Mutant viral capsid libraries and related systems and methods

10584328 ยท 2020-03-10

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided are mutant viral capsid cell libraries, individual cells of such libraries, systems, vectors, and methods for generating the cell libraries, and methods of use thereof to screen for mutant viral capsids with desired characteristics.

Claims

1. A method for generating a mutant adeno-associated virus (AAV) capsid cell library, comprising, (a) transfecting a plurality of eukaryotic cells with a first vector and a second vector, wherein the plurality of cells comprise an integrase-specific DNA attachment site in their genome, wherein the first vector comprises a polynucleotide sequence that encodes a mutant viral capsid operably linked to a promoter and comprises an integrase-specific DNA attachment site that recombines with the integrase-specific DNA attachment site in the cell, and wherein the second vector encodes a heterologous integrase which promotes integration at the DNA attachment site, and (b) selecting the plurality of cells for expression of the first vector, thereby generating the mutant viral capsid cell library, wherein less than 10% of the cells transfected in step (a) comprise two or more vectors encoding a mutant AAV capsid, wherein substantially all of the selected cells comprise a single heterologous polynucleotide encoding the mutant viral capsid integrated into the genome of the cell, and wherein the mutant viral capsid cell library encodes a plurality of mutant viral capsids.

2. The method of claim 1, wherein the integrase-specific DNA attachment site in the genome of the cell is a native pseudo attP site, the integrase is C31, and the integrase-specific DNA attachment site in the first vector is C31 attB.

3. The method of claim 2, comprising transfecting a titrated molar ratio of the first vector:second vector, wherein substantially all of the selected cells have only one integration event of the first vector at a pseudo native attP site.

4. The method of claim 1, further comprising transfecting the mutant AAV capsid cell library with an AAV rep-expressing polynucleotide that encodes one or more of Rep78, Rep68, Rep52, and/or Rep40, and/or a helper vector or plasmid, and incubating the cell library for a time sufficient to produce virions that comprise a mutant AAV capsid.

5. The method of claim 4, further comprising collecting and screening the virions for at least one phenotype, wherein screening comprises infecting target cells with the virions under suitable conditions or administering the virions to a mammalian subject, followed by isolating the infected target cells or isolating a target tissue from the mammalian subject.

6. The method of claim 5, further comprising performing reverse transcription polymerase chain reaction (RT-PCR) on RNA from the infected, isolated cells or tissue to identify and sequence a mutant AAV capsid of interest.

7. The method of claim 1, wherein the integrase-specific DNA attachment site in the genome of the cells is a single pseudo Bxb1 attP site, the integrase is Bxb1, and the integrase-specific DNA attachment site in the vector is Bxb1 attB.

8. The method of claim 1, wherein the integrase-specific DNA attachment site in the genome of the cells is a single pseudo C31 attP site, the integrase is C31, and the integrase-specific DNA attachment site in the vector is C31 attB.

9. The method of claim 8, wherein substantially all of the selected cells have only one integration event of the vector which is at the single pseudo C31 attP site.

10. The method of claim 1, wherein the vector that encodes the mutant viral capsid further encodes a reporter protein, optionally green fluorescent protein (GFP).

11. The method of claim 3, further comprising contacting the cells with a helper virus encoding a rep protein, and incubating the cell library for a time sufficient to produce virions that comprise a mutant AAV capsid.

12. The method of claim 11, wherein the helper virus is an adenovirus or a herpes virus.

13. The method of claim 12, comprising collecting and screening the virions for at least one phenotype relative to a wild-type AAV capsid, wherein the at least one phenotype is altered cell tropism, reduced neutralizing antibody binding, or both.

14. The method of claim 13, wherein screening comprises infecting target cells with the virions under suitable conditions and isolating the infected cells.

15. The method of claim 14, wherein isolating the cells or tissue is based on expression of a reporter protein encoded by the virions, wherein the reporter protein is optionally green fluorescent protein (GFP).

16. The method of claim 14, wherein the target cells comprise retinal cells and the at least one phenotype is increased tropism towards (or infectivity of) the retinal cells.

17. The method of claim 14, wherein the at least one phenotype is reduced neutralizing antibody binding and the suitable conditions comprise the presence of neutralizing antibodies.

18. The method of claim 17, wherein the target cells are HeRC32 cells which express a rep protein.

19. The method of claim 6, wherein prior to performing RT-PCR the method comprises increasing the quantity of mutant AAV capsid RNA in an infected target cell, which comprises the step of transducing the target cells or target tissue with an adenovirus or herpes simplex virus.

20. The method of claim 1, wherein the plurality of eukaryotic cells are transfected with the first vector and the second vector at a vector ratio of the first vector to the second vector of about 1:50.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIGS. 1A and 1B show one illustrative embodiment for producing (FIG. 1A) and screening (FIG. 1B) a mutant viral capsid library according to the present invention.

(2) FIG. 2 shows how integration frequency or rate (number of integration events per cell) depends on the molar ratio of donor plasmid (attB-containing and mutant viral capsid-encoding plasmid) to C31 integrase-encoding plasmid. Numbers above each bar show the number of cells counted that incorporated only the sequence encoding the red reporter (cross-hatched bars), the number of cells that incorporated only the sequence encoding the green reporter (light gray bars), and the number of cells that incorporated both red and green coding sequences (i.e., double integrants; solid bars). Also shown is the total number of cells counted in each study (non-filled bars). The percentage of double integrant cells (i.e., % cells in which two or more integration events occurred) is shown for each molar ratio tested.

DETAILED DESCRIPTION OF THE INVENTION

(3) Embodiments of the present disclosure relate to mutant viral capsid cell libraries, particularly for mutant AAV capsids, individual cells of such libraries, systems and methods for generating the cell libraries, and methods of use thereof to screen for mutant viral capsids with desired characteristics. Such embodiments allow for the generation of viral capsid libraries with high diversity, for example, with up to billions of variants or more and little to no cross-packaging, in the least because all or substantially all of the cells in a given library contain a single integrated copy of their own mutant viral capsid gene.

(4) The cells and libraries can be used, for example, to screen and select for mutant or variant capsids having desired properties relative to wild-type capsids, such as variants with reduced binding to neutralizing antibodies and/or variants with altered cell tropism. In specific instances, the variant capsids, particularly AAV capsids, can be selected for improved retinal cell tropism.

(5) Definitions

(6) The term retinal cell refers to any of the cell types that comprise the retina, including but not limited to retinal ganglion cells, amacrine cells, horizontal cells, bipolar cells, and photoreceptor cells, including rods and cones, Mller glial cells, and retinal pigmented epithelium.

(7) A vector as used herein refers to a macromolecule or association of macromolecules that comprises or associates with a polynucleotide and which can be used to mediate delivery of the polynucleotide to a cell. Illustrative vectors include, for example, plasmids, viral vectors, liposomes, and other gene delivery vehicles.

(8) The term AAV is an abbreviation for adeno-associated virus, and may be used to refer to the virus itself or derivatives thereof. The term covers all subtypes and both naturally occurring and recombinant forms, except where required otherwise. The term AAV includes AAV type 1 (AAV-1), AAV type 2 (AAV-2), AAV type 3 (AAV-3), AAV type 4 (AAV-4), AAV type 5 (AAV-5), AAV type 6 (AAV-6), AAV type 7 (AAV-7), AAV type 8 (AAV-8), avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, and ovine AAV. Primate AAV refers to AAV that infect primates, non-primate AAV refers to AAV that infect non-primate mammals, bovine AAV refers to AAV that infect bovine mammals, etc.

(9) An AAV virus or AAV viral particle or rAAV vector particle refers to a viral particle composed of at least one AAV capsid protein (typically by all of the capsid proteins of a wild-type AAV) and an encapsidated polynucleotide rAAV vector. If the particle comprises a heterologous polynucleotide (i.e. a polynucleotide other than a wild-type AAV genome such as a transgene to be delivered to a mammalian cell), it is typically referred to as a rAAV vector particle or simply a rAAV vector. Thus, production of an rAAV particle necessarily includes production of an rAAV vector, as such a vector is contained within a rAAV particle.

(10) The term replication defective as used herein relative to an AAV viral vector of the invention means the AAV vector cannot independently replicate and package its genome. For example, when a cell of a subject is infected with rAAV virions, the heterologous gene is expressed in the infected cells, however, due to the fact that the infected cells lack AAV rep and cap genes and accessory function genes, the rAAV is not able to replicate further.

(11) An AAV variant or AAV mutant as used herein refers to a viral particle composed of a variant AAV capsid protein, where the variant AAV capsid protein comprises at least one amino acid difference (e.g., amino acid substitution, amino acid insertion, amino acid deletion) relative to a corresponding parental AAV capsid protein. In some instances, the variant capsid protein confers reducing binding to host antibodies and/or increased infectivity of a retinal cell compared to the infectivity of the retinal cell by an AAV virion comprising the corresponding parental AAV capsid protein. An AAV variant or mutant AAV virion will preferably contain a polynucleotide encoding the mutant capsid proteins that make up the mutant AAV virion capsid.

(12) The abbreviation rAAV refers to recombinant adeno-associated virus, also referred to as a recombinant AAV vector (or rAAV vector). A rAAV vector as used herein refers to an AAV vector comprising a polynucleotide sequence not of AAV origin (i.e., a polynucleotide heterologous to AAV), typically a sequence of interest for the genetic transformation of a cell. In general, the heterologous polynucleotide is flanked by at least one, and generally by two AAV inverted terminal repeat sequences (ITRs). The term rAAV vector encompasses both rAAV vector particles and rAAV vector plasmids.

(13) As used herein, the term gene or coding sequence refers to a nucleotide sequence in vitro or in vivo that encodes a gene product. In some instances, the gene consists or consists essentially of coding sequence, that is, sequence that encodes the gene product. In other instances, the gene comprises an additional, non-coding, sequence. For example, the gene may or may not include regions preceding and following the coding region, e.g. 5 untranslated (5 UTR) or leader sequences and 3 UTR or trailer sequences, as well as intervening sequences (introns) between individual coding segments (exons).

(14) As used herein, a transgene is a gene that is delivered to a cell by a vector.

(15) As used herein, the term gene product refers to the desired expression product of a polynucleotide sequence such as a polypeptide, peptide, protein.

(16) As used herein, the terms polypeptide, peptide, and protein refer to polymers of amino acids of any length. The terms also encompass an amino acid polymer that has been modified; for example, disulfide bond formation, glycosylation, lipidation, phosphorylation, or conjugation with a labeling component.

(17) The term polynucleotide or nucleic acid as used herein includes mRNA, RNA, cRNA, cDNA, and DNA. The term typically refers to polymeric form of nucleotides of at least 10 bases in length, either ribonucleotides or deoxyribonucleotides or a modified form of either type of nucleotide. The term includes single and double stranded forms of DNA. The terms isolated DNA and polynucleotide and nucleic acid refers to a DNA molecule that has been isolated free of total genomic DNA of a particular species. Therefore, an isolated DNA segment encoding a polypeptide refers to a DNA segment that contains one or more coding sequences yet is substantially isolated away from, or purified free from, total genomic DNA of the species from which the DNA segment is obtained. Also included are non-coding polynucleotides (e.g., primers, probes, oligonucleotides), which do not encode a polypeptide. Included within the term polynucleotide are DNA segments and smaller fragments of such segments, and also recombinant vectors, including, for example, plasmids, cosmids, phagemids, phage, viruses, and the like.

(18) Additional coding or non-coding sequences may, but need not, be present within a polynucleotide. Hence, the polynucleotides of the present invention, regardless of the length of the coding sequence itself, may be combined with other DNA sequences, such as promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, other coding segments, and the like, such that their overall length may vary considerably.

(19) By comprising it is meant that the recited elements are required in, for example, the composition, method, kit, etc., but other elements may be included to form the, for example, composition, method, kit etc. within the scope of the claim. For example, an expression cassette comprising a gene encoding a mutant viral capsid operably linked to a promoter is an expression cassette that may include other elements in addition to the gene and promoter, e.g. poly-adenylation sequence, enhancer elements, other genes, linker domains, etc.

(20) By consisting essentially of, it is meant a limitation of the scope of the, for example, composition, method, kit, etc., described to the specified materials or steps that do not materially affect the basic and novel characteristic(s) of the, for example, composition, method, kit, etc. For example, an expression cassette or polynucleotide consisting essentially of a gene encoding a mutant viral capsid operably linked to a promoter and a polyadenylation sequence may include additional sequences, e.g. linker sequences, so long as they do not materially affect the transcription or translation of the gene. As another example, a variant, or mutant, polypeptide fragment consisting essentially of a recited sequence has the amino acid sequence of the recited sequence plus or minus about 10 amino acid residues at the boundaries of the sequence based upon the full length nave polypeptide from which it was derived, e.g. 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 residue less than the recited bounding amino acid residue, or 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 residues more than the recited bounding amino acid residue.

(21) By consisting of, it is meant the exclusion from the composition, method, or kit of any element, step, or ingredient not specified in the claim. For example, an expression cassette consisting of a gene encoding a mutant viral capsid operably linked to a promoter, and a polyadenylation sequence consists only of the promoter, polynucleotide sequence encoding the mutant viral capsid, and polyadenylation sequence. As another example, a polypeptide consisting of a recited sequence contains only the recited sequence.

(22) As used herein, the terms sequence identity, for example, % sequence identity, refers to the degree of identity between two or more polynucleotides when aligned using a nucleotide sequence alignment program; or between two or more polypeptide sequences when aligned using an amino acid sequence alignment program. Similarly, the term identical or percent identity when used herein in the context of two or more nucleotide or amino acid sequences refers to two sequences that are the same or have a specified percentage of amino acid residues or nucleotides when compared and aligned for maximum correspondence, for example as measured using a sequence comparison algorithm, e.g. the Smith-Waterman algorithm, etc., or by visual inspection. For example, the percent identity between two amino acid sequences may be determined using the Needleman and Wunsch, (1970, J. Mol. Biol. 48: 444-453) algorithm which has been incorporated into the GAP program in the GCG software package, using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6. As another example, the percent identity between two nucleotide sequences may be determined using the GAP program in the GCG software package, using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6. A particularly preferred set of parameters (and the one that should be used unless otherwise specified) are a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5. The percent identity between two amino acid or nucleotide sequences can also be determined using the algorithm of E. Meyers and W. Miller (1989, Cabios, 4: 11-17) which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. The nucleic acid and protein sequences described herein can be used as a query sequence to perform a search against public databases to, for example, identify other family members or related sequences. Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al., (1990, J. Mol. Biol, 215: 403-10). BLAST nucleotide searches can be performed with the NBLAST program, score=100, wordlength=12 to obtain nucleotide sequences homologous to nucleic acid molecules of the invention. BLAST protein searches can be performed with the XBLAST program, score=50, wordlength=3 to obtain amino acid sequences homologous to protein molecules of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., (1997, Nucleic Acids Res, 25: 3389-3402). When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used.

(23) The term % homology is used interchangeably herein with the term % identity herein and refers to the level of nucleic acid or amino acid sequence identity between two or more aligned sequences, when aligned using a sequence alignment program. For example, as used herein, 80% homology means the same thing as 80% sequence identity determined by a defined algorithm, and accordingly a homologue of a given sequence has greater than 80% sequence identity over a length of the given sequence.

(24) The term expression as used herein encompasses the transcription and/or translation of an endogenous gene, a transgene or a coding sequence in a cell.

(25) An expression vector as used herein encompasses a vector, e.g. plasmid, minicircle, viral vector, liposome, and the like as discussed above or as known in the art, comprising a polynucleotide which encodes a gene product of interest, and is used for effecting the expression of a gene product in an intended target cell. An expression vector also comprises control elements operatively linked to the encoding region to facilitate expression of the gene product in the target. The combination of control elements, e.g. promoters, enhancers, UTRs, miRNA targeting sequences, etc., and a gene or genes to which they are operably linked for expression is sometimes referred to as an expression cassette. Many such control elements are known and available in the art or can be readily constructed from components that are available in the art.

(26) A promoter as used herein encompasses a DNA sequence that directs the binding of RNA polymerase and thereby promotes RNA synthesis, i.e., a minimal sequence sufficient to direct transcription. Promoters and corresponding protein or polypeptide expression may be ubiquitous, meaning strongly active in a wide range of cells, tissues and species or cell-type specific, tissue-specific, or species specific. Promoters may be constitutive, meaning continually active, or inducible, meaning the promoter can be activated or deactivated by the presence or absence of biotic or abiotic factors. Also included in the nucleic acid constructs or vectors of the invention are enhancer sequences that may or may not be contiguous with the promoter sequence. Enhancer sequences influence promoter-dependent gene expression and may be located in the 5 or 3 regions of the native gene.

(27) An enhancer as used herein encompasses a cis-acting element that stimulates transcription of adjacent genes. Enhancers can function (i.e., can be associated with a coding sequence) in either orientation, over distances of up to several kilobase pairs (kb) from the coding sequence and from a position downstream of a transcribed region.

(28) A termination signal sequence as used herein encompasses any genetic element that causes RNA polymerase to terminate transcription, such as for example a polyadenylation signal sequence.

(29) A polyadenylation signal sequence as used herein encompasses a recognition region necessary for endonuclease cleavage of an RNA transcript that is followed by the polyadenylation consensus sequence AATAAA. A polyadenylation signal sequence provides a polyA site, i.e. a site on a RNA transcript to which adenine residues will be added by post-transcriptional polyadenylation.

(30) As used herein, the terms operatively linked or operably linked refers to a juxtaposition of genetic elements, e.g. promoter, enhancer, termination signal sequence, polyadenylation sequence, etc., wherein the elements are in a relationship permitting them to operate in the expected manner. For instance, a promoter is operatively linked to a coding region if the promoter helps initiate transcription of the coding sequence. There may be intervening residues between the promoter and coding region so long as this functional relationship is maintained.

(31) As used herein, the term heterologous means derived from a genotypically distinct entity from that of the rest of the entity to which it is being compared. For example, a polynucleotide introduced by genetic engineering techniques into a plasmid or vector derived from a different species is a heterologous polynucleotide. As another example, a promoter removed from its native coding sequence and operatively linked to a coding sequence with which it is not naturally found linked is a heterologous promoter. Thus, for example, an rAAV that includes a heterologous nucleic acid encoding a heterologous gene product is an rAAV that includes a nucleic acid not normally included in a naturally-occurring, wild-type AAV, and the encoded heterologous gene product is a gene product not normally encoded by a naturally-occurring, wild-type AAV.

(32) The term endogenous as used herein with reference to a nucleotide molecule or gene product refers to a nucleic acid sequence, e.g. gene or genetic element, or gene product, e.g. RNA, protein, that is naturally occurring in or associated with a host virus or cell.

(33) The term native as used herein refers to a nucleotide sequence, e.g. gene, or gene product, e.g. RNA, protein, that is present in a wild-type virus or cell.

(34) An endogenous recognition site refers to a site that is native to the genome, or a recognition site that occurs naturally in the genome of a cell (i.e., the sites are not introduced into the genome, for example, by recombinant means).

(35) The term variant as used herein refers to a mutant of a reference polynucleotide or polypeptide sequence, for example a native polynucleotide or polypeptide sequence, i.e. having less than 100% sequence identity with the reference polynucleotide or polypeptide sequence. Put another way, a variant comprises at least one amino acid difference (e.g., amino acid substitution, amino acid insertion, amino acid deletion) relative to a reference polynucleotide sequence, e.g. a native polynucleotide or polypeptide sequence. For example, a variant may be a polynucleotide having a sequence identity of 70% or more with a full length native polynucleotide sequence, e.g. an identity of 75% or 80% or more, such as 85%, 90%, or 95% or more, for example, 98% or 99% identity with the full length native polynucleotide sequence. As another example, a variant may be a polypeptide having a sequence identity of 70% or more with a full length native polypeptide sequence, e.g. an identity of 75% or 80% or more, such as 85%, 90%, or 95% or more, for example, 98% or 99% identity with the full length native polypeptide sequence. Variants may also include variant fragments of a reference, e.g. native, sequence sharing a sequence identity of 70% or more with a fragment of the reference, e.g. native, sequence, e.g. an identity of 75% or 80% or more, such as 85%, 90%, or 95% or more, for example, 98% or 99% identity with the native sequence.

(36) The term introducing, as used herein, includes delivery of a vector to a cell or cells, for example, for recombinant protein expression and/or for the introduction of one or more DNA attachment sites. Such a introducing may take place in vivo, in vitro or ex vivo. A vector for expression of a gene product may be introduced into a cell by transfection, which typically means insertion of heterologous DNA into a cell by physical means (e.g., calcium phosphate transfection, electroporation, microinjection or lipofection); infection, which typically refers to introduction by way of an infectious agent, i.e. a virus; or transduction, which typically means stable infection of a cell with a virus or the transfer of genetic material from one microorganism to another by way of a viral agent (e.g., a bacteriophage).

(37) The terms integrase or recombinase refer to a family of enzymes that mediate site-specific recombination between specific DNA sequences recognized by the recombinase (see, e.g., Esposito and Scocca, Nucleic Acids Res. 25:3605-3614, 1997); Nunes-Duby et al., Nucleic Acids Res. 26:391-406, 1998; and Stark et al., Trends in Genet. 8:432-439, 1992).

(38) A DNA attachment site or integrase-specific DNA attachment site refers to a stretch, domain or region of nucleotides that, when the system is employed, is recognized by the integrase of the system in which the genome attachment site is a member. System members as used herein refer to elements of the systems (i.e., a pair of integration-specific recognition sites and a corresponding integrase) that can interact to accomplish site-specific recombination. Attachment sites may vary in length, but typically ranges from about 20 to about 300 nucleotides in length, or from about 23 to about 100 nucleotides, or from about 28 to about 50 nucleotides in length, and generally about 40 nucleotides in length. Attachment sites can be in the genome of a cell, or in a vector. A DNA attachment site in the genome of a cell can be a native or endogenous DNA attachment site, which occurs naturally in the cell, or an exogenous, non-native, engineered, or introduced attachment site, which has been introduced into the genome of the cell by recombinant techniques.

(39) A pseudo site or pseudo DNA attachment site refers to a DNA sequence comprising a recognition site that is bound by a recombinase enzyme where the recognition site differs in one or more nucleotides from a wild-type recombinase recognition sequence and/or is present as an endogenous sequence in a genome that differs from the sequence of a genome where the wild-type recognition sequence for the recombinase resides. In some embodiments a pseudo attP site or pseudo attB site refer to pseudo sites that are similar to the recognitions site for wild-type phage (attP) or bacterial (attB) attachment site sequences, respectively, for phage integrase enzymes, such as the phage C31 or Bxb1. In some embodiments, the pseudo attP site is present in the genome of a host cell, while the pseudo attB site is present on a targeting vector in the system of the invention. A pseudo att site is a general term that can refer to a pseudo attP site or a pseudo attB site. It is understood that att sites or pseudo att sites may be present on linear or circular nucleic acid molecules.

(40) The term modulating includes increasing or stimulating, as well as decreasing or reducing, typically in a statistically significant or a physiologically significant amount as compared to a control. An increased or enhanced amount is typically a statistically significant amount, and may include an increase that is 1.1, 1.2, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30 or more times (e.g., 500, 1000 times) (including all integers and decimal points in between and above 1, e.g., 1.5, 1.6, 1.7, 1.8, etc.) the amount produced by no composition or a control composition. A decreased or reduced amount is typically a statistically significant amount, and may include a 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% decrease in the amount produced by no composition (or a control composition, including all integers in between.

(41) By statistically significant, it is meant that the result was unlikely to have occurred by chance. Statistical significance can be determined by any method known in the art. Commonly used measures of significance include the p-value, which is the frequency or probability with which the observed event would occur, if the null hypothesis were true. If the obtained p-value is smaller than the significance level, then the null hypothesis is rejected. In simple cases, the significance level is defined at a p-value of 0.05 or less.

(42) Substantially or essentially means nearly totally or completely, for instance, 90%, 95%, 96%, 97%, 98%, 99% or greater of some given quantity.

(43) Substantially free refers to the nearly complete or complete absence of a given quantity for instance, less than about 10%, 5%, 4%, 3%, 2%, 1%, 0.5% or less of some given quantity. For example, certain compositions may be substantially free of cell proteins, membranes, nucleic acids, endotoxins, or other contaminants.

(44) Transformation is typically used to refer to bacteria comprising heterologous DNA or cells which express an oncogene and have therefore been converted into a continuous growth mode such as tumor cells. A vector used to transform a cell may be a plasmid, virus or other vehicle.

(45) Typically, a cell is referred to as transduced, infected; transfected or transformed dependent on the means used for administration, introduction or insertion of heterologous DNA (i.e., the vector) into the cell. A cell is transduced with exogenous or heterologous DNA when the DNA is introduced into the cell by a virus. A cell is transfected with exogenous or heterologous DNA when the DNA is introduced into the cell by a non-viral method. Non-viral methods include chemical (e.g., lipofection) methods. The terms transduced and infected are used interchangeably herein to refer to cells that have received a heterologous DNA or heterologous polynucleotide from a virus.

(46) The term host cell, as used herein refers to a cell which has been transduced, infected, transfected or transformed with a vector. The vector may be a plasmid, a viral particle, a phage, etc. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to those skilled in the art. It will be appreciated that the term host cell refers to the original transduced, infected, transfected or transformed cell and progeny thereof.

(47) The various compositions and methods of the invention are described below. Although particular compositions and methods are exemplified herein, it is understood that any of a number of alternative compositions and methods are applicable and suitable for use in practicing the invention. It will also be understood that an evaluation of the expression constructs and methods of the invention may be carried out using procedures standard in the art.

(48) The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry and immunology, which are within the scope of those of skill in the art. Such techniques are explained fully in the literature, such as, Molecular Cloning: A Laboratory Manual, second edition (Sambrook et al., 1989); Oligonucleotide Synthesis (M. J. Gait, ed., 1984); Animal Cell Culture (R. I. Freshney, ed., 1987); Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (D. M. Weir & C. C. Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (J. M. Miller & M. P. Calos, eds., 1987); Current Protocols in Molecular Biology (F. M. Ausubel et al., eds., 1987); PCR: The Polymerase Chain Reaction, (Mullis et al., eds., 1994); and Current Protocols in Immunology (J. E. Coligan et al., eds., 1991), each of which is expressly incorporated by reference herein.

(49) Several aspects of the invention are described below with reference to example applications for illustration. It should be understood that numerous specific details, relationships, and methods are set forth to provide a full understanding of the invention. One having ordinary skill in the relevant art, however, will readily recognize that the invention can be practiced without one or more of the specific details or with other methods. The present invention is not limited by the illustrated ordering of acts or events, as some acts may occur in different orders and/or concurrently with other acts or events. Furthermore, not all illustrated acts or events are required to implement a methodology in accordance with the present invention.

(50) The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the singular forms a, an and the are intended to include the plural forms as well, unless the context clearly indicates otherwise. Furthermore, to the extent that the terms including, includes, having, has, with, or variants thereof are used in either the detailed description and/or the claims, such terms are intended to be inclusive in a manner similar to the term comprising.

(51) The term about or approximately means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, about can mean within 1 or more than 1 standard deviation, per the practice in the art. Alternatively, about can mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and more preferably still up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold, of a value. Where particular values are described in the application and claims, unless otherwise stated the term about meaning within an acceptable error range for the particular value should be assumed.

(52) All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited. It is understood that the present disclosure supersedes any disclosure of an incorporated publication to the extent there is a contradiction.

(53) It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as solely, only and the like in connection with the recitation of claim elements, or the use of a negative limitation.

(54) The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing-herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.

(55) Unless otherwise indicated, all terms used herein have the same meaning as they would to one skilled in the art and the practice of the present invention will employ, conventional techniques of microbiology and recombinant DNA technology, which are within the knowledge of those of skill of the art.

(56) Cells and Cell Libraries for Screening Mutant Capsids

(57) The present invention provides methods for generating stable cell libraries that can be used to produce a plurality of variant AAV virions (i.e., a mutant AAV library), or more generally a plurality of mutant virions. The mutant AAV library can be tested in vitro and screened in vivo to identify and select virions with unique and useful properties. The variant AAV virions produced by a cell library of this disclosure can comprise a plurality of distinctive mutations in one or more of their capsid protein(s) (VP1, VP2, and/or VP3), which may endow one or more of the virions in the library with an altered and desirable tropism and/or an ability to evade antibodies in an animal subject. This can be important because antibodies having the ability to bind to the AAV capsid may neutralize the ability of a recombinant AAV gene therapy virion to infect a target cell. The tropism, or cellular range, of an adeno-associated virus (AAV) is typically determined by the binding of the AAV capsid to molecules or receptors present on the surface of target cells. The ability to effectively modify the AAV capsid, for example by introducing one or more amino acid substitutions or peptide insertions into a capsid protein, and to then generate a stable cell library that can serve as a stable and renewable source for the continued and on-demand production of these variant AAV virions may be a valuable tool for discovering AAV virions that can infect cells in a target tissue while evading neutralizing antibodies. As such the present invention is expected to have utility in gene therapy research and vector development.

(58) A cell library of the present invention can encode and express a library of variant AAV virions, and more generally a plurality of variant virions, having one or more mutations in their capsid proteins. In addition to the many embodiments contemplated by the present invention, the present invention includes methods for making mutant AAV capsid cell libraries, cell libraries produced by the method, isolated cells contained by the libraries, clonal cell lines that may be derived from a cell library, and the vectors and vector systems used in the method for generating a cell library.

(59) One embodiment is an isolated cell comprising a heterologous polynucleotide having a coding sequence (e.g., a mutant cap gene) that encodes a non-naturally occurring mutant viral capsid, wherein the coding sequence for the capsid is operably linked to a promoter on the polynucleotide, and wherein the heterologous polynucleotide is integrated into the genome of the cell. In preferred embodiments, the isolated cell comprises no more than two heterologous polynucleotides, and most preferably no more than one heterologous polynucleotide encoding a mutant viral capsid integrated into the genome of the cell. Accordingly, an isolated cell of this disclosure will preferably comprise one heterologous polynucleotide encoding a non-naturally occurring mutant viral capsid and the polynucleotide will be integrated into the genome of the cell. In a preferred aspect, the heterologous polynucleotide is integrated into the genome of the isolated cell at a pseudo attP site in the cellular genome. Even more preferably, the heterologous polynucleotide is integrated into the genome of the isolated cell at and only at a pseudo attP site in the cellular genome. In a preferred form, the mutant viral capsid is a mutant AAV capsid. In preferred forms, the coding sequence is operably linked to a heterologous promoter on the polynucleotide and the polynucleotide is integrated at no more than one site or no more than one pseudo attP site in the cellular genome. Stated in other terms, the isolated cell of this invention preferably does not encode or express more than one mutant viral capsid, or in more specific embodiments does not encode more than one mutant AAV capsid. In other words, when the isolated cell is cultured, the mutant viral capsid protein(s) expressed by the cell are structurally identical one to the other, such that a single cell does not express a heterogeneous population of dissimilar capsids encoded by two or more different mutant capsid genes. In some forms, the heterologous polynucleotide is flanked by inverted terminal repeats (ITRs) and the polynucleotide is stably integrated into the genome of the cell. In some forms the polynucleotide further includes a coding sequence for a reporter protein.

(60) In other embodiments, an isolated cell according to this disclosure comprises one heterologous polynucleotide or at most two heterologous polynucleotides. In cases where the cell comprises two heterologous polynucleotides, the two heterologous polynucleotides preferably encode structurally identical mutant viral capsids.

(61) The cell or cell line can be a eukaryotic cell. Exemplary eukaryotic cells include mammalian cells and insect cells. Specific non-limiting examples of useful mammalian and insect cells are described below.

(62) Other embodiments are directed to a library of cells, comprising a plurality of isolated cells described herein, wherein less than 50% of the cells in the library, more preferably less than 10%, and even more preferably less than 5% of the cells in the library encode two or more different mutant viral capsid proteins per cell. In certain embodiments, at least 95% or at least 90% of the cells in the library of cells encode only one mutant viral capsid protein.

(63) Another embodiment is a method for generating a mutant viral capsid cell library, comprising (a) transfecting a plurality of eukaryotic cells with a mixture of first and second plasmids or vectors, wherein the plurality of cells comprise an integrase-specific DNA attachment site in their genome, wherein the first plasmid or vector contains an integrase-specific DNA attachment site and a coding sequence that encodes a non-naturally occurring mutant viral capsid, wherein the integrase-specific DNA attachment site in the first plasmid or vector recombines with a pseudo attP site in the cellular genome, wherein the coding sequence for the mutant viral capsid protein is operably linked to a promoter on the first plasmid or vector, wherein the second plasmid or vector encodes an integrase, which promotes recombination and thereby integration of the first plasmid or vector into the genome of the cell at a pseudo attP site, and wherein the ratio (e.g., the molar ratio) of first plasmid to second plasmid in the mixture is such that in greater than 70%, 80%, 90%, or greater than 95% of the cells in the population exposed to the mixture of plasmids or transfected by the plasmids, no more than one plasmid or vector encoding a mutant viral capsid is integrated per cell, and (b) selecting the population of cells from step (a) for expression of the first plasmid or vector, thereby generating a mutant viral capsid cell library. In some embodiments the ratio (e.g., molar ratio) of the first:second plasmids or vectors in the mixture is about 1:200, 1:100, 1:50, 1:40, 1:30, 1:25, 1:20, 1:19, 1:18, 1:17, 1:16, 1:15, 1:14, 1:13, 1:12, 1:11, 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, or 1:2. In a preferred embodiment, the molar ratio of the first:second plasmids or vectors is about 1:50.

(64) In some embodiments the ratio (e.g., molar ratio) of the plasmid encoding the mutant viral capsid plasmid to the plasmid encoding the integrase in the mixture is at least 1:10, 1:20, 1:30, 1:40, 1:50, or 1:100. In some aspects, the integrase is an exogenous or non-Rep integrase. In some aspects, the exogenous or non-Rep integrase is a phage integrase.

(65) In preferred forms of the method described above for generating a mutant viral capsid cell library, the percentage of cells in a population receiving two or more mutant viral capsid genes or coding sequences following transfection with the first and second plasmids is less than 10%. Put in other terms, the percentage of cells integrating two or more capsid genes is less than 10% and even more preferably less than about 5%.

(66) In some forms of this method greater than 35%, greater than about 40%, greater than 60%, and most preferably greater than 70% of the cells in the population (i.e., in the plurality of cells) are transfected by the first plasmid at step (a). That is, the transfection efficiency of the method is preferably at least 35%, 40%, 50%, 60%, or is at least 70%.

(67) In specific forms of the method for generating a mutant viral capsid cell library, the non-naturally occurring mutant viral capsid is a non-naturally occurring mutant AAV capsid, and the integrase-specific DNA attachment site is a C31 integrase-specific attB attachment site, the integrase of the second plasmid is C31, and the polynucleotide sequence containing the mutant cap gene is integrated into the cellular genome at a pseudo attP site in the cellular genome.

(68) In a further form, the heterologous polynucleotide is stably integrated into the cellular genome at a pseudo attP site in the cellular genome. According to preferred forms of the method, the rate or frequency of multiple (two or more) integration events per cell (i.e., the integration of two or more mutant cap genes per cell) in the population of cells or cell library is such that less than 10% of the cells, or more preferably less than 5% of the cells in the library integrate more than one mutant capsid gene per cell. In certain embodiments, at least 95% or at least 90% of the cells in the population of cells or cell library comprise only one stably integrated heterologous polynucleotide.

(69) The invention further encompasses methods for screening mutant AAV virions for at least one phenotype relative to a wild-type or naturally occurring AAV capsid. In some embodiments, the at least one phenotype is altered cell tropism, reduced neutralizing antibody binding, or both altered cell tropism and reduced neutralizing antibody binding relative to the corresponding parental or relative to a naturally occurring AAV capsid. In one embodiment, the method comprises contacting target cells or a target tissue with a mutant AAV virion library, isolating the target cells or tissue, performing reverse transcription polymerase chain reaction (RT-PCR) on RNA from the isolated target cells or tissue to convert mutant AAV capsid RNA present in the isolated cells or tissue to cDNA, and sequencing mutant capsid DNA, thereby identifying mutant AAV virions that successfully infected the target cells or cells in the target tissue. The method can optionally further comprise contacting the isolated target cells or tissue with adenovirus prior to performing RT-PCR. By target cells and tissues is meant the intended targets of a gene therapy protocol. For purposes of screening a mutant virion library in vivo, such as a mutant AAV capsid library, target cells and tissues can be tested or screened as described above to determine whether they were infected by a mutant AAV virion. Mutant virions that productively infect cells within a target tissue may be candidates for further rounds of selection and study as potential gene therapy vectors for the delivery of a therapeutic gene to target cells in need of therapy.

(70) Certain embodiments relate to isolated cells and cell lines that comprise at least one integrated, non-naturally-occurring mutant (variant) viral capsid, including viral packaging cell lines that comprise only one integrated mutant viral capsid, and libraries of the cells/cell lines. Among other advantages, such embodiments can reduce or prevent cross-packaging of different mutant viral capsids by ensuring the generation of viruses with only one type of mutant viral capsid from each cell (or cell line), and thereby optimizing the rescue of selected or desired mutants during directed evolution and screening processes.

(71) Exemplary isolated cells or cell lines comprise a heterologous polynucleotide that encodes a non-naturally-occurring mutant viral capsid which is operably linked to a promoter and is flanked by Inverted Terminal Repeats (ITRs), wherein the heterologous polynucleotide is integrated into the genome of the cell and is flanked by hybrid integrase-specific DNA attachment sites.

(72) In certain embodiments, the cell or cell line is a eukaryotic cell. Exemplary eukaryotic cells include mammalian cells and insect cells.

(73) Examples of useful mammalian cells include human embryonic kidney cell lines (HEK-293 cells, HEK-293T cells, 293 cells sub-cloned for growth in suspension culture, see, e.g., Yuan et al., Hum Gen Ther. 22:613-24, 2011; Graham et al., J. Gen Virol. 36:59 (1977)); human cervical carcinoma cells (HELA, ATCC CCL 2); monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651); baby hamster kidney cells (BHK, ATCC CCL 10); mouse sertoli cells (TM4, Mather, Biol. Reprod. 23:243-251 (1980)); monkey kidney cells (CV1 ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL-1587); canine kidney cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51); TR1 cells (Mather et al., Annals N.Y. Acad. Sci. 383:44-68 (1982)); MRC 5 cells; FS4 cells; and a human hepatoma line (Hep G2). Other useful mammalian host cell lines include Chinese hamster ovary (CHO) cells, including DHFR-CHO cells (Urlaub et al., PNAS USA 77:4216 (1980)); and myeloma cell lines such as NSO and Sp2/0. In specific embodiments, the cell is a HEK-293 cell or a derivative thereof.

(74) Examples of useful insect cell lines include SF9 cells, sf21 cells, S2 (Schneider 2) cells, BTI-TN-5B1-4 (High Five Cells), and Tni cells (see, e.g., Drugmand et al., Biotechnology Adv. 30:1140-57, 2011; and Murphy and PiwnicaWorms, Curr Protoc Protein Sci. Chapter 5: Unit 5.4, 2001). In specific embodiments, the insect cell is an SF9 cell or a derivative thereof.

(75) Non-limiting examples of useful promoters include the SV40, CMV, and elongation factor (EF)-1 promoters, among others.

(76) Non-naturally-occurring mutant (variant) viral capsids can be derived from any viral capsid. Examples include adeno-associated virus (AAV), alphavirus, adenovirus, herpes virus, and retrovirus capsids, including capsids from Moloney murine leukemia virus (M-MuLV), Moloney murine sarcoma virus (MoMSV), Harvey murine sarcoma virus (HaMuSV), murine mammary tumor virus (MuMTV), gibbon ape leukemia virus (GaLV), feline leukemia virus (FLV), spumavirus, Friend murine leukemia virus, Murine Stem Cell Virus (MSCV) and Rous Sarcoma Virus (RSV)), and lentiviruses such as HIV (human immunodeficiency virus; including HIV type 1, and HIV type 2), visna-maedi virus (VMV) virus, the caprine arthritis-encephalitis virus (CAEV), equine infectious anemia virus (EIAV), feline immunodeficiency virus (FIV), bovine immune deficiency virus (BIV), and simian immunodeficiency virus (SIV). In particular embodiments, the mutant viral capsid is a mutant AAV capsid. For AAV, the mutant or variant AAV capsid proteins may be derived from any adeno-associated virus serotype, including without limitation, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, etc. Exemplary mutant capsid proteins may be altered by the insertion, deletion or substitution of nucleotides in the VP1, VP2 or VP3 sequence(s), including combinations thereof.

(77) Mutant viral capsids and polynucleotides that encode the same can be generated by any variety of mutagenesis techniques. For example, in certain instances, any number of random mutant viral capsids can be prepared by loop insertion mutagenesis (see, e.g., Heinis and Johnsson, Methods Mol Biol. 634:217-32, 2010) and/or error prone polymerase chain reaction (PCR) (see, e.g., McCullum et al., Methods Mol Biol. 634:103-9, 2010). These can be incorporated into an appropriate vector for introduction into the cells described herein.

(78) By Inverted Terminal Repeats (ITRs) including functional AAV ITR sequences, is meant that the ITR sequences function as intended for the rescue, replication and packaging of the virion, for example, the AAV vector particle. Hence, AAV ITRs for use in the vectors of the invention need not have a wild-type nucleotide sequence, and may be altered by the insertion, deletion or substitution of nucleotides or the AAV ITRs may be derived from any of several AAV serotypes, e.g. AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10.

(79) In some embodiments, the polynucleotide encoding the mutant viral capsid (which is flanked itself by ITRs) is flanked by hybrid integrase-specific DNA attachment sites, typically two of such attachment sites, one at each of the 5 and 3 ends of the polynucleotide. A hybrid DNA attachment site or hybrid integrase-specific DNA attachment site refers to a DNA attachment that results from a recombination event between two corresponding DNA attachment sites, and which each comprise part of the two sites. Certain hybrid DNA attachment sites are irreversible and can no longer be the subject of further recombination event. Certain hybrid DNA attachment sites are reversible and can be the subject of a further recombination event. In specific embodiments, the hybrid DNA attachment sites each comprise part of an attP site and part of an attB site. Specific examples of hybrid DNA attachment sites include attR and attL.

(80) In specific embodiments, the isolated cell has only one integration event of a heterologous polynucleotide that encodes a non-naturally-occurring mutant viral capsid (e.g., a single integrated copy of a heterologous polynucleotide that encodes a single mutant viral capsid). In these and related embodiments, the isolated cell comprises or expresses a single mutant or variant viral capsid, for example, a single mutant AAV capsid.

(81) In some embodiments, the isolated cell (or cell line) comprises an exogenous or non-native reporter protein, for instance, a heterologous polynucleotide that encodes a reporter protein that is operably linked to a promoter. Such can be used to identify transfected cells, for example, cells which have been successfully transfected with the heterologous polynucleotide that encodes the mutant viral capsid. In some embodiments, the polynucleotide that encodes the reporter protein is on a separate vector or expression cassette than the polynucleotide that encodes the mutant viral capsid. In particular embodiments, the polynucleotide that encodes the reporter protein is on the same vector or expression system as the polynucleotide that encodes the mutant viral capsid. In some instances, the polynucleotide that encodes the mutant viral capsid and the polynucleotide that encodes the reporter protein are operably linked to the same promoter, and optionally separated by translational regulatory elements such as an internal ribosomal entry site (IRES). In certain instances, the polynucleotide that encodes the mutant viral capsid and the polynucleotide that encodes the reporter protein are operably linked to different promoters, which can be oriented in the same or different direction.

(82) Examples of reporter proteins (and genes) include fluorescent reporter proteins, luminescent reporter proteins, and substrate-specific reporter proteins. Specific examples include green fluorescent protein (GFP), yellow fluorescent protein (YFP), red fluorescent protein (GFP), mCherry, mRaspberry, mPlum, mTomato, dsRed, luciferase, and -galactosidase (-gal), among others.

(83) In certain embodiments, the isolated cell (or cell line) comprises an exogenous or non-native drug-resistance protein or gene, for instance, a heterologous polynucleotide that encodes a drug-resistance protein which is operably linked to a promoter. Exemplary drug-resistance proteins or genes include pac (puromycin), bsd (blasticidin), neo (G418), hygB (hygromycin B), Sh ble (zeocin), Sh bla (gentamycin). Such can be used to select for transfected cells, for example, cells which have been successfully transfected with the heterologous polynucleotide that encodes the mutant viral capsid. In some embodiments, the polynucleotide that encodes the drug-resistance protein is on a separate vector or expression cassette than the polynucleotide that encodes the mutant viral capsid. In particular embodiments, the polynucleotide that encodes the drug-resistance protein is on the same vector or expression system as the polynucleotide that encodes the mutant viral capsid. In some instances, the polynucleotide that encodes the mutant viral capsid and the polynucleotide that encodes the drug-resistance protein are operably linked to the same promoter, and optionally separated by translational regulatory elements such as an internal ribosomal entry site (IRES). In certain instances, the polynucleotide that encodes the mutant viral capsid and the polynucleotide that encodes the drug-resistance protein are operably linked to different promoters, which can be oriented in the same or different direction. Such embodiments can also be combined with reporter proteins, as described herein. For instance, where the cell comprises a polynucleotide that encodes the mutant viral capsid, the reporter protein, and the drug-resistance protein, each of which can be on the same or different vector(s), operably linked to the same or different promoter(s).

(84) Certain embodiments include libraries of at least one of the isolated cells or cell lines described herein. Included are cell libraries that comprise a plurality of isolated cells or cell lines described herein, wherein the non-naturally-occurring mutant viral capsid of each cell is distinct from the mutant viral capsid of substantially all of the other cells of the library. In some embodiments, the mutant viral capsid of each cell is distinct from the mutant viral capsid of about or at least about 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the other cells of the library. Certain libraries include at least about 2, 5, 10, 20, 50, 100, 200, 300, 400, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000, 110.sup.5, 210.sup.5, 310.sup.5, 410.sup.5, 510.sup.5, 610.sup.5, 710.sup.5, 810.sup.5, 910.sup.5, 110.sup.6, 210.sup.6, 310.sup.6, 410.sup.6, 510.sup.6, 610.sup.6, 710.sup.6, 810.sup.6, 910.sup.6, 110.sup.7, 210.sup.7, 310.sup.7, 410.sup.7, 510.sup.7, 610.sup.7, 710.sup.7, 810.sup.7, 910.sup.7, 110.sup.8, 210.sup.8, 310.sup.8, 410.sup.8, 510.sup.8, 610.sup.8, 710.sup.8, 810.sup.8, 910.sup.8, 110.sup.9 cells, wherein the mutant capsid of each cell is distinct from the mutant capsid of substantially all of the other cells of the library. In specific embodiments, the mutant viral capsid is a mutant AAV capsid.

(85) In some embodiments, substantially all of the plurality of cells in the library have only one integration event of a polynucleotide that encodes a mutant viral capsid. In particular embodiments, about or at least about 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the cells in the library have one integration event of a polynucleotide that encodes a mutant viral capsid. In specific embodiments, substantially all of the cells in the library contain a single integration event of a unique viral mutant capsid relative to the other cells in the library.

(86) Also included are mixtures of at least two of the isolated cells or cell lines described herein, for example, mixtures of at least about 2-10,000 (including all integers and ranges in between, for example, 2, 5, 10, 20, 50, 100, 200, 300, 400, 500, 1000) of the isolated cells or cell lines described herein.

(87) Certain embodiments include cell culture devices or plates, comprising an isolated cell or a mutant viral capsid cell library, as described herein. In some embodiments, each cell culture device or well therein comprises about or at least about 1, 2, 5, 10, 20, 50, 100, 200, 300, 400, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000, 110.sup.5, 210.sup.5, 310.sup.5, 410.sup.5, 510.sup.5, 610.sup.5, 710.sup.5, 810.sup.5, 910.sup.5, 110.sup.6, 210.sup.6, 310.sup.6, 410.sup.6, 510.sup.6, 610.sup.6, 710.sup.6, 810.sup.6, 910.sup.6, 110.sup.7 or more cells. Included are cell culture devices, for example, multi-well plates (e.g., microplates) that comprise about or at least about 2, 6, 12, 24, 48, 96, 192, 384, 1536 or more wells. Also included are tissue culture dishes, flasks, T-flasks, roller bottles, cell factories, and suspension cultures, for example, in 1 L and 5 L spinners, 5 L, 14 L, 40 L, 100 L and 200 L stir tank bioreactors, and 20/50 L and 100/200 L WAVE bioreactors, among others known in the art.

(88) Any of the libraries or cell culture devices/plates can be configured for high-throughput screening (HTS). The isolated cells or cell lines, including libraries and mixtures thereof, can be used in any of the methods, systems, or kits described herein.

(89) Vector Systems for the Preparation of Mutant Capsids, Cells, and Cell Libraries

(90) Certain embodiments include systems, for example, vector systems, for generating one or more cells that comprise a non-naturally-occurring mutant viral capsid, and libraries of such cells, that is, vector systems for the preparation of mutant viral capsid cell libraries.

(91) Particular examples include a system for generating a mutant viral capsid cell library, comprising a system (e.g., vector system) for inserting a plasmid into a native (i.e., endogenous) DNA attachment site in the genome of a eukaryotic cell, comprising

(92) (a) a vector encoding a mutant viral capsid which is operably linked to a promoter and flanked by Inverted Terminal Repeats (ITRs), and comprising an integrase-specific DNA attachment site which recombines with the native DNA attachment site in the genome of the cell, and

(93) (b) a vector encoding an integrase which is operably linked to a promoter, wherein the integrase promotes integration of the vector of (a) into the native DNA attachment site in the genome of the cell.

(94) These and related embodiments can be used to insert or integrate a plasmid encoding the mutant viral capsid into a native DNA attachment site in the genome of a cell of essentially any type, for example, a cell that has not been engineered to contain an integrase-specific DNA attachment site. In some instances, the vector of (a), which encodes the mutant viral capsid is titrated to minimize the occurrence of multiple integration events, and increase the probability that each transfected cell will contain only one integration event or copy of a mutant viral capsid. In specific embodiments, the mutant viral capsid is a mutant AAV capsid.

(95) In certain embodiments, the integrase is a serine recombinase, for example, the phage integrase Bxb1, the phage integrase C31, the phage integrase TP901-1, the phage integrase R4, the phage integrase FC1, the resolvase Tn3, the resolvase , or the invertase Gin. In some embodiments, the integrase is a tyrosine integrase, for example, lambda integrase, HK022 integrase, P22 integrase, HP1 integrase, L5 integrase, Cre recombinase, FLP invertase, and XerC.

(96) In particular embodiments, the native DNA attachment site is a pseudo attP site. In some embodiments, the native DNA attachment site is a pseudo attP site, the integrase-specific attachment site in the vector of (a) is C31 attB, and the integrase is C31. In certain embodiments, the native DNA attachment site is a pseudo attP site, the integrase-specific attachment site in the vector of (a) is Bxb1 attB, and the integrase is Bxb1. Certain systems further comprise a plurality of eukaryotic cells (e.g., HEK-293 cells) in which the native DNA attachment site is in the genome of the cells. In some embodiments, the vector of (a) and (b) are on the same vector (e.g., the same plasmid). In some embodiments, the vector of (a) encodes a reporter protein, as described herein and known in the art. In some instances, the polynucleotide which encodes the reporter protein is located between the ITRs, that is, it is flanked by the ITRs. In certain embodiments, the vector of (a) encodes a drug resistance gene, as described herein and known in the art. In some instances, the polynucleotide encoding the drug resistance gene is located outside of the ITRs, that is, it is not flanked by the ITRs.

(97) Also included are systems for generating a mutant viral capsid cell library, comprising

(98) (a) a system for introducing a first integrase-specific DNA attachment site into the genome of the eukaryotic cell, comprising (i) a vector comprising the first integrase-specific DNA attachment site and a second integrase-specific DNA attachment site (e.g., attB site) which recombines with a DNA attachment site in the genome of the cell (e.g., native pseudo attP site), and (ii) a vector encoding a first integrase which is operably linked to a promoter, wherein the first integrase promotes integration of the vector of (a)(i) into the genome of the cell via recombination between the second integrase-specific attachment site (e.g., attB site) and the DNA attachment site in the genome of the cell (e.g., native pseudo attP site); and

(99) (b) a system for inserting a plasmid into the first DNA attachment site in the genome of a eukaryotic cell, comprising (i) a vector encoding a mutant viral capsid which is operably linked to a promoter and flanked by Inverted Terminal Repeats (ITRs), and comprising a third integrase-specific DNA attachment site which recombines with the first integrase-specific DNA attachment site, and (ii) a vector encoding a second integrase which is operably linked to a promoter, wherein the second integrase promotes integration of the vector of (b)(i) into the first integrase-specific DNA attachment site.

(100) These and related embodiments can be used initially to engineer a desired, integrase-specific DNA attachment site into the genome of essentially any cell (e.g., using a native pseudo attP site in the cell and an attB site in the vector of (a)(i)), and after that insert the vector encoding the mutant viral capsid (which has the corresponding attachment site) into the genome of the cell at the engineered DNA attachment site. In some instances, it will be useful to ensure that only a single copy of the first integrase-specific DNA attachment site is inserted into the genome of the cell, so that only one copy of the mutant viral capsid vector will be integrated into the genome of the cell. In specific embodiments, the mutant viral capsid is a mutant AAV capsid.

(101) As noted above, illustrative examples of integrases or recombinases suitable for use in embodiments of the present disclosure include, but are not limited to, serine recombinases and tyrosine recombinases. Exemplary serine recombinases include the phage integrase Bxb1, the phage integrase C31, the phage integrase TP901-1, the phage integrase R4, the phage integrase FC1, the resolvase Tn3, the resolvase , and the invertase Gin. Exemplary tyrosine recombinases include lambda integrase, HK022 integrase, P22 integrase, HP1 integrase, L5 integrase, Cre recombinase, FLP invertase, and XerC. In specific embodiments, the integrase is a Bxb1 integrase which promotes integration of DNA into a Bxb1 attB or Bxb1 attP DNA attachment site. In particular embodiments, the integrase is a C31 integrase which promotes integration into a pseudo attP, C31 attP, or C31 attB DNA attachment site.

(102) Examples of integrase-specific DNA attachment sites include, without limitation, attB, attP, attL, and attR sequences, which are recognized by the recombinase enzyme Integrase, e.g., phi-c31. The C31 SSR mediates recombination only between the heterotypic sites attB (34 bp in length) and attP (39 bp in length) (Groth et al., 2000). attB and attP, named for the attachment sites for the phage integrase on the bacterial and phage genomes, respectively, both contain imperfect inverted repeats that are likely bound by C31 homodimers (Groth et al., 2000). The product or hybrid DNA attachment sites, attL and attR, are effectively inert to further C31-mediated recombination (Belteki et al., 2003), making the reaction irreversible. For catalyzing insertions, it has been found that attB-bearing DNA inserts into a genomic attP site more readily than an attP site into a genomic attB site (Thyagarajan et al., 2001; Belteki et al., 2003). Thus, specific strategies position by homologous recombination an attP-bearing docking site into a defined locus, which is then partnered with an attB-bearing incoming sequence for insertion.

(103) The native attB and attP recognition sites of phage C31 (bacteriophage C31) are generally about 34 to 40 nucleotides in length (see Groth et al., PNAS USA. 97:5995-6000, 2000). These sites are typically arranged as follows: AttB comprises a first DNA sequence attB5, a core region, and a second DNA sequence attB3, in the relative order from 5 to 3 attB5-core region-attB3. AttP comprises a first DNA sequence attP5, a core region, and a second DNA sequence attP3, in the relative order from 5 to 3 attP5-core region-attP3. The core region of attP and attB of C31 has the sequence 5-TTG-3. Other phage integrases (such as the Bxb1 phage integrase) and their recognition sequences can be adapted for use according to the embodiments described herein. Exemplary phage integrase-specific DNA attachment sites are provided in Table A1 below.

(104) TABLE-US-00001 TABLEA1 PhageIntegrase-SpecificDNAAttachmentSites Name Sequence C31 GTCAGAAGCGGTTTTCGGGAGTAGTGCCCC SEQID attP AACTGGGGTAACCTTTGAGTTCTCTCAGTT NO:1 GGGGGCGTAGGGTCGCCGACATGACACAAG G C31 GACGGTCTCGAAGCCGCGGTGCGGGTGCCA SEQID attB GGGCGTGCCCTTGGGCTCCCCGGGCGCGTA NO:2 CTCCACCTCACCCATCTGGTCCATCATGAT Bxb1 CGTGATGACCTGTGTCTTCGTGGTTTGTCT SEQID attP GGTCAACCACCGCGGTCTCAGTGGTGTACG NO:3 GTACAAACCCATGAGAGCCCTGGTAGTCAT Bxb1 CCGGCTTGTCGACGACGGCGGTCTCCGTCG SEQID attB TCAGGATCAT NO:4 TP901-1 AGATATCATATTTAAATTCCAACTCGCTTA SEQID attP ATTGCGAGTTTTTATTTCGTTTATTTCAAT NO:5 TAAGGTAACTAAAAAACTCCTTTTAAGGAG TP901-1 TTAAAATACTGATAATTGCCAACACAATTA SEQID attB ACATCTCAATCAAGGTAAATGCTTTTTGCT NO:6 TTTTTTGCCAAAGCTTTCTTCCGTGAATTT

(105) Thus, the vectors, cells, and systems described herein can use any one or more of the foregoing phage native or integrase-specific DNA attachment sites, arranging the combinations as is appropriate (e.g., attP site recombines with an attB site). In specific embodiments, for the system of (a) above, the first integrase-specific DNA attachment site is Bxb1 attP, the second integrase-specific attachment site is C31 attB, and the first integrase is C31. In particular embodiments, for the system of (b) above, the third DNA attachment site is Bxb1 attB, and the second integrase is Bxb1.

(106) For the tyrosine recombinases, one example of an integrase-specific DNA attachment site for Cre recombinase is loxP which is an approximately 34 base pair sequence comprising two 13 base pair inverted repeats (serving as the recombinase binding sites) flanking an 8 base pair core sequence (see, e.g., Sauer, Current Opinion in Biotechnology 5:521-527, 1994). Other exemplary loxP sites include, but are not limited to: lox511 (Hoess et al., 1996; Bethke and Sauer, 1997), lox5171 (Lee and Saito, 1998), lox2272 (Lee and Saito, 1998), m2 (Langer et al., 2002), lox71 (Albert et al., 1995), and lox66 (Albert et al., 1995). Suitable recombinase recognition sites for the FLP recombinase include, but are not limited to: FRT (McLeod, et al., 1996), F1, F2, F3 (Schlake and Bode, 1994), F4, F5 (Schlake and Bode, 1994), FRT(LE) (Senecoff et al., 1988), FRT(RE) (Senecoff et al., 1988). Thus, the vectors and systems described herein can use any one or more of the foregoing integrase-specific DNA attachment sites, arranging the combinations as is appropriate.

(107) Certain systems comprise a plurality of eukaryotic cells, which comprise a native DNA attachment site in the genome of the cell that recombines with the second integrase-specific DNA attachment site. As noted herein, examples of native DNA attachment sites include pseudo attP sites.

(108) In some systems, the vector of (a)(i) and (a)(ii) are on separate vectors. In particular instances, the vector of (b)(i) and (b)(ii) are on separate vectors. In some embodiments, the vector of (b)(i) encodes a reporter protein, as described herein and known in the art. In some instances, the polynucleotide which encodes the reporter protein is located between the ITRs, that is, it is flanked by the ITRs. In certain embodiments, the vector of (b)(i) encodes a drug resistance gene, as described herein and known in the art. In some instances, the polynucleotide encoding the drug resistance gene is located outside of the ITRs, that is, it is not flanked by the ITRs.

(109) Any convenient vector that finds use delivering polynucleotide sequences to cells is encompassed by the systems and vectors of the present disclosure. For example, the vector may comprise single or double stranded nucleic acid, e.g. single stranded or double stranded DNA. For example, the gene delivery vector may be a naked DNA, e.g. a plasmid, a minicircle, etc. As another example, the vector may be a virus, e.g., an alphavirus, an adenovirus, an adeno-associated virus, a herpes virus, a retrovirus (e.g., M-MuLV, MoMSV, HaMuSV, MuMTV, GaLV, FLV, spumavirus, Friend murine leukemia virus, MSCV, and RSV) or a lentivirus (e.g., HIV including HIV type 1 and HIV type 2, VMV, CAEV, EIAV, FIV, BIV, and SIV)). While embodiments encompassing the use of adeno-associated virus are described in greater detail herein, it is expected that the ordinarily skilled artisan will appreciate that similar knowledge and skill in the art can be brought to bear on non-AAV vectors as well. See, for example, the discussion of retroviral vectors in, e.g., U.S. Pat. Nos. 7,585,676 and 8,900,858; the discussion of lentiviral vectors in, e.g., Naldini et al., (1996a, 1996b, and 1998); Zufferey et al., (1997); Dull et al., 1998, U.S. Pat. Nos. 6,013,516; and 5,994,136; and the discussion of adenoviral vectors in, e.g. U.S. Pat. No. 7,858,367, the full disclosures of which are incorporated herein by reference.

(110) Certain embodiments include kits, which comprise any one or more of the systems (e.g., vector systems), isolated cells, cells, and/or cell libraries described herein. Some kits can optionally include instructions for using the systems to generate a mutant viral capsid cell library, as described herein. In specific embodiments, the mutant viral capsid cell library is a mutant AAV capsid cell library.

(111) Methods of Preparing and Screening Mutant Capsid Cells and Cell Libraries

(112) Certain embodiments relate to methods for generating a mutant viral capsid cell library, comprising (a) transfecting a plurality of eukaryotic cells with a first and a second vector, wherein the plurality of cells comprise an integrase-specific DNA attachment site in their genome, wherein the first vector encodes a mutant viral capsid which is operably linked to a promoter which is flanked by Inverted Terminal Repeats (ITRs) and comprises an integrase-specific DNA attachment site that recombines with the integrase-specific DNA attachment site in the cell, and wherein the second vector encodes a heterologous integrase which promotes integration at the DNA attachment site, and (b) selecting the plurality of cells for expression of the first vector, thereby generating the mutant viral capsid library. In specific embodiments, the mutant viral capsid is a mutant AAV capsid. These particular methods are useful, for example, for transfecting cells that contain the desired, integrase-specific DNA attachment site in the genome of the cells (e.g., a native pseudo attP site, or an engineered site), but which do not already express the corresponding integrase.

(113) In particular embodiments, the integrase-specific DNA attachment site in the genome of the cells is a single non-native Bxb1 attP site, the integrase is Bxb1, and the integrase-specific DNA attachment site in the vector is Bxb1 attB. In certain embodiments, the integrase-specific DNA attachment site in the genome of the cells is a single non-native C31 attP site, the integrase is C31, and the integrase-specific DNA attachment site in the vector is C31 attB. In some instances, substantially all of the selected cells have only one integration event of the vector which is at the single, non-native attP site. For example, in certain embodiments, about or at least about 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the cells have only one integration event of the vector which is at the single non-native attB or attP site.

(114) In some embodiments, the integrase-specific DNA attachment site in the genome of the cell is a native pseudo attP site, the integrase is Bxb1, and the integrase-specific DNA attachment site in the vector is Bxb1 attB. In particular embodiments, the integrase-specific DNA attachment site in the genome of the cell is a native pseudo attP site, the integrase is C31, and the integrase-specific DNA attachment site in the vector is C31 attB. In certain instances, substantially all of the selected cells have only one integration event of the vector at a pseudo native attP site. For example, in certain embodiments, about or at least about 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the cells have only one integration event of the vector which is a pseudo native attP site. Certain of these and related methods include transfecting a titrated amount of the vector that encodes the mutant viral capsid to increase the probability that only one integration event will occur in substantially all of the selected cells. As one example, certain embodiments include the transfection of the first (mutant viral capsid) and second (integrase) vectors, where the ratio (e.g., molar ratio) of the first:second vectors can be about 1:50, 1:40, 1:30, 1:25, 1:20, 1:19, 1:18, 1:17, 1:16, 1:15, 1:14, 1:13, 1:12, 1:11, 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, or 1:2, in specific instances about 1:10.

(115) According to some embodiments, following transfection with first and second vectors, less than 10% and more preferably less than 5% of the cells comprise two or more vectors encoding a mutant viral capsid. The ratio of first:second vectors is titrated such that preferably less than 10%, and more preferably less than about 5% of the cells from step (a) undergo two or more integration events.

(116) In some embodiments, the vector that encodes the mutant viral capsid further encodes a reporter protein, as described herein. In specific instances, the reporter protein is a green fluorescent protein (GFP).

(117) In specific embodiments, the mutant viral capsid is a mutant AAV capsid. In these and related embodiments, certain methods comprise transfecting the mutant AAV capsid cell library with an AAV rep-expressing polynucleotide that encodes one or more of Rep78, Rep68, Rep52, and/or Rep40, and/or an AAV helper vector or plasmid, and incubating the cell library for a time sufficient to produce virions, e.g., AAV virions, which comprise the mutant capsid. Some methods comprise contacting the cells with a helper virus encoding a rep protein, and incubating the cell library for a time sufficient to produce virions that comprise the mutant AAV capsid. Exemplary helper viruses include adenovirus, retroviruses, and herpes virus.

(118) Virions, e.g., AAV or other virions comprising a mutant capsid, can be produced using standard methodology. For example, in the case of AAV virions or AAV virus particles, an AAV helper construct may be introduced into the mutant viral capsid-containing cells or cell libraries, where the helper construct includes AAV coding regions capable of being expressed in the producer cell and which complement AAV helper functions absent in the AAV vector. This is followed by introduction of helper virus and/or additional vectors into the producer cell, wherein the helper virus and/or additional vectors provide accessory functions capable of supporting efficient AAV virion production. The producer cells are then cultured to produce AAV. These steps are carried out using standard methodology. Replication-defective AAV virions encapsulating the recombinant AAV vectors of the instant invention are made by standard techniques known in the art using AAV packaging cells and packaging technology. Examples of these methods may be found, for example, in U.S. Pat. Nos. 5,436,146; 5,753,500, 6,040,183, 6,093,570 and 6,548,286, expressly incorporated by reference herein in their entirety. Further compositions and methods for packaging are described in Wang et al. (US 2002/0168342), also incorporated by reference herein in its entirety.

(119) In the case of other virions, as noted above, the mutant viral capsid-containing cells or cell libraries may be contacted with a helper virus that comprises or encodes the necessary rep protein(s). Examples of such helper viruses include adenovirus and herpes virus. The virions, e.g., AAV virions, that comprise the mutant viral capsid can be collected and optionally purified and formulated according to techniques in the art (see, e.g., the Examples).

(120) When generating a library of variant AAV virions for in vivo or in vitro screening, it is important to avoid, or at the very least minimize, the occurrence of cross packaging. An advantage of the present invention is the prevention or minimization of cross packaging. Cross packaging occurs when the polynucleotide sequence encoding one mutant is packaged by the capsid proteins of another mutant. Cross packaging makes it difficult if not impossible to trace the properties of the capsid (e.g., tropism, antibody reactivity, heparan sulfate binding, etc.) to the sequence encoding the capsid, resulting both in the identification of a false-positive mutant capsid (that does not embody the preferred tropism properties) and the loss of the actual mCap cDNA encoding the mutant capsid with the preferred tropism properties.

(121) Without wishing to be bound by any theory, it is believed that the probability that the genome of one variant will be packaged or encapsidated by the capsid proteins of a different AAV genome increases with the number of capsid genes per cell. When multiple variant AAV genomes are present in the same cell, the translation and replication of each genome may give rise to a complex mixture of viral DNA, VP1, VP2, and VP3 capsid proteins. Under these conditions, AAV genomes may be incorrectly encapsidated by the capsid proteins of another genome and capsid proteins derived from two or possibly even three different genomes may assemble to form hybrid capsids that, ultimately, cannot be linked to any particular genome or group of genes. For these reasons, it was important to develop a method that favors a single integration event of just one capsid gene per cell.

(122) Certain embodiments include screening the virions, e.g., AAV virions, for at least one phenotype. In some embodiments, the virions are screened for at least one phenotype relative to a corresponding, wild-type AAV capsid, for example, a virion that comprises a corresponding, wild-type AAV capsid. Typically, the at least one phenotype will relate to the properties of the AAV capsid, including, for example, altered cell tropism, reduced neutralizing antibody binding, or both.

(123) Certain embodiments include screening mutant viral capsids for altered cell tropism, for instance, by screening the virions produced by a mutant viral capsid cell library for the ability to infect a given target cell, and thereby identifying a mutant viral capsid of interest. For example, see FIG. 1B. Thus, certain embodiments include screening the virions (e.g., w/mutant AAV capsids) for altered cell tropism, for example, relative to virion that comprises a corresponding, wild-type AAV capsid. In certain embodiments, a mutant viral capsid of interest has increased cell tropism towards a target cell, for example, relative to a corresponding wild-type capsid (e.g., AAV). In some embodiments, a mutant viral capsid of interest has reduced cell tropism towards a target cell, relative to a corresponding wild-type capsid (e.g., AAV). These and related embodiments include infecting target cells with the virions (e.g., w/mutant AAV capsids) under suitable conditions. In some instances, the virions comprise a reporter gene (or encode a reporter gene), and the methods optionally include isolating infected cells based on expression of the reporter protein. For fluorescent reporter proteins such as GFP, infected cells can be isolated according to any variety of techniques, including cell sorting by FACS (Fluorescence-activated cell sorting) or flow cytometry. In some instances, infected cells can be isolated without cell sorting, for example, by processing the population of infected cells (in whole or in part) directly from tissue culture or by excising and processing a tissue of choice (e.g., for screens/infections performed in vivo). In these and related embodiments, assays such as RT-PCR can be performed to identify the mutant capsids of interest.

(124) Exemplary target cells for screening for altered cell tropism include ocular cells such as photoreceptor cells (cone cells, rod cells), retinal pigment epithelium cells, bipolar cells, ganglion cells, horizontal cells, amacrine cells, Muller glial cells and corneal epithelial cells, lung cells (e.g., alveolar type I epithelial cells or pneumocytes, alveolar type II cells or pneumocytes, capillary endothelial cells, alveolar macrophages) liver cells (e.g., hepatocytes, sinusoidal endothelial cells, phagocytic Kupffer cells, hepatic stellate cells, intrahepatic lymphocytes), cardiac cells (e.g., atrial and ventricular cardiomyocytes, cardiac fibroblasts, endothelial cells, cardiac smooth muscle cells, cardiac pacemaker cells, Purkinje fibers), brain cells, peripheral nerve cells (neurons, Schwann cells), central nervous system and brain cells (neurons, glial cells including astrocytes, oligodendrocytes, and microglia), cells of the musculoskeletal system (e.g., myocytes, smooth muscle cells, chondrocytes, osteoclasts, osteoblasts), cells of the gastrointestinal system (e.g., enterocytes, Goblet cells, enteroendocrine cells, Paneth cells), pancreatic cells (e.g., alpha cells, beta cells, delta cells, (gamma) cells), skin cells (e.g., keratinocytes, melanocytes, Merkel cells, Langerhans cells). Additional examples of target cells include immune cells and vascular cells. Immune cells include, for example, granulocytes such as neutrophils, eosinophils and basophils, macrophages/monocytes, lymphocytes such as B-cells, killer T-cells (i.e., CD8+ T-cells), helper T-cells (i.e., CD4+ T-cells, including Th1 and Th2 cells), natural killer cells, T-cells, dendritic cells, and mast cells. Examples of vascular cells include smooth muscle cells, endothelial cells, and fibroblasts. In specific embodiments, the target cells are retinal cells, and the altered cell tropism comprises increased cell tropism to or infectivity of retinal cells.

(125) In some embodiments, the at least one phenotype is reduced neutralizing antibody binding (see, e.g., Rapti et al., Molecular Ther. 20:73-83, 2010; and Calcedoa et al., The Journal of Infectious Diseases. 199:381-390, 2009). In this regard, the presence of neutralizing antibodies to AAV as a result of previous exposure can significantly limit effective gene transfer using AAV vectors. Certain embodiments therefore include screening mutant viral capsids for reduced neutralizing antibody binding, for instance, by testing the vector particles produced by a mutant viral capsid library for the ability to infect a given target cell in the presence of neutralizing antibodies. Certain of these and related embodiments include infecting target cells with the virions (e.g., w/mutant AAV capsids) in the presence of neutralizing antibodies (e.g., sera from subjects previously exposed to AAV), and identifying a mutant viral capsid of interest. In certain embodiments, the virion(s) comprising the mutant viral capsid of interest show infectivity towards the target cell in the presence of neutralizing antibodies. In certain embodiments, the virion(s) comprising the mutant viral capsid of interest show increased infectivity towards the target cell in the presence of neutralizing antibodies, relative to a corresponding wild-type capsid (e.g., AAV capsid). In particular embodiments, the increased infectivity is statistically significant, as described herein and known in the art.

(126) Certain methods include performing reverse transcription polymerase chain reaction (RT-PCR) on RNA from the infected, isolated cells or virions (e.g., w/mutant AAV capsids) to identify and sequence a mutant AAV capsid of interest. This approach can provide advantages relative to the sequence of genomic DNA, because the latter can sometimes contain, for example, non-expressed or inactive capsid sequences that differ from the active capsid sequence of interest, and which can confound efforts to identify and confirm the sequence of the mutant capsid of interest.

(127) For example, in relation to studies intended to screen for mutant AAV virions that might have applications for treatment of retinal diseases, it may be desirable to identify a viral vector that can deliver a therapeutic gene to the back of the eye upon administration to the vitreous body in the front of the eye. However, while some AAV particles may cross from the vitreous to the retina, they may not infect or transduce retinal cells. When extracting retinal cell tissue for analysis, these non-infectious AAV particles can contaminate the PCR sample and may contribute to the signal that is attributed to infectious particles. The present method and system uses RT-PCR to specifically amplify AAV mRNA only, which detects only those genomes that have successfully infected cells and avoids false-positive signals due to AAV DNA carried by non-infectious virions located in the extracellular matrix or on the cell surface only.

(128) Also included are steps for increasing the quantity of mutant AAV capsid RNA in an infected target cell. Such steps can be performed prior to and in addition to RT-PCR. In some instances, increasing the quantity of mutant AAV capsid RNA in an infected target cell comprises transducing isolated target cells with an adenovirus or a herpes simplex virus (e.g., HSV-1) prior to performing RT-PCR. In some embodiments the adenovirus is Ad5. Such procedures for transducing cells or tissues with an adenovirus or HSV-1 can, for example, be performed on target cells and tissues after removing the target cells or tissue from the mammalian subject to which a mutant AAV virion library was administered. The transduction step can then be followed by the step of performing RT-PCR on RNA from the target cells or tissue.

(129) Accordingly, the present invention further includes pharmaceutical compositions comprising a plurality of mutant virions of this disclosure, or more specifically mutant AAV virions, and a pharmaceutically acceptable carrier. Non-limiting examples of such carriers include water, physiological saline, and phosphate buffered saline (PBS). In some cases, the carrier is sterile and is fluid to the extent that easy syringability exists. By pharmaceutically acceptable carrier is meant a material that may be administered to a subject with little or no harmful effects.

(130) Non-limiting illustrative examples of a mammalian subject include a non-human primate (e.g., a monkey), horse, pig, dog, mouse, rabbit, gerbil, or rat.

(131) The mutant virions may be administered to the subject using any suitable means. The route of administration may depend on the target cells or tissue of interest. For example, mutant virions may be administered systemically. Specific routes of administration may include, but are not limited to, intravenous, intra-arterial, intramuscular, intraperitoneal, retro-orbital, intraocular, intravitreal, or sub-retinal administration. Other routes may comprise administration to the central nervous system. Among the many variations contemplated, a library of mutant virions, such as a library of mutant AAV virions, may be administered as a single dose or in separate pharmaceutical compositions simultaneously or sequentially.

(132) The dosage of a mutant viral library administered to a test animal or mammalian subject for screening purposes may vary and may depend on a number of factors, such as route or mode of administration and body weight. For example, for delivery to large organs (e.g., liver, muscle, heart and lung) a preferred dosage may be about 510.sup.10 to 110.sup.13 AAV genomes per 1 kg of body weight. For delivery to the eye, it may be desirable to administer from about 110.sup.9 to 510.sup.12 vector genomes. Adjustments in dosage may be necessary to guard against possible side effects. In some embodiments, a sample of the variant viral library may be in a volume of about 0.1 mL to about 100 mL of solution containing from about 110.sup.9 to 110.sup.16 genomes virus vector.

(133) In certain instances, the methods provided herein can include additional rounds of selection and screening. For example, a mutant viral capsid that is identified during one round of selection and screening as having one or more desirable properties (e.g., altered tropism, reduced neutralizing antibody binding) can be subject to another round of mutagenesis to generate a library of polynucleotides and cells that comprise additional viral capsid mutants. These can then be screened for the desired phenotypes. Such can be repeated, for example, one, two, three or more times, until the desired mutant viral capsid is obtained.

(134) Accordingly, additional embodiments include compositions comprising an isolated mutant virus, or viral variant, or plurality of isolated viral variants, and a suitable diluent or carrier, wherein the viral variant or plurality of viral variants comprise(s) a capsid(s) having one or more amino acid substitutions, insertions, or deletions relative to a corresponding parental viral capsid, and wherein the viral variant or plurality of viral variants has/have been produced from a cell library and identified and isolated by any one of the screening methods described herein. In some aspects, the viral variant is an AAV variant, and the plurality of viral variants are AAV variants. Suitable diluents include sterile, buffered, isotonic, aqueous liquids, or gels, solids, or semi-solids that preserve the activity of the virus and that can be administered to cells, tissues, or a mammalian subject with little or no toxicity.

(135) Another embodiment is a mutant AAV virion or capsid identified by any of the methods described herein. Such methods can, for example, comprise the step of performing RT-PCR on RNA from an infected cell or target tissue to identify and sequence a mutant AAV capsid of interest, and may optionally further include the step of transducing the infected cell or target tissue with an adenovirus. According to one embodiment, transducing the infected cell or target tissue with an adenovirus is performed before performing RT-PCR.

(136) Additionally, a cell library of the present invention allows for scalable production of a plurality of AAV virions having one or more mutations in their capsid protein. Because the coding sequence encoding the mutant capsid is stably integrated into the cellular genome and is not merely transiently transfected, a cell library of this disclosure can in theory be expanded by growth and passaging in culture to increase the number of cells, and therefore the number of mutant virus-encoding units in the library. The scalability of the present methods is expected to be of practical benefit for some directed evolution protocols, particularly those involving systemic administration, which may require significant quantities of virus to effectively identify mutant virions with a tropism toward large organs (e.g., heart, liver, lungs, kidney and the like).

EXAMPLES

(137) The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g. amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Centigrade, and pressure is at or near atmospheric.

(138) General methods in molecular and cellular biochemistry can be found in such standard textbooks as Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., Harbor Laboratory Press 2001); Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al. eds., John Wiley & Sons 1999); Protein Methods (Bollag et al., John Wiley & Sons 1996); Nonviral Vectors for Gene Therapy (Wagner et al. eds., Academic Press 1999); Viral Vectors (Kaplift & Loewy eds., Academic Press 1995); Immunology Methods Manual (I. Lefkovits ed., Academic Press 1997); and Cell and Tissue Culture: Laboratory Procedures in Biotechnology (Doyle & Griffiths, John Wiley & Sons 1998), the disclosures of which are incorporated herein by reference. Reagents, cloning vectors, and kits for genetic manipulation referred to in this disclosure are available from commercial vendors such as BioRad, Stratagene, Invitrogen, Sigma-Aldrich, and Clontech.

Example 1

Generating a Packaging Cell Library

(139) A packaging cell library was generated using a two-plasmid transfection approach. One plasmid encoded C31 integrase and the other contained an attB attachment site and a polynucleotide expression cassette encoding the mutant AAV capsid (mCap) to be integrated (FIG. 1A). Phage integrase, C31, is believed to be well tolerated by mammalian cells and integrates specifically at pseudo attP sites naturally present in the cellular genome (Calos, MP (2006) The C31 Integrase System for Gene Therapy Curr. Gene Ther. 6(6):633-645; Chalberg et al. (2005) C31 Integrase Confers Genomic Integration and Long-Term Transgene Expression in Rat Retina Investigative Ophthalmology & Visual Science 46 (6):2140-2146). In the plasmid containing the mCap cDNA, the mCap cDNA was operably linked to a CMV promoter and the expression cassette was flanked by ITRs. The cassette also contained a sequence encoding green fluorescent protein (GFP) operably linked to a separate promoter (e.g., SV40) to help identify and sort transfected and infected cells in later steps.

(140) To generate a mutant AAV capsid cell library, HEK-293 (293) cells were split and seeded the day before transfection and incubated at 37 C. in a CO.sub.2 incubator. Co-transfection was performed with a first plasmid that encoded the C31 integrase and a second plasmid that encoded mutagenized AAV capsid cDNA linked to a strong CMV promoter and a GFP transgene linked to the SV40 promoter. The latter cassette was flanked between two AAV ITRs, and the backbone of the cassette contained an attB site for recombination and integration of the plasmid into pseudo attP sites in the cell genome. Also included was a neomycin resistance gene to allow for drug selection of cells expressing the second plasmid.

(141) The co-transfection was performed at an approximately 50:1 ratio of the C31 plasmid and the mutant AAV capsid plasmid. LIPOFECTAMINE 3000 reagent was used to transfect the HEK293 cells.

(142) After adding the transfection mix, cells were incubated for 24 hours and then split onto new plates and incubated at 37 C. in the CO.sub.2 incubator for an additional 24 hours. The cells were then placed under G418 selection for 2 weeks. After colony formation, the cells were trypsinized, and pooled. This is the cell library.

(143) To generate virions for screening, the cell library was plated such that the cells are at 85-90% confluency after 3 days. On day 3 after plating, the cell library was co-transfected with Ad-helper plasmid and Rep2-expressing plasmid. After about five days, the cells were harvested and lysed to isolate the virions that comprise the viral mutant capsids, which were purified by iodiaxonal gradient, formulated, and then used for screening.

Example 2

Controlling Integration Frequency

(144) When generating a library of variant AAV virions for in vivo or in vitro screening, it is important to avoid, or at the very least minimize, the occurrence of cross packaging. Cross packaging occurs when the polynucleotide sequence encoding one mutant is packaged by the capsid proteins of another mutant. Cross packaging makes it difficult if not impossible to trace the properties of the capsid (e.g., tropism, antibody reactivity, heparin sulfate binding, etc.) to the sequence encoding the capsid, resulting both in the identification of a false-positive mutant capsid (that does not embody the preferred tropism properties) and the loss of the actual mCap cDNA encoding the mutant capsid with the preferred tropism properties.

(145) For these reasons, it was important to develop a method that favors a single integration event of just one capsid gene per cell. We investigated how integration frequency may depend on the ratio of integrase-encoding plasmid to mutant capsid-encoding plasmid carrying the attB site. Cells were transfected with first and second donor plasmids together with a third plasmid encoding C31 integrase. The first donor plasmid contained an expression cassette encoding red fluorescent protein (RFP), while the second donor plasmid contained an expression cassette encoding green fluorescent protein (GFP). Each of the donor plasmids contained an attB DNA attachment site for integration into the genome and a neomycin resistance gene for drug selection.

(146) HEK 293 cells were transfected with a mixture of first, second, and third plasmids at a donor plasmid (equal parts RFP and GFP plasmids) to integrase-encoding plasmid ratio of 1:1, 1:10, 1:50, 1:100, and 1:200, using FuGENE 6 transfection reagent. After selection with G418, red (cells containing RFP) and green (cells containing GFP) colonies were counted along with colonies expressing both RFP and GFP. Colonies that emitted red only or green only were counted as single integrants, and colonies that emitted both red and green fluorescence were counted as double integrants. The percentage of red-only and green-only colonies that might possibly have contained some cells having two or more copies of the RFP or GFP gene, respectively, was estimated to be roughly equivalent to the percentage of colonies exhibiting both red and green fluorescence and was accounted for as part of the analysis.

(147) As shown in FIG. 2, the number of double integrants, expressed as a percentage of the total number of colonies counted, generally decreased as the amount of donor plasmid relative to integrase-encoding plasmid was decreased from a donor:integrase plasmid ratio of 1:1 to 1:200. A 1:50 ratio of donor to integrase plasmid was deemed optimal because it maintained the highest amount of donor plasmid integration, which can be an important factor for achieving high diversity during the generation of a mutant viral capsid library, and because it resulted in a low (less than about 10%) double integration rate.

Example 3

Screening AAV Variants In Vivo

(148) It was of interest to ascertain whether we are able to identify virions with altered tropism and/or other beneficial properties from performing a screen using a library of mutant AAV virions produced in accordance with this disclosure. Without limitation, a mutant AAV virion may, for example, exhibit one or more of the following properties: 1) increased heparan sulfate binding affinity relative to wild-type AAV; 2) decreased heparan sulfate binding affinity relative to wild-type AAV; 3) increased infectivity of a cell that is resistant to infection with AAV, or that is less permissive to infection with AAV than a prototypical permissive cell; 4) increased evasion of neutralizing antibodies; 5) increased ability to cross an endothelial cell layer (see, for example, U.S. Pat. No. 9,233,131); and 6) increased ability to cross the inner limiting membrane (ILM).

(149) To further investigate the properties of one mutant AAV capsid library, a library of variant AAV virions was screened in vivo for the ability to pass through the inner limiting membrane (ILM) and infect retinal cells in non-human primate eyes. Generally, naturally occurring serotypes of AAV cannot effectively transduce photoreceptor cells in the back of the eye when the viruses are administered via intravitreal injection in the eye because they are unable to cross through the inner limiting membrane (ILM) (Dalkara et al. (2013) In VivoDirected Evolution of a New Adeno-Associated Virus for Therapeutic Outer Retinal Gene Delivery from the Vitreous Sci. Transl. Med. 5: 189ra76).

(150) A sample of a mutant AAV capsid library produced according to the method generally depicted in FIG. 1A and containing mutant AAV virions with a random peptide insertion in a surface exposed region of the capsid, was injected intravitreally into the eyes of African Green monkeys. Six weeks post injection, the animals were sacrificed and retinal tissue explants from each animal were isolated and separately transduced with Ad5 virus (MOI of 1000). The Ad5 virus increases production of mutant AAV RNA that encodes for mCap in those target cells that were infected in the animal with the mutant AAV, thereby increasing the quantity of mutant capsid RNA in infected cells for subsequent detection by RT-PCR. After transduction with Ad5 and further incubation, retinal tissue punches were collected from each explant. RNA was then extracted from each of the tissue punches and converted to cDNA by RT-PCR followed by one round of PCR. These products were then cloned back into plasmids and sequenced to determine the sequences of mutant AAV capsids that were able to successfully cross the ILM and infect retinal cells in the monkey eye.

(151) All of the above U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent applications and non-patent publications referred to in this specification and/or listed in the Application Data Sheet, are incorporated herein by reference, in their entirety.

(152) The preceding merely illustrates the principles of the invention. It will be appreciated that those skilled in the art will be able to devise various arrangements which, although not explicitly described or shown herein, embody the principles of the invention and are included within its spirit and scope. Furthermore, all examples and conditional language recited herein are principally intended to aid the reader in understanding the principles of the invention and the concepts contributed by the inventors to furthering the art, and are to be construed as being without limitation to such specifically recited examples and conditions. Moreover, all statements herein reciting principles, aspects, and embodiments of the invention as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Additionally, it is intended that such equivalents include both currently known equivalents and equivalents developed in the future, i.e., any elements developed that perform the same function, regardless of structure. The scope of the present invention, therefore, is not intended to be limited to the exemplary embodiments shown and described herein. Rather, the scope and spirit of the present invention is embodied by the appended claims.

(153) In general, in the following claims, the terms used should not be construed to limit the claims to the specific embodiments disclosed in the specification and the claims, but should be construed to include all possible embodiments along with the full scope of equivalents to which such claims are entitled. Accordingly, the claims are not limited by the disclosure.