P21-activated kinase inhibitor domain targeted transgenic mouse

10584353 ยท 2020-03-10

Assignee

Inventors

Cpc classification

International classification

Abstract

Mice comprising a modified p21-activated kinase (Pak) inhibitor domain (PID*), optionally linked with GST and capable of constitutive expression of PID are provided. Also provided are cells, tissue, and organs obtainable from such mice, and methods for producing mice comprising a modified p21-activated kinase (Pak) inhibitor domain (PID*).

Claims

1. A transgenic mouse, comprising a genomically integrated transgene, wherein the transgene is integrated into the ROSA26 locus, wherein the transgene comprises a stop cassette flanked by lox P sites upstream of a modified p21-activated (Pak) inhibitor domain (PID*) sequence (SEQ ID NO:1), wherein the stop cassette prevents expression of SEQ ID NO:1, and wherein upon exposure to CRE recombinase the stop cassette is excised from the mouse genome such that SEQ ID NO:1 is expressed.

2. The transgenic mouse of claim 1, wherein the transgene comprises SEQ ID NO:2.

3. The transgenic mouse of claim 1, wherein the transgene comprises SEQ ID NO:3.

4. A method for producing the transgenic mouse of claim 1, comprising: a) introducing a transgene into a mouse egg, embryo, or embryonic stem cell, wherein the transgene is integrated into the ROSA26 locus, wherein the transgene comprises a stop cassette flanked by lox P sites upstream of a modified p21-activated (Pak) inhibitor domain (PID*) sequence (SEQ ID NO: 1), wherein the stop cassette prevents expression of SEQ ID NO: 1; b) generating a mouse embryo from the mouse egg or embryonic stem cell from (a) and transferring said mouse embryo, or the mouse embryo from (a), into a pseudopregnant female mouse; c) gestating the mouse embryo from b), wherein the pseudopregnant female mouse produces a transgenic mouse comprising a genomically integrated transgene wherein the transgene is integrated into the ROSA26 locus, wherein the transgene comprises a stop cassette flanked by lox P sites upstream of a modified p21-activated (Pak) inhibitor domain (PID*) sequence (SEQ ID NO: 1), wherein the stop cassette prevents expression of SEQ ID NO: 1, and wherein upon exposure to CRE recombinase the stop cassette is excised from the mouse genome such that SEQ ID NO: 1 is expressed.

5. A method for producing a transgenic mouse expressing a modified p21-activated (Pak) inhibitor domain (PID*) sequence (SEQ ID NO: 1), comprising: a) introducing a transgene into a mouse egg, embryo, or embryonic stem cell, wherein the transgene is integrated into the ROSA26 locus, wherein the transgene comprises a stop cassette flanked by lox P sites upstream of a modified p21-activated (Pak) inhibitor domain (PID*) sequence (SEQ ID NO: 1), wherein the stop cassette prevents expression of SEQ ID NO: 1; b) generating a mouse embryo from the mouse egg or embryonic stem cell from (a) and transferring said mouse embryo, or the mouse embryo from (a), into a pseudopregnant female mouse; c) gestating the mouse embryo from b), wherein the pseudopregnant female mouse produces a transgenic mouse comprising a genomically integrated transgene wherein the transgene is integrated into the ROSA26 locus, wherein the transgene comprises a stop cassette flanked by lox P sites upstream of a modified p21-activated (Pak) inhibitor domain (PID*) sequence (SEQ ID NO: 1), wherein the stop cassette prevents expression of SEQ ID NO: 1, and wherein upon exposure to CRE recombinase the stop cassette is excised from the mouse genome such that SEQ ID NO: 1 is expressed; d) selecting a transgenic female mouse produced in step c) and breeding the female mouse with a male mouse comprising a CRE-expressing transgene; and e) selecting offspring whose genome comprises the transgene comprising a stop cassette flanked by lox P sites upstream of a modified p21-activated (Pak) inhibitor domain (PID*) sequence (SEQ ID NO: 1) and said CRE-expressing transgene, wherein upon exposure to CRE recombinase the stop cassette is excised from the mouse genome such that SEQ ID NO: 1 is expressed in said offspring.

6. The method of claim 5, wherein the nucleic acid sequence is operably linked to reporter (IRES-eGFP) such that the nucleic acid sequence and the IRES-eGFP are coexpressed.

7. The method of claim 5, wherein the CRE-expressing transgene is driven by a PDX2 promoter active in intestinal epithelial cells.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIGS. 1A-1E show exemplary embodiments comprising generation and analysis of conditional ROSA26-promoter-based expression alleles. FIG. 1A shows an LR reaction performed between the pROSA26-DV1 vector and pEntry clone containing GST-PID* fragment to generate ROSA26 targeting vector. FIG. 1B shows that homologous recombination occurred between exon 1 and 2 of wild-type ROSA26 locus in G4 ES cells after electroporation. Black boxes represent the exons located at ROSA26 locus. FIG. 1C shows the targeted allele. FIG. 1D shows that the Cre-mediated deletion of intervening loxP flanked PGK-neo-3xpA (STOP) cassette results in the ROSA26-locus-based expression of an exon1-GST-PID*-IRES-eGFP bi-cistronic fusion transcript. FIG. 1E shows genotyping PCR analysis of genomic DNA isolated from the tail detecting presence of fusion transcript by both external primers (F1 and R1) and internal primers (F2 and R2) shown in FIG. 1C.

(2) FIG. 1F shows the effect of PID on cellular structure of mice colon. Reduced BrdU indicates reduced cell proliferation, while increased Cleaved Caspase 3 indicates increased cellular apoptosis. H&E shows hematoxylin and eosin staining of tissue samples.

(3) FIGS. 2A-2F show that the inhibition of Group I Paks activity by PID retards tumor progression in vivo. FIG. 2A shows that body weights of CDX2; APC/+; ROSAPID/+ and CDX2; APC/+; ROSA+/+ mice were measured once every two weeks for 8 months. FIG. 2B shows the total number of tumors collected and counted from control and experimental mice at 8 months of age. FIG. 2C shows the adenoma number in the intestinal tracts of CDX2; APC/+; ROSAPID/+ and CDX2; APC/+; ROSA+/+ mice at 8 months of age. FIG. 2D shows the adenocarcinoma number in the intestinal tracts of CDX2; APC/+; ROSAPID/+ and CDX2; APC/+; ROSA+/+ mice at 8 months of age. FIG. 2E shows tumor size measured on paraffin-embedded sections stained for H&E collected from CDX2; APCloxP/+; ROSAPID/+ and CDX2; APCloxP/+; ROSA+/+ mice. FIG. 2F shows representative H&E staining of colon tumor dissected from CDX2; APCloxP/+; ROSAPID/+ and CDX2; APCloxP/+; ROSA+/+ mice (Bar=100 m).

(4) FIGS. 2G-2I show the down-regulation of multiple signaling pathways in PID+ cells. FIG. 2G shows that body weights of 6 groups of control mice including ROSAPID/+, ROSA+/+, CDX2; ROSAPID/+ and CDX2; ROSA+/+, APCloxP/+; ROSAPID/+, APCloxP/+; ROSA+/+ were measured once every two weeks for 8 months. FIG. 2H shows that paraffin sections of colon tumor obtained from CDX2; APC/+; ROSAPID/+ and CDX2; APC/+; ROSA+/+ mice were subjected to immunohistological staining using antibodies against Phospho-Pak, Phospho-Mek, Phospho-Akt and Phospho-Histone H3. FIG. 2I shows immunoblot analysis of MAPK and Akt-mTOR signaling pathways from PID+ and PID-primary epithelium cell lysates.

(5) FIGS. 3A-3E show that expression of PID inhibits invasiveness and motility by suppressing EMT. FIG. 3A shows that cell variability of primary colon epithelium tumor cells derived from CDX2; APC/+; ROSAPID/+(#4, 7 and 26) and CDX2; APC/+; ROSA+/+(#35, 48 and 56) mice was measured by MTT assay. FIG. 3B shows invasion assay of PID+(4, 7 and 26) and PID (35, 48 and 56) primary cells. FIG. 3C shows migration assay of PID+(4, 7 and 26) and PID-(35, 48 and 56) primary cells. FIG. 3D shows real-time PCR analysis for relative EMT gene expression levels in PID+ and PID cells, including Zeb1, Zeb2, Slug and Twist1 (Transcription factors), Fibronectin, N-Cadherin and Vimentin (Mesenchymal markers), E-Cadherin, CLDN and CRB3 (Epithelial markers) and genes related to Wnt signaling pathway (cyclin D1, cyclin D2, -Cat, -Cat and c-myc). *P<0.05, **P<0.005, ***P<0.0005, student t-test (NS, not significant). FIG. 3E shows that immunoblot analysis of EMT markers confirmed that PID cells undergo EMT.

(6) FIGS. 3F-3I shows that EMT is suppressed by expression of PID. FIG. 3F shows the cellular morphologies observed under a phase-contrast microscope. Bar, 400 m. FIG. 3G shows a clustergram of up- and down-regulated epithelial-mesenchymal transition (EMT)-related genes in PID+ and PID cells. FIG. 3H shows relative expression level of stem cell markers and other genes related to Wnt signaling evaluated by real-time PCR. FIG. 3I shows proliferation of PID+ cells transfected with either with LNA-Scrambled (Neg) or LNA-200 oligo was measured by MTT assay.

(7) FIGS. 4A-4F show up-regulation of epithelial markers via miRNA-200. FIG. 4A shows changes in pre-miRNA-200 relative expression levels in PID+ and PID cells, as measured by real-time PCR. FIG. 4B shows PID+ cells were transfected repeatedly every 3 days with either LNA-scrambled (Neg) or LNA-200 oligo, then subjected to invasion assay. FIG. 4C shows migration assay of PID+ cells transfected with either with LNA-Scrambled (Neg) or LNA-200 oligo. FIG. 4D shows relative expression of epithelial markers quantified by real-time PCR 22 days after the first transfection and immunoblot analysis of E-Cadherin in PID+ cells either harboring LNA-Scrambled or LNA-200 oligo. FIG. 4E shows Western blotting analysis of E-Cadherin in PID+ cells either harboring LNA-Scrambled or LNA-200 oligonucleotide. GAPDH served as a loading control. FIG. 4F shows changes in expression of epithelial and mesenchymal markers in PID cells transduced with lentivirus bearing either miR-200b-200a-429 cluster or miR-200c-141 cluster, as measured by real-time PCR. FIG. 4G shows Western blotting analysis of N-Cadherin in PID cells expressing either miR-200b-200a-429 cluster or miR-200c-141 cluster. GAPDH served as a loading control.

(8) FIGS. 5A-5G show that alternative splicing of CD44 contributes to EMT in PID-expressed cells. FIG. 5A shows a schematic of CD44 gene exons structure. Nos. 1-5 and 16-20 represent constitutive exons, and v1-v10 are variable exons that can be alternately or entirely spliced out. Arrows (under v1-v10) show forward primers position for CD44 variants, arrow located at 5 end (under No. 5) is forward primer for standard form of CD44, whereas arrow at 3 region (under No. 16) is the common reverse primer for RT-PCR. FIG. 5B shows exon-specific RT-PCR analysis for the expression of CD44 variants in PID+ and PID cells. The lane indicated by std shows PCR products obtained by using primers spanning all variants. CD44s only shown in PID cells indicated by an asterisk. Lane M shows a 100 bp DNA ladder. FIG. 5C shows immunoblot analysis of CD44 isoform in PID+(4, 7 and 26) and PID (35, 48 and 56) cells. GAPDH served as the internal control. FIG. 5D shows real-time PCR results illustrating relative gene expression levels of CD44v6, CD44v4 and total CD44 in PID+ and PID cells. Results were normalized to GAPDH. FIG. 5E shows isoforms of CD44 which were measured by RT-PCR. FIG. 5F shows immunoblots for factors regulating EMT (C=cytoplasmic; N=nuclear). FIG. 5G shows expression of makers in cells transfected with empty vector (EV) or a non-phosphorylatable form of Snail.

(9) FIG. 6 shows a 15,405 bp genomic sequence of a pROSA26-GST-PID plasmid. The PID sequence comprises amino acids 83-149 of the sequence of the Pak1 protein. A BamH1 linker on the 5 end of the cDNA was used to clone to a GST-vector (pGex-2T), and a stop codon after amino acid 149 followed by an EcoR1 restriction site.

DETAILED DESCRIPTION OF THE INVENTION

(10) Various terms relating to aspects of the invention are used throughout the specification and claims. Such terms are to be given their ordinary meaning in the art, unless otherwise indicated. Other specifically defined terms are to be construed in a manner consistent with the definition provided herein.

(11) In order to determine the effects of inhibiting Pak function in vivo, a vector was designed to overexpress a modified p21-activated kinase (Pak) inhibitor domain (PID*=human Pak1 residues 83-149, with E.fwdarw.K mutation residue 129 of this protein, linked to GST to facilitate detection) from group A Paks (Pak1, -2, and -3) in mice. Transgene expression was restricted to a limited number of tissues in order to avoid the potential for wide-ranging, deleterious effects on development.

(12) This is a new transgenic mouse model that is designed to constitutively express PID linked to GST to facilitate detection from group A Paks (Pak1, -2, and -3). When the transgene mouse is bred with appropriate mouse strains, e.g., CRE-expressing mice (see, for example, www.jax.org/mouse-search?searchTerm=CRE, which is incorporated herein by reference), the activity of group A Paks could be manipulated in any tissue at any time. This is useful for evaluating the role of group A Paks in normal mouse development and organ function, as well as in mouse disease models such as cancer, neurologic diseases such as Fragile X syndrome and Alzheimer's disease, and pathologic inflammatory states.

(13) For example, a Pak inhibitor can be used for testing for pancreatic cancer. ROSA26-LSL-PID* mice can be bred with CAGG-LSL-Rasv12 mice to obtain doubly transgenic progeny, and then Ad-Cre virus could be instilled into the lungs of such mice to induce recombination, activating expression of PID* and Rasv12. The survival of such mice would be compared to controls instilled with control Ad virus and to those lacking the ROSA26-LSL-PID* transgene.

(14) More specifically, the transgenic mice of the present invention allow the evaluation of the role of group A Paks in preclinical cancer models. A Paks could be conditionally inhibited in mice in any tissue at any time. This would allow the determination if loss of group A Pak activity is beneficial in various cancer models. Unlike knock-out mice, the transgenic mouse model of the present invention continues to express endogenous group A Pak proteins, and this will mimic the effects of a small molecule group A Pak inhibitor, thus predicting drug effects.

(15) By expressing a regulated peptide inhibitor of group A Paks, the mouse model provides a better indicator of small molecule inhibitors than knock-outs or shRNA-expressing mice, as endogenous Pak proteins are still expressed. Further, the Pak1 PID, which has been modified by mutating E129K, no longer binds FMRI (fragile X mental retardation-1) protein. Thus, the PID* represents a specific group A Pak inhibitor, without other known cellular targets.

(16) While somewhat similar in concept to the example of the ROSA26-LSL-PID* mouse disclosed hereinafter, the transgenic mouse of the present invention is superior because it: i) only binds to group A Paks, and does not titrate out other binding partners, such as small GTPases, PIX, or Nck; ii) is regulated by Cre recombinanse, allowing flexibility in Pak inhibition in particular tissues and at particular times; and iii) the transgene is inserted as a single copy into a safe, well-characterized location in the genome (the ROSA26 locus, thus not disturbing expression of key mouse genes).

(17) In general reference to FIGS. 1A-1E, an exemplary embodiment of the invention comprises the generation of the ROSA26-promoter-based expression alleles. The ROSA26-promoter is selected for gene expression because it is known as a safe harbor site in the mouse genome, whereby insertion of a transgene will not disrupt the genes of the mouse.

(18) Generally, a gateway enzyme mix (LR-clonase) can be used to catalyze recombination between an entry clone (containing a gene of interest flanked by attL sites) and a destination vector (containing attR sites) to generate an expression clone. More specifically, the LR-clonase reaction can be used to insert the pROSA26-DV1 vector and pEntry clone containing GST-PID* fragment to generate ROSA26 targeting vector as shown in FIG. 1B. Using this technique, homologous recombination occurred between exon 1 and 2 of wild-type ROSA26 locus in G4 ES cells after electroporation as shown in FIG. 1B. The targeted allele comprises a fused GST-PID* gene sequence, as well as the reporter gene sequence, IRES-eGFP, as shown in FIG. 1C.

(19) During recombination, a Cre recombinase mediated deletion of intervening loxP flanked PGK-neo-3xpA (STOP) cassette occurs in the ROSA26-locus-based expression of an exon1-GST-PID*-IRES-eGFP bi-cistronic fusion transcript. This deletion results from Cre-Lox recombinase technology at a site-specific location so that the GST-PID* gene sequence can be expressed constitutively. The system consists of a single enzyme, Cre recombinase, that recombines a pair of short target sequences, e.g., the Lox sequences, without the need to insert extra supporting proteins or sequences. Placing the Lox sequence appropriately flanking the PGK-neo-3xpA (STOP) cassette allows the genes to be deleted. As a result, the activity of the Cre enzyme can be controlled so that it is expressed in a particular cell type or triggered by an external stimulus like a chemical signal or a heat shock. These targeted DNA changes are useful in cell lineage tracing and when mutants are lethal if expressed globally.

(20) Genotyping using PCR analysis of genomic DNA isolated from tail detecting presence of fusion transcript by both external primers (F1 and R1) and internal primers (F2 and R2). These primers are as follows:

(21) TABLE-US-00001 F1: SEQIDNO:4 5-TAGGTAGGGGATCGGGACTCT-3 R1 SEQIDNO:5 5-GCGAAGAGTTTGTCCTCAACC-3 F2 SEQIDNO:6 5-CCCATCAAGCTGATCCGGAACC-3 R2 SEQIDNO:7 5-GTGAACAGCTCCTCGCCCTTG-3
These primers can be used to confirm expression of the GST-PID* gene sequence in vitro and in vivo. The IRES-eGFP plasmid can also be used to confirm expression of GST-PID* plasmid.

(22) It has been observed in accordance with the invention that viable GST-PID* transgenic mice can be produced, that these mice allow constitutive expression of a potent cell cycle inhibitor, p21-activate kinase (Pak) inhibitor (PID*), and that the PID* expression inhibited cell proliferation in each of the tissues studied. The PID* sequence is shown in SEQ ID NO:1, the GST-PID* sequence is shown in SEQ ID NO:2 (with PID sequence underlined), the GST-PID* sequence is shown (with PID sequence underlined) within SEQ ID NO:3.

(23) The invention features p21 PID transgenic mice. This provides control of expression of the transgene in mice, and they may be useful as a tool to aid studies of development, tissue renewal, aging, cancer, and a variety of chronic diseases that involve cell proliferation.

(24) In one aspect, a transgenic mouse comprises a transgene comprising a nucleic acid sequence encoding modified p21-activated kinase (Pak) inhibitor domain (PID* optionally linked to GST).

(25) The mice comprise at least one copy of the transgene, which preferably is stably integrated into a chromosome. The transgene may be present in the gametes and/or somatic cells of the animal. The transgene may comprise SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3.

(26) Preferably, the transgene is present in and capable of expression in one or more tissues or organs in the mouse. Exemplary tissues and organs include, but are not limited to, the skin, tongue, bone marrow, and muscle tissues of the gastrointestinal tract such as the esophagus, stomach, small intestine, and large intestine or subpart such as the colon. Cells, tissues, or organs comprising the transgene may be isolated from the mouse, and may be grown in culture and/or subjected to further study.

(27) It is possible to achieve tissue-specific (and organ-specific) expression of the transgene, for example, by breeding the loxP mouse with a Cre.sup.+/+ mouse having the Cre recombinase gene expressed in particular tissues or organs. For example, a Cre-expressing mouse can include, but not be limited to, CDX2-Cre, Tie2-Cre, Postn-Cre, in addition to others. Constitutive expression of the transgene in particular tissues is thus achieved. Alternatively, tissue or cell-specific expression of the transgene may be achieved by mating the mice with CRE-expressing mice.

(28) The invention is not limited to mice, and can include any member of a category of other non-human mammals such as rodents (e.g., rats, rabbits), companion animals, farm animals, non-human primates, and other non-human mammals. Mice, being exemplified, are preferred.

(29) The invention also features methods for producing a transgenic mouse, as well as mice produced by any of the methods. In some aspects, the method comprises breeding a mouse comprising a p21 (GST-PID*) transgene with a mouse comprising a CRE-expressing transgene, and selecting offspring having the p21 (GST-PID*) transgene and the CRE-expressing transgene.

(30) In some aspects, the method comprises introducing a nucleic acid sequence encoding modified p21 (GST-PID*) into a mouse egg (fertilized or unfertilized), zygote, embryo, or embryonic stem cell, and transferring the mouse egg, zygote, embryo, or embryonic stem cell having the introduced nucleic acid sequence into a female mouse. The method may further comprise fertilizing the egg. The method may further comprise breeding the female mouse and selecting offspring having the nucleic acid sequence. Offspring may be referred to as progeny.

(31) In some aspects, the method comprises introducing a nucleic acid sequence encoding modified p21 (GST-PID*) into a mouse egg (fertilized or unfertilized), zygote, embryo, or embryonic stem cell, transferring the mouse egg, zygote, embryo, or embryonic stem cell having the introduced nucleic acid sequence into a female mouse, breeding the female mouse with a male mouse comprising a CRE-expressing transgene, and selecting offspring having the nucleic acid sequence and the CRE-expressing transgene, preferably expressed in specific target tissues.

(32) Any technique suitable for introducing the nucleic acid sequence may be used. Non-limiting examples include electroporation, microinjection, viruses, lipofection, calcium phosphate, and other known transformation techniques.

(33) Animals, including offspring, may be screened to confirm the presence of the transgene according to any technique suitable in the art. For example, cells may be isolated and tested for the presence of the gene, a detectable marker, selection marker, translation product, detectable mRNA, and/or detectable phenotype. Green fluorescent protein (GFP) may be linked to or coexpressed with the PID transgene to confirm presence, as well as expression of the transgene.

(34) Offspring carrying the transgene can further be bred with other animals to perpetuate the transgenic line, or can be bred with animals carrying other transgenes. Breeding includes back crossing, including back crossing into distinct genetic backgrounds. Offspring include any filial or backcross generation.

(35) The present disclosure provides the following embodiments, which are not limiting:

Embodiment 1

(36) A transgenic mouse, comprising a transgene comprising SEQ ID NO:1 having a modified p21-activated kinase (Pak) inhibitor domain (PID*).

Embodiment 2

(37) A transgenic mouse, comprising a transgene comprising a modified p21-activated kinase (Pak) inhibitor domain (PID*).

Embodiment 3

(38) A transgenic mouse, comprising a transgene comprising SEQ ID NO:2 having a modified p21-activated kinase (Pak) inhibitor domain fused with a Glutathione S-transferase (GST-PID*).

Embodiment 4

(39) A transgenic mouse, comprising a transgene comprising SEQ ID NO:3 having a modified p21-activated kinase (Pak) inhibitor domain (PID*) fused with a Glutathione S-transferase (GST-PID*) in a ROSA26 genomic sequence.

Embodiment 5

(40) The transgenic mouse of embodiments 1, 2, 3, or 4, wherein the p21-activate kinase (Pak) inhibitor domain (PID*) is constitutively expressed.

Embodiment 6

(41) A method for producing the transgenic mouse of embodiments 1, 2, 3 or 4, comprising introducing a nucleic acid sequence encoding modified p21-activated kinase (Pak) inhibitor domain (PID*) into a mouse egg, embryo, or embryonic stem cell, and transferring the mouse egg, embryo, or embryonic stem cell having the introduced nucleic acid sequence into a female mouse.

Embodiment 7

(42) The method of embodiment 6, further comprising breeding the female mouse and selecting offspring having the nucleic acid sequence.

Embodiment 8

(43) The method of embodiment 7, wherein the p21-activate kinase (Pak) inhibitor domain (PID*) is constitutively expressed within a specific tissue of the offspring.

Embodiment 9

(44) A method for producing the transgenic mouse of embodiments 1, 2, 3 or 4, comprising introducing a nucleic acid sequence encoding modified p21-activated kinase (Pak) inhibitor domain (PID*) into a mouse egg, embryo, or embryonic stem cell; transferring the mouse egg, embryo, or embryonic stem cell having the introduced nucleic acid sequence into a female mouse; breeding the female mouse with a male mouse comprising a CRE-expressing transgene; and selecting offspring having the nucleic acid sequence and the CRE-expressing transgene.

Embodiment 10

(45) The method of embodiment 9, wherein the nucleic acid sequence is operably linked to reporter (IRES-eGFP) such that the nucleic acid sequence and the IRES-eGFP are coexpressed.

(46) The following examples are provided to describe the invention in greater detail. They are intended to illustrate, not to limit, the invention.

Example 1

General Experimental Methods

(47) ES Cell Culture

(48) The G4 ES cell line was grown and manipulated at 37 C. in 5% CO.sub.2 on mitomycin C-treated mouse embryonic fibroblasts in high-glucose DMEM supplemented with 15% ES-graded FBS, 2 mM L-glutamine, 1 mM sodium pyruvate, 0.1 mM non-essential amino acids, 0.1 mM 2-mercaptophenol and 2000 U/ml recombinant LIF.

(49) Gateway-Compatible Vector Construction

(50) The Gateway-compatible pROSA26-DV1 was obtained (Dr. J. Haigh). GST-PID* fragment was cloned into pEntry vector after PCR and gel purification. LR reaction was performed using Clonase Enzyme Mix (Life Technology) according to manufacturer's instruction. Positive clone (pROSA26-GST-PID*-IRES-eGFP) was linearized by Pvul and electroporated into G4 ES cells.

(51) Generation of Transgenic Mice and Tumor Measurement

(52) Twenty-four hours after electroporation, G418 (200 ug/ml) was added to medium for 10 days to select for neomycin-resistant cells. 200 of ES cell clones were picked and genomic DNA was obtained for screening positive clone using F1 and R1 primer pairs to generate a 1.2 kb PCR product.

(53) ROSA26 targeted ES cells were utilized in a diploid embryo for ES cell aggregation experiment. Female mice were super-ovulated and diploid embryos were obtained by flushing from the oviduct. ES cells were gently trypsinized in 0.25% trypsin/EDTA (Life Technology) to break up into small clumps with 8-15 cells and placed next to the embryos for cell aggregation. Blastocyst stage embryos were transferred into pseudo pregnant female mice.

(54) All animal experiments were approved by the Fox Chase Cancer Center Institutional Animal Care and Use Committee (IACUC) and carried out according to NIH-approved protocols in compliance with the guide for the Care and Use of Laboratory Animals. Genomic DNA of pups was prepared from tails for detecting existence of transgene by both external primer (F1 and R1) and internal primer (F2 and R2). The adult agouti bearing ROSA26 targeted allele (named ROSAPID/+) was bred with CDX2P-NLS-Cre and APCloxP/+ transgenic mice separately to generate CDX2P-NLS-Cre; ROSAPID/+ and APCloxP/+; ROSAPID/+ colonies. Progeny from these colonies were subsequently bred to generate CDX2P-NLS-Cre; APC/+; ROSAPID/+ mice. Genotyping was performed by PCR analysis of tail biopsy DNA. All mice were examined once every two weeks for 10 months. Mice were euthanized if mice exhibited signs of illness.

(55) While the invention is described in conjunction with specific embodiments, many alternatives, modifications, permutations, and variations will become apparent to those skilled in the art in light of the foregoing description. Accordingly, it is intended that the invention embraces all such alternatives, modifications, permutations, and variations as falling within the scope of the claims of the invention.

(56) TABLE-US-00002 (PID) SEQIDNO:1 cacacaattcatgtcggttttgatgctgtcacaggggagtttacggga atgccagagcagtgggcccgcttgcttcagacatcaaatatcactaag tcggagcagaagaaaaacccgcaggctgttctggatgtgttgaagttt tacgactcgaaggagacatccaacagccagaaatacatgagctttaca gataagtcatga (GST-PID) SEQIDNO:2 gatccccatcaagctgatccggaacccttaatataacttcgtataatg tatgctatacgaagttattaggtccctcgacctgcagcccaagctagc ttatcgataccgtcgacctcgaatcacaagtttgtacaaaaaagcagg ctccgcggccgcccccttcaccatggcccctatactaggttattggaa aattaagggccttgtgcaacccactcgacttcttttggaatatcttga agaaaaatatgaagagcatttgtatgagcgcgatgaaggtgataaatg gcgaaacaaaaagtttgaattgggtttggagtttcccaatcttcctta ttatattgatggtgatgttaaattaacacagtctatggccatcatacg ttatatagctgacaagcacaacatgttgggtggttgtccaaaagagcg tgcagagatttcaatgcttgaaggagcggttttggatattagatacgg tgtttcgagaattgcatatagtaaagactttgaaactctcaaagttga ttttcttagcaagctacctgaaatgctgaaaatgttcgaagatcgttt atgtcataaaacatatttaaatggtgatcatgtaacccatcctgactt catgttgtatgacgctcttgatgttgttttatacatggacccaatgtg cctggatgcgttcccaaaattagtttgttttaaaaaacgtattgaagc tatcccacaaattgataagtacttgaaatccagcaagtatatagcatg gcctttgcagggctggcaagccacgtttggtggtggcgaccatcctcc aaaatcggatctggttccgcgtggatcccacacaattcatgtcggttt tgatgctgtcacaggggagtttacgggaatgccagagcagtgggcccg cttgcttcagacatcaaatatcactaagtcggagcagaagaaaaaccc gcaggctgttctggatgtgttgaagttttacgactcgaaggagacatc caacagccagaaatacatgagctttacagataagtcatga SEQIDNO:3 ttaattaagggatctgtagggcgcagtagtccagggtttccttgatga tgtcatacttatcctgtcccttttttttccacagctcgcggttgagga caaactcttcgcggtctttccagtggggatcgacggtatcgtagagtc gaggccgctctagaactagtggatccggaacccttaatataacttcgt ataatgtatgctatacgaagttattaggtccctcgacctgcaggaatt ctaccgggtaggggaggcgcttttcccaaggcagtctggagcatgcgc tttagcagccccgctggcacttggcgctacacaagtggcctctggcct cgcacacattccacatccaccggtagcgccaaccggctccgttctttg gtggccccttcgcgccaccttctactcctcccctagtcaggaagttcc cccccgccccgcagctcgcgtcgtgcaggacgtgacaaatggaagtag cacgtctcactagtctcgtgcagatggacagcaccgctgagcaatgga agcgggtaggcctttggggcagcggccaatagcagctttgctccttcg ctttctgggctcagaggctgggaaggggtgggtccgggggcgggctca ggggcgggctcaggggcggggcgggcgcgaaggtcctcccgaggcccg gcattctcgcacgcttcaaaagcgcacgtctgccgcgctgttctcctc ttcctcatctccgggcctttcgacctgcagccaatatgggatcggcca ttgaacaagatggattgcacgcaggttctccggccgcttgggtggaga ggctattcggctatgactgggcacaacagacaatcggctgctctgatg ccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtca agaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgc ggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcg acgttgtcactgaagcgggaagggactggctgctattgggcgaagtgc cggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtat ccatcatggctgatgcaatgcggcggctgcatacgcttgatccggcta cctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgta ctcggatggaagccggtcttgtcgatcaggatgatctggacgaagagc atcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgca tgcccgacggcgatgatctcgtcgtgacccatggcgatgcctgcttgc cgaatatcatggtggaaaatggccgcttttctggattcatcgactgtg gccggctgggtgtggcggaccgctatcaggacatagcgttggctaccc gtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcg tgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatc gccttcttgacgagttcttctgaggggatccgctgtaagtctgcagaa attgatgatctattaaacaataaagatgtccactaaaatggaagtttt tcctgtcatactttgttaagaagggtgagaacagagtacctacatttt gaatggaaggattggagctacgggggtgggggtggggtgggattagat aaatgcctgctctttactgaaggctctttactattgctttatgataat gtttcatagttggatatcataatttaaacaagcaaaaccaaattaagg gccagctcattcctcccactcatgatctatagatctatagatctctcg tgggatcattgtttttctcttgattcccactttgtggttctaagtact gtggtttccaaatgtgtcagtttcatagcctgaagaacgagatcagca gcctctgttccacatacacttcattctcagtattgttttgccaagttc taattccatcagaagcttgcagatctgcgactctagaggatctgcgac tctagaggatcataatcagccataccacatttgtagaggttttacttg ctttaaaaaacctcccacacctccccctgaacctgaaacataaaatga atgcaattgttgttgttaacttgtttattgcagcttataatggttaca aataaagcaatagcatcacaaatttcacaaataaagcatttttttcac tgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatg tctgGatctgcgactctagaggatcataatcagccataccacatttgt agaggttttacttgctttaaaaaacctcccacacctccccctgaacct gaaacataaaatgaatgcaattgttgttgttaacttgtttattgcagc ttataatggttacaaataaagcaatagcatcacaaatttcacaaataa agcatttttttcactgcattctagttgtggtttgtccaaactcatcaa tgtatcttatcatgtctgGatctgcgactctagaggatcataatcagc cataccacatttgtagaggttttacttgctttaaaaaacctcccacac ctccccctgaacctgaaacataaaatgaatgcaattgttgttgttaac ttgtttattgcagcttataatggttacaaataaagcaatagcatcaca aatttcacaaataaagcatttttttcactgcattctagttgtggtttg tccaaactcatcaatgtatcttatcatgtctggatccccatcaagctg atccggaacccttaatataacttcgtataatgtatgctatacgaagtt attaggtccctcgacctgcagcccaagctagcttatcgataccgtcga cctcgaatcacaagtttgtacaaaaaagcaggctccgcggccgccccc ttcaccatggcccctatactaggttattggaaaattaagggccttgtg caacccactcgacttcttttggaatatcttgaagaaaaatatgaagag catttgtatgagcgcgatgaaggtgataaatggcgaaacaaaaagttt gaattgggtttggagtttcccaatcttccttattatattgatggtgat gttaaattaacacagtctatggccatcatacgttatatagctgacaag cacaacatgttgggtggttgtccaaaagagcgtgcagagatttcaatg cttgaaggagcggttttggatattagatacggtgtttcgagaattgca tatagtaaagactttgaaactctcaaagttgattttcttagcaagcta cctgaaatgctgaaaatgttcgaagatcgtttatgtcataaaacatat ttaaatggtgatcatgtaacccatcctgacttcatgttgtatgacgct cttgatgttgttttatacatggacccaatgtgcctggatgcgttccca aaattagtttgttttaaaaaacgtattgaagctatcccacaaattgat aagtacttgaaatccagcaagtatatagcatggcctttgcagggctgg caagccacgtttggtggtggcgaccatcctccaaaatcggatctggtt ccgcgtggatcccacacaattcatgtcggttttgatgctgtcacaggg gagtttacgggaatgccagagcagtgggcccgcttgcttcagacatca aatatcactaagtcggagcagaagaaaaacccgcaggctgttctggat gtgttgaagttttacgactcgaaggagacatccaacagccagaaatac atgagctttacagataagtcatgaaagggtgggcgcgccgacccagct ttcttgtacaaagtggtgattcgaggtcgacggtatcgataagcttga tatcgaattccgcccctctccctcccccccccctaacgttactggccg aagccgcttggaataaggccggtgagcgtttgtctatatgttattttc caccatattgccgtcttttggcaatgtgagggcccgaaacctggccct gtcttcttgacgacgattcctaggggtctttcccctctcgccaaagga atgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagct tcttgaagacaacaacgtctgtagcgaccctttgcaggcagcggaacc ccccacctggcgacatggatagttgtggaaagagtcaaatggctctcc tcaagcgtattcaacaaggggctgaaggatgcccagaaggtaccccat tgtatgggatctgatctggggcctcggtgcacatgctttacatgtgtt tagtcgaggttaaaaaacgtctaggccccccgaaccacggggacgtgg ttttggtttgaaaaacacgatgataatatggccacaaccatggtgagc aagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctg gacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgag ggcgatgccacctacggcaagctgaccctgaagttcatctgcaccacc ggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctac ggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgac ttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatc ttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttc gagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttc aaggaggacggcaacatcctggggcacaagctggagtacaactacaac agccacaacgtctatatcatggccgacaagcagaagaacggcatcaag gtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctc gccgaccactaccagcagaacacccccatcggcgacggccccgtgctg ctgcccgacaaccactacctgagcacccagtccgccctgagcaaagac cccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgcc gccgggatcactctcggcatggacgagctgtacaagtaaagcggccgc gagctcgctgatcagcctcgactgtgccttctagttgccagccatctg ttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactc ccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctga gtaggtgtcattctattctggggggtggggtggggcaggacagcaagg gggaggattgggaagacaatagcaggcatgctggggatgcggtgggct ctatggcttctgaggcggaaagaaccagctggggctcgatcctctagt tggcgcgccgcgggagtcttctgggcaggcttaaaggctaacctggtg tgtgggcgttgtcctgcaggggaattgaacaggtgtaaaattggaggg acaagacttcccacagattttcggttttgtcgggaagttttttaatag gggcaaataggaaaatggaggataggagtcatctggggtttatgcagc aaaactacaggtatattgcttgtatccgcctcggagatttccatgagg agataaagacatgtcacccgagtttatactctcctgcttagatcctac tacagtatgaaatacagtgtggcgaggtagactatgtaagcagattta atcattttaaagagcccagtacttcatatccatttctcccgctccttc tgcagccttatcaaaaggtatttagaacactcattttagccccatttt catttattatactggcttatccaacccctagacagagcattggcattt tccctttcctgatcttagaagtctgatgactcatgaaaccagacagat tagttacatacaccacaaatcgaggctgtagctggggcctcaacactg cagttcttttataactccttagtacactttttgttgatcctttgcctt gatccttaattttcagtgtctatcacctctcccgtcaggtggtgttcc acatttgggcctattctcagtccagggagttttacaacaatagatgta ttgagaatccaacctaaagcttaactttccactcccatgaatgcctct ctcctttttctccattataactgagctatwaccattaatggtttcagg tggatgtctcctcccccaatatacctgatgtatctacatattgccagg ctgatattttaagacatwaaaggtatatttcattattgagccacatgg tattgattactgctactaaaattttgtcattgtacacatctgtaaaag gtggttccttttggaatgcaaagttcaggtgtttgttgtctttcctga cctaaggtcttgtgagcttgtattttttctatttaagcagtgctttct cttggactggcttgactcatggcattctacacgttattgctggtctaa atgtgattttgccaagcttcttcaggacctataattttgcttgacttg tagccaaacacaagtaaaatgattaagcaacaaatgtatttgtgaagc ttggtttttaggttgttgtgttgtgtgtgcttgtgctctataataata ctatccaggggctggagaggtggctcggagttcaagagcacagactgc tcttccagaagtcctgagttcaattcccagcaaccacatggtggctca caaccatctgtaatgggatctgatgccctcttctggtgtgtctgaaga ccacaagtgtattcacattaaataaataatcctccttcttcttctttt tttttttttaaagagaatwctgtctccagtagaattactgaagtaatg aaatactttgtgtttgttccaatatggwagccaataatcaaatactct twagcactggaaatgtaccaaggaactattttatttaagtgwactgtg gacagaggagccataactgcagacttgtgggatacagaagaccaatgc agacttaatgtcttttctcttacactaagcaataaagaaataaaaatt gaacttctagtatcctatttgttaaactgctagctttactaacttttg tgcttcatctatacaaagctgaaagctaagtctgcagccattactaaa catgaaagcaagtaatgataattttggatttcaaaaatgtagggccag agtttagccagccagtggtggtgcttgcctttatgccttaatcccagc actctggaggcagagacaggcagatctctgagtttgagcccagcctgg tctacacatcaagttctatctaggatagccaggaatacacacagaaac cctgttggggaggggggctctgagatttcataaaattataattgaagc attccctaatgagccactatggatgtggctaaatccgtctacctttct gatgagatttgggtattattttttctgtctctgctgttggttgggtct tttgacactgtgggctttcttaaagcctccttccctgccatgtggtct cttgtttgctactaacttcccatggcttaaatggcatggctttttgcc ttctaagggcagctgctgagwtttgcagcctgatttccagggtggggt tgggaaatctttcaaacactaaaattgtcctttaatttttttttaaaa aatgggttatataataaacctcataaaatagttatgaggagtgaggtg gactaatattaatgagtccctcccctataaaagagctattaaggcttt ttgtcttatactaactttttttttaaatgtggtatctttagaaccaag ggtcttagagttttagtatacagaaactgttgcatcgcttaatcagat tttctagtttcaaatccagagaatccaaattcttcacagccaaagtca aattaagaatttctgactttaatgttatttgctactgtgaatataaaa tgatagcttttcctgaggcagggtctcactatgtatctctgcctgatc tgcaacaagatatgtagactaaagttctgcctgcttttgtctcctgaa tactaaggttaaaatgtagtaatacttttggaacttgcaggtcagatt cttttataggggacacactaagggagcttgggtgatagttggtaaatg tgtttaagtgatgaaaacttgaattattatcaccgcaacctacttttt aaaaaaaaaagccaggcctgttagagcatgctaagggatccctaggac ttgctgagcacacaagagtagtacttggcaggctcctggtgagagcat atttcaaaaaacaaggcagacaaccaagaaactacagtaaggttacct gtctttaaccatctgcatatacacagggatattaaaatattccaaata atatttcattcaagttttcccccatcaaattgggacatggatttctcc ggtgaataggcagagttggaaactaaacaaatgttggttttgtgattt gtgaaattgttttcaagtgatagttaaagcccatgagatacagaacaa agctgctatttcgaggtctcttggttatactcagaagcacttctttgg gtttccctgcactatcctgatcatgtgctaggcctwccttaggctgat tgttgttcaaataacttaagtttcctgtcaggtgatgtcatatgattt catatatcaaggcaaaacatgttatatatgttaaacatttgkacttaa tgtgaaagttaggtctttgtgggttttgattttaatttcaaaacctga gctaaataagtcattttacatgtcttacatttggtgaattgtatattg tggtttgcaggcaagactctctgacctagtaaccctcctatagagcac tttgctgggtcacaagtctaggagtcaagcatttcaccttgaagttga gacgttttgttagtgtatactagttatatgttggaggacatgtttatc cagaagatattcaggactatttttgactgggctaaggaattgattctg attagcactgttagtgagcattgagtggcctttaggcttgaattggag tcacttgtatatctcaaataatgctggccttttttwaaaagcccttgt tctttatcaccctgttttctacataatttttgttcaaagaaatacttg tttggatctccttttgacaacaatagcatgttttcaagccatattttt tttcctttttttttttttttttggtttttcgagacagggtttctctgt atagccctggctgtcctggaactcactttgtagaccaggctggcctcg aactcagaaatccgcctgcctctgcctcctgagtgccgggattaaagg cgtgcaccaccacgcctggctaagttggatattttgtatataactata accaatactaactccactgggtggatttttaattcagtcagtagtctt aagtggtctttattggcccttattaaaatctactgttcactctaacag aggctgttggactagtggsactaagcaacttcctacggatatactagc agataagggtcagggatagaaactagtctagcgttttgtatacctacc agcttatactaccttgttctgatagaaatatttaggacatctagctta tcgatccgtcgacggtatcgataagcttgatatcgaattctaccgggt aggggaggcgcttttccaaggcagtctgagcatgcgcttagcagcccc gctggcacttggcgctacacaagtggcctytggcctcgcacacattcc acatccaccggtaggcgccaaccggctccgttctttggtggccccttc gcgccaccttctwctcctcccctagtcaggaagttcccccccgccccg cagctcgcgtcgtsaggacgtgacaaatggaagtagcacgtctcacta gtctcgtcagatggacagcaccgctgagcaatggaagcgggtaggcct ttggggcagcggccaatagcagctttgctccttcgctttctgggctca gaggctgggaaggggtgggtccgggggcgggctcaggggcgggctcag gggcggggcgggcgcccgaaggtcctccggaggcccggcattctgcac gcttcaaaagcgcacgtctgccgcgctgttctcctcttcctcatctcc gggcctttcgacctgcaggtcctcgccatggatcctgatgatgttgtt attcttctaatcttttgtatggaaaacttttcttcgtaccacgggact aaacctggttatgtagattccattcaaaaaggtatacaaaagccaaaa tctggtacacaaggaaattatgacgatgattggaaagggttttatagt accgacaataaatacgacgctgcgggatactctgtagataatgaaaac ccgctctctggaaaagctggaggcgtggtcaaagtgacgtatccagga ctgacgaaggttctcgcactaaaagtggataatgccgaaactattaag aaagagttaggtttaagtctcactgaaccgttgatggagcaagtcgga acggaagagtttatcaaaaggttcggtgatggtgcttcgcgtgtagtg ctcagccttcccttcgctgaggggagttctagcgttgaatatattaat aactgggaacaggcgaaagcgttaagcgtagaacttgagattaatttt gaaacccgtggaaaacgtggccaagatgcgatgtatgagtatatggct caagcctgtgcaggaaatcgtgtcaggcgatctctttgtgaaggaacc ttacttctgtggtgtgacataattggacaaactacctacagagattta aagctctaaggtaaatataaaatttttaagtgtataatgtgttaaact actgattctaattgtttgtgtattttagattccaacctatggaactga tgaatgggagcagtggtggaatgcagatcctagagctcgctgatcagc ctcgactgtgccttctagttgccagccatctgttgtttgcccctcccc cgtgccttccttgaccctggaaggtgccactcccactgtcctttccta ataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctat tctggggggtggggtggggcaggacagcaagggggaggattgggaaga caatagcaggcatgctggggatgcggtgggctctatggcttctgaggc ggaaagaaccagctggggctcgacctcgagggggggcccggtacccag cttttgttccctttagtgagggttaattgcgcgcttggcgtaatcatg gtcatagctgtttcctgtgtgaaattgttatccgctcacaattccaca caacatacgagccggaagcataaagtgtaaagcctggggtgcctaatg agtgagctaactcacattaattgcgttgcgctcactgcccgattccag tcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcg gggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcact gactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcac tcaaaggcggtaatacggttatccacagaatcaggggataacgcagga aagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaag gccgcgttgctggcgtttttccataggctccgcccccctgacgagcat cacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggacta taaagataccaggcgtttccccctggaagctccctcgtgcgctctcct gttccgaccctgccgcttaccggatacctgtccgcctttctcccttcg ggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcg gtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgtt cagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaac ccggtaagacacgacttatcgccactggcagcagccactggtaacagg attagcagagcgaggtatgtaggcggtgctacagagttcttgaagtgg tggcctaactacggctacactagaaggacagtatttggtatctgcgct ctgctgaagccagttaccttcggaaaaagagttggtagctcttgatcc ggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcag cagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttt tctacggggtctgacgctcagtggaacgaaaactcacgttaagggatt ttggtcatgagattatcaaaaaggatcttcacctagatccttttaaat taaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttgg tctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatc tgtctatttcgttcatccatagttgcctgactccccgtcgtgtagata actacgatacgggagggcttaccatctggccccagtgctgcaatgata ccgcgagacccacgctcaccggctccagatttatcagcaataaaccag ccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcc tccatccagtctattaattgttgccgggaagctagagtaagtagttcg ccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtg gtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaa cgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggtt agctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtg ttatcactcatggttatggcagcactgcataattctcttactgtcatg ccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtca ttctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtca atacgggataataccgcgccacatagcagaactttaaaagtgctcatc attggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctg ttgagatccagttcgatgtaacccactcgtgcacccaactgatcttca gcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaagg caaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaata ctcatactcttcctttttcaatattattgaagcatttatcagggttat tgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaa ataggggttccgcgcacatttccccgaaaagtgccacctaaattgtaa gcgttaatattttgttaaaattcgcgttaaatttttgttaaatcagct cattttttaaccaataggccgaaatcggcaaaatcccttataaatcaa aagaatagaccgagatagggttgagtgttgttccagtttggaacaaga gtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccg tctatcagggcgatggcccactacgtgaaccatcaccctaatcaagtt ttttggggtcgaggtgccgtaaagcactaaatcggaaccctaaaggga gcccccgatttagagcttgacggggaaagccggcgaacgtggcgagaa aggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtg tagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgc cgctacagggcgcgtcccattcgccattcaggctgcgcaactgttggg aagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaag ggggatgtgctgcaaggcgattaagttgggtaacgccagggttttccc agtcacgacgttgtaaaacgacggccagtgagcgcgcgtaatacgact cactatagggcgaattggagctccccgcggcaggccctccgagcgtgg tggagccgttctgtgagacagccgggtacgagtcgtgacgctggaagg ggcaagcgggtggtgggcaggaatgcggtccgccctgcagcaaccgga gggggagggagaagggagcggaaaagtctccaccggacgcggccatgg ctcgggggggggggggcagcggaggascgcttccggccgacgtctcgt cgctgattggcttyttttcctcccgccgtgtgtgaaaacacaaatggc gtgttttggttggcgtaaggcgcctgtcagttaacggcagccggagtg cgcagccgccggcagcctcgctctgcccactgggtggggcgggaggta ggtggggtgaggcgagctgnacgtgcgggcgcggtcggcctctggcgg ggcgggggaggggagggagggtcagcgaaagtagctcgcgcgcgagcg gccgcccaccctccccttcctctgggggagtcgttttacccgccgccg gccgggcctcgtcgtctgattggctctcggggcccagaaaactggccc ttgccattggctcgtgttcgtgcaagttgagtccatccgccggccagc gggggcggcgaggaggcgctcccaggttccggccctcccctcggcccc gcgccgcagagtctggccgcgcgcccctgcgcaacgtggcaggaagcg cgcgctgggggcggggacgggcagtagggctgagcggctgcggggcgg gtgcaagcacgtttccgacttgagttgcctcaagaggggcgtgctgag ccagacctccatcgcgcactccggggagtggagggaaggagcgagggc tcagttgggctgttttggaggcaggaagcacttgctctcccaaagtcg ctctgagttgttatcagtaagggagctgcagtggagtaggcggggaga aggccgcacccttctccggaggggggaggggagtgttgcaataccttt ctgggagttctctgctgcctcctggcttctgaggaccgccctgggcct gggagaatcccttgccccctcttcccctcgtgatctgcaactccagtc tttc