98 0.04 MSS 4.39 MSI-L F02025 Pancreatic cancer 70% 1646 0.97 0 MSS 7.13 MSS F00880 Pancreatic cancer 25% 1165 0.95 0.04 MSS 5.59 MSS F00627 Pancreatic cancer 20% 1624 0.96 0.01 MSS 3.58 MSS F01909 Pancreatic cancer 40% 1231 0.96 0 MSS 5.33 MSS F00936 Pancreatic cancer  5% 2249 0.98 0.02 MSS 5.23 MSS F01771 Pancreatic cancer 15% 1912 0.97 0.01 MSS 4.6 MSS F02526 Pancreatic cancer 35% 1359 0.97 0.01 MSS 8.82 MSS F02525 Pancreatic cancer 10% 869.2 0.95 0 MSS 3.75 MSS E00666 Pancreatic cancer  5% 1357 0.94 0.01 MSS 5.75 MSS F00081 Pancreatic cancer 80% 909.1 0.95 0.01 MSS 9.63 MSS F01436 Pancreatic cancer 40% 1782 0.97 0.09 MSS 5.28 MSS F01769 Pancreatic cancer 40% 1557 0.96 0 MSS 4.53 MSS F00296 Pancreatic cancer 15% 1299 0.97 0.03 MSS 6.04 MSS F00728 Pancreatic cancer 15% 1570 0.97 0.01 MSS 14.15 MSS F00788 Pancreatic cancer 15% 1490 0.97 0.02 MSS 3.62 MSS E01854 Papillary Thyroid Carcinoma 40% 1538 0.97 0 MSS 5.96 MSS F00992 Gastric cancer 50% 1156 0.96 0.01 MSS 3.31 MSI-L F00834 Primary peritoneal serous 40% 695.5 0.95 0.01 MSS 4.15 MSS carcinoma (PPSC) E01902 prostate cancer  5% 1551 0.97 0.02 MSS 8.74 MSS F02364 Prostate cancer 25% 1139 0.97 0.02 MSS 4.78 MSS F00044 Prostate cancer 35% 2999 0.98 0.02 MSS 3.26 MSS E00755 Renal cell carcinoma 60% 830.9 0.92 0 MSS 12.65 MSS E00755 Renal cell carcinoma 60% 1279 0.94 0 MSS 3.48 MSS F00394 Renal cell carcinoma 85% 1182 0.96 0.01 MSS 3.94 MSS F01081 Rectal cancer 10% 1240 0.95 0 MSS 5.31 MSS F00326 Rectal cancer 50% 1468 0.96 0.01 MSS 2.79 MSS F02135 Rectal cancer 10% 2202 0.97 0.01 MSS 4.8 MSS F00586 Rectum cancer 25% 1393 0.95 0 MSS 3.74 MSS F00119 Renal cancer 60% 1837 0.96 0.01 MSS 4.45 MSS F00035 Uterine cancer 45% 1554 0.98 0.06 MSS 3.45 MSS D02004 Skin cancer 65% 805.9 0.93 0 MSS 13.93 MSS D02004 Skin cancer 65% 526.5 0.91 0.01 MSS 5.27 MSS F02332 Sarcoma  5% 2019 0.96 0.01 MSS 6.79 MSS F00987 Sarcoma 70% 1701 0.97 0.01 MSS 3.28 MSS F00887 Sarcoma 40% 555.2 0.93 0.03 MSS 6.65 MSS F00144 Sarcoma 60% 1140 0.97 0.02 MSS 3.31 MSS F00603 Sarcoma 10% 1608 0.97 0.1 MSS 4.25 MSS F01472 Sarcoma 50% 1062 0.97 0.03 MSS 3.66 MSS F01520 Sarcoma 80% 1080 0.95 0.01 MSS 3.95 MSS E01878 Sigmoid cancer  5% 1435 0.92 0.01 MSS 6.12 MSS F02430 Squamous cell carcinoma 40% 903.3 0.95 0 MSS 8.21 MSS E00318 Stomach adenoacrinoma 40% 1456 0.96 0.02 MSS 4.81 MSS F01162 Gastric cancer 10% 920.3 0.94 0.02 MSS 4.91 MSS F00171 Gastric cancer 10% 1565 0.96 0.02 MSS 3.31 MSS F01377 Gastric cancer 75% 1421 0.97 0.05 MSS 5.28 MSS F00274 Submandibular gland cancer 75% 1012 0.97 0.01 MSS 5.17 MSS F00172 Thymic cancer 80% 1273 0.95 0 MSS 3.56 MSS F01274 Thymoma involvement 35% 1109 0.94 0.02 MSS 3.4 MSS F00245 Thyriod cancer 40% 871.4 0.94 0.05 MSS 3.58 MSS F02375 Breast cancer 40% 1242 0.94 0 MSS 4.96 MSS F00656 Breast cancer 85% 2417 0.98 0.01 MSS 2.53 MSS F02369 Tongue cancer 40% 1473 0.96 0.01 MSS 5.54 MSS E00764 Tonsillar cancer 50% 1304 0.94 0.01 MSS 6.54 MSS E00764 Tonsillar cancer 50% 1655 0.94 0 MSS 2.51 MSS F01546 Transitional cell carcinoma 45% 680.3 0.95 0.02 MSS 6.38 MSI-L F01014 Endometrioid adenocarcinoma 40% 1646 0.97 0.03 MSS 3.65 MSS F00624 Uterus leiomyosarcoma 40% 1422 0.95 0.02 MSS 3.61 MSS F01281 Hypopharyngeal Cancer 60% 2083 0.96 0 MSS 3.53 MSS F01414 Oral Cancer 35% 521.5 0.92 0.03 MSS 11.35 MSS D01425 Colon cancer 60% 858.9 0.95 0.01 MSS 5.83 MSS F01837 Endometrial cancer 25% 1477 0.96 0.93 MSI-H 9.98 MSI-H F00956 Endometrial cancer 10% 1485 0.95 0 MSS 2.64 MSS F02435 Endometrial cancer 60% 1934 0.97 0.02 MSS 4.4 MSS F00891 Endometrial cancer 35% 922.7 0.94 0.01 MSS 6.21 MSS F01833 Leiomyosarcoma 60% 1693 0.97 0.03 MSS 4.04 MSS F00763 Unknown primary 10% 1383 0.98 0.01 MSS 3.43 MSS F01174 Unknown primary 25% 809 0.94 0.06 MSS 6.79 MSS F00811 Unknown primary 80% 1318 0.97 0.03 MSS 6.07 MSS F00113 Unknown primary 60% 1737 0.96 0.01 MSS 3.31 MSS F00765 Breast cancer 70% 1272 0.97 0.01 MSS 4.62 MSS F01780 Thyroid cancer 10% 703.7 0.92 0 MSS 5.98 MSI-L F02213 Skin cancer 60% 907.3 0.97 0.01 MSS 4.66 MSS F02485 Ovarian cancer 40% 1026 0.95 0.03 MSS 3.82 MSS F02415 Ovarian cancer 65% 1581 0.96 0.09 MSS 15.76 MSS F01318 Ovarian cancer 20% 1420 0.96 0 MSS 3.66 MSS F01267 Ovarian cancer 20% 1729 0.96 0.03 MSS 3.53 MSS F00696 Ovarian cancer 70% 828.9 0.94 0.01 MSS 5.36 MSS F02644 Ovarian cancer 50% 2333 0.98 0.01 MSS 4.32 MSS F01519 Ovarian cancer 40% 1407 0.97 0 MSS 4.61 MSS D00465 Ovarian cancer 80% 1545 0.96 0.02 MSS 7.28 MSS F02189 Ovarian cancer 35% 1528 0.98 0.06 MSS 3.82 MSS F02443 Ovarian cancer/Endometrial 70% 1940 0.97 0 MSS 4.41 MSS cancer F02100 Cholangiocarcinoma 45% 1639 0.97 0.03 MSS 4.44 MSS E00771 Breast Cancer 50% 963 0.94 0.02 MSS 14.75 MSS F00730 Breast cancer 35% 1905 0.98 0.01 MSS 17.6 MSS F01173 Breast cancer 45% 1282 0.95 0.05 MSS 4.36 MSS F00984 Breast cancer 35% 1744 0.97 0.07 MSS 3.07 MSS E00771 Breast Cancer 50% 1238 0.95 0.01 MSS 4.75 MSS F00985 Breast cancer 30% 1463 0.96 0.09 MSS 3.94 MSS F01399 Rectal cancer  5% 797.4 0.93 0 MSS 4.78 MSS F01401 Rectal cancer 30% 1021 0.95 0 MSS 6.77 MSI-L F01118 Lung cancer NA 1564 0.96 0.07 MSS 2.22 MSS F01539 Lung cancer/Thyroid cancer 20% 1353 0.98 0.08 MSS 8.01 MSS F00421 Gastric cancer 50% 1420 0.96 0.01 MSS 4.11 MSS F01598 Gastric cancer 15% 965.3 0.96 0 MSS 6.02 MSS F01478 Gastric cancer 20% 683.9 0.95 0.01 MSS 5.42 MSS F01482 Gastric cancer 15% 760.4 0.94 0.01 MSS 5.83 MSS F02434 Gastric cancer 25% 879.4 0.95 0.16 MSS 5.28 MSS F01929 Esophageal cancer 65% 547.5 0.92 0 MSS 8.38 MSS F00396 Unknown primary 10% 1741 0.97 0.01 MSS 3.81 MSS F02028 Pancreatic cancer 40% 680.9 0.96 0.01 MSS 6.9 MSS F01198 Pancreatic cancer 40% 1600 0.97 0.02 MSS 7.51 MSS F01903 Pancreatic cancer 15% 1194 0.97 0 MSS 3.67 MSS F01912 Pancreatic cancer 10% 1501 0.97 0 MSS 3.61 MSS F00360 Pancreatic cancer 20% 1167 0.97 0.01 MSS 3.85 MSS F00789 Pancreatic cancer 35% 861.8 0.94 0.03 MSS 4.95 MSS F00160 Pancreatic cancer 10% 1472 0.95 0.04 MSS 2.82 MSS F01264 Pancreatic cancer 80% 1383 0.98 0.03 MSS 5.8 MSS F01473 Pancreatic cancer 10% 557.8 0.93 0.02 MSS 5.3 MSS F00674 Pancreatic cancer 65% 2158 0.97 0.01 MSS 2.54 MSS F01582 Pancreatic cancer 30% 771.1 0.93 0.01 MSS 5.27 MSS F01969 Pancreatic cancer  2% 1669 0.98 0.01 MSS 4.01 MSI-L F01997 Pancreatic cancer 35% 1013 0.94 0.01 MSS 7.13 MSS F01986 Pancreatic cancer 10% 1923 0.99 0.03 MSS 4.89 MSS F01773 Pancreatic cancer 10% 1450 0.97 0.04 MSS 4.55 MSS F01550 Pancreatic cancer 40% 1781 0.96 0.01 MSS 5.57 MSS F02116 Pancreatic cancer 60% 1966 0.98 0 MSS 3.09 MSS F02433 Pancreatic cancer 20% 953.9 0.95 0.04 MSS 6.02 MSS F02527 Pancreatic cancer 10% 2167 0.98 0.01 MSS 5.82 MSS F02041 Pancreatic cancer 40% 1960 0.99 0.17 MSS 7.01 MSS F00868 Thymic carcinoma 25% 911.8 0.95 0.01 MSS 4.92 MSS F02432 Osteosarcoma 90% 1298 0.95 0 MSS 5.86 MSS F02646 Osteosarcoma 10% 1453 0.93 0.01 MSS 4.84 MSS F00190 Salivary gland cancer  2% 1620 0.96 0 MSS 3.9 MSS F01171 Sarcoma 35% 1193 0.91 0 MSS 4.31 MSS F01427 Kidney cancer 80% 1084 0.94 0 MSS 4.97 MSS E01792 Melanoma 40% 1383 0.95 0.03 MSS 13.13 MSS E00467 Peritoneal carcinoma 40% 996.4 0.94 0.01 MSS 5.44 MSS F01169 Peritoneal cancer 25% 861.6 0.95 0.01 MSS 5.28 MSS F00129 Peritoneal cancer 60% 1257 0.96 0.02 MSS 5.44 MSS F00803 Bladder cancer 80% 704.9 0.94 0.03 MSS 3.2 MSS F02403 Nasopharyngeal carcinoma 85% 1633 0.98 0.01 MSS 7.01 MSS F01176 Sinus cancer 40% 1373 0.95 0.03 MSS 2.6 MSS F02171 Head and Neck Cancers 40% 1302 0.93 0.01 MSS 4.54 MSS F00731 Cholangiocarcinoma 40% 1525 0.97 0.99 MSI-H 15.72 MSI-H E00407 Cholangiocarcinoma NA 1555 0.97 0 MSS 4.02 MSS F01172 Cholangiocarcinoma 25% 944.7 0.93 0 MSS 3.03 MSS F00836 Cholangiocarcinoma 20% 2087 0.97 0.01 MSS 3.68 MSS F01120 Cholangiocarcinoma 65% 1250 0.97 0.02 MSS 2.93 MSS D00831 Cholangiocarcinoma 70% 1498 0.97 0 MSS 3.85 MSS F00068 Cholangiocarcinoma 60% 991.8 0.95 0.02 MSS 10.69 MSS F00493 Cholangiocarcinoma  2% 1447 0.96 0.02 MSS 3.89 MSS F00727 Cholangiocarcinoma 20% 1244 0.97 0.02 MSS 4.03 MSS F02115 Cholangiocarcinoma 10% 3378 0.98 0.01 MSS 3.26 MSS F00246 Cholangiocarcinoma 40% 1803 0.96 0.02 MSS 3.29 MSS F01288 Cholangiocarcinoma 65% 1336 0.97 0.01 MSS 4.74 MSS F00976 Cholangiocarcinoma 20% 1825 0.97 0.01 MSS 4.17 MSS F01060 Cholangiocarcinoma 10% 1797 0.97 0 MSS 3.86 MSS F00186 Gallbladder cancer 40% 1244 0.97 0.01 MSS 5.47 MSS F01266 Lung cancer 40% 507.6 0.93 0.02 MSS 6.47 MSS F02384 Prostate cancer 35% 1302 0.98 0.01 MSS 7.07 MSS ACT0744 NA NA 554.2 0.92 1 MSI-H 27.02 MSI-H ACT0953 NA NA 983.7 0.94 0.95 MSI-H 36.59 MSI-H ACT0893 NA NA 1105 0.96 0 MSS 4.37 MSS ACT0897 NA NA 1209 0.96 0.02 MSS 4.66 MSS ACT0894 NA NA 1403 0.97 0.05 MSS 6.92 MSS ACT0887 NA NA 1682 0.97 0.99 MSI-H 19.78 MSI-H ACT1217 NA NA 1731 0.96 0.05 MSS 10.2 MSS F03491 Anal cancer 75% 1394 0.96 0 MSS 4.98 MSS

    TABLE-US-00003 TABLE 3 MSI Model Validation Results 5-marker MSI-PCR detection system MSI-H MSS Total MSI Model MSI-H 28 6 34 MSS 2 403 405 Total 30 409 439

    TABLE-US-00004 TABLE 4 MSI Model Performance Performance Summary Agreement Statistic Point Estimate Wilson Score 95% CI PPA 93% 79%, 98% NPA 99% 97%, 99% PPV 82% 66%, 92% NPV 100%  98%, 100%

    EXAMPLE 3

    MSI detection for Samples of Different Tumor Purity

    [0077] Total of three cancer cell lines with MSI-H were utilized (where they come from) for the determination of the lowest amount of tumor purity required to determine MSI status. These three cancer cell lines were diluted with their own matched normal cell to form a series of diluted samples with 100%, 80%, 50%, 40%, 30%, and 20% of tumor content. The MSI score for each of these samples is shown in Table 5.

    TABLE-US-00005 TABLE 5 MSI status determined by MSI model for cell lines of different tumor purity Mean Target base Tumor/ Cell sequencing coverage Normal MSI MSI line depth at 100x percentage score status RKO 746.6 0.91 100%/0%  0.85 MSI-H RKO 623.3 0.92 80%/20% 0.98 MSI-H RKO 800.4 0.93 50%/50% 1 MSI-H RKO 824.1 0.92 40%/60% 1 MSI-H RKO 702.3 0.92 30%/70% 1 MSI-H RKO 712 0.92 20%/80% 0.92 MSI-H C33A 894.4 0.92 100%/0%  0.99 MSI-H C33A 687.3 0.92 80%/20% 1 MSI-H C33A 789.3 0.92 50%/50% 1 MSI-H C33A 763.8 0.92 40%/60% 1 MSI-H C33A 680.1 0.92 30%/70% 0.99 MSI-H C33A 694 0.92 20%/80% 0.97 MSI-H SW48 1670 0.92 100%/0%  1 MSI-H SW48 832.4 0.92 80%/20% 1 MSI-H SW48 721.8 0.92 50%/50% 1 MSI-H SW48 870.8 0.93 40%/60% 1 MSI-H SW48 784.5 0.93 30%/70% 0.99 MSI-H SW48 848 0.93 20%/80% 0.66 MSI-H