Promoter and use thereof

Abstract

The present invention relates to a novel promoter, a vector comprising the promoter, a microorganism comprising the promoter or the vector, and a method for producing a target product using the microorganism.

Claims

1. A nucleic acid molecule having a promoter activity consisting of any one of the nucleotide sequence selected from the group consisting of SEQ ID NOS: 1 to 3.

2. A gene expression cassette comprising the nucleic acid molecule of claim 1 and a target gene.

3. A recombinant vector comprising the nucleic acid molecule of claim 1.

4. A recombinant microorganism of the genus Corynebacterium comprising the nucleic acid molecule of claim 1.

5. The recombinant microorganism according to claim 4, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum or Corynebacterium ammoniagenesis.

6. A method of producing a target product, comprising: (a) culturing the recombinant microorganism of claim 4 in a medium; and (b) recovering a target product from the microorganism or the medium.

7. The method according to claim 6, wherein the target product is psicose, tagatose, or an amino acid.

8. A recombinant vector comprising the gene expression cassette of claim 2.

9. A recombinant microorganism of the genus Corynebacterium comprising the recombinant vector of claim 3.

10. A recombinant microorganism of the genus Corynebacterium comprising the recombinant vector of claim 8.

11. The recombinant microorganism according to claim 9, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum or Corynebacterium ammoniagenesis.

12. The recombinant microorganism according to claim 10, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum or Corynebacterium ammoniagenesis.

13. A method of producing a target product, comprising: (a) culturing the recombinant microorganism of claim 9 in a medium; and (b) recovering a target product from the microorganism or the medium.

14. A method of producing a target product, comprising: (a) culturing the recombinant microorganism of claim 10 in a medium; and (b) recovering a target product from the microorganism or the medium.

15. The method according to claim 13, wherein the target product is psicose, tagatose, or an amino acid.

16. The method according to claim 14, wherein the target product is psicose, tagatose, or an amino acid.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIGS. 1A-1B shows the results of GFP assay illustrating the measured strength of novel promoters. FIG. 1(A) shows the results of GFP assay of novel promoters based on Corynebacterium glutamicum ATCC13032, and FIG. 1(B) shows the results of GFP assay of novel promoters based on Corynebacterium glutamicum ATC13869.

(2) FIGS. 2A-2C shows the results of HPLC confirming the production of psicose. FIG. 2(A) shows the result of the reaction with fructose as a substrate using Corynebacterium glutamicum ATCC13032/CJ4-ATPE-2, FIG. 2(B) shows the result of the reaction with fructose as a substrate using Corynebacterium glutamicum ATCC3032/SPL1-ATPE-2, and FIG. 2(C) shows the result of the reaction with fructose as a substrate using Corynebacterium glutamicum ATCC13032/SPL7-ATPE-2.

(3) FIGS. 3A-3B shows the results of HPLC confirming the production of tagatose. FIG. 3(A) shows the result of the reaction with fructose as a substrate using Corynebacterium glutamicum ATCC13032/CJ4-7N(m) and FIG. 3(B) shows the result of the reaction with fructose as a substrate using ATCC13032/SPL13-TN(m).

DETAILED DESCRIPTION OF THE INVENTION

(4) Hereinafter, the present disclosure will be described in more detail with reference to the following Examples, etc., to help the understanding of the present disclosure. However, these Examples can be modified in various other forms and the scope of the present disclosure should not be interpreted to be limited by these Examples. The Examples of the present disclosure are provided for the purpose of a full-depth explanation to those who have an average knowledge in the art.

Example 1: Confirmation of Target Gene Expression Induced by a Novel Promoter

(5) 1-1. Preparation of Recombinant Vectors Containing Novel Promoter Sequences

(6) For the synthesis of a novel promoter capable of inducing the expression of a target gene, various promoter sequences derived from a microorganism of the genus Corynebacterium and a microorganism of the genus Escherichia were analyzed. Promoters having the nucleotide sequences represented by SEQ ID NOS: 1, 2, and 3 were synthesized and named as SPL1, SPL7, and SPL13, respectively.

(7) Based on SPL1, SPL7, and SPL13 promoters prepared by synthesis as templates, PCR was performed using the primers of SEQ ID NO: 4 and SEQ ID NO: 5 which include KpnI/EcoRV restriction sites [Sambrook et al, Molecular Cloning, a Laboratory Manual (1989), Cold Spring Harbor Laboratories]. PCR was performed under the following conditions: denaturation at 94 C. for 5 min; 30 cycles of denaturation at 94 C. for 30 sec, annealing at 60 C. for 30 sec, and extension at 72 C. for 30 sec; and extension at 72 C. for 7 min. As a result, SPL1, SPL7, and SPL13 at a size of about 300 bp were obtained.

(8) The Open Reading Frame (ORF) of the GFP gene was obtained by performing PCR using the pGFPuv vector (Clontech, USA) as a template along with the primers of SEQ ID NO: 6 and SEQ ID NO: 7 which include PstI/EcoRV restriction sites. PCR was performed under the following conditions: denaturation at 94 C. for 5 min; 30 cycles of denaturation at 94 C. for 30 sec, annealing at 55 C. for 30 sec, and extension at 72 C. for 1 min; and extension at 72 C. for 7 min. As a result, the GFP gene fragment (SEQ ID NO: 25) of about 716 bp was obtained.

(9) In the PstI and KpnI restriction sites of a shuttle vector pECCG117 (Biotechnology letters, vol 13, No. 10, p. 721-726 (1991), (Korean Patent No. 10-1992-0007401)) which can be expressed in E. coli and Coryne-form microorganism, each of SPL1. SPL7, and SPL13, which was treated with restriction enzymes KpnI and EcoRV, and the ORF of the GFP gene which was treated with PstI and EcoRV were operably linked to each other using a DNA ligase, and thereby recombinant vectors, in which each of SPL1, SPL7, and SPL13 is linked to GFP, were prepared and they were named as pSPL1-GFP, pSPL7-GFP, and pSPL13-GFP, respectively.

(10) 1-2. Preparation of Transformed Strains

(11) The vector pECCG117, the recombinant vectors (pSPL1-GFP, pSPL7-GFP, and pSPL13-GFP) prepared above, and p117-CJ4-GFP, which includes a previously-disclosed promoter pcj4 (Korean Patent No. 10-0620092), were transformed into Corynebacterium glutamicum ATCC13032 and Corynebacterium glutamicum ATCC13869 by electric pulse method (Appl. Microbiol. Biotechnol. (1999) 52: 541-545), respectively, and the transformed strains were obtained in Luria-Bertani (LB) agar plate containing kanamycin (25 mg/L). The strains obtained based on ATCC13032 were named as Corynebacterium glutamicum ATCC13032/pECCG117, Corynebacterium glutamicum ATCC13032 SPL1-GFP, Corynebacterium glutamicum ATCC13032/SPL7-GFP, Corynebacterium glutamicum ATCC13032/SPL13-GFP, and Corynebacterium glutamicum ATCC13032/CJ4-GFP, respectively. Additionally, the strains obtained based on ATCC13869 were named as Corynebacterium glutamicum ATCC13869/pECCG117, Corynebacterium glutamicum ATCC13869/SPL1-GFP, Corynebacterium glutamicum ATCC13869/SPL7-GFP, Corynebacterium glutamicum ATCC13869/SPL13-GFP, and Corynebacterium glutamicum ATCC13869/CJ4-GFP, respectively.

(12) The 6 kinds of strains obtained by transformation above, i.e., ATCC13032/SPL7-GFP, ATCC13032/SPL13-GFP, ATCC13032 SPL1-GFP, ATCC13869/SPL7-GFP, ATCC13869/SPL13-GFP, and ATCC13869/SPL1-GFP, were named as CA01-2301, CA01-2302, CA01-2303, CA01-2304, CA01-2305, and CA01-2306, respectively, and then deposited in the Korean Culture Center of Microorganisms (KCCM), an international depositary authority under the Budapest Treaty, on Feb. 17, 2017, with the accession numbers KCCM11971P, KCCM11972P, KCCM11973P, KCCM11974P, KCCM11975P and KCCM11976P.

(13) 1-3. Confirmation of Activities of Novel Promoters

(14) For the confirmation of the activities of SPL1, SPL7, and SPL13 promoters, the transformed strains obtained in Example 1-2 (i.e., Corynebacterium glutamicum ATCC13032/pECCG117, Corynebacterium glutamicum ATCC13032/CJ4-GFP, Corynebacterium glutamicum ATCC13032/SPL1-GFP, Corynebacterium glutamicum ATCC13032/SPL7-GFP, Corynebacterium glutamicum ATCC13032/SPL13-GFP, Corynebacterium glutamicum ATCC13869/pECCG117, Corynebacterium glutamicum ATCC3869/CJ4-GFP, Corynebacterium glutamicum ATCC13869/SPL1-GFP, Corynebacterium glutamicum ATCC13869/SPL7-GFP, and Corynebacterium glutamicum ATCC13869/SPL13-GFP) were cultured by the method described below and their GFP activities were measured.

(15) The transformed strains were inoculated into each flask containing 25 mL of a culture medium (glucose (20 g), ammonium sulfate ((NH.sub.4).sub.2SO.sub.4) (5 g), yeast extract (5 g), urea (1.5 g), KH.sub.2PO.sub.4 (4 g), K.sub.2HPO.sub.4 (8 g). MgSO.sub.4.7H.sub.2O (0.5 g), biotin (150 g), thiamine HCl salt (1.5 mg), calcium-pantothenic acid (3 mg), and nicotinamide (3 mg) (based on 1 L of distilled water), pH 7.2) and cultured in a shaking incubator at 30 C. for 20 hours. The bacterial cells were recovered by centrifugation (5,000 rpm, 15 min), washed twice with 50 mM Tris-HCl (pH 8.0) buffer, and suspended in the same buffer. Glass beads were added to the suspension (1.25 g/1.5 mL), and the bacterial cells were disrupted using a bead beater for 6 minutes. Then, the resultant was subjected to centrifugation, (15,000 rpm, 20 minutes) the supernatant was recovered therefrom, and the concentrations of proteins were quantitated by the Bradford method. For an equal amount of bacterial cells extracts, the excited light was irradiated at 488 nm according to a method introduced by Laure Gory et al. (FEMS Microbiology Letters, 194, 127-133, 2001), and the emitted light at 511 nm was measured using the LS-50B spectrophotometer (Perkin-Elmer), and thereby the expression level of the GFP gene was measured (Table 1).

(16) TABLE-US-00001 TABLE 1 Strains Fluorescence Sensitivity ATCC13032/pECCG117 0.0 ATCC13032/CJ4-GFP 850.2 ATCC13032/SPL1-GFP 3197.4 ATCC13032/SPL7-GFP 3097.7 ATCC13032/SPL13-GFP 3051.1 ATCC13869/pECCG117 0.0 ATCC13869/CJ4-GFP 921.7 ATCC13869/SPL1-GFP 3342.3 ATCC13869/SPL7-GFP 3425.5 ATCC13869/SPL13-GFP 3287.3

(17) As shown in Table 1 above, all of SPL1, SPL7, and SPL13 showed their promoter activities in two different kinds of Corynebacterium glutamicum and also showed higher fluorescence sensitivity than the pcj4 promoter, which is known to be a strong promoter. From these results, it was found that SPL1, SPL7, and SPL13 are very strong promoters which can express target genes in Corynebacterium glutamicum.

Example 2. Evaluation of the Ability of Producing Target Products

(18) 2-1. Evaluation of the Ability of Producing Psicose

(19) (1) Preparation of Vectors and Transformed Strains for ATPE Expression Including SPL1 and SPL7 Promoter Sequences

(20) Vectors for Corynebacterium strains with enhanced expression of ATPE (psicose epimerase derived from Agrobacterium tumefaciens) were prepared using SPL1 and SPL7. The Open Reading Frame (ORF) of ATPE gene was amplified by performing PCR (30 cycles of reactions of 30 sec at 94 C., 30 sec at 55 C., and 1 min at 72 C.) using the pET24-ATPE-2 vector (SEQ ID NO: 8) as a template along with the primers of SEQ ID NOS: 9 and 10. The amplified ATPE gene and the pSPL1-GFP and pSPL7-GFP vectors for Corynebacterium strains prepared in Example 1 were treated with restriction enzymes EcoRV and PstI, and the ATPE-2 obtained by the PCR was operably linked thereto using the BD In-Fusion kit, and thereby, the pSPL1-ATPE-2 and pSPL7-ATPE-2 vectors for Corynebacterium strains were finally prepared.

(21) The thus-prepared pSPL1-ATPE-2 and pSPL7-ATPE-2 vectors were introduced to the ATCC13032 strain by electroporation, and thereby SPL1-ATPE-2 and SPL7-ATPE-2 strains were prepared.

(22) (2) Evaluation of the Ability of Producing Psicose by Transformed Strains

(23) The strains prepared by the above procedure were cultured using the media with the same composition as in Example 1 and their ATPE activities were measured. The ATCC13032/pECCG117 and ATCC13032/CJ4-ATPE-2 strains were used as control groups.

(24) The strains were cultured overnight in a solid LB medium placed in a 30 C. incubator and the overnight culture of each strain was inoculated into a 25 mL medium and cultured in a shaking incubator at 30 C. for 24 hours. The culture was centrifuged and the supernatant was removed. The recovered bacterial bodies were washed with EPPS solution (pH 8.0), and the thus-obtained pellet was dissolved in EPPS solution (pH 8.0). POESA (1 mg/mL) was added thereto, reacted at room temperature for 1 hour, and centrifuged. Then, the resulting pellet obtained by centrifugation was dissolved in EPPS solution (pH 8.0), and a fructose solution (350 g/L) as a substrate was added thereto and reacted at 50 C. for 3 hours, and the reaction was stopped by heat treatment. Then, a supernatant was recovered by centrifugation and the amount of psicose production was measured by HPLC analysis (FIGS. 1(A), 1(B), and 1(C)). The amount of psicose production after reaction was indicated in Table 2 below.

(25) TABLE-US-00002 TABLE 2 Strains Fructose (g/L) Psicose (g/L) ATCC13032/pECCG117 348.7 0 ATCC13032/CJ4-ATPE-2 329.9 18.8 ATCC13032/SPL1-ATPE-2 263.2 79.2 ATCC13032/SPL7-ATPE-2 280.1 67.4

(26) As shown in Table 2, it was confirmed that the psicose producibilities of Corynebacterium glutamicum ATCC13032/SPL1-ATPE-2 and ATCC13032/SPL7-ATPE-2 were improved by 321% and 258%, compared to that of Corynebacterium glutamicum ATCC13032/CJ4-ATPE-2, respectively. From the above, it was confirmed that when the SPL1 and SPL7 promoters of the present disclosure were used, the amount of expression of the gene encoding ATPE was increased thus confirming that the ATPE activity was significantly increased.

(27) 2-2. Evaluation of the Ability of Producing Tagatose

(28) (1) Preparation of Vectors and Transformed Strains for UxaE Expression Including an SPL13 Promoter Sequence

(29) Vectors for Corynebacterium strains were prepared by cloning the tagatose epimerase gene (UxaE) derived from Thermotoga neapolitana using CJ4-GFP, in which GFP is inserted, and SPL13-GFP prepared in Example 1. The Open Reading Frame (ORF) of TN(m) gene was amplified by performing PCR (30 reaction cycles of 30 sec at 94 C., 30 sec at 55 C., and 1 min at 72 C.) using the pET28a-TN(m) vector (SEQ ID NO: 11) as a template along with the primers of SEQ ID NOS: 12 and 13. The amplified TN(m) gene and the CJ4-GFP and SPL13-GFP vectors for Corynebacterium strains were treated with restriction enzymes EcoRV and PstI, and then ligated, and thereby, the pCJ4-TN(m) and pSPL13-TN(m) vectors for Corynebacterium strains were finally prepared.

(30) The thus-prepared pCJ4-TN(m) and pSPL13-TN(m) vectors were introduced to the ATCC13032 strain by electroporation and thereby ATCC13032/CJ4-TN(m) and SPL13-TN(m) strains were prepared.

(31) (2) Evaluation of the Ability of Producing Tagatose by Transformed Strains

(32) The strains prepared by the above procedure were cultured and pre-treated in the same media and culture conditions described in Example 1 and the strains for activating UxaE were acquired. The evaluation of activity was performed by changing only the amount of substrate, reaction temperature, and time in the same manner as in Example 2-1 (by reacting at 60 C. for 2 hours after adding a fructose solution (100 g/L)). Then, the supernatant was recovered by centrifugation and the amount of tagatose production was measured by HPLC analysis (FIGS. 2(A) and 2(B)). The amount of tagatose production after reaction was indicated in Table 3 below.

(33) TABLE-US-00003 TABLE 3 Strains Fructose (g/L) Tagatose (g/L) ATCC13032/pECCG117 100 0 ATCC13032/CJ4-TN(m) 92.2 6.9 ATCCI3032/SPL13-TN(m) 82.7 16.8

(34) As shown in Table 3, the tagatose producibility of Corynebacterium glutamicum ATCC13032/SPL13-TN(m) was improved by 143% compared to that of Corynebacterium glutamicum ATCC13032/CJ4-TN(m). From the above, it was confirmed that when the SPL13 promoter of the present disclosure was used, the amount of expression of the gene encoding UxaE was increased thus confirming that the UxaE activity was significantly increased.

(35) 2-3. Evaluation of the Ability of Producing Valine

(36) (1) Preparation of pECCG117-SPL7-ilvE Vector and Transformed Strains Including an SPL7 Promoter Sequence

(37) For the confirmation of L-valine producing ability as an example of L-amino acids, pECCG11?-CJ7-ilvE and pECCG117-SPL7-ilvE vectors were prepared as follows, so as to enhance the enzyme activity of ilvE (NCgl2123), which encodes a branched-chain amino-acid aminotransferase, which is a major gene for valine biosynthesis. Specifically, as a result of performing PCR (30 reaction cycles of 30 sec at 94 C., 30 sec at 55 C., and 1 min at 72 C.) using the ATCC14067 chromosome as a template along with the primers of SEQ ID NOS: 14 and 15, a PCR fragment with a size of about 1104 bp, which has an EcoRV restriction site at 5 end and a PstI restriction site at 3 end of the NCgl2123 gene, was amplified. The thus-obtained PCR fragment was purified and mixed with pECCG117-CJ7-GFP (Korean Patent No. 10-0620092) and pECCG117-SPL7-GFP, which were treated with EcoRV and PstI restriction enzymes, respectively, and vectors were prepared using the In-fusion cloning Kit. The thus-prepared vectors were named as pECCG117-CJ7-ilvE and pECCG117-SPL7-ilvE, respectively.

(38) TABLE-US-00004 SEQIDNO:14 5 GAGATCAAAACAGATATCATGACGTCATTAGAGTTC3 SEQIDNO:15 5 ATCCCCCGGGCTGCAGTTAGCCAACCAGTGGGTA3

(39) The thus-prepared recombinant vectors of pECCG117-CJ7-ilvE and pECCG117-SPL7-ilvE, and the pECCG117 vector were transformed into a valine-producing strain, Corynebacterium glutamicum KCCM1201P (Korean Patent No. 10-1117022), by an electric pulse method, and the transformed strains were obtained in a LB agar plate containing kanamycin (25 mg/L). The thus-obtained strains were named as KCCM11201P/pECCG117, KCCM11201P/CJ7-ilvE, and KCCM11201P/SPL7-ilvE, respectively.

(40) (2) Evaluation of the Ability of Producing Valine by Transformed Strains

(41) The ability of producing L-valine by the 3 different kinds of transformed strains was analyzed by culturing as described below.

(42) Each of the strains in an amount of a platinum loop was inoculated into a 250 mL corner-baffle flask containing 25 mL of a production medium and cultured in a shaking incubator (200 rpm) at 30 C. for 72 hours. Upon completion of the cultivation, the concentration of L-valine in each culture was analyzed by HPLC (SHIMADZU LC-20AD).

(43) <Production Medium (pH 7.2)>

(44) Glucose (50 g), (NH.sub.4).sub.2SO.sub.4 (20 g), Corn Steep Solids (20 g), KH.sub.2PO.sub.4 (1 g), MgSO.sub.4.7H.sub.2O (0.5 g), Biotin (200 g) (based on 1 L of distilled water)

(45) The above cultivation and analysis were performed repeatedly, and the analyzed L-valine concentrations are shown in Table 4 below.

(46) TABLE-US-00005 TABLE 4 L-valine (g/L) Strains Batch 1 Batch 2 Batch 3 Average Con- KCCM11201P/pECCG117 2.7 2.9 2.9 2.8 trol 1 KCCM11201P/CJ7-ilvE 3.1 3.2 3.4 3.2 2 KCCM11201P/SPL7-ilvE 3.9 4.0 3.8 3.9

(47) As shown in Table 4, it was confirmed that the ability of producing valine by the KCCM11201P/SPL7-ilvE strain, where the promoter of the present disclosure is introduced, was improved by 21.8% compared to that of the Corynebacterium glutamicum KCCM11201P/CJ7-ilvE, where a known promoter is introduced, and additionally, it was improved by 39.2% compared to that of the control group, KCCM11201P/pECCG117. From the above results, it was confirmed that the SPL7 promoter enhanced the expression of the ilvE gene thereby significantly increasing the activity of the enzyme encoded by the corresponding gene.

(48) 2-4. Evaluation of the Ability of Producing Lysine

(49) (1) Preparation of pDZTn-SPL13-gapN1 Vector and Transformed Strains Including an SPL13 Promoter Sequence

(50) For the confirmation of L-lysine producing ability as a representative example of L-amino acids, vectors were prepared as follows so as to enhance the enzyme activity of the NADP-dependent glyceraldehyde-3-phosphate dehydrogenase (GapN), which is derived from known Streptococcus mutants.

(51) For the insertion into a transposable gene NCgl2392 in a microorganism of the genus Corynebacterium, PCR (30 reaction cycles of 30 sec at 94 C., 30 sec at 55 C., and 1 min at 72 C.) was performed using the chromosome of the wild-type Corynebacterium glutamicum ATCC13032 as a template, along with the following primers of SEQ ID NO: 16, SEQ ID NO: 17. SEQ ID NO: 18, and SEQ ID NO: 19, based on the NIH Genbank of the NIH (USA), and as a result, fragments including the 5end and the 3 end of NCgl2392 gene were amplified. As a result of performing PCR (30 reaction cycles of 30 sec at 94 C., 30 sec at 55 C., and 2 min at 72 C.) using the pECCG122-Pcj7-gapN1 vector (Korean Patent No. 10-1182033) along with the following primers of SEQ ID NO: 20 and SEQ ID NO: 21, Pcj7-gapN1 was amplified. As a result of performing PCR (30 reaction cycles of 30 sec at 94 C., 30 sec at 55 C., and 1 min at 72 C.) using the pECCG122-Pcj7-gapN1 vector and the SPL13-GFP vector prepared in Example 1, along with the following primers of SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 21, SPL13 and gapN genes were amplified, respectively, and these genes were cloned into the pDZ vector (Korean Patent No. 0924065), which is not replicable in Corynebacterium glutamicum, along with the NCgl2392 gene fragments prepared above, and thereby pDZTn-Pcj7-gapN1 and pDZTn-SPL13-gapN1 vectors were prepared.

(52) TABLE-US-00006 SEQIDNO:16 5 ATCCTCTAGAGTCGACCAAATGCTCCAACCGTCCGT3 SEQIDNO:17 5 CTCGAGGAACTCATTCCTTCTGCTCG3 SEQIDNO:18 5 TCTAGAACTAGTGGGCCCGACATCTAATAACCGGGCAG3 SEQIDNO:19 5 ATGCCTGCAGGTCGACGCAGACGCACTCGACTACAC3 SEQIDNO:20 5 GAATGAGTTCCTCGAGAGAAACATCCCAGCGCTACT3 SEQIDNO:21 5 GCCCACTAGTTCTAGATTATTTGATATCAAATACGA3 SEQIDNO:22 5 GAATGAGTTCCTCGAGGGCGCTTCATGTCAACAATC3 SEQIDNO:23 5 ATTGTTTTGTCATATGTGTTTTGATCTCCTCCAATA3 SEQIDNO:24 5 CATATGACAAAACAATATAAAAA3

(53) Each of the above vectors (pDZTn-Pcj7-gapN1 and pDZTn-SPL13-gapN1) was transformed using the KCCM11016P strain with enhanced ability of producing lysine (the microorganism was disclosed as KFCC10881, re-deposited to an international depositary authority under the Budapest treaty, and assigned an accession number of KCCM11016P; Korean Patent No. 10-0159812) as a parent strain, by the electric pulse method (Appl. Microbiol. Biotechnol. (1999) 52: 541-545), and transformed strains were obtained in a selective medium containing 25 mg/L of kanamycin. In order to select colonies in which the gapN gene was inserted in the genome by secondary recombination process (crossover), those colonies where the Pcj7-gapN1 and SPL13-gapN1 genes are inserted, respectively, were obtained using primer pairs of SEQ ID NOS: 20 and 21 and SEQ ID NOS: 21 and 22. The thus-obtained colonies were named as KCCM11016P/CJ7-gapN1 and KCCM11016P/SPL13-gapN1, respectively.

(54) (2) Evaluation of the Ability of Producing Lysine by Transformed Strains

(55) The ability of producing L-lysine by the 3 different kinds of transformed strains was analyzed by culturing as described below.

(56) Each of the strains was inoculated into a 250 mL corner-baffle flask containing 25 mL of a seed medium and cultured in a shaking incubator (200 rpm) at 30 C. for 20 hours. Then, 1 mL of the seed culture was inoculated into a 250 mL corner-baffle flask containing 24 mL of a production medium and cultured in a shaking incubator (200 rpm) at 30 C. for 72 hours. The concentration of L-lysine in each culture was analyzed by HPLC (SHIMADZU, LC-20AD).

(57) <Seed Medium (pH 7.0)>

(58) Glucose (20 g). Peptone (10 g), Yeast Extract (5 g). Urea (1.5 g), KH.sub.2PO.sub.4 (4 g), K.sub.2HPO.sub.4 (8 g), MgSO.sub.4.7H.sub.2O (0.5 g), Biotin (100 g), Thiamine HCl (1000 g), Calcium-Pantothenic Acid (2000 g), Nicotinamide (2000 g) (based on 1 L of distilled water)

(59) <Production Medium (pH 7.0)>

(60) Glucose (100 g), (NH.sub.4).sub.2SO.sub.4 (40 g), Soybean Protein (2.5 g), Corn Steep Solids (5 g), Urea (3 g), KH.sub.2PO.sub.4 (1 g), MgSO.sub.4.7H.sub.2O (0.5 g), Biotin (100 g), Thiamine HCl salt (1000 g), Calcium-Pantothenic Acid (2000 g), Nicotinamide (3000 g), and CaCO.sub.3 (30 g) (based on 1 L of distilled water)

(61) The above cultivation and analysis were performed repeatedly, and the analyzed L-lysine concentrations are shown in Table 5 below.

(62) TABLE-US-00007 TABLE 5 L-lysine (g/L) Strains Batch 1 Batch 2 Batch 3 Average Con- KCCM11016P 42.3 43.1 41.2 42.2 trol 1 KCCM11016P/ 47.6 49.1 49.2 48.3 CJ7-gapN1 2 KCCM11016P/ 51.0 51.5 52.9 51.8 SPL13-gapN1

(63) As shown in Table 5, it was confirmed that the ability of producing lysine by the KCCM1016P/SPL13-gapN1 strain, where the promoter of the present disclosure is introduced, was improved by 7.2% compared to that of the Corynebacterium glutamicum KCCM11016P/CJ7-gapN1, where a known promoter is introduced, and additionally, it was improved by 22.7% compared to that of the control group, KCCM11016P. From the above results, it was confirmed that the SPL13 promoter enhanced the expression of the gapN1 gene thereby significantly increasing the activity of the enzyme encoded by the corresponding gene.

(64) Summarizing the above results, the SPL1, SPL7, and SPL13 promoters of the present disclosure can significantly enhance the expression of a target gene in a recombinant microorganism, compared to the conventional known promoters. Accordingly, the promoters of the present disclosure can not only provide an effective expression system but also be effectively used in various industrial fields for high-yield production of target products, such as saccharides, functional materials, and amino acids.