STABILIZING COMPOSITION AND METHOD FOR PRESERVING A BODILY FLUID
20230225308 · 2023-07-20
Inventors
Cpc classification
C12Q1/24
CHEMISTRY; METALLURGY
A01N1/0221
HUMAN NECESSITIES
C12N1/04
CHEMISTRY; METALLURGY
A01N1/0215
HUMAN NECESSITIES
International classification
Abstract
An aqueous stabilizing composition for preserving a bodily fluid at ambient temperature is provided. The aqueous stabilizing composition comprises: a sugar selected from a monosaccharide, a disaccharide, or a combination thereof; a buffering agent; a C.sub.1-C.sub.6 alkanol; boric acid, a salt of boric acid, or a combination thereof; and a chelating agent; wherein the composition has a pH of from 4.5 to 5.2. A method for preserving a bodily fluid using the aqueous stabilizing composition is also provided, the method comprising: a) obtaining a sample of the bodily fluid; b) contacting the bodily fluid with the aqueous stabilizing composition to form a mixture; c) mixing the mixture of (b) to form a homogeneous mixture; and d) storing the homogeneous mixture at ambient temperature.
Claims
1. An aqueous stabilizing composition for preserving a bodily fluid at ambient temperature, the composition comprising: a sugar selected from a monosaccharide, a disaccharide, or a combination thereof; a buffering agent; a C.sub.1-C.sub.6 alkanol; boric acid, a salt of boric acid, or a combination thereof; and a chelating agent; wherein the composition has a pH of from 4.5 to 5.2.
2. The composition of claim 1, wherein the sugar is a monosaccharide.
3. The composition of claim 2, wherein the monosaccharide is selected from fructose, glucose, mannose, galactose, or a combination thereof.
4. The composition of claim 3, wherein the monosaccharide is selected from fructose, glucose, or a combination thereof.
5. The composition of claim 1, wherein the sugar is a disaccharide.
6. The composition of claim 5, wherein the disaccharide is selected from trehalose, lactose, or sucrose, or a combination thereof.
7. The composition of claim 6, wherein the disaccharide is sucrose.
8. The composition of any one of claims 1-7, wherein the buffering agent is acetate buffer, citrate buffer, or a combination thereof; optionally, wherein the acetate buffer is selected from sodium acetate, potassium acetate, ammonium acetate, or a combination thereof; optionally, wherein the citrate buffer is selected from sodium citrate, ammonium citrate, or a combination thereof.
9. The composition of claim 8, wherein the buffering agent is sodium acetate.
10. The composition of any one of claims 1-9, wherein the C.sub.1-C.sub.6 alkanol is selected from methanol or ethanol.
11. The composition of claim 10, wherein the C.sub.1-C.sub.6 alkanol is ethanol.
12. The composition of any one of claims 1-11, wherein the chelating agent is selected from ethylenediaminetriacetic acid (EDTA), 1,2-cyclohexanediamine tetraacetic acid (CDTA), diethylenetriamine pentaacetic acid (DTPA), tetraazacyclododecanetetraacetic acid (DOTA), tetraazacyclotetradecanetetraacetic acid (TETA), desferioximine, or chelator analogs thereof.
13. The composition of claim 12, wherein the chelating agent is CDTA.
14. The composition of any one of claims 1-13, wherein: the sugar is present in an amount of from about 5% to about 45% (wt/vol), of from about 5% to about 40% (wt/vol), or from about 10% to about 30% (wt/vol), or from about 18% to about 22% (wt/vol), or about 20% (wt/vol), the buffering agent is present in an amount of from about 150 mM to about 1.75 M, or from about 150 mM to about 1.5 M, or from about 500 mM to about 1.2 M, or from about 0.7 M to about 0.8 M, or about 0.75 M; the C.sub.1-C.sub.6 alkanol is present in an amount of from about 5% to about 50% (vol/vol), or from about 10% to about 30% (vol/vol), or from about 20% to about 25% (vol/vol), or about 23% (vol/vol); the boric acid, the salt of boric acid or the combination thereof is present in an amount of from about 0.5% to about 5% (wt/vol), or from about 1% to about 3% (wt/vol), or from about 2% to about 2.5% (wt/vol), or about 2.2% (wt/vol), and the chelating agent is present in an amount of from about 10 mM to about 120 mM, or from about 10 mM to about 100 mM, or from about 30 mM to about 70 mM, or from about 40 mM to about 60 mM, or about 50 mM.
15. The composition of any one of claims 1-14, wherein the composition comprises, consists essentially of, or consists of: fructose, glucose, sucrose, or a combination thereof in an amount of from about 5% to about 45% (wt/vol), or from about 5% to about 40% (wt/vol), or from about 10% to about 30% (wt/vol), or from about 18% to about 22% (wt/vol), or about 20% (wt/vol), sodium acetate in an amount of from about 150 mM to about 1.75 M, or from about 150 mM to about 1.5 M, or from about 500 mM to about 1.2 M, or from about 0.7 M to about 0.8 M, or about 0.75 M; methanol, ethanol, or a combination thereof in an amount of from about 5% to about 50% (vol/vol), or from about 10% to about 30% (vol/vol), or from about 20% to about 25% (vol/vol), or about 23% (vol/vol); boric acid in an amount of from about 0.5% to about 5% (wt/vol), or from about 1% to about 3% (wt/vol), or from about 2% to about 2.5% (wt/vol), or about 2.2% (wt/vol), and CDTA in an amount of from about 10 mM to about 120 mM, or from about 10 mM to about 100 mM, or from about 30 mM to about 70 mM, or from about 40 mM to about 60 mM, or about 50 mM.
16. The composition of any one of claims 1-15, wherein the composition comprises, consists essentially of, or consists of: fructose, glucose, or a combination thereof in an amount of from about 5% to about 45% (wt/vol), or from about 5% to about 40% (wt/vol), or from about 10% to about 30% (wt/vol), or from about 18% to about 22% (wt/vol), or about 20% (wt/vol), sodium acetate in an amount of from about 150 mM to about 1.75 M, or from about 150 mM to about 1.5 M, or from about 500 mM to about 1.2 M, or from about 0.7 M to about 0.8 M, or about 0.75 M; ethanol in an amount of from about 5% to about 50% (vol/vol), or from about 10% to about 30% (vol/vol), or from about 20% to about 25% (vol/vol), or about 23% (vol/vol); boric acid in an amount of from about 0.5% to about 5% (wt/vol), or from about 1% to about 3% (wt/vol), or from about 2% to about 2.5% (wt/vol), or about 2.2% (wt/vol), and CDTA in an amount of from about 10 mM to about 120 mM, or from about 10 mM to about 100 mM, or from about 30 mM to about 70 mM, or from about 40 mM to about 60 mM, or about 50 mM.
17. The composition of any one of claims 1-16, wherein the composition stabilizes cells, extracellular vesicles, nucleic acids, and/or microorganisms contained in the bodily fluid.
18. The composition of claim 17, wherein the cells are selected from cancer cells or nucleated blood cells.
19. The composition of claim 17, wherein the nucleic acid is deoxyribonucleic acid (DNA).
20. The composition of claim 19, wherein the DNA comprises cell-free DNA (cfDNA), such as circulating tumor DNA (ctDNA).
21. The composition of claim 17, wherein the nucleic acid is ribonucleic acid (RNA).
22. The composition of claim 21, wherein the RNA comprises cell-free RNA (cfRNA).
23. The composition of claim 21, wherein the RNA comprises extracellular vesicle RNA (EV RNA).
24. The composition of claim 17, wherein the microorganisms are selected from bacteria or viruses.
25. A method for preserving a bodily fluid, the method comprising: a) obtaining a sample of the bodily fluid; b) contacting the bodily fluid with an aqueous stabilizing composition as defined in any one of claims 1-24 to form a mixture; c) mixing the mixture of (b) to form a homogeneous mixture; and d) storing the homogeneous mixture at ambient temperature.
26. The method of claim 25, wherein preserving the bodily fluid comprises stabilizing cells, extracellular vesicles, nucleic acids, and/or microorganisms contained in the bodily fluid.
27. The method of claim 26, wherein the cells are selected from cancer cells or nucleated blood cells.
28. The method of claim 26, wherein the nucleic acid is deoxyribonucleic acid (DNA).
29. The method of claim 28, wherein the DNA comprises cell-free DNA (cfDNA), such as circulating tumor DNA (ctDNA).
30. The method of claim 26, wherein the nucleic acid is ribonucleic acid (RNA).
31. The method of claim 30, wherein the RNA comprises cell-free RNA (cfRNA).
32. The method of claim 30, wherein the RNA comprises extracellular vesicle RNA (EV RNA).
33. The method of claim 26, wherein the microorganisms are selected from bacteria or viruses.
34. The method of any one of claims 26-33, wherein the cells, nucleic acids, extracellular vesicles, and/or microorganisms contained in the bodily fluid are stabilized for at least 7 days at ambient temperature, or for at least 14 days at ambient temperature.
35. The composition of any one of claims 1-24, or the method of any one of claims 25-34, wherein the bodily fluid is urine or saliva.
36. An aqueous composition comprising: a sugar selected from a monosaccharide, a disaccharide, or a combination thereof; a buffering agent; a C.sub.1-C.sub.6 alkanol; boric acid, a salt of boric acid, or a combination thereof; a chelating agent; and a bodily fluid.
37. The composition of claim 36, wherein the sugar is a monosaccharide.
38. The composition of claim 37, wherein the monosaccharide is selected from fructose, glucose, mannose, galactose, or a combination thereof.
39. The composition of claim 38, wherein the monosaccharide is selected from fructose, glucose, or a combination thereof.
40. The composition of claim 36, wherein the sugar is a disaccharide.
41. The composition of claim 40, wherein the disaccharide is selected from trehalose, lactose, or sucrose, or a combination thereof.
42. The composition of claim 41, wherein the disaccharide is sucrose.
43. The composition of any one of claims 36-42, wherein the buffering agent is acetate buffer, citrate buffer, or a combination thereof; optionally, wherein the acetate buffer is selected from sodium acetate, potassium acetate, ammonium acetate, or a combination thereof; optionally, wherein the citrate buffer is selected from sodium citrate, ammonium citrate, or a combination thereof.
44. The composition of claim 43, wherein the buffering agent is sodium acetate.
45. The composition of any one of claims 36-44, wherein the C.sub.1-C.sub.6 alkanol is selected from methanol or ethanol.
46. The composition of claim 45, wherein the C.sub.1-C.sub.6 alkanol is ethanol.
47. The composition of any one of claims 36-46, wherein the chelating agent is selected from ethylenediaminetriacetic acid (EDTA), 1,2-cyclohexanediamine tetraacetic acid (CDTA), diethylenetriamine pentaacetic acid (DTPA), tetraazacyclododecanetetraacetic acid (DOTA), tetraazacyclotetradecanetetraacetic acid (TETA), desferioximine, or chelator analogs thereof.
48. The composition of claim 47, wherein the chelating agent is CDTA.
49. The composition of any one of claims 36-48, wherein: the sugar is present in an amount of from about 1.5% to about 15% (wt/vol), or from about 2% to about 10% (wt/vol), or from about 5% to about 7% (wt/vol), or about 6% (wt/vol), the buffering agent is present in an amount of from about 50 mM to about 500 mM, or from about 200 mM to about 400 mM, or from about 220 mM to about 240 mM, or about 230 mM, or about 225 mM; the C.sub.1-C.sub.6 alkanol is present in an amount of from about 2% to about 40% (vol/vol), or from about 3% to about 20% (vol/vol), or from about 5% to about 10% (vol/vol), or about 6.5% (vol/vol), or about 6.9% (vol/vol); the boric acid, the salt of boric acid or the combination thereof is present in an amount of from about 0.1% to about 2% (wt/vol), or from about 0.2% to about 1.5% (wt/vol), or from about 0.5% to about 1.0% (wt/vol), or about 0.7% (wt/vol), or about 0.6% (wt/vol); and the chelating agent is present in an amount of from about 2.5 mM to about 50 mM, or from about 5 mM to about 25 mM, or from about 10 mM to about 20 mM, or about 16 mM, or about 15 mM.
50. The composition of any one of claims 36-49, wherein the bodily fluid is urine or saliva.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0019] For a better understanding of the present invention including the progression of development to get to the end product, reference is made to the following description which is to be used in conjunction with the accompanying drawings, where:
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0036] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
[0037] As used in the specification and claims, the singular forms “a”, “an” and “the” include plural references unless the context clearly dictates otherwise.
[0038] The term “comprising” as used herein will be understood to mean that the list following is non-exhaustive and may or may not include any other additional suitable items, for example one or more further feature(s), component(s) ingredient(s) and/or elements(s) as appropriate.
[0039] Terms of degree such as “substantially”, “about” and “approximately” as used herein mean a reasonable amount of deviation of the modified term such that the end result is not significantly changed. These terms of degree should be construed as including a deviation of at least ±10% of the modified term if this deviation would not negate the meaning of the word it modifies.
[0040] The term “bodily fluid” as used herein will be understood to mean a naturally occurring fluid from a human or an animal, and includes, but is not limited to urine, saliva, sputum, serum, plasma, blood, pharyngeal, nasal/nasal pharyngeal and sinus secretions, mucous, gastric juices, pancreatic juices, bone marrow aspirates, cerebral spinal fluid, feces, semen, products of lactation or menstruation, cervical secretions, vaginal fluid, tears, or lymph. In one embodiment, the bodily fluid is selected from urine or saliva. In another embodiment, the bodily fluid is urine.
[0041] The term “ambient temperature” as used herein refers to a range of temperatures that could be encountered by the mixture of a bodily fluid (e.g. urine sample) and the aqueous stabilizing composition described herein from the point of collection, during transport (which can involve relatively extreme temperatures, albeit usually for shorter periods of time (e.g. <5 days)), as well as during prolonged storage prior to analysis. In one embodiment, the ambient temperature is ranging from about −20° C. to about 50° C. In another embodiment, the ambient temperature is room temperature (RT) and ranges from about 15° C. to about 25° C.
[0042] The term “monosaccharide” as used herein will be understood to mean a sugar that is not decomposable into simpler sugars by hydrolysis, is classed as either an aldose or ketose, and contains one or more hydroxyl groups per molecule. In one embodiment, the monosaccharide is selected from fructose, glucose, mannose, or galactose. In another embodiment, the monosaccharide is fructose, glucose, or a combination thereof.
[0043] The term “disaccharide” as used herein will be understood to mean a compound in which two monosaccharide units are joined by a glycosidic linkage. In one embodiment, the disaccharide is selected from sucrose, trehalose, and lactose. In another embodiment, the disaccharide is sucrose.
[0044] It has been found that compositions according to the present application comprising disaccharides can be more difficult to prepare, as such solutions may have very high viscosities which can lead to improper mixing of the components and/or addition to the specimen (i.e. bodily fluid) due to difficulties in mixing. Overall, due to workability of the samples, monosaccharides are preferred over disaccharides for the compositions and methods of the present application.
[0045] The term “chelator” or “chelating agent” as used herein will be understood to mean a chemical that will form a soluble, stable complex with certain metal ions (e.g., Ca.sup.2+ and Mg.sup.2+), sequestering the ions so that they cannot normally react with other components, such as deoxyribonucleases (DNases) or endonucleases (e.g. type I, II and III restriction endonucleases) and exonucleases (e.g. 3′ to 5′ exonuclease), enzymes which are abundant in various body fluid samples. In the present composition, chelating agent(s) participates in the inhibition of DNases and microbial growth in biological samples. A chelator can be, for example, ethylene glycol tetraacetic acid (EGTA), (2-hydroxyethyl)ethylenediaminetriacetic acid (HEDTA), diethylene triamine pentaacetic acid (DTPA), nitrilotriacetic acid (NTA), ethylenediaminetriacetic acid (EDTA), 1,2-cyclohexanediaminetetraacetic acid (CDTA), N,N-bis(carboxymethyl)glycine, triethylenetetraamine (TETA), tetraazacyclododecanetetraacetic acid (DOTA), desferioximine, citrate anhydrous, sodium citrate, calcium citrate, ammonium citrate, ammonium bicitrate, citric acid, diammonium citrate, ferric ammonium citrate, and lithium citrate. These chelating agents may be used singly or in combination of two or more thereof.
[0046] The term “C.sub.1-C.sub.6 alkanol” as used herein will be understood to mean straight-chain or branched, such as methanol, ethanol, propanol, isopropanol, butanol, n-butanol, pentanol, hexanol, or any combination thereof. In one embodiment of the present composition, the preferred alcohol is ethanol.
[0047] In one embodiment, there is provided an aqueous stabilizing composition for preserving a bodily fluid at ambient temperature, the composition comprising: a sugar selected from a monosaccharide, a disaccharide, or a combination thereof; a buffering agent; a C.sub.1-C.sub.6 alkanol; boric acid, a salt of boric acid, or a combination thereof; and a chelating agent; wherein the composition has a pH of from 4.5 to 5.2.
[0048] In one embodiment, the aqueous composition comprises boric acid; a salt of boric acid, such as, for example, dihydrogen borate, hydrogen borate, diborate, triborate, tetraborate, metaborate, hydroxoborate, borate salts; or a combination thereof. In another embodiment, the aqueous composition comprises boric acid, sodium borate, or a combination thereof. In yet another embodiment, the aqueous composition comprises boric acid. In one embodiment, the boric acid, the salt of boric acid or the combination thereof is present in the aqueous stabilizing composition in an amount of from about 0.5% to about 5% (wt/vol), or from about 1% to about 3% (wt/vol); or from about 2% to about 2.5% (wt/vol), or about 2.2% (wt/vol).
[0049] In one embodiment, the sugar is a monosaccharide, such as, for example, fructose, glucose, mannose, galactose, or a combination thereof. In another embodiment, the monosaccharide is fructose, glucose, or a combination thereof. In another embodiment, the sugar is a disaccharide, such as, for example, trehalose, lactose, or sucrose, or a combination thereof. In another embodiment, the disaccharide is sucrose. In one embodiment, the sugar is present in the aqueous stabilizing composition in an amount of from about 5% to about 45% (wt/vol), of from about 5% to about 40% (wt/vol), or from about 10% to about 30% (wt/vol), or from about 18% to about 22% (wt/vol), or about 20% (wt/vol).
[0050] In general, the pH of the present aqueous stabilizing composition can be maintained in the desired range using one or more appropriate buffering agents. In accordance with one embodiment, the composition comprises one, two, or more buffering agents (non-limiting examples being acetate buffer and citrate buffer, such as sodium acetate, potassium acetate, ammonium acetate, sodium citrate, and ammonium citrate) with pK.sub.a values, logarithmic acid dissociation constants, at 25° C. ranging from 3 to 6.5 to maintain the pH within the preferred range of 4.5 to 5.2. In one embodiment, the buffering agent is sodium acetate.
[0051] An acid dissociation constant, K.sub.a, is a quantitative measure of the strength of an acid in solution. The larger the K.sub.a value, the more dissociation of the molecules in solution and thus the stronger the acid. Due to the many orders of magnitude spanned by K.sub.a values, a logarithmic measure of the acid dissociation constant, pK.sub.a, is more commonly used in practice. The larger the value of pK.sub.a, the smaller the extent of dissociation at any given pH, i.e., the weaker the acid. In living organisms, acid-base homeostasis and enzyme kinetics are dependent on the pK.sub.a values of many acids and bases present in the cell and in the body. In chemistry, knowledge of pK.sub.a values is necessary for the preparation of buffer solutions and is also a prerequisite for a quantitative understanding of the interaction between acids or bases and metal ions to form complexes. One skilled in the art will understand that a given compound/buffer can buffer the pH of a solution only when its concentration is sufficient and when the pH of the solution is close (within about one pH unit) to its pK.sub.a. In one embodiment, the pH of the present composition is in the range of 4.5 to 5.2. In a preferred embodiment, the pH of the composition is about 5.0. The amount of buffering agent(s) in the aqueous stabilizing composition can be of from about 150 mM to about 1.75 M, or from about 150 mM to about 1.5 M, or from about 500 mM to about 1.2 M, or from about 0.7 M to about 0.8 M, or about 0.75 M, for example.
[0052] In one embodiment, the C.sub.1-C.sub.6 alkanol in the aqueous stabilizing composition is selected from methanol or ethanol. In another embodiment, the C.sub.1-C.sub.6 alkanol is ethanol. In yet another embodiment, the C.sub.1-C.sub.6 alkanol is present in the aqueous stabilizing composition in an amount of from about 5% to about 50% (vol/vol), or from about 10% to about 30% (vol/vol), or from about 20% to about 25% (vol/vol), or about 23% (vol/vol).
[0053] Ethanol causes dehydration of proteins or a reduction in water activity, followed by electrostatic attraction between proteins, aggregation and insolubilization. While wishing to not be bound by theory, the inventor believes that ethanol, at the percentage used, has little to no fixative properties in this composition; rather, it is important for overall stability and enhances the functionality of other chemical compounds which may be included in the present composition. In addition, for shipping/transport of flammable liquids, it is desirable to keep organic solvents, such as ethanol, below 24% by volume in solutions for exemption from Transport of Dangerous Goods (TDG) regulations (United Nations (UN) number 1170); otherwise a solution with >24% ethanol is classified as class 3 (flammable liquids), special packaging is mandated, and transport complexity and costs increase. As such, an aqueous stabilizing composition comprising about 23% (vol/vol) or lower is particularly advantageous.
[0054] In another embodiment, the chelating agent in the aqueous stabilizing composition is selected from, for example, ethylenediaminetriacetic acid (EDTA), 1,2-cyclohexanediamine tetraacetic acid (CDTA), diethylenetriamine pentaacetic acid (DTPA), tetraazacyclododecanetetraacetic acid (DOTA), tetraazacyclotetradecanetetraacetic acid (TETA), desferioximine, or chelator analogs thereof. In another embodiment, the chelating agent is CDTA. In another embodiment, the chelating agent is present in the aqueous stabilizing composition in an amount of from about 10 mM to about 120 mM, or from about 10 mM to about 100 mM, or from about 30 mM to about 70 mM, or from about 40 mM to about 60 mM, or about 50 mM.
[0055] In one embodiment of the aqueous stabilizing composition, the composition comprises, consists essentially of, or consists of: the sugar (such as fructose, glucose, sucrose, or a combination thereof; preferably fructose, glucose, or a combination thereof) in an amount of from about 5% to about 45% (wt/vol), of from about 5% to about 40% (wt/vol), or from about 10% to about 30% (wt/vol), or from about 18% to about 22% (wt/vol), or about 20% (wt/vol); the buffering agent (such as, for example, sodium acetate) in an amount of from about 150 mM to about 1.75 M, or from about 150 mM to about 1.5 M, or from about 500 mM to about 1.2 M, or from about 0.7 M to about 0.8 M, or about 0.75 M; the C.sub.1-C.sub.6 alkanol (such as methanol, ethanol, or a combination thereof; preferably ethanol) in an amount of from about 5% to about 50% (vol/vol), or from about 10% to about 30% (vol/vol), or from about 20% to about 25% (vol/vol), or about 23% (vol/vol); the boric acid, the salt of boric acid or the combination thereof (preferably boric acid) in an amount of from about 0.5% to about 5% (wt/vol); or from about 1% to about 3% (wt/vol); or from about 2% to about 2.5% (wt/vol), or about 2.2% (wt/vol); and the chelating agent (such as CDTA) in an amount of from about 10 mM to about 120 mM, or from about 10 mM to about 100 mM, or from about 30 mM to about 70 mM, or from about 40 mM to about 60 mM, or about 50 mM.
[0056] In one embodiment, the aqueous stabilizing composition stabilizes cells (such as cancer cells or nucleated blood cells), extracellular vesicles, nucleic acids (e.g. cellular DNA and RNA, such as cell-free DNA (cfDNA), cell-free RNA (cfRNA), and extracellular vesicle RNA (EV RNA)), and/or microorganisms (such as bacteria or viruses) contained in the bodily fluid.
[0057] In another embodiment, there is provided a method for preserving a bodily fluid, the method comprising: a) obtaining a sample of the bodily fluid; b) contacting the bodily fluid with the aqueous stabilizing composition as defined above to form a mixture; c) mixing the mixture of (b) to form a homogeneous mixture; and d) storing the homogeneous mixture at ambient temperature. In one embodiment, preserving the bodily fluid comprises stabilizing cells (such as cancer cells or nucleated blood cells), extracellular vesicles, nucleic acids (e.g. DNA and RNA, such as cell-free DNA (cfDNA), cell-free RNA (cfRNA), and extracellular vesicle RNA (EV RNA)), and/or microorganisms (such as bacteria or viruses) contained in the bodily fluid. In another embodiment, the cells, nucleic acids, extracellular vesicles, and/or microorganisms contained in the bodily fluid are stabilized for at least 7 days at ambient temperature. In another embodiment, the cells, nucleic acids, extracellular vesicles, and/or microorganisms contained in the bodily fluid are stabilized for at least 14 days at ambient temperature. In another embodiment, the bodily fluid is urine or saliva. In another embodiment, the bodily fluid is urine.
[0058] In yet another embodiment, there is provided an aqueous composition comprising: a sugar selected from a monosaccharide, a disaccharide, or a combination thereof; a buffering agent; a C.sub.1-C.sub.6 alkanol; boric acid, a salt of boric acid, or a combination thereof; a chelating agent; and a bodily fluid. In one embodiment, the bodily fluid is urine. In another embodiment, the bodily fluid is urine and the pH of the aqueous composition comprising the bodily fluid is between 5 and 5.5. In another embodiment, the sugar is present in an amount of from about 1.5% to about 15% (wt/vol), or from about 2% to about 10% (wt/vol), or from about 5% to about 7% (wt/vol), or about 6% (wt/vol); the buffering agent is present in an amount of from about 50 mM to about 500 mM, or from about 200 mM to about 400 mM, or from about 220 mM to about 240 mM, or about 230 mM, or about 225 mM; the C.sub.1-C.sub.6 alkanol is present in an amount of from about 2% to about 40% (vol/vol), or from about 3% to about 20% (vol/vol), or from about 5% to about 10% (vol/vol), or about 6.5% (vol/vol), or about 6.9% (vol/vol); the boric acid, the salt of boric acid or the combination thereof is present in an amount of from about 0.1% to about 2% (wt/vol), or from about 0.2% to about 1.5% (wt/vol), or from about 0.5% to about 1.0% (wt/vol), or about 0.7% (wt/vol), or about 0.6% (wt/vol), and the chelating agent is present in an amount of from about 2.5 mM to about 50 mM, or from about 5 mM to about 25 mM, or from about 10 mM to about 20 mM, or about 16 mM, or about 15 mM.
[0059] In one embodiment, the bodily fluid is urine and the urine sample is collected using a device for capturing a predetermined volume of a predefined portion of urine (e.g. first void), such as that described in WO2014037152 entitled “LIQUID SAMPLER, KIT OF PARTS, AND METHOD FOR ASSEMBLY”. In one embodiment, the Colli-Pee® First Void Urine Collection Device (Novosanis) can be used. The aqueous stabilizing composition can be present in the device at the time of collection, or the urine can be contacted with the aqueous stabilizing composition immediately post-collection. The reservoir containing the urine sample and aqueous stabilizing composition can be sealed with an appropriate cap, and the combined sample and stabilizing composition can be gently mixed, for example by inverting the tube. Urine samples can also be collected in standard urine specimen containers (e.g. VWR, Cat. No. 10804-050) and then mixed with the stabilizing composition. Alternatively, collected urine can be transported to the laboratory on ice packs where it can be mixed with the present stabilizing composition.
[0060] In another embodiment, the bodily fluid is saliva and the saliva sample is collected using a device such as, for example, those described in WO2007/068094 entitled “CONTAINER SYSTEM FOR RELEASABLY STORING A SUBSTANCE”, WO2010/020043 entitled “SAMPLE RECEIVING DEVICE”, and WO2010/130055 entitled “CLOSURE, CONTAINING APPARATUS, AND METHOD OF USING SAME”.
[0061] In another embodiment, the bodily fluid is feces, and the fecal sample is collected using a device such as that described in WO2015172250 entitled “DEVICE FOR COLLECTING, TRANSPORTING AND STORING BIOMOLECULES FROM A BIOLOGICAL SAMPLE”.
[0062] In still another embodiment, the sample of the bodily fluid can be collected in a standard, commercially-available laboratory or transport tube (e.g. 10 mL round-bottom tube (92×15.3 mm), Cat. No. 60.610; Sarstedt, or larger tube depending on the sample type and size). The tube containing the sample of the bodily fluid and aqueous stabilizing composition can be sealed with an appropriate cap, and the combined sample and stabilizing composition can be gently mixed, for example by inverting the tube.
[0063] Bodily fluid should preferably be mixed immediately with the stabilizing composition at the point of collection. Otherwise, samples should be stored and/or transported on ice packs or refrigerated before mixing with the composition.
[0064] As the skilled worker will appreciate, the aqueous stabilizing composition (“chemistry”) described herein can be combined with the sample of the bodily fluid in a variety of ratios. For example, where the bodily fluid is urine, it is desirable to avoid overly diluting the sample and thus reducing the analytes collected; thus, the ratio of chemistry:urine can range, for instance, from 0.25:1 to 0.75:1—e.g. 0.25:1, 0.30:1, 0.35:1, 0.40:1, 0.45:1, 0.50:1, 0.55:1, 0.60:1, 0.65:1, 0.70:1, or 0.75:1. In one embodiment, the ratio of chemistry:urine is 0.40:1 to 0.45:1.
[0065] For other bodily fluids, such as feces, in order to ensure sufficient mixing, higher ratios of chemistry:sample can be used.
[0066] In one embodiment, following the step of contacting the bodily fluid with the aqueous stabilizing composition and mixing to form a homogeneous mixture, the homogenous mixture then comprises: the sugar (such as fructose, glucose, sucrose, or a combination thereof; preferably fructose, glucose, or a combination thereof) in an amount of from about 1.5% to about 15% (wt/vol), or from about 2% to about 10% (wt/vol), or from about 5% to about 7% (wt/vol), or about 6% (wt/vol); the buffering agent (such as, for example, sodium acetate) in an amount of from about 50 mM to about 500 mM, or from about 200 mM to about 400 mM, or from about 220 mM to about 240 mM, or about 230 mM, or about 225 mM; the C.sub.1-C.sub.6 alkanol (such as methanol, ethanol, or a combination thereof; preferably ethanol) in an amount of from about 2% to about 40% (vol/vol), or from about 3% to about 20% (vol/vol), or from about 5% to about 10% (vol/vol), or about 6.5% (vol/vol), or about 6.9% (vol/vol); the boric acid, the salt of boric acid or the combination thereof (preferably boric acid) in an amount of from about 0.1% to about 2.2% (wt/vol); or from about 0.2% to about 1.5% (wt/vol); or from about 0.5% to about 1.0% (wt/vol), or about 0.7% (wt/vol) or about 0.6% (wt/vol); and the chelating agent (preferably CDTA) in an amount of from about 2.5 mM to about 50 mM, or from about 5 mM to about 25 mM, or from about 10 mM to about 20 mM, or about 16 mM, or about 15 mM.
[0067] As noted above, in one embodiment, the aqueous stabilizing composition stabilizes cells (such as cancer cells or nucleated blood cells), extracellular vesicles, nucleic acids (e.g. DNA and RNA, such as cell-free DNA (cfDNA), cell-free RNA (cfRNA), and extracellular vesicle RNA (EV RNA)), and/or microorganisms (such as bacteria or viruses) contained in the bodily fluid. In one embodiment, the aqueous stabilizing composition stabilizes such components of the bodily fluid for at least 7 days at ambient temperature. In another embodiment, the aqueous stabilizing composition stabilizes such components of the bodily fluid for at least 14 days at ambient temperature. Such stabilization can be assessed by methods known to those skilled in the art, such as via monitoring the degradation of cell-free nucleic acids (described further in the Materials and Methods section, and in the Examples which follow).
[0068] ΔC.sub.t corresponds to the relative change in the amount or expression of a given gene. ΔC.sub.t corresponds to C.sub.t(T)-C.sub.t(T0), where C.sub.t(T) stands for cycle threshold at day 7 or day 14 while C.sub.t(T0) denotes cycle threshold at day 0. Cycle threshold (C.sub.t) value of a reaction is defined as the cycle number when the fluorescence of a PCR product can be detected above the background signal. In the present studies, this ΔC.sub.t when calculated as C.sub.t(T7 or T14)-C.sub.t(T0) accounts for the change in the stability of different analytes in unpreserved and preserved samples after storage at room temperature for a specified amount of time. ΔC.sub.t when calculated as C.sub.t(T0 Chem)-C.sub.t(T0 NA) accounts for the neutrality (change in the basal concentration of analytes with the addition of a given chemistry in the urine samples relative to the unpreserved urine samples at the time of collection, i.e. Day 0). Unchanged ΔC.sub.t values or ΔC.sub.t values close to 0 are indicative of stability, as this means that the concentration of analyte is not significantly changing over the course of time (and thus is indicative of the stability of the analyte in the composition under the testing conditions). For example, in the present cell-free DNA studies, ΔC.sub.t value ranged from +2 to +14 in unpreserved samples held at RT for 7 days. This marked increase in ΔC.sub.t value (median value: >+5) is indicative of degradation of cell-free DNA in unpreserved samples. On the other hand, ΔC.sub.t median value for the detection of cell-free DNA after storage at room temperature in the present aqueous stabilizing composition was almost zero, indicating preservation of cell-free DNA stability and content and also indirectly accounts for cellular stability and integrity. For cell-free RNA, median ΔC.sub.t value of +2.5 in unpreserved samples is indicative of cell-free RNA degradation, while relatively lower median ΔC.sub.t value of 1.3 is indicative of better stability of cell-free RNA content in preserved samples when compared to unpreserved samples. For cellular RNA stability, a median ΔC.sub.t value of +7.0 in unpreserved samples is indicative of marked degradation of cellular RNA. On the other hand, median ΔC.sub.t value of less than 2 in preserved samples indicate cellular RNA stability. Similarly, for EV RNA, a median ΔC.sub.t value of more than +3 in unpreserved samples is indicative of instability and compromised detection of EV RNA, while a median ΔC.sub.t value of 0.5 in preserved samples indicates excellent EV RNA stability and detection. This is merely one exemplary method of assessing stabilization of cells, extracellular vesicles, nucleic acids, and/or microorganisms in bodily fluids, and other methods of assessing such stabilization are known to the skilled worker and/or are outlined in further detail in the Materials and Methods section and Examples described below.
[0069] As described in further detail in Example 7 below, preservative agents/compositions containing formalin/formaldehyde-based fixatives may be used to fix cells in biological samples or specimens and prevent leaking of cellular nucleic acids into the extracellular space. Such compositions may contain formaldehyde, or alternatively compounds capable of releasing an aldehyde, such as a formaldehyde releaser/formaldehyde donor/formaldehyde-releasing preservative which is a chemical compound that slowly releases formaldehyde. Notably, when compared to the DNA isolated from frozen tissues, formalin-fixed tissues exhibit a high frequency of non-reproducible sequence alteration (Srinivasan M, Sedmak D, Jewell S (2002) Effect of fixatives and tissue processing on the content and integrity of nucleic acids. Am J Pathol 161(6): 1961-1971). Formaldehyde, a principal ingredient of most commonly used fixatives, leads to the generation of DNA-protein and RNA-protein cross-linkages. Furthermore, the nucleic acids will fragment in situations where the fixative solution is not buffered. Both of the above provide challenges for PCR-based analyses (Gilbert M T P, Haselkorn T, Bunce M, Sanchez J J, Lucas S B, Jewell L D, Van Marck E, Worobey M (2007) The isolation of nucleic acids from fixed, paraffin-embedded tissues—Which methods are useful when? PLoS ONE 2(6): e537. Doi: 10.1371/journal.pone.0000537; Wong S Q, Li J, Tan A Y-C, Vedururu R, Pang J-M B, Do H, Ellul J, Doig K, Bell A, MacArthur G A, Fox S B, Thomas D M, Fellowes A, Parisot J P, Dobrovic A (2014) Sequence artifacts in a prospective series of formalin-fixed tumours tested for mutations in hotspot regions by massively parallel sequencing. BMC Medical Genomics 7:23. Doi: 10.1186/1755-8794-7-23). Specifically, this chemical damage to DNA reduces Taq DNA polymerase fidelity and PCR amplification efficiency (Sikorsky J A, Primerano D A, Fenger T W, Denvir J (2007) DNA damage reduces Taq DNA polymerase fidelity and PCR amplification efficiency. Biochem Biophys Res Commun 355(2): 431-437). Hence, formalin/formaldehyde-based fixatives are not ideal for molecular analyses. Thus, an advantage of the aqueous stabilizing composition and method for preserving a bodily fluid at ambient temperature as disclosed herein is that the compositions and methods of the present application do not require the use of formaldehyde, or compounds/components capable of releasing an aldehyde such as formaldehyde releasers, formaldehyde donors or formaldehyde-releasing preservatives.
EXAMPLES
[0070] Materials and Methods
[0071] Cell-Free Nucleic Acids Extraction:
[0072] Cell-free nucleic acids extraction was performed using QiaAmp Circulating Nucleic Acid Extraction Kit (Qiagen; Cat. No. 55114) according to manufacturer's protocol. First morning, First Void (FMFV) human urine, random mid-day first void (FV) urine samples and saliva samples were centrifuged down at 3000 g-3800 g for 10-20 minutes at room temperature (RT) and the cleared supernatant (2-4 mL) was used for cell-free nucleic acids extraction. Extracted cell-free nucleic acids profile was assessed on 4200 Agilent Tapestation platform using HS D5000 tapes (Agilent, Cat. No. 5067-5592) and reagents (Agilent, Cat. No. 5067-5593) according to manufacturer's instructions.
[0073] Urinary Extracellular Vesicles (EV) RNA Extraction:
[0074] Urine EV RNA extraction was performed using exoRNeasy Maxi Kit (Qiagen; Cat. No. 77164) or Ultrafiltration. Urine Samples were precleared by centrifugation at 3000×g for 10 minutes at RT, followed by filtration of supernatant using 0.80 μm syringe filter (Sartorius® Minisart NML®, Cat. No. 16592, or Millipore® Millex®-AA, Cat. No. SLAA033SB) prior to EV isolation and >200 nucleotide (nt) long RNA extraction according to manufacturer's instructions (Supplemental Information: Purification of exosomal RNA, including miRNA, from urine using the exoRNeasy Serum/Plasma Midi/Maxi Kit). EVs and EV RNA isolation using Ultrafiltration was performed using AMICON Ultra-15 centrifugal units with Ultracel-100 regenerated cellulose membrane (Millipore-Sigma; Cat. No. UFC910024) as follows:
[0075] 1. Empty Ultracel-100 15 mL columns were washed with 1×PBS pH 7.4 (Thermo fisher Scientific; Cat. No. 10010023) using centrifugation at 4000 g for 5 mins at room temperature (RT).
[0076] 2. Precleared and filtered urine samples were concentrated using Ultracel-100 columns by performing centrifugation at 4000 g for 10 mins at RT and the resulting filtrate was discarded.
[0077] 3. Ultracel-100 15 mL columns filter with retained concentrated urine were washed with 1×PBS pH 7.4 (Thermo fisher Scientific; Cat. No. 10010023) by centrifugation at 4000 g for 5 mins at RT.
[0078] 3. 700 μL of QIAzol Lysis Reagent Qiagen; Cat. No. 79306) was added directly to the washed Ultracel-100 filter for the lysis of captured EVs for EV RNA extraction. The filter columns were transferred to new 50 mL Falcon tubes; vortexed for 10 sec, incubated at RT for 5 mins followed by centrifugation at 4000 g for 5 mins at RT.
[0079] 4. The resulting filtrate and the reminiscent lysate retained on the filter was collected for EV RNA isolation. Add 100 μL of chloroform and vortex vigorously. Let stand for 2-5 minutes at RT.
[0080] 5. Centrifuge at 12,000×g for 15 minutes at 4° C. Transfer ˜400 μL of aqueous phase to a new tube.
[0081] 6. Add 400 μL (equal volume) of 70% ethanol and mix properly prior to transfer of the mixture to Qiagen RNeasy MinElute columns. Centrifuge at 8,000×g for 30 seconds at RT. Discard the filtrate
[0082] 7. Add 700 μL of Buffer RWT (Qiagen) to the columns. Centrifuge at 8,000×g for 30 seconds at RT. Discard the filtrate.
[0083] 8. Add 500 μL of Buffer RPE (Qiagen) to the columns. Centrifuge at 8,000×g for 30 seconds at RT. Discard the filtrate.
[0084] 9. Add 500 μL of Buffer RPE (Qiagen) to the columns. Centrifuge at 8,000×g for 2 minutes at RT. Discard the filtrate and transfer the empty columns to new 2 mL collection tubes (Qiagen). Centrifuge the columns with lids open at maximum speed for 5 mins to dry the membrane.
[0085] 10. Add 20 μL of RNase-free water to the center of the dried spin columns. Let the columns stand at RT for 1 mins followed by centrifugation at maximum speed for 1 min at RT.
[0086] 11. Store the collected RNA samples at −80° C. until quantification and downstream processing.
[0087] 12. Extracted EV RNA samples were quantified on Agilent 2100 Bioanalyzer using Agilent RNA 6000 Pico Kit (Cat. No. 5067-1513) according to the manufacturer's instructions and/or Ribogreen quantification analysis using Quant-iT Ribogreen RNA Assay Kit (Thermo Fisher Scientific, Cat. No. R11490) for downstream cDNA preparations.
[0088] 16S qPCR Assay:
[0089] Extracted nucleic acids from urine samples were subjected to qPCR assay for the quantification of bacterial DNA content using 2× iTaq Universal SYBR Mastermix (Bio-Rad; Cat. No. 1725121). The primers and qPCR conditions of the Bacterial 16s rRNA are as follows: BacrRNA173-Forward primer 5′ ATTACCGCGGCTGCTGG 3′ (SEQ ID NO: 1), BacrRNA173-Reverse primer 5′ CCTACGGGAGGCAGCAG 3′ (SEQ ID NO: 2) (D C Emery, D K Shoemark, T E Blatstone, C M Waterfall, J A Coghill, T A Cerajewska, M Davies, N X West, S J Allen (2017) 16S rRNA next generation sequencing analysis shows bacteria in Alzheimer's post-mortem brain. Frontiers in Aging Neuroscience 9: 195. Doi: 10.3389/friagi.2017.00195). The amplification mixture (20 μL) contained: 10 μL of 2×iTaq Universal SYBR mastermix, 1 μL each of 10 μM forward and reverse primer, 6 μL of nuclease-free water (NFW from Invitrogen, Cat. No. 10977023) and 2 μL of extracted urinary cell-free nucleic acids. E. coli gDNA standards with serial dilutions (1, 1:10, 1:100 and 1:1000) and a non-template control (2 μL of RNase/DNase-free water) were used in each qPCR run. PCR reactions were performed on a Bio-Rad C1000 Touch Thermal Cycler (#1851196) and conditions are as follows: 95° C.: 5 minutes, [95° C.: 20 seconds, 56° C.: 30 seconds]×45 cycles. Melt curves were obtained by heating the samples from 65° C. to 95° C. by increments of 0.5° C. and plate read for 5 seconds at every increment. Bacterial cell-free DNA or cellular DNA quantification analysis was performed using “ΔC.sub.t” which stands for [C.sub.t(T7)-C.sub.t(T0)]. “C.sub.t(T7)” and “C.sub.t(T0)” stands for qPCR cycle threshold at day 7 and day 0, respectively.
[0090] Human β-Globin qPCR Assay:
[0091] Extracted nucleic acids from urine samples were subjected to qPCR assay for the quantification of human cell-free DNA content using 2× iTaq Universal SYBR Mastermix (Bio-Rad; Cat. No. 1725121). The primers and the PCR conditions of the human β-globin qPCR assay are described in the literature (M Jung, S Klotzek, M Lewandowski, M Fleischhacker, K Jung (2003) Changes in concentration of DNA in serum and plasma during storage of blood samples. Clinical Chem 49(6): 1028-1029) and are as follows: Forward primer: 5′ ACACAACTGTGTTCACTAGC 3′ (SEQ ID NO: 3), reverse primer: 5′ CAACTTCATCCACGTTCACC 3′ (SEQ ID NO: 4). The amplification mixture (20 μL) contained: 10 μL of 2× iTaq Universal SYBR mastermix, 1 μL each of 10 μM forward and reverse primer, 6 μL of nuclease-free water (Invitrogen, Cat. No. 10977023) and 2 μL of extracted urinary cell-free nucleic acids. Human gDNA standards with serial dilution (1, 1:10, 1:100, 1:1000) and a non-template control (2 μL of RNase/DNase-free water) were used in each qPCR run. PCR reactions were performed on a Bio-Rad C1000 Touch Thermal Cycler (#1851196) and conditions are as follows: 95° C.: 5 minutes, [(95° C.: 20 seconds, 56° C.: 30 seconds)×45 cycles]. Melt curves were obtained by heating samples from 65° C. to 95° C. by increments of 0.5° C. and plate read for 5 seconds at every increment. For stability assessment: Human cell-free DNA quantification analysis was performed using “ΔC.sub.t” which stands for [C.sub.t(T)-C.sub.t(T0)]. “C.sub.t(T)” stands for qPCR cycle threshold at day 7 or day 14, while “C.sub.t(T0)” represents qPCR cycle threshold at day 0 for both the unpreserved and chemistry containing urine samples. Cell-free DNA quantification relative to unpreserved day 0 (NA) sample was quantified using ΔC.sub.t calculations as [C.sub.t(T)-C.sub.t(T0 NA)] where C.sub.t(T0 NA) represents qPCR cycle threshold for day 0 unpreserved samples. Furthermore, to assess neutrality (i.e. change in the basal concentration of cell-free DNA with the addition of a given chemistry in the urine samples at the time of collection), ΔC.sub.t calculations were performed as [C.sub.t(T0 Chem)-C.sub.t(T0 NA)] where C.sub.t(T0 Chem) represents qPCR cycle threshold for day 0 urine samples with chemistry/stabilization solution.
[0092] In-Vitro DNA Methylation Assay:
[0093] This assay was performed as described in the literature (C Ernst, P O McGowan, V Deleva, M J Meaney, M Szyf, G Turecki (2008) The effects of pH on DNA methylation state: In vitro and post-mortem brain studies. J Neurosci Methods 174(1):123-125). pGL3-basic plasmid (Promega; Cat. No. E1751) contains 25 CCGG sites. 1 μg of plasmid was treated with CpG methyl transferase (New England Biolabs; Cat. No. M0226S), an enzyme that methylates all cytosine nucleotides in a CpG dinucleotide according to the manufacturer's protocol. To confirm the methylation status, methylated plasmid (pGL3-CH3) was subjected to restriction endonuclease digestions with: HpaII and MspI. Both of these enzymes recognize the same site (CCGG). While HpaII is blocked from cutting DNA when the internal C is methylated; MspI is insensitive to the methylation status of the internal C. The in vitro-methylated pGL3 plasmid was column purified using Zymo Research's DNA Clean & Concentrator-5 kit (Cat. No. D4013). An equal amount of the purified plasmid was either spiked into 1× TE buffer pH 8.0 (positive control) or into male-pooled and female-pooled FMFV urine samples containing the composition of the present invention and the reaction tubes were kept at RT for 7 days. Following incubation, the DNA samples under went bisulfite conversion using Qiagen EpiTec Bisulfite Kit (Cat No. 59104). Bisulfite treatment will create a sequence difference between un-methylated plasmid (cytosines to uracil conversion) and methylated plasmid (methylated cytosines will remain immune to conversion) (Y Li and T O Tollefsbol (2011) DNA methylation detection: Bisulfite genomic sequencing analysis. Methods Mol Biol 791: 11-21. Doi: 10.1007/978-1-61779-316-5_2). PCR experiment using methylated plasmid-specific primers would generate a 278 bp amplicon. Primers were used as described in Ernst et al. (2008) supra (Forward primer: 5′-AAGATGTTTTTTTGTGATTGGT-3′ (SEQ ID NO: 5); Reverse primer: 5′-TTCCTATTTTTACTCACCCAAA-3′ (SEQ ID NO: 6)).
[0094] HPV Plasmid Spike-In Assay:
[0095] E. coli DH5a strain HPV16 plasmid (Human papilloma virus; type 16 clone) (ATCC Cat. No. 45113) was cultured in LB medium for the extraction of HPV16 plasmid using ZymoPURE II Plasmid Maxi prep Sample Kit (Zymo Research, Cat. Nos. D4202 & D4203). Extracted/purified plasmid was spiked in female-pooled and male-pooled first morning, first void urine samples at concentration (1-10 ng/mL), with and without the preservative chemistry of the present invention. A 200 μL aliquot of each plasmid-spiked urine sample was processed for total DNA extraction using QiaAmp DNA mini kit on QIAcube Connect. The amount of plasmid DNA in each reaction tube and at different days (T0 and T7) was quantified using a qPCR assay for the ampicillin resistance gene (Amp.sup.R) found on the HPV16 plasmid backbone. The Amp.sup.R qPCR primers and conditions are as follows: Forward Primer (FP): 5′AGCCATACCAAACGACGAG 3′ (SEQ ID NO: 7); Reverse primer (RP): 5′AGCAATAAACCAGCCAGCC 3′ (SEQ ID NO: 8). The amplification mixture (20 μL) contained 10 μL of 2× iTaq Universal SYBR mastermix, 1 μL each of 10 μM forward and reverse primer, 6 μL of nuclease-free water (Invitrogen, Cat. No. 10977023) and 2 μL of extracted urinary nucleic acids. HPV16 plasmid standards with serial dilution (1, 1:10, 1:100, 1:1000) and non-template control (2 μL of RNase/DNase-free water) was used in each qPCR run. PCR reactions were performed on a Bio-Rad C1000 Touch Thermal Cycler (#1851196) and the conditions are as follows: 95° C.: 5 minutes, [(95° C.: 20 seconds, 55° C.: 30 seconds)×45 cycles]. Melt curves were obtained by heating samples from 65° C. to 95° C. by increments of 0.5° C. and plate read for 5 seconds at every increment. HPV plasmid DNA quantification analysis was performed using “ΔC.sub.t” which stands for [C.sub.t(T7)-C.sub.t(T0)]. “C.sub.t(T7)” and “C.sub.t(T0)” stands for qPCR cycle threshold at day 7 and day 0, respectively.
[0096] Urinary Cell-Free and Cellular RNA Extraction:
[0097] Total cellular RNA from urine pellets was extracted using 1) Qiagen RNeasy plus Mini Kit (Cat. No. 74134) and eluted in 30 μL of RNase-free water according to manufacturer's instructions and/or 2) Trizol LS reagent (Sigma, Cat. No. T3934) as described below:
[0098] At each time point, samples were spun at 3800×g for 20 minutes. Pellets were resuspended in 750 μL of TRI Reagent LS (and 250 μL of water) at each time point. Samples were allowed to stand for 5 minutes before freezing at −80° C. The samples were thawed at RT and processed as follows: [0099] 1. Add 200 μL of chloroform and vortex vigorously. Let stand for 2-15 minutes at RT. [0100] 2. Centrifuge at 12,000×g for 15 minutes at 4° C. (volume of aqueous phase is about 70% of TRI Reagent volume). Transfer 500 μL of aqueous phase to a new tube. [0101] 3. Add 50 μL of 10× DNase buffer and 1 μL of RNase-free DNase (Lucigen, Cat. No. D9905K). Incubate at 37° C. for 15 minutes. [0102] 4. Add 500 μL (equal volume) of acid phenol chloroform and vortex vigorously. Let stand for 5 minutes followed by centrifuge at 12,000×g for 10 minutes at 4° C. Transfer the aqueous phase into a new tube and add 1 μL of 20 μg/μL of glycogen and 500 μL of isopropanol. Let stand for 10 minutes at RT. [0103] 5. Centrifuge at 12,000×g for 8 minutes at 4° C. Remove supernatant and wash pellet with 1 mL of 75% ethanol. Vortex sample and then centrifuge at 12,000×g for 5 minutes. Remove the supernatant and air dry pellet for 5-10 minutes. [0104] 6. Resuspend pellet in 30 μL of RNase-free water.
[0105] Total cell-free nucleic acids were extracted from supernatant using Qiagen Circulating Nucleic Acids Kit (Cat. No. 55114) and eluted in 30-50 μL of kit buffer AVE. RNA Profile Analysis was performed on 2100 Agilent Bioanalyzer using Pico6000 RNA assay (Cat. No. 5067-1513). mRNA Target Analysis was performed using Taqman based RT-qPCR assay for β-actin (ACTB: Hs00357333_g1) from Thermo Fisher Scientific (Cat. No. 4331182). For cell-free RNA quantification studies, prior to cDNA synthesis, cell-free DNA removal was performed using DNAse I digestion followed by RNA cleanup using RNeasy MinElute Cleanup Kit (Qiagen; Cat No. 74204) as per the instructions described in the QIAamp Circulating Nucleic Acids Kit (Qiagen; Cat. No. 55114).
[0106] RT-qPCR Assay for Cellular, Cell-Free and EV RNA:
[0107] cDNA was prepared with an equal amount (ng) of extracted RNA from each sample using random hexamers & M-MLV reverse transcriptase (Thermo Fisher Scientific; Cat. No. 28025-013), according to manufacturer's protocol; β-actin Taqman assay was performed with Taqman Gene Expression Master Mix II with UNG (Thermo Fisher Scientific; Cat. No. 4440038), according to manufacturer's protocol, using 2 μL of cDNA neat and each sample was run in either duplicate or triplicate. Initially, the efficiency of ACTB TaqMan assay was tested using serial dilutions of cDNA prepared from blood RNA. PCR reaction was performed in a Bio-Rad C1000 Touch Thermal Cycler (Cat. No. 1851196) and the conditions are as follows: 50° C.: 2 minutes, 95° C.: 10 minutes, [95° C.: 15 seconds, 60° C.: 1 minute]×45 cycles. RNA stability quantification was represented as “ΔC.sub.t” which stands for [C.sub.t(T7)-C.sub.t(T0)]. “C.sub.t(T7)” and “C.sub.t(T0)” stands for qPCR cycle threshold at day 7 and day 0, respectively. Furthermore, to assess neutrality (change in the basal concentration of analytes with the addition of a given chemistry in the urine samples at the time of collection), ΔC.sub.t calculations were performed as [C.sub.t(T0 Chem)-C.sub.t(T0 NA)] where C.sub.t(T0 Chem) represents qPCR cycle threshold for day 0 urine samples with chemistry/stabilization solution.
[0108] Droplet Digital PCR (ddPCR) Analysis of DNA Samples for the Target β-Globin Gene:
[0109] Individual reactions for ddPCR contained a final primer concentration of 100 nM with 2× QX200 ddPCR EvaGreen Supermix (Bio-Rad; Cat. No. 1864034) in a final volume of 23 μL. 20 μL of the reaction mix was transferred a DG8 Cartridge (Bio-Rad; Cat. No. 1864008) with 65 μL of Droplet Generation Oil for EvaGreen (Bio-Rad; Cat. No. 1864006), covered with a DG8 Gasket (Bio-Rad; Cat. No. 1863009) and converted to droplets with the Bio-Rad QX200 Droplet Generator. Droplets were then transferred to a 96-well plate (Bio-Rad; Cat. No. 12001925) and heat sealed at 180° C. for 6 seconds with Pierce-able Foil Heat Seal (Bio-Rad; Cat. No. 1814040) using the Bio-Rad PX1 PCR Plate Sealer (Cat. No. 1814000). The samples were then cycled in a Bio-Rad C1000 Touch Thermal Cycler (Cat. No. 1851196) using a 3-step cycling program: 95° C. for 5 minutes, followed by 50 cycles of 95° C. for 30 seconds, annealing temperature set at 58° C. for 1 minute and 72° C. for 30 seconds, followed by 1 cycle each of 4° C. for 5 minutes, 90° C. for 5 minutes and hold at 12° C. The primers used in the β-globin ddPCR assay were same as used in the above mentioned the β-globin qPCR assay (Forward primer: 5′ ACACAACTGTGTTCACTAGC 3′ (SEQ ID NO: 3), reverse primer: 5′ CAACTTCATCCACGTTCACC 3′ (SEQ ID NO: 4)). All ramp rates were set at 2° C./second. The cycled plate was then transferred and read on the QX200 Droplet Reader (Bio-Rad; Cat. No. 1864003); data was analyzed with the Quanta-Soft Software (Bio-Rad; Cat. No. 1864011). For the analysis, the abundance was reported as concentration (copy number per μL) and the total accepted droplets were more than 10,000 droplets for a given sample.
[0110] Urinary Cellular DNA Extraction and Quantification:
[0111] Total cellular DNA from urine pellets was extracted using QiaAmp DNA mini kit (Qiagen; Cat. No. 51306) according to manufacturer's instructions and eluted in 50 μL of elution buffer or nuclease-free water (NFW). At each time point, samples were spun at 3800×g for 20 minutes. Urine pellets were kept frozen at −80° C. until extraction. Pellets were thawed at RT and resuspended in 200 μL of 1×PBS followed by total DNA extraction. Total cellular DNA quantification was performed using Quant-iT™ Picogreen™ dsDNA Reagent (Thermo Fisher Scientific; Cat. No. P7581). Total genomic DNA profile was assessed on Agilent 4200 Tapestation using Genomic DNA Tape according to the instructions. Targeted amplification of human genomic DNA was performed using GAPDH PCR for ˜1 Kb amplicon product. The primers and the PCR conditions of the GAPDH qPCR assay are as follows: Forward Primer: 5′-GTC AAC GGA TTT GGT CGT ATT G-3′ (SEQ ID NO: 9); Reverse Primer: 5′-CTC TCT TCC TCT TGT GCT CTT G-3′ (SEQ ID NO: 10). 95° C., 5 minutes, [95° C., 30 seconds; 56° C., 30 seconds; 72° C., 60 seconds]×25 cycles; 72° C., 10 minutes 4° C., hold. Each reaction was set up as follows:
TABLE-US-00001 Final μL Per Reagent Concentration Reaction 10X PCR Buffer 1X 2.5 1 mg/mL BSA 100 μg/mL 2.5 50 mM MgCl.sub.2 3 mM 1.5 10 mM dNTPs 0.3 mM 0.75 10 μM Forward Primer* 0.5 μM 1.25 10 μM Reverse Primer* 0.5 μM 1.25 5 U/μLTaq 0.1 U/μL 0.5 NFW 12.75 Template DNA — (2) Total 25
[0112] In the Examples below, percentages of sugar in the compositions are in wt/vol, percentages of alkanol (e.g. methanol or ethanol) in the compositions are in vol/vol, and percentages of boric acid are in wt/vol.
Example 1—Urinary Cell-Free DNA Content is Sample- and Sex-Dependent
[0113] Approximately 20-30 mL of first morning, first void (FMFV) urine was collected from healthy female and male donors into urine specimen cups; transported and stored on ice packs until downstream processing. Within 3 hours of urine collection, a 4.5 mL aliquot of each specimen was centrifuged at 3,800 g for 20 minutes at room temperature. Cell-free nucleic acids were extracted from each 4.0 mL of the resulting supernatant either immediately or from frozen supernatant aliquots stored at −80° C. using the QIAamp Circulating Nucleic Acids Kit (Qiagen; Catalogue No. 55114; see Materials and Methods). Subsequently, urinary cell-free DNA (Ucf-DNA) concentration was measured using a Pico-Green quantification assay. The average urinary cell-free DNA concentration for female donors was about 15 ng/mL, compared to approximately 3 ng/mL for males (see
Example 2—Human Cell-Free DNA Degrades in Unstabilized Urine Stored at Room Temperature
[0114] In the absence of a preservative or stabilizing agent (NA), urine stored at room temperature undergoes both visible and molecular changes. In this example, 20-30 mL of first morning, first void (FMFV) urine was collected from a healthy female donor and stored at room temperature for 7 days. During this period, this representative urine sample became increasingly turbid (
Example 3—Different Sugars (Monosaccharides/Disaccharides) can be Used in the Present Urine Stabilization Composition for Cell-Free DNA
[0115] Five healthy male and female donors provided a 60-70 mL first morning, first void (FMFV) urine specimen. Specimens were transported to the laboratory on ice packs where 1) 20 mL of each specimen was stored in the absence of a stabilizing composition (unpreserved), and 2) 12 mL of each urine specimen was mixed with 4 mL of stock solution [Table 1 (i)] containing different sugars, i.e. Glucose (Chem G), Sucrose (Chem S) and Fructose (Chem F), and 4 mL of 95% ethanol. In this example, final composition of the stabilization solution after mixing with urine is described below [see Table 1 (ii)]. Both types of specimens were stored at room temperature (23±3° C.) for at least 7 days.
[0116] On day zero and day 7, 4.5 mL aliquot of each unpreserved and different chemistries containing specimens were centrifuged at 3,800 g for 20 minutes at room temperature. 4.0 mL of supernatant was recovered from each specimen post-centrifugation and cell-free DNA was extracted using the QIAamp Circulating Nucleic Acids Kit (Qiagen, see Materials and Methods). Two microliters of purified cell-free DNA from each specimen served as template in β-globin qPCR analysis (see Material and Methods).
[0117] In another experimental setting, healthy male and female donors provided random first void (FV) urine specimen using Colli-Pee® device (Novosanis). Specimens were transported to the laboratory on ice packs where male and female urine samples were pooled to generate male pooled and female pooled specimens, respectively. An aliquot of each pooled specimen was stored 1) in the absence of a stabilizing composition (unpreserved), and 2) mixed with chemistries containing different sugars [Table 2 (i)], i.e. Glucose (Chem G), and Fructose (Chem F) in the urine: chemistry ratio of 1:0.43 An this example, final composition of the stabilization solution after mixing with urine is described below [see Table 2 (ii)]. All specimens were stored at room temperature (23±3° C.) for at least 7 days.
[0118] On day zero and day 7, 2.5 mL aliquot of each unpreserved and different chemistries containing specimen were centrifuged at 3,000 g for 10 minutes at room temperature followed by filtration using 0.8 μm syringe filters (Sartorius® Minisart NML®, Cat. No. 16592, or Millipore® Millex®-AA, Cat. No. SLAA033SB). 2.0 mL of precleared supernatant was used for cell-free DNA (cfDNA) extraction using the QIAamp Circulating Nucleic Acids Kit (Qiagen, see Materials and Methods).
[0119] The present composition with the disaccharide sucrose is difficult to prepare due to very high viscosity of the solution leading to improper mixing of the components. High viscosity can further lead to improper addition of stabilizing solution to the specimen due to difficulties in mixing. Therefore, to avoid these basic complications in preparation and testing of stabilizing solutions, it was decided to focus on monosaccharide-containing compositions being effective, while still maintaining sufficient stabilization of cell-free DNA content (
TABLE-US-00002 TABLE 1i Compositions of different stock solutions prior to mixing with urine. Chemistry G Chemistry S Chemistry F Composition (Glucose) (Sucrose) (Fructose) Sodium acetate 1750 mM 1750 mM 1750 mM Boric acid 5% 5% 5% CDTA 119 mM 119 mM 119 mM Sugar 45% 45% 45% pH 4.7-5.0 4.7-5.0 4.7-5.0
TABLE-US-00003 TABLE 1ii Final compositions of stabilizing solution after mixing with urine. Chemistry G Chemistry S Chemistry F Composition (Glucose) (Sucrose) (Fructose) Sodium acetate 350 mM 350 mM 350 mM Boric acid 1% 1% 1% CDTA 23.8 mM 23.8 mM 23.8 mM Sugar 9% 9% 9% Ethanol 19% 19% 19%
TABLE-US-00004 TABLE 2i Compositions of different stock solutions prior to mixing with urine. Chemistry G Chemistry F Composition (Glucose) (Fructose) Sodium acetate 750 mM 750 mM Boric acid 2.2% 2.2% CDTA 50 mM 50 mM Sugar 20% 20% Ethanol 23% 23% pH 5.0-5.2 5.0-5.2
TABLE-US-00005 TABLE 2ii Final compositions of stabilizing solution after mixing with urine. Chemistry G Chemistry F Composition (Glucose) (Fructose) Sodium acetate 225 mM 225 mM Boric acid 0.7% 0.7% CDTA 15 mM 15 mM Sugar 6% 6% Ethanol 6.9% 6.9%
Example 4: Presence of Sugar, Alcohol, Buffer and Lower pH Modulates the Stabilization Effect of the Present Composition
[0120] Six healthy female donors provided a 30 mL first morning, first void urine (FMFV) specimen and their urine samples were pooled together to generate two different pooled urine specimens; 1) 15 mL of each pooled specimen was stored in the absence of a stabilizing composition (NA), and 2) 11 mL of each pooled urine specimen was mixed with 3 mL of stock solution (with different iterations of the present composition; Table 3 below) and 1 mL of 95% ethanol/methanol as described in Table 4. The final composition after mixing with the pooled urine is described in Table 5 below. All specimens were stored at room temperature (23±3° C.) for at least 7 days. For comparison, 25 mL of pooled urine was mixed with 5 mL of Streck's urine fixative (reference composition), commercially known as “Cell-free DNA Urine Preserve” (Cat. No. 230216), and stored at room temperature for at least 7 days. This reference composition comprises the formaldehyde releasing agent imidazolidinyl urea, as well as K.sub.3EDTA and glycine.
[0121] On day zero and day 7, 4.5 mL aliquot of each unpreserved and chemistry containing pooled specimen was centrifuged at 3,800 g for 20 minutes at room temperature. 4.0 mL of supernatant was recovered from each specimen post-centrifugation and stored at −80° C. To assess the stability of the cell-free DNA with and without stabilization composition, frozen supernatant from both unpreserved and different chemistries containing day 0 and day 7 urine samples were subjected to cell-free DNA extraction using the QIAamp Circulating Nucleic Acids Kit (Qiagen, see Materials and Methods). Two microliters of purified cell-free DNA from each specimen served as template in β-globin qPCR analysis (see Material and Methods).
[0122]
TABLE-US-00006 TABLE 3 Composition of stock solutions prior to the mixture with urine. Chem F w/o Chem F w/o Composition Chem F Fructose Buffer Sodium acetate 1750 mM 1750 mM — Boric acid 5% 5% 5% CDTA 119 mM 119 mM 119 mM Fructose 45% 45% pH 4.7-8.5 5.0 5.0
TABLE-US-00007 TABLE 4 Addition of different iterations in the urine sample. Urine Stock Solution 95% Ethanol/Methanol (mL) (mL) (mL) Chem F (pH 4.7-8.5) 11 3 1 Chem F w/o Fructose 11 3 1 Chem F w/o Buffer 11 3 1 Chem F w/o Ethanol 12 3 — Chem F w/o Fructose 12 3 — plus Ethanol Chem F w/o Buffer 12 3 — plus Ethanol Chem F with Methanol 11 3 1
TABLE-US-00008 TABLE 5 Final Composition after mixing with urine. Chem F w/o Chem F w/o Composition Chem F Fructose Buffer Sodium acetate 350 mM 350 mM — Boric acid 1% 1% 1% CDTA 23.8 mM 23.8 mM 23.8 mM Fructose 9% — 9%
Example 5: Stabilizing Composition for the Preservation of Nucleic Acids in Urine at Room Temperature
[0123] A total of eleven healthy donors (male and female) provided a 40-60 mL first morning, first void (FMFV) urine specimen. Specimens were transported to the laboratory on ice packs where i) 20 mL of each specimen was stored in the absence of a stabilizing composition (unpreserved), and 2) 12 mL of each urine specimen was mixed with stabilization solution [4 mL of stock solution; Table 6 (i), and 4 mL of 95% ethanol]. In this example, final composition of the stabilization solution after mixing with urine is described below [see Table 6 (ii)]. Both types of specimens were stored at room temperature (23±3° C.) for at least 7 days. On day zero and day 7, 4.5 mL aliquot of each unpreserved and specimen with stabilization solution was centrifuged at 3,800 g for 20 minutes at room temperature. 4.0 mL of supernatant was recovered from each specimen post-centrifugation and cell-free DNA (cfDNA) was extracted using the QIAamp Circulating Nucleic Acids Kit (Qiagen, see Materials and Methods). Two microliters of purified cfDNA from each specimen served as template in β-globin qPCR analysis (see Material and Methods).
[0124] In another experimental setting, urine samples from both male and female healthy donors were pooled to generate male and female pooled urine specimens. An aliquot of each specimen was stored in the 1) absence of a stabilizing composition (unpreserved), 2) mixed with the stock solution [Table 7 (i)] in 1:0.43 ratio and 3) mixed with Norgen urine collection and preservation tubes (Cat. 18111). In this example, final composition of the stabilization solution “Chemistry F (Chem F)” after mixing with urine is described below [see Table 7 (ii)]. All specimens were stored at room temperature (23±3° C.) for at least 7 days. On day zero and day 7, 2.5 mL aliquot of each unpreserved and stabilization solution containing urine specimen was centrifuged at 3,000 g for 10 minutes at room temperature followed by filtration using 0.8 μm syringe filters (Sartorius® Minisart NML®, Cat. No. 16592, or Millipore® Millex®-AA, Cat. No. SLAA033SB). 2.0 mL of supernatant was recovered from each specimen post-centrifugation and cell-free DNA (cfDNA) was extracted using the QIAamp Circulating Nucleic Acids Kit (Qiagen, see Materials and Methods).
[0125] In another experimental setting, first void urine samples from healthy male and female donors collected using Colli-Pee® device (Novosanis) were pooled to generate male and female pooled urine specimens, respectively. An aliquot of each specimen was stored in the 1) absence of a stabilizing composition (unpreserved), 2) mixed with the stock solution (Table 7i) in 1:0.43 ratio and 3) mixed with Norgen urine collection and preservation tubes (Norgen Biotek; Cat. 18111). In this example, final composition of the stabilization solution after mixing with urine is described below (see Table 7ii). All specimens were stored at room temperature (23±3° C.) for at least 14 days. On day zero and day 14, 2.5 mL aliquot of each unpreserved and stabilization solution containing urine specimen was centrifuged at 3,000 g for 10 minutes at room temperature followed by filtration using 0.8 μm syringe filters (Sartorius® Minisart NML®, Cat. No. 16592, or Millipore® Millex®-AA, Cat. No. SLAA033SB). 2.0 mL of supernatant was recovered from each specimen post-centrifugation and cell-free DNA (cfDNA) was extracted using the QIAamp Circulating Nucleic Acids Kit (Qiagen, see Materials and Methods).
TABLE-US-00009 TABLE 6i Composition of stock solution prior to mixing with urine. Composition Stock solution Sodium acetate 1750 mM Boric acid 5% CDTA 119 mM Fructose 45% pH 4.7-5.0
TABLE-US-00010 TABLE 6ii Final compositions of stabilizing solution after mixing with urine. Composition Stabilizing solution (Chem F) Sodium acetate 350 mM Boric acid 1% CDTA 23.8 mM Fructose 9% Ethanol 19%
TABLE-US-00011 TABLE 7i Composition of stock solution prior to mixing with urine. Composition Stock solution Sodium acetate 750 mM Boric acid 2.2% CDTA 50 mM Fructose 20% Ethanol 23% pH 5.0-5.2
TABLE-US-00012 TABLE 7ii Final compositions of stabilizing solution after mixing with urine. Composition Stabilizing solution (Chem F) Sodium acetate 225 mM Boric acid 0.7% CDTA 15 mM Fructose 6% Ethanol 6.9%
Example 6: Stabilizing Composition Preserves the Integrity of Prostate Cancer Cells for 7 Days at Room Temperature
[0126] Urine from male donors may contain exfoliated prostate epithelial cells as a result of shedding from the prostate gland during normal turnover. Moreover, this secretion into urine can also be increased by physical manipulation of prostate gland by performing prostatic massage, especially in prostate cancer patients. Hence, to test the stability and intactness of cells in the stabilization solution containing urine sample, prostate cancer cells were used as one of the cell types of interest.
[0127] Cell-free DNA content over time was used to measure cellular integrity in the presence of the stabilizing composition, Chemistry F. In one experimental setting [Example 6(i)], first morning, first void urine (FMFV) specimens were pooled from 3 healthy male and 3 female donors to generate one female-pooled (FP) and one male-pooled (MP) urine specimen. Alongside male urine, female urine samples were also included in this study to test the stability of cancer cells in more concentrated, high biomass-containing urine matrix. The pooled specimens were centrifuged at 3,000 g for 10-20 minutes at room temperature, followed by filtration of the resulting supernatant using a 0.2 micron filter. These precleared, cell-free urine specimens were aliquoted and then spiked (S) with prostate cancer cells (LNCaP clone FGC; ATCC CRL-1740™).
[0128] To test the concentration-dependent effect of Chemistry F on the stability of spiked prostate cancer cells, varying amounts (mL) of stock solution (see Table 8) and a fixed amount of 95% ethanol were added to achieve different final concentrations of various components in Chemistry F after mixing with precleared urine containing spiked prostate cancer cells (see Table 9). The stock solution and ethanol were mixed with precleared urine containing spiked prostate cancer cells as described in Table 10.
[0129] In another experimental setting [Example (6ii)], first morning, first void urine (FMFV) specimens were pooled from three healthy females to generate one female-pooled (FP) urine specimen. The pooled specimens were centrifuged at 3,000 g for 10-20 minutes at room temperature, followed by filtration of the resulting supernatant using a 0.2 micron filter. These precleared, cell-free urine specimens were aliquoted and then spiked (S) with prostate cancer cells (LNCaP clone FGC; ATCC CRL-1740™). In this experimental setting, the amount (mL) of 95% ethanol was also varied along with variations in the amount of stock solution (mL) (Table 8) to achieve different final concentrations of components in Chemistry F after mixing with precleared urine containing spiked prostate cancer cells as specified in Table 11. The stock solution and ethanol amounts were mixed with precleared urine containing spiked prostate cancer cells as described in Table 12.
[0130] In both the experimental settings, the specimens were incubated with the present compositions for 30-60 minutes (day 0) or 7 days prior to cell-free DNA extraction using QIAamp Circulating Nucleic Acids Kit (Qiagen, see Materials and Methods). Extracted human cell-free DNA was quantified using β-globin qPCR assay (
[0131]
[0132]
TABLE-US-00013 TABLE 8 Composition of Stock Solution Composition Stock solution Sodium acetate 2800 mM Boric acid 8% CDTA 190.4 mM Fructose 72% pH 4.7-5.0
TABLE-US-00014 TABLE 9 Final composition of 0.8×, 0.5× and 0.25× Chemistry F after mixing with precleared urine spiked with prostate cancer cells. 0.8× 0.5× 0.25× Composition Chemistry F Chemistry F Chemistry F Sodium acetate 280 mM 175 mM 87.5 mM Boric acid 0.8% 0.5% 0.25% CDTA 19 mM 11.9 mM 5.95 mM Fructose 7.2% 4.5% 2.25% Ethanol 13.2% 13.7% 14.1%
TABLE-US-00015 TABLE 10 Amount of Stock Solution and ethanol added to the precleared urine spiked with prostate cancer cells. Final conc. after Stock 95% Precleared Urine Total volume mixing Solution Ethanol containing spiked (Urine + with urine (mL) (mL) cells (mL) Chemistry) (mL) 0.8× 1.4 2 11 14.4 0.5× 0.9 2 11 13.9 0.25 ×.sup. 0.45 2 11 13.45
TABLE-US-00016 TABLE 11 Final composition of 1×, 0.5× and 0.25× Chemistry F after mixing with precleared urine spiked with prostate cancer cells. 1× 0.5× 0.25× Composition Chemistry F Chemistry F Chemistry F Sodium acetate 350 mM 175 mM 87.5 mM Boric acid 1% 0.5% 0.25% CDTA 23.8 mM 11.9 mM 5.95 mM Fructose 9% 4.5% 2.25% Ethanol 11.88% 5.94% 2.97%
TABLE-US-00017 TABLE 12 Amount of Stock Solution and ethanol added to the precleared urine spiked with prostate cancer cells. Final conc. Stock 95% Precleared Urine Total volume after mixing Solution Ethanol containing spiked (Urine + with urine (mL) (mL) cells (mL) Chemistry) (mL) 1× 1 1 6 8 .sup. 0.5× 0.5 0.5 7 8 0.25 × 0.25 0.25 7.5 8
Example 7: Composition of the Present Invention Maintains the Integrity of Nucleated White Blood Cells Spiked into Precleared Urine Specimens and Stored at Room Temperature for 7 Days
[0133] Since bodily fluids (e.g. blood and urine) of most healthy individuals ordinarily do not contain substantial amounts of cell-free nucleic acids, elevated amounts of cell-free nucleic acids are usually indicative of a health issue (or pregnancy). However, after a blood sample is collected from a patient, cell lysis begins and the nucleic acids from within the blood cells are mixed with the cell-free nucleic acids, making it difficult to isolate and distinguish cell-free nucleic acids. In addition, these cell-free nucleic acids are susceptible to nuclease-initiated degradation in vitro. Consequently, the disease indication capability of cell-free nucleic acids may be diminished, as their presence is no longer accurately ascertainable. Ideally, prevention of cell lysis and cell-free nucleic acid degradation within the biological sample would allow for the cell-free nucleic acids to be accurately measured and the presence of any disease risk to be detected.
[0134] Preservative agents may be used to fix cells in biological samples or specimens and prevent leaking of cellular nucleic acids into the extracellular space. After the cell-free nucleic acids have been isolated, they can be tested to identify the presence, absence or severity of disease states including, but not limited to, a multitude of cancers. Pathology collections around the world represent an archive of genetic material to study populations and diseases. However, for preservation purposes, large portions of these collections have been fixed in formalin/formaldehyde-containing solutions, a treatment that results in cross-linking of biomolecules. A formaldehyde releaser, formaldehyde donor or formaldehyde-releasing preservative is a chemical compound that slowly releases formaldehyde. Notably, when compared to the DNA isolated from frozen tissues, formalin-fixed tissues exhibit a high frequency of non-reproducible sequence alteration (Srinivasan M, Sedmak D, Jewell S (2002) Effect of fixatives and tissue processing on the content and integrity of nucleic acids. Am J Pathol 161(6): 1961-1971). Formaldehyde, a principal ingredient of most commonly used fixatives, leads to the generation of DNA-protein and RNA-protein cross-linkages. Furthermore, the nucleic acids will fragment in situations where the fixative solution is not buffered. Both of the above provide challenges for PCR-based analyses (Gilbert M T P, Haselkorn T, Bunce M, Sanchez J J, Lucas S B, Jewell L D, Van Marck E, Worobey M (2007) The isolation of nucleic acids from fixed, paraffin-embedded tissues—Which methods are useful when? PLoS ONE 2(6): e537. Doi: 10.1371/journal.pone.0000537; Wong S Q, Li J, Tan A Y-C, Vedururu R, Pang J-M B, Do H, Ellul J, Doig K, Bell A, MacArthur G A, Fox S B, Thomas D M, Fellowes A, Parisot J P, Dobrovic A (2014) Sequence artifacts in a prospective series of formalin-fixed tumours tested for mutations in hotspot regions by massively parallel sequencing. BMC Medical Genomics 7:23. Doi: 10.1186/1755-8794-7-23). Specifically, this chemical damage to DNA reduces Taq DNA polymerase fidelity and PCR amplification efficiency (Sikorsky J A, Primerano D A, Fenger T W, Denvir J (2007) DNA damage reduces Taq DNA polymerase fidelity and PCR amplification efficiency. Biochem Biophys Res Commun 355(2): 431-437). Hence, formalin/formaldehyde-based fixatives are not ideal for molecular analyses.
[0135] In this example, the cellular stability of isolated white blood cells spiked into urine samples was assessed in the presence of the present preservative, compared to the formaldehyde-releasing preservative in Streck's Cell-Free DNA Urine Preserve (as described in Example 4). White blood cells were prepared from 1 mL of whole blood following selective lysis of red blood cells. The pelleted and washed white blood cells were spiked into urine samples and cfDNA content was used to measure the stability/intactness of the white blood cells. FMFV urine samples from female and male donors were pooled together to generate two female- and two male-pooled urine samples, respectively. The samples were “precleared” by centrifuging at 3,000 g for 10-20 minutes, followed by filtration of the supernatant using a 0.2-micron filter. The precleared urine samples were aliquoted and spiked with white blood cells followed by the addition of the present chemistry at a final concentration as mentioned in Table 13 (see below) or Streck's Cell-Free DNA Urine Preserve. The amount of stock solution (Table 14) and ethanol added to the precleared urine sample spiked with nucleated white blood cells is described in Table 15 (see below). Samples were incubated at room temperature for 30-60 minutes (day 0) or 7 days prior to cfDNA extraction using the QiaAmp Circulating Nucleic Acid Extraction Kit, according to the manufacturer's protocol. The extracted cfDNA was quantified using β-globin qPCR assay (see Materials and Methods).
[0136] The data (see
TABLE-US-00018 TABLE 13 Final concentration of the present composition after mixing with urine spiked with nucleated white blood cells. Stabilization Composition solution (Chem F) Sodium acetate 350 mM Boric acid 1% CDTA 23.8 mM Fructose 9% Ethanol 11.875%
TABLE-US-00019 TABLE 14 Composition of Stock Solution Composition Stock solution Sodium acetate 1750 mM Boric acid 5% CDTA 119 mM Fructose 45% pH 4.7-5.0
TABLE-US-00020 TABLE 15 Amount of Stock Solution and ethanol added to the precleared urine spiked with nucleated white blood cells. Final conc. Stock 95% Precleared Urine Total volume after mixing Solution Ethanol containing spiked (Urine + with urine (mL) (mL) cells (mL) Chemistry) (mL) 1× 6 3.8 20.2 30
Example 8: The Present Composition Preserves DNA Methylation Status for 7 Days at Room Temperature in Both Female-Pooled and Male-Pooled Urine Samples
[0137] DNA methylation, a process by which methyl groups are added to the DNA molecule, is one of several epigenetic mechanisms that cells use to control gene expression. It plays a pivotal role in many biological processes such as gene expression, embryonic development, cellular proliferation, differentiation and chromosome stability. Aberrant DNA methylation is often associated with the loss of DNA homeostasis and genomic instability leading to the development of diseases such as cancer (Y Li, T O Tollefsbol (2011) DNA methylation detection: Bisulfite genomic sequencing analysis. Methods Mol Biol 791: 11-21).
[0138] An ideal urine preservative solution must preserve the methylation status of DNA in studies involving DNA methylation as an epigenetic biomarker. Hence, to examine the effect of Chemistry F on DNA methylation status, an in vitro DNA methylation assay was performed using pGL3-basic plasmid which contains 25 CCGG sites. The assay involved the following steps as described in the Materials and Methods section. 1) In vitro methylation of plasmid followed by confirmation of methylation using restriction endonucleases digestion (
TABLE-US-00021 TABLE 16 Final concentration of the composition after mixing with urine. Composition Chemistry F Sodium acetate 350 mM Boric acid 1% CDTA 23.8 mM Fructose 9% Ethanol 19%
TABLE-US-00022 TABLE 17 Stock Solution: Composition Stock Solution Sodium acetate 1750 mM Boric acid 5% CDTA 119 mM Fructose 45% pH 4.7-5.0
TABLE-US-00023 TABLE 18 Final concentration Stock 95% Urine spiked with after mixing with Solution ethanol methylated plasmid urine (μL) (μL) (μL) 1× Chem F 10 10 30
Example 9: The Composition of the Present Invention Preserves Human Papillomavirus (HPV) in First Morning, First Void Urine Samples after 7 Days Storage at Room Temperature
[0139] Cervical cancer is caused by sexually-acquired infection with certain types of genital HPV which are classified as high-risk and low-risk depending on their association with uterine cervical cancers (Munoz N, Bosch F X, de Sanjose S, Herrero R, Castellsaque X, Shah K V, Snijders P J, Meijer C J (2003) Epidemiologic classification of human papillomavirus types associated with cervical cancer. N Engl J Med 348(6): 518-527. Doi: 10.1056/NEJMoa021641). HPV16, 18, 31, 33, 35, 45, 52, 58, 39, 51, 56, and 59 have been classified as high risk HPV genotypes (Bouvard V, Baan R, Straif K, Grosse Y, Secretan B, E I Ghissassi F, Benbrahim-Tallaa L, Guha N, Freeman C, Galichet L, Cogliano V (2009) A review of human carcinogens—Part B: Biological agents. The Lancet Oncology 10: 321-322), out of which two HPV types (16 and 18) are the major cause (70%) of cervical cancers and pre-cancerous cervical lesions according to the WHO.
[0140] Urine being non-invasive provides a simple and feasible alternative to HPV detection in cervical specimens based on the literature around HPV detection (Vorsters, P Van Damme, G Clifford (2014) Urine testing for HPV: rationale for using first void. BMJ 349: g6252; Bernal, S. et al., Comparison of urine and cervical samples for detecting human papillomavirus (HPV) with the Cobas 4800 HPV test, Journal of Clinical Virology 61 (2014) 548-552; Enerly, E. et al., Monitoring human papillomavirus prevalence in urine samples: a review, Clinical Epidemiology 2013:5 67-79). In this study, the effect of the present composition on the stability of urine spiked with exogenous HPV circular DNA (HPV 16) has been evaluated. This system presents the most challenging scenario (non-protected circular DNA floating in the urine space/matrix) as compared to the mixed population of endogenous viral particles which would be present in both the protected (particles inside the cervical cells and/or covered with host proteins), as well as in non-protected state in HPV16 infected patient urine samples.
[0141] Healthy male and female donors provided first morning, first void (FMFV) urine specimens which were transported to the laboratory on ice packs and pooled together to generate two male- and two female-pooled urine samples. Purified HPV16 plasmid DNA (see Materials and Methods) was spiked into approximately 1 mL of pooled FMFV urine samples at a concentration of 1-10 ng/mL, with and without the composition of the present invention, Chemistry F (pH 4.7-5.0), and stored at room temperature for up to 7 days. The final concentration of the components in the stabilization composition “Chemistry F (Chem F)” after combining with the urine sample is described in Table 19 (below). On day 0 and day 7, a 200 μL aliquot of each of the HPV16 plasmid-spiked urine sample was processed for total DNA extraction using QiaAmp DNA mini kit according to the manufacturer's protocol. The DNA was eluted using 100 μL of kit elution buffer. The extracted DNA was further subjected to a qPCR assay for the HPV16 plasmid DNA quantification using Ampicillin resistance gene (Amp.sup.R) on the HPV16 plasmid backbone. Bacterial DNA was quantified using 16S qPCR assay (see Materials and Methods).
[0142] After 7 days at room temperature, the composition of the present invention stabilized exogenous spiked-in HPV16 plasmid DNA in FMFV urine samples as shown by ΔC.sub.t median value close to zero in preserved urine specimens, unlike in unpreserved specimens which showed marked increase in ΔC.sub.t median value (
TABLE-US-00024 TABLE 19 Final concentration of the stabilization composition “Chem F” in the urine sample. Stabilizing Composition Solution (Chem F) Sodium acetate 350 mM Boric acid 1% CDTA 23.8 mM Fructose 9% Ethanol 6%
Example 10: Stabilizing Composition for the Preservation of Extracellular Vesicles (EV) RNA in Urine at Room Temperature
[0143] Urine, being non-invasive as a sample type, has an obvious advantage over blood when used for liquid biopsy purposes. Urine contains prostate secretions and hence represents a potential valuable source for the detection and monitoring of prostate cancer. Prostate cancer is the second leading cause of cancer-related death in men and the most commonly diagnosed male malignancy worldwide, with >1.1 million cases recorded in 2012 (http://www.cancerresearchuk.org/) (O E Bryzgunova, M M Zaripov, T E Skvortsova, E A Lekchnov, A E Grigor'eva, I A Zaporozhchenko, E A Morozkin, E I Ryabchikova, Y B Yurchenko, V E Voitsitskiy, P P Laktionov (2016) Comparative study of extracellular vesicles from the urine of healthy individuals and prostate cancer patients. PLoS One 11(6): e0157566. Doi: 10.1371/joumal.pone.0157566).
[0144] The most well characterized urine biomarker for prostate cancer is a non-coding EV RNA known as PCA3 (DD3) with an increased expression in prostate cancer (M J Bussemakers, A van Bokhoven, G W Verhaegh, F P Smit, H F M Karthaus, J A Schalken, F M J Debruyne, N Ru, W B Isaacs (1999) DD3: a new prostate-specific gene, highly overexpressed in prostate cancer. Cancer Res 59: 5975-5979; K L Pellegrini, D Patil, K J S Douglas, G Lee, K Wehrmeyer, M Torlak, J Clark, C S Cooper, C S Moreno, M G Sanda (2018) Detection of prostate cancer-specific transcripts in extracellular vesicles isolated from post-DRE urine. Prostate 77(9): 990-999. Doi: 10.1002/pros.23355). ExoDx Prostate test (Exosome Diagnostics) is also based on urinary exosome RNA content for the prediction of high-grade prostate cancer (J McKiernan, M J Donovan, V O'Neill, S Bentink, M Noerholm, S Belzer, J Skog, M W Kattan, A Partin, G Andriole, G Brown, J T Wei, I M Thompson, P CVarroll (2016) A novel urine exosome gene expression assay to predict high-grade prostate cancer at initial biopsy. JAMA Oncol 2(7): 882-889. Doi: 10.1001/jamaoncol.2016.0097). The potential for microbial proliferation and the labile nature of host cells and extracellular vesicles (EVs) at the point of sample collection and transport to the lab drive the need for stabilization of urine samples for home sampling, as multi-site collections and at-clinic collections are increasingly prohibitive for large-scale recruitment and lead to variability in the time between collections and processing. Therefore, development of urine stabilization for home sampling opens up new applications for various urine derived biomarkers (e.g. urinary EV RNAs in prostate cancer) to be used in liquid biopsy analysis.
[0145] In one of the experimental settings, first morning first void urine samples were collected from healthy male and female donors in the standard urine collection cup. Specimens were transported to the laboratory on ice packs where samples were pooled together to form pooled urine specimens (MP, male-pooled; FP, female-pooled). i) 30 mL of pooled urine was stored in the absence of a stabilizing composition (unpreserved), and 2) 24 mL of pooled urine specimen was mixed with stabilization composition [4 mL of stock solution (Table 20) and 2 mL of 95% ethanol] and stored. The composition of the stock solution is described in Table 20. Both types of specimens were stored at room temperature (23±3° C.) for at least 7 days. The final composition of the stabilization solution “Chemistry F (Chem F)” after mixing with urine is described in Table 21. On day zero and day 7, 10 mL aliquot of each unpreserved and Chem F containing urine specimen was centrifuged at 3,000 g for 10 minutes at room temperature, followed by 0.8 μM filtration. Precleared supernatant recovered from each specimen post-centrifugation and filtration was used for EV RNA extraction with the ExoRNeasy maxi kit (Qiagen, see Materials and Methods). The concentration of extracted RNA samples was measured using 2100 Agilent Bioanalyzer and/or Ribogreen quantification. cDNA was prepared using the M-MLV Reverse Transcription kit and qPCR was performed using β-actin (ACTB) TaqMan assay (see Materials and Methods). For cDNA synthesis, an equal amount (ng) of total extracted RNA from the unpreserved and stabilized condition was used for a given urine sample.
[0146] In another experimental setting, male and female healthy donors provided random (mid-day), first void urine sample using the Colli-Pee® First Void Urine Collection Device (Novosanis). Specimens were transported to the laboratory on ice packs where samples were pooled together to form pooled urine specimens (MP, male-pooled; FP, female-pooled). i) 40 mL of pooled urine was stored in the absence of a stabilizing composition (unpreserved), and 2) 28 mL of pooled urine specimen was mixed with 12 mL of Chemistry F (Chem F) stabilizing composition and stored. The composition of the stabilization solution is described in Table 22 i. Both types of specimens were stored at room temperature (23±3° C.) for at least 7 days. The final composition of the stabilization solution “Chem F” after mixing with urine is described in Table 22 ii. On day zero and day 7, 17 mL aliquot of each unpreserved and Chem F containing specimen was centrifuged at 3,000 g for 10 minutes at room temperature, followed by 0.8 μM filtration. 16 mL of precleared supernatant was recovered from each specimen post-centrifugation and filtration and EV RNA was extracted using the ExoRNeasy maxi kit (Qiagen, see Materials and Methods). The concentration of extracted RNA samples was measured using 2100 Agilent Bioanalyzer and/or Ribogreen quantification (see Materials and Methods). The profile of the extracted EV RNAs was also determined on 2100 Agilent Bioanalyzer. For cDNA synthesis, an equal amount (ng) of total extracted RNA from the unpreserved and stabilization condition was used for a given urine sample. cDNA was prepared using the M-MLV Reverse Transcription kit and qPCR was performed using β-actin TaqMan assay (see Materials and Methods). β-actin has been referred to as a housekeeping gene for exosomal mRNA quantification using qPCR assay (H Jiang, Z Li, X Li, J Xia (2015) Intercellular transfer of messenger RNAs in multiorgan tumorigenesis by tumor cell-derived exosomes. Mol Med Rep 11: 4657-4663. Doi: 10.3892/mmr.2015.3312; K C Miranda, D T Bond, M McKee, J Skog, T G Paunescu, N Da Silva, D Brown, L M Russo (2010) Nucleic acids within urinary exosomes/microvesicles are potential biomarkers for renal disease. Kidney Int 78(2): 191-199. Doi: 10.1038/ki.2010.106; S Haque, S R Vaiselbuh (2018) Exosomes molecular diagnostics: direct conversion of exosomes into the cDNA for gene amplification by two-step polymerase chain reaction. J Biol Methods 5(3): e96. Doi: 10.14440/jbm.2018.249; L Dong, W Lin, P Qi, M Xu, Z Wu, S Ni, D Haung, W-W Weng, C Tan, W Sheng, X Zhou, X Du (2016) Circulating long RNAs in serum extracellular vesicles: their characterization and potential application as biomarkers for diagnosis of colorectal cancer. Cancer Epidemiol Biomarkers Prev 25(7):1158-1166. Doi: 10.1158/1055-9965. EPI-16-0006).
[0147] Overall data from the total of 7 samples (3 female-pooled and 4 male-pooled urine samples) from both experimental set-ups is combined and presented in
[0148] In another experimental setting, male and female healthy donors provided random (mid-day), first void urine sample using the Colli-Pee® First Void Urine Collection Device (Novosanis). Specimens were transported to the laboratory on ice packs where samples were pooled together to form pooled urine specimens (MP, male-pooled; FP, female-pooled). An aliquot of pooled urine was stored in the 1) absence of a stabilizing composition (unpreserved), 2) mixed with stock solutions [Table 22 (iii)] containing different sugars in the urine: chemistry ratio of 1:0.43 and stored. All specimens were stored at room temperature (23±3° C.) for at least 7 days. The final composition of the stabilization solution after mixing with urine is described in Table 22 (iv). On day zero and day 7, 8.5 mL aliquot of each unpreserved, Chem F and Streck preservative containing urine specimen was centrifuged at 3,000 g for 10 minutes at room temperature followed by 0.8 μM filtration (Sartorius® Minisart NML®, Cat. No. 16592, or Millipore® Millex®-AA, Cat. No. SLAA033SB). 8 mL of precleared supernatant was recovered from each specimen post-centrifugation and filtration and EV RNA was extracted using ultrafiltration (see EV RNA extraction in Materials and Methods). The concentration of extracted RNA samples was measured using Ribogreen quantification (see Materials and Methods). For cDNA synthesis, an equal amount (ng) of total extracted RNA from the unpreserved and stabilization condition was used for a given urine sample. cDNA was prepared using the M-MLV Reverse Transcription kit and qPCR was performed using β-actin TaqMan assay (see Materials and Methods).
[0149]
[0150] In another experimental setting, male and female healthy donors provided random (mid-day), first void urine sample using the Colli-Pee® First Void Urine Collection Device (Novosanis). Specimens were transported to the laboratory on ice packs where samples were pooled together to form pooled urine specimens (MP, male-pooled; FP, female-pooled). An aliquot of pooled urine was stored in the 1) absence of a stabilizing composition (NA, unpreserved), 2) mixed with Chemistry F stabilizing composition in the urine: chemistry ratio of 1:0.43 and 3) mixed with 5 mL of Streck's urine preservative (Cat. No. 230216) and stored. The composition of the stabilization solution is described in Table 23 (i). Both types of specimens were stored at room temperature (23±3° C.) for at least 7 days. The final composition of the stabilization solution after mixing with urine is described in Table 23 (ii). On day zero and day 7, 11 mL aliquot of each unpreserved, Chem F and Streck preservative containing urine specimen was centrifuged at 3,000 g for 10 minutes at room temperature, followed by 0.8 μM filtration. 10 mL of precleared supernatant was recovered from each specimen post-centrifugation and filtration and EV RNA was extracted using the ExoRNeasy Maxi kit (Qiagen, see Materials and Methods). The concentration of extracted RNA samples was measured using Ribogreen quantification (see Materials and Methods). For cDNA synthesis, an equal amount (ng) of total extracted RNA from the unpreserved and stabilization condition was used for a given urine sample. cDNA was prepared using the M-MLV Reverse Transcription kit and qPCR was performed using β-actin TaqMan assay (see Materials and Methods).
[0151]
TABLE-US-00025 TABLE 20 Composition of the present invention prior to mixture with urine. Composition Stock solution Sodium acetate 1750 mM Boric acid 5% CDTA 119 mM Fructose 45% pH 4.7-5.0
TABLE-US-00026 TABLE 21 Final composition of the present invention after mixture with urine. Stabilizing Composition Solution (Chem F) Sodium acetate 233.3 mM Boric acid 0.67% CDTA 15.9 mM Fructose 6.0% Ethanol 6.3%
TABLE-US-00027 TABLE 22 (i) Composition of the present invention prior to mixture with urine. Composition Stock solution Sodium acetate 771.2 mM Boric acid 2.2% CDTA 52.4 mM Fructose 19.8% Ethanol 22.4% pH 5.0
TABLE-US-00028 TABLE 22 (ii) Final composition of the present invention after mixture with urine. Stabilizing Solution Composition (Chem F) Sodium acetate 231.4 mM Boric acid 0.67% CDTA 15.7 mM Fructose 5.9% Ethanol 6.7%
TABLE-US-00029 TABLE 22 (iii) Composition of the present invention prior to mixture with urine. Stock solution with Stock solution with Composition Fructose (Chem F) Glucose (Chem G) Sodium acetate 750 mM 750 mM Boric acid 2.2% 2.2% CDTA 50 mM 50 mM Sugar 20% 20% Ethanol 23% 23% pH 5.0-5.2 5.0-5.2
TABLE-US-00030 TABLE 22 (iv) Final composition of the present invention after mixture with urine. Stabilizing Solution Stabilizing Solution Composition (Chem F) (Chem G) Sodium acetate 225 mM 225 mM Boric acid 0.7% 0.7% CDTA 15 mM 15 mM Sugar 6% 6% Ethanol 6.9% 3.9%
TABLE-US-00031 TABLE 23 (i) Composition of the present invention prior to mixture with urine. Composition Stock solution Sodium acetate 750 mM Boric acid 2.2% CDTA 50 mM Fructose 20% Ethanol 23% pH 5.0-5.2
TABLE-US-00032 TABLE 23 (ii) Final composition of the present invention after mixture with urine. Stabilizing Solution Composition (Chem F) Sodium acetate 225 mM Boric acid 0.7% CDTA 15 mM Fructose 6% Ethanol 6.9%
Example 11: Stabilizing Composition for the Preservation of Cell-Free RNA (cfRNA) in Urine at Room Temperature
[0152] Male and Female healthy donors provided random (mid-day), first void urine samples using the Colli-Pee® First Void Urine Collection Device (Novosanis). Specimens were transported to the laboratory on ice packs where samples were pooled together to form pooled urine specimens (MP, male-pooled; FP, female-pooled). An aliquot of pooled urine was stored in the 1) absence of a stabilizing composition (unpreserved), 2) mixed with Chemistry F stabilizing composition in the urine: chemistry ratio of 1:0.43 and stored. The composition of the stabilization solution is described in Table 24. Both types of specimens were stored at room temperature (23±3° C.) for at least 7 days. The final composition of the stabilization solution after mixing with urine is described in Table 25. On day zero and day 7, 2.5 mL aliquot of each unpreserved and Chem F containing urine specimen was centrifuged at 3,000 g for 10 minutes at room temperature, followed by 0.8 μM filtration. 2 mL of precleared supernatant was recovered from each specimen post-centrifugation and filtration and cell-free nucleic acids were extracted using the QiaAmp circulating nucleic acids extraction kit (Qiagen, see Materials and Methods). Extracted nucleic acids were subjected to DNAse digestion to remove DNA contamination for the efficient purification of total cell-free RNA. The concentration of extracted RNA samples was measured using Ribogreen quantification (see Materials and Methods). For cDNA synthesis, an equal amount (ng) of total extracted RNA from the unpreserved and stabilization condition was used for a given urine sample. cDNA was prepared using the M-MLV Reverse Transcription kit and qPCR was performed using β-actin TaqMan assay (see Materials and Methods).
[0153]
TABLE-US-00033 TABLE 24 Composition of the Stock Solution Composition Stock Solution Sodium acetate 750 mM Boric acid 2.2% CDTA 50 mM Fructose 20% Ethanol 23% pH 4.7-5.0
TABLE-US-00034 TABLE 25 Final concentration of present composition after mixing with urine. Stabilizing Solution Composition (Chem F) Sodium acetate 225 mM Boric acid 0.7% CDTA 15 mM Fructose 6% Ethanol 6.9%
Example 12: Stabilizing Composition for the Preservation of Urinary Cellular RNA in Urine at Room Temperature
[0154] This example is comprised of two separate studies. In the first study, mid-day first void urine samples from 8 male and 8 female donors were collected using the Colli-Pee® First-void Urine Collection Device (Novosanis) and pooled to form a total of 4 pooled urine specimens (2 male (MP) and 2 female (FP)). i) 40 mL of each specimen was stored in the absence of a stabilizing composition (unpreserved), and ii) 28 mL of each urine specimen was mixed with 12 mL of stock solution (Table 26). Both types of specimens were stored at room temperature (23±3° C.) for at least 7 days. The final composition after mixing with urine is described in Table 27 below.
[0155] In the second study, 4 healthy donors provided a 30 mL first morning, first void (FMFV) urine specimen and their urine samples were pooled together to generate two pooled urine specimens. i) 30 mL of each specimen was stored in the absence of a stabilizing composition (unpreserved, NA), and ii) 24 mL of each urine specimen was mixed with 4 mL of stock solution (Table 28) and 2 mL of 95% ethanol. Both types of specimens were stored at room temperature (23±3° C.) for at least 7 days. The final composition of the stabilization solution “Chem F” after mixing with urine is described in Table 29 below. For comparison, 25 mL of urine was mixed with 5 mL of Streck's urine fixative (reference composition), commercially known as “Cell-free DNA Urine Preserve” (Cat. No. 230216), and stored at room temperature for at least 7 days. The reference composition comprises the formaldehyde-releasing agent imidazolidinyl urea, as well as K.sub.3EDTA and glycine.
[0156] On day zero and day 7, 15-16 mL aliquot of each unpreserved, Chem F and Streck's preservative containing urine specimen was centrifuged at 3,800 g for 20 minutes at room temperature. Total cellular pellet was recovered from each specimen post-centrifugation and urinary cellular RNA was extracted using either Trizol LS reagent (study I) as described in the Materials and Methods or Qiagen RNeasy plus Mini Kit (study II) according to manufacturer's protocol. Targeted mRNA analysis on extracted cellular RNA using β-actin (ACTB) TaqMan based RT-qPCR experiments was performed as described (see Materials and Methods).
[0157] Overall data from the total of 4 samples (2 female-pooled and 2 male-pooled urine samples) from first experimental set-up is combined and presented in
[0158]
TABLE-US-00035 TABLE 26 Composition of the present invention prior to mixture with urine. Composition Stock solution Sodium acetate 771.2 mM Boric acid 2.2% CDTA 52.4 mM Fructose 19.8% Ethanol 22.4% pH 5.0
TABLE-US-00036 TABLE 27 Final composition of the present invention after mixture with urine. Stabilizing Solution Composition (Chem F) Sodium acetate 231.4 mM Boric acid 0.67% CDTA 15.7 mM Fructose 5.9% Ethanol 6.7%
TABLE-US-00037 TABLE 28 Composition of the present invention prior to mixture with urine. Composition Stock Solution Sodium acetate 1750 mM Boric acid 5% CDTA 119 mM Fructose 45% pH 4.7-5.0
TABLE-US-00038 TABLE 29 Final composition of the present invention after mixture with urine. Stabilizing Solution Composition (Chem F) Sodium acetate 233.33 mM Boric acid 0.67% CDTA 15.87 mM Fructose 6% Ethanol 6.3%
Example 13: Stabilizing Composition for the Preservation of Urinary Cellular DNA in Urine at Room Temperature
[0159] In this study, mid-day first void urine samples from 6 male and 6 female healthy donors were collected using the Colli-Pee® First-void Urine Collection Device (Novosanis) and pooled to form a total of 4 pooled urine specimens [2 male-pooled (MP) and 2 female-pooled (FP)]. i) 30 mL of each specimen was stored in the absence of a stabilizing composition (unpreserved), and ii) 21 mL of each urine specimen was mixed with 9 mL of stock solution (Table 30). Both types of specimens were stored at room temperature (23±3° C.) for at least 7 days. The final composition after mixing with urine is described in Table 31 below.
[0160] On day zero and day 7, 15 mL aliquot of each unpreserved and Chem F containing specimen was centrifuged at 3000 g for 10 minutes at room temperature. Total cellular pellet was recovered from each specimen post-centrifugation and urinary cellular DNA was extracted using QiaAmp DNA Mini Kit (Qiagen) according to manufacturer's protocol. The profile of the extracted cellular DNA was assessed on Agilent 4200 Tapestation using Genomic DNA tape. Extracted DNA was used to amplify ˜1 Kb PCR product (GAPDH gene) for measuring DNA stability as described (see Materials and Methods).
[0161]
[0162]
TABLE-US-00039 TABLE 30 Composition of the present invention prior to mixture with urine. Composition Stock Solution Sodium acetate 771.2 mM Boric acid 2.2% CDTA 52.4 mM Fructose 19.8% Ethanol 22.4% pH 5.0
TABLE-US-00040 TABLE 31 Final composition of the present invention after mixture with urine. Stabilizing Solution Composition (Chem F) Sodium acetate 231.4 mM Boric acid 0.67% CDTA 15.7 mM Fructose 5.9% Ethanol 6.7%
Example 14: Stabilizing Composition for the Preservation of Cell-Free Nucleic Acids Profile in Saliva Samples Stored at Room Temperature
[0163] Like urine, saliva sampling is easy, safe, inexpensive and ideal for in-home collection. Saliva is composed of various molecules (e.g. enzymes, hormones, antibodies, mucins, growth factors, nucleic acids, exosomes, and antimicrobial constituents) that are filtered, processed and secreted from the vasculature that nourish the salivary glands. Many of these enter saliva from blood by passing through the spaces between cells by transcellular or para-cellular routes. Therefore, most compounds found in blood are also present in saliva. Hence, saliva shows high potential for monitoring health and disease (Y-H Lee and D T Wong (2009) Saliva: an emerging biofluid for early detection of diseases. Am J Dent 22(4): 241-248; K-A Hyun, H Gwak, J Lee, B Kwak, H-I Jung (2018) Salivary exosome and cell-free DNA for cancer detection. Micromachines 9: 340).
[0164] In this study, raw saliva samples were collected from 6 healthy individuals and were mixed together to form a pooled saliva sample. i) 7 mL of pooled saliva sample was mixed with 3 mL of 1× TE buffer (Thermo Fisher Scientific; Cat. No. AM9858) (unpreserved), and ii) 7 mL of pooled saliva was mixed with 3 mL of stock solution (see Table 32). TE buffer was added to the unpreserved specimen, to overcome the mucinous nature of saliva for the efficient separation of extracellular and cellular compartments. Both types of specimens were stored at room temperature (23±3° C.) for at least 7 days. The final composition after mixing with saliva is described in Table 33 below.
[0165] On day zero and day 7, 4.5 mL aliquot of each unpreserved and chemistry F (Chem F) containing specimen was centrifuged at 3,800 g for 20 minutes at room temperature. 4.0 mL of supernatant was recovered from each specimen post-centrifugation and cell-free nucleic acids were extracted using the QIAamp Circulating Nucleic Acids Kit (Qiagen, see Materials and Methods). The profile of the extracted cell-free nucleic acids was assessed on Agilent 4200 Tapestation using HS D5000 tape (Agilent; Cat. No. 5067-5592).
TABLE-US-00041 TABLE 32 Composition of the present invention prior to mixture with saliva Composition Stock Solution Sodium acetate 771.2 mM Boric acid 2.2% CDTA 52.4 mM Fructose 19.8% Ethanol 22.4% pH 5.0
TABLE-US-00042 TABLE 33 Final composition of the present invention after mixture with saliva. Stabilizing Solution Composition (Chem F) Sodium acetate 231.4 mM Boric acid 0.67% CDTA 15.7 mM Fructose 5.9% Ethanol 6.7%
[0166] All publications, patents and patent applications mentioned in this Specification are indicative of the level of skill of those skilled in the art to which this invention pertains and are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.
[0167] The invention being thus described, it will be obvious that the same may be varied in many ways. Such variations are not to be regarded as a departure from the spirit and scope of the invention, and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims. The scope of the claims should not be limited to the preferred embodiments set for the description, but should be given the broadest interpretation consistent with the description as a whole.