RECOMBINANT HERPES SIMPLEX VIRUS AND USE THEREOF

20200071679 ยท 2020-03-05

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention relates to the field of virology and tumor therapy. In particular, the present invention provides a recombinant herpes simplex virus (HSV) capable of specifically replicating at a high level in a tumor cell and effectively killing the tumor cell, but replicating at low levels in normal cells, thereby the recombinant herpes simplex virus of the present invention not only has high lethality against tumor cells, but also has significantly decreased side effects (especially neurotoxicity). Further, the present invention relates to a viral vector constructed based on the recombinant herpes simplex virus, a pharmaceutical composition comprising the recombinant herpes simplex virus or the viral vector, and the use of the recombinant herpes simplex virus or the viral vector. The recombinant herpes simplex virus of the present invention can be used to infect and kill tumor cells, and can be used for gene drug delivery into tumor cells for gene therapy.

    Claims

    1. A recombinant HSV virus, which does not express a functional ICP0 protein and ICP34.5 protein; but is capable of expressing a functional UL43 protein, a functional UL41 protein, a functional UL48 protein, or any combination thereof.

    2. The recombinant HSV virus according to claim 1, wherein the genome of the recombinant HSV virus comprises the following modifications: two copies of the ICP0 gene each independently comprising a loss-of-function mutation or which is deleted or substituted with an exogenous nucleotide sequence; and two copies of the ICP34.5 gene each independently comprising a loss-of-function mutation or which is deleted or substituted with an exogenous nucleotide sequence.

    3. (canceled)

    4. The recombinant HSV virus according to claim 2, wherein the genome of the recombinant HSV virus comprises a UL43 gene capable of expressing a functional UL43 protein, and a UL41 gene capable of expressing a functional UL41 protein, a UL48 gene, or combinations thereof, capable of expressing a functional UL48 protein.

    5. The recombinant HSV virus according to claim 1, wherein the recombinant HSV virus further comprises a fifth exogenous nucleotide sequence.

    6. A viral vector, comprising the genome of the recombinant HSV virus according to claim 1.

    7.-11. (canceled)

    12. A host cell, which is infected with the recombinant HSV virus according to claim 1, or which comprises a genome of the recombinant HSV virus, or which is transfected with a viral vector comprising a genome of the recombinant HSV virus.

    13. A method of obtaining the recombinant HSV virus according to, claim 1, comprising: (1) cultivating a host cell, which is infected with the recombinant HSV virus, or comprises a genome of the recombinant HSV virus, or is transfected with a viral vector comprising a genome of the recombinant HSV virus; (2) collecting and lysing the host cell after the host cell has undergone a lesion to obtain a lysate of the host cell; and (3) recovering the recombinant HSV virus from the lysate.

    14. A pharmaceutical composition, which comprises the recombinant HSV virus according to claim 1, or a genome of the recombinant HSV virus, or a viral vector comprising a genome of the recombinant HSV virus, and a pharmaceutically acceptable carrier or excipient.

    15. A method of treating a tumor, which comprises administering to a subject in need thereof a therapeutically effective amount of the recombinant HSV virus according to claim 1, or a viral vector comprising a genome of the recombinant HSV virus, or a pharmaceutical composition comprising the recombinant HSV virus or the viral vector.

    16. (canceled)

    17. The recombinant HSV virus according to claim 2, wherein in the genome of the recombinant HSV virus: (1) a first copy of the ICP0 gene comprises a first loss-of-function mutation, a second copy of the ICP0 gene comprises a second loss-of-function mutation; a first copy of the ICP34.5 gene comprises a third loss-of-function mutation, and a second copy of the ICP34.5 gene comprises a fourth loss-of-function mutation; or (2) a first copy of the ICP0 gene comprises a first loss-of-function mutation, a second copy of the ICP0 gene comprises a second loss-of-function mutation; and the two copies of the ICP34.5 gene are deleted; or (3) a first copy of the ICP0 gene comprises a first loss-of-function mutation, a second copy of the ICP0 gene comprises a second loss-of-function mutation; a first copy of the ICP34.5 gene is substituted with a third exogenous nucleotide sequence, and a second copy of the ICP34.5 gene is substituted with a fourth exogenous nucleotide sequence; or (4) the two copies of the ICP0 gene are deleted; a first copy of the ICP34.5 gene comprises a third loss-of-function mutation, and a second copy of the ICP34.5 gene comprises a fourth loss-of-function mutation; or (5) the two copies of the ICP0 gene are deleted; and the two copies of the ICP34.5 gene are deleted; or (6) the two copies of the ICP0 gene are deleted; a first copy of the ICP34.5 gene is substituted with a third exogenous nucleotide sequence, and a second copy of the ICP34.5 gene is substituted with a fourth exogenous nucleotide sequence; or (7) a first copy of the ICP0 gene is substituted with a first exogenous nucleotide sequence, a second copy of the ICP0 gene is substituted with a second exogenous nucleotide sequence; a first copy of the ICP34.5 gene comprises a third loss-of-function mutation, and a second copy of the ICP34.5 gene comprises a fourth loss-of-function mutation; or (8) a first copy of the ICP0 gene is substituted with a first exogenous nucleotide sequence, a second copy of the ICP0 gene is substituted with a second exogenous nucleotide sequence; and the two copies of ICP34.5 genes are deleted; or (9) a first copy of the ICP0 gene is substituted with a first exogenous nucleotide sequence, a second copy of the ICP0 gene is substituted with a second exogenous nucleotide sequence; a first copy of the ICP34.5 gene is substituted with a third exogenous nucleotide sequence, and a second copy of the ICP34.5 gene is substituted with a fourth exogenous nucleotide sequence.

    18. The recombinant HSV virus according to claim 17, wherein a) the first loss-of-function mutation, the second loss-of-function mutation, the third loss-of-function mutation, and the fourth loss-of-function mutation each is independently selected from the group consisting of: missense mutation, nonsense mutation, frameshift mutation, base deletion, base substitution, base addition, and any combination thereof; b) the first exogenous nucleotide sequence, the second exogenous nucleotide sequence, the third exogenous nucleotide sequence, and the fourth exogenous nucleotide sequence each independently encodes a foreign protein selected from the group consisting of: fluorescent protein, immunomodulatory polypeptide, cytokine, chemokine, antibody, and cytotoxic peptide, or c) a combination of a) and b).

    19. The recombinant HSV virus according to claim 18, having any one or more of the following: (1) the fluorescent protein is selected from the group consisting of green fluorescent protein, red fluorescent protein, blue fluorescent protein, yellow fluorescent protein, and any combination thereof; (2) the immunomodulatory polypeptide is selected from the group consisting of CD40L, OX40L, inducible costimulatory molecule (ICOS), FTL3L, LIGHT, CD137L, CD70, 4-1BB, GITR, CD28, and any combination thereof; (3) the cytokine is selected from the group consisting of interleukin, interferon, tumor necrosis factor, colony stimulating factor, and any combination thereof; (4) the chemokine is selected from the group consisting of CCL2, RANTES, CCL7, CCL9, CCL10, CCL12, CCL15, CCL19, CCL21, CCL20, XCL-1, and any combination thereof; (5) the cytotoxic peptide is selected from the group consisting of thymidine kinase TK (TK/GCV), TRAIL, FasL, and any combination thereof; and (6) the antibody is selected from the group consisting of anti-PD-1 antibody, anti-PD-L1 antibody, anti-TIGIT antibody, anti-BTLA antibody, anti-CTLA-4 antibody, anti-Tim-3 antibody, anti-Lag-3 antibody, anti-CD137 antibody, anti-OX40 antibody, anti-GITR antibody, anti-CD73 antibody, anti-KIR antibody, anti-ICOS antibody, anti-CSF1R antibody, anti-EGFR antibody, anti-VEGFR antibody, anti-HER2 antibody, anti-PDGFR antibody, and any combination thereof.

    20. The recombinant HSV virus according to claim 4, wherein the recombinant HSV virus has one or more characteristics selected from the group consisting of: (1) one or more non-essential genes are deleted or mutated; (2) an essential gene of the recombinant HSV virus is not deleted, and does not contain a loss-of-function mutation; (3) except for the two copies of the ICP0 gene and the two copies of the ICP34.5 gene, the genome of the recombinant HSV virus comprises all other genes of the wild-type HSV virus, and none of the other genes comprises a loss-of-function mutation; and (4) the genome of the recombinant HSV virus further comprises a modification in which a native promoter of one or more HSV genes is substituted with a tumor-specific promoter.

    21. The recombinant HSV virus according to claim 20, characterized by any one or more of the following: (1) the non-essential gene is selected from the group consisting of UL3 gene, UL4 gene, UL14 gene, UL16 gene, UL21 gene, UL24 gene, UL31 gene, UL32 gene, US3 gene, UL51 gene, UL55 gene, UL56 gene, US2 gene, US12 gene (i.e., ICP47 gene), LAT gene, nucleotide fragment corresponding to nt5853-nt7485 of JQ673480.1, and any combination thereof; (2) the non-essential gene comprises a loss-of-function mutation, or is substituted with an exogenous nucleotide sequence; (3) the essential gene comprises ICP27 gene, ICP4 gene, VP5 gene, gL gene, gH gene, gD gene, gK gene, gB gene, gN gene, UL5 gene, UL6 gene, UL8 gene, UL9 gene, UL12 gene, UL25 gene, UL26 gene, UL28 gene, UL29 gene, UL30 gene, UL33 gene, UL36 gene, UL38 gene, UL42 gene, UL48 gene and UL52 gene; and (4) the tumor-specific promoter is a promoter of hTERT.

    22. The recombinant HSV virus according to claim 4, wherein the genome of the recombinant HSV virus further comprises one or more modifications selected from the group consisting of: (1) substitution of a native promoter of the VP5 gene with a tumor-specific promoter; (2) substitution of a native promoter of the ICP27 gene with a tumor-specific promoter; (3) substitution of a native promoter of the ICP4 gene with a tumor-specific promoter; and (4) deletion or mutation of one or more of the UL55 gene, the US2 gene, the LAT gene, and the nucleotide fragment corresponding to nt5853-nt7485 of JQ673480.1.

    23. The recombinant HSV virus according to claim 1, wherein the recombinant HSV virus is a recombinant HSV-1 virus, a recombinant HSV-2 virus, or an HSV-1/HSV-2 chimeric virus; or the recombinant HSV virus is derived from a HSV-1 strain KOS.

    24. The recombinant HSV virus according to claim 5, wherein the fifth exogenous nucleotide sequence encodes a foreign protein selected from the group consisting of fluorescent protein, immunomodulatory polypeptide, cytokine, chemokine, antibody, and cytotoxic peptide.

    25. The host cell according to claim 12, wherein the cell is a tumor cell selected from the group consisting of lung cancer cell, liver cancer cell, breast cancer cell, osteosarcoma cell, ovarian cancer cell, cervical cancer cell, prostate cancer cell, glioma cell, melanoma cell, colorectal cancer cell, and pancreatic cancer cell.

    26. The pharmaceutical composition according to claim 14, characterized by any one or more of the following: (1) the pharmaceutical composition is formulated for treating a tumor; (2) the pharmaceutical composition is an injectable solution or a lyophilized powder; (3) the pharmaceutical composition comprises a therapeutically effective amount of the recombinant HSV virus or the genome of the recombinant HSV virus or the viral vector; (4) the pharmaceutical composition is a unit dose form; and (5) 10.sup.2-10.sup.9 pfu of the recombinant HSV virus is present per unit dose of the pharmaceutical composition.

    27. The method according to claim 15, characterized by any one or more of the following: (1) the tumor is selected from the group consisting of lung cancer, liver cancer, breast cancer, osteosarcoma, ovarian cancer, prostate cancer, glioma, melanoma, colorectal cancer, and pancreatic cancer; (2) the subject is a mammal; and (3) the subject is a human.

    Description

    DRAWINGS

    [0149] FIG. 1A shows the construction strategy of the recombinant virus OVN.

    [0150] FIG. 1B shows the construction strategy of the recombinant virus OVH.

    [0151] FIG. 2 is a schematic illustration of the genome modifications comprised in the recombinant viruses HSV1716, NV1020, G207, OncoVex.sup.GM-CSF (T-VEC) and OVN; wherein the symbol x indicates a deletion.

    [0152] FIG. 3 is a schematic illustration of the genome modifications comprised in the recombinant viruses OVN, OVH and dICP0 in comparison with the virus strain KOS; wherein the symbol x indicates a deletion.

    [0153] FIG. 4 shows the gel electrophoresis results of products obtained by PCR using the genome of virus strain KOS, OVN, OVH or dICP0 as a template and primers capable of specifically amplifying ICP0 gene, ICP34.5 gene, ICP27 gene or hTERT core promoter.

    [0154] FIG. 5 shows the results of real-time quantitative PCR analysis of IE gene expression (mRNA) of KOS, OVN, OVH or dICP0.

    [0155] FIG. 6 shows the virus titers after infection of L-O2 cells (FIG. 6A) or U-2 OS cells (FIG. 6B) for 48 h with virus KOS, OVN, OVH or dICP0 at a multiplicity of infection of 1 (i.e. MOI=1).

    [0156] FIG. 7 shows the virus titers at different time points (12 h, 24 h, 36 h, 48 h and 60 h after infection) after infection of monolayer U-2 OS cells with virus KOS, OVN, OVH or dICP0 at a MOI of 0.01. The results in FIG. 7 show that the virus KOS, OVN, OVH or dICP0 has substantially comparable replication ability in tumor cells (e.g., U-2 OS cells).

    [0157] FIG. 8 shows the cell survival rate after infection of L-O2 cells (FIG. 8A) or U-2 OS cells (FIG. 8B) for 72 h with virus KOS, OVN, OVH or dICP0 at a MOI of 1; wherein MOCK represents cells without being infected with the virus. The results in FIG. 8 show that the viruses KOS, OVN, OVH, and dICP0 have substantially comparable cell killing ability in tumor cells (e.g., U-2 OS cells), but viruses OVN and OVH have cell killing ability significantly lower than that of viruses KOS and dICP0 in normal cells (e.g., L-O2 cells).

    [0158] FIG. 9 shows the cell survival rate after infection of various tumor cells with virus OVN or OVH for 48 h; wherein MOCK represents tumor cells without being infected with the virus. The experimental results of FIG. 9 show that the recombinant viruses OVN and OVH can significantly kill a variety of tumor cells.

    [0159] FIG. 10 shows the survival rate of mice after intracranial injection of virus KOS, dICP0, OVN or OVH at a given dose; wherein Vehicle represents mice without being injected with the virus.

    [0160] FIG. 11 shows the tumor volume-time curves (FIG. 11A) and survival rate-time curves (FIG. 11B) of nude mice inoculated with Huh7 cells after treatment with OVN or OVH; wherein DMEM represents untreated mice.

    [0161] FIG. 12 shows the tumor volume-time curves of tumors on left flank (FIG. 12A) and tumors on right flank (FIG. 12B) of mice (C57BL/6) inoculated with Hepal-6 cells after treatment with OVN or OVH; wherein, DMEM represents untreated mice.

    [0162] FIG. 13 is a schematic illustration showing the difference in genome structure between recombinant viruses OVH, OVH1 and OVH2 and recombinant virus OVN; wherein, compared with recombinant virus OVN, the native promoter sequence of the ICP27 gene of recombinant virus OVH, the native promoter sequence of the VP5 gene of recombinant virus OVH1, the native promoter sequence of the ICP4 gene of recombinant virus OVH2, were substituted with hTERT core promoter sequence, respectively.

    [0163] FIG. 14 is a schematic illustration of the genome structure differences among the recombinant viruses d34.5/01acZ, OVN, OVN-GFP, OVN-PD-1-scfv, OVH-GFP and OVH-PD-1-scfv; wherein NULL represents deletion.

    [0164] FIG. 15 shows the results of fluorescence microscopic observation of U-2 OS cells infected with the recombinant virus OVN-GFP or OVH-GFP.

    [0165] FIG. 16 shows that after infection of U-2 OS cells with the recombinant virus OVH or OVH-PD-1-scfv for 24 h or 48 h, the ability of cell supernatants to inhibit the specific binding of PD-1/PD-L1 (FIG. 16A) and the analysis results of the interaction between the cell supernatants and PD-1 protein (FIG. 16B); wherein MOCK represents tumor cells without being infected with the virus.

    [0166] FIG. 17 shows the tumor volume-time curves of tumors on left flank (FIG. 17A) and tumors on right flank (FIG. 17B) of mice (C57BL/6) inoculated with Hepal-6 cells after treatment with OVH or OVH-PD-1-scfv; wherein, Vehicle represents untreated mice.

    [0167] FIG. 18 shows the virus titers after infection of U-2 OS cells for 60 h with virus OVN, OVN-dUL41, OVN-dUL43, OVN-dUL48, OVN-dUL55, OVN-dUS2, OVN-dLAT or OVN-dNF at a MOI of 0.01, respectively.

    [0168] FIG. 19 shows the cell survival rates after infection of normal cells (L-O2 cells, FIG. 19A) or tumor cells (U-2 OS cells, FIG. 19B) for 72 h with the virus OVN, OVN-dUL41, OVN-dUL43, OVN-dUL48, OVN-dUL55, OVN-dUS2, OVN-dLAT or OVN-dNF at a MOI of 0.5, respectively.

    SPECIFIC MODELS FOR CARRYING OUT THE INVENTION

    [0169] The invention is described with reference to the following examples which are intended to illustrate, but not limit the invention.

    [0170] Unless otherwise specified, the molecular biology experimental methods, virological experimental methods, immunoassays, and zoological experimental methods used in the present application are all experimental methods conventionally used by those skilled in the art. For example, molecular biology experimental methods can be the methods described in: J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, 1989, and F. M. Ausubel et al., Guide to Molecular Biology Experiments, 3rd edition, John Wiley & Sons, Inc., 1995. The reagents (e.g., enzymes, plasmids, and primers) used in the respective examples were purchased from commercial companies, and various reagents (e.g., enzymes) were used in accordance with the conditions recommended by the manufacturers. Those skilled in the art would understand that the examples are illustrative to the invention, and are not intended to limit the scope of the invention.

    Example 1. Construction of Recombinant Virus OVN and OVH

    [0171] (1.1) Culture and Titer Determination of Herpes Simplex Virus Type 1 (HSV-1)

    [0172] Wild-type HSV-1 strain KOS was purchased from ATCC (Cat. No. VR-1493), and its whole-genome information has been published in NCBI (GenBank: JQ673480.1). Cultured Vero cells (purchased from ATCC, USA, Cat. No. CCL-81) were infected with the strain KOS at a MOI of 0.1. After 48 hours, all cells were collected by cell scraper and centrifuged to remove the cell culture medium. The obtained cell precipitate was resuspended in fresh complete medium and stored at 80 C. Subsequently, the cell suspension was repeatedly freeze-thawed (3 times), then centrifuged, and the supernatant was collected to obtain a virus solution. The virus solution was aliquoted and stored at 80 C.

    [0173] U-2 OS cells (purchased from ATCC, USA, catalogue number HTB-96) were seeded in 6 cm culture plates at a density of 110.sup.6 cells. After the cells were grown into a monolayer, serial 10-fold dilutions of the virus solution obtained above were performed, and then the cells were infected with virus solutions (500 l) of different dilution gradients, respectively. After 75 min of infection, the cell culture medium was discarded, 5 mL of fresh complete medium was added, and the cells were further cultured. After 2 h, 10 mL of methylcellulose medium was added, and the plate was placed in an incubator for 2 days. Subsequently, a basal medium comprising 0.01% neutral red was added into the plate and incubation was continued for 12 hr. After the completion of the culture, all the cell culture medium was discarded, and the plaques of the respective culture plates were counted. According to the number of plaques of each culture plate and the dilution factor of the virus solution, the virus titer was calculated according to the following formula: virus titer (PFU/mL)=number of plaques per plate2virus dilution factor.

    [0174] (1.2) Construction of Recombinant Plasmid

    [0175] The sequence (SEQ ID NO: 1) between the 33.sup.rd base (nt33) to the 5876.sup.th base (nt5876) of the wild type HSV-1 virus genome (GenBank: JQ673480.1) was cloned to the commercially available PUC57 vector (Shanghai Shenggong) using restriction enzymes SacI and PstI, thereby obtaining plasmid PUC57-F0. Subsequently, the sequence between the NcoI and SalI cleavage sites in the plasmid PUC57-F0 was substituted with the gene sequence of LacZ (SEQ ID NO: 2) using restriction endonucleases NcoI and SalI, thereby obtaining plasmid PUC57-d34.5/01acZ. Further, the sequence between the NcoI and SalI cleavage sites in the plasmid PUC57-F0 was also cut off, thereby obtaining plasmid PUC57-d34.5/0.

    [0176] (1.3) Construction and Identification of Recombinant Viruses OVN and OVH

    [0177] The construction strategies of the recombinant viruses OVN and OVH are shown in FIG. 1A-1B, respectively.

    [0178] (1.3.1) Construction of Recombinant Virus d34.5/01acZ

    [0179] U-2 OS cells were seeded in 24-well plates at a density of 110.sup.5 cells per well and cultured overnight at 37 C. in a cell culture incubator. The recombinant plasmid PUC57-d34.5/01acZ was transfected into U-2 OS cells using transfection reagent lipofectamine 2000. After 24 h of transfection, the cells were infected with the virus strain KOS at a MOI of 3. After cytopathic effect was observed, the cells were harvested. The harvested cells were lysed by repeated freeze-thaw method, then centrifuged, and the supernatant was collected to obtain a virus solution. The virus titer of the obtained virus solution was measured.

    [0180] The harvested virus was inoculated into a culture plate in which monolayer of U-2 OS cells were grown. After culturing for 2 days, a basal medium comprising 0.01% neutral red and 100 ug/mL X-gal was uniformly added to the culture plate, and the cells were further cultured for 12 hr. Subsequently, blue plaques appearing on the culture plate were selected, and the virus obtained from the blue plaques was monoclonalized (3 times) to obtain the recombinant virus d34.5/01acZ. After being verified by sequencing, it was found that the two copies of the ICP34.5 and ICP0 genes in the recombinant virus d34.5/01acZ genome were substituted with the lacZ gene as compared to the strain KOS.

    [0181] (1.3.2) Construction of Recombinant Virus OVN (d34.5/0)

    [0182] U-2 OS cells were seeded in 24-well plates at a density of 110.sup.5 cells per well and cultured overnight at 37 C. in a cell culture incubator. The recombinant plasmid PUC57-d34.5/0 was transfected into U-2 OS cells using transfection reagent lipofectamine 2000. After 24 h of transfection, the cells were infected with the recombinant virus d34.5/01acZ at a MOI of 3. After cytopathic effect was observed, the cells were harvested. The harvested cells were lysed by repeated freeze-thaw method, then centrifuged, and the supernatant was collected to obtain a virus solution. The virus titer of the obtained virus solution was measured.

    [0183] The harvested virus was seeded into a culture plate in which monolayer of U-2 OS cells were grown. After culturing for 2 days, a basal medium comprising 0.01% neutral red and 100 ug/mL X-gal was uniformly added to the culture plate, and the cells were further cultured for 12 hr. Subsequently, white plaques appearing on the culture plate were selected, and the virus obtained from the white plaques was monoclonalized (3 times) to obtain the recombinant virus OVN (d34.5/0). After being verified by sequencing, the two copies of the lacZ gene had been deleted in the recombinant virus OVN (d34.5/0) genome as compared with the recombinant virus d34.5/01acZ; and the sequence of nt510 to nt5439 (SEQ ID NO: 6) and the sequence of nt120802 to nt125731 (SEQ ID NO: 6) of the wild type HSV-1 genome (GenBank: JQ673480.1) were deleted in the recombinant virus OVN (d34.5/0) as compared with the strain KOS.

    [0184] (1.3.3) Construction of Recombinant Virus OVH

    [0185] Sequence of base 112861 (nt112861) to 113422 (nt113422) (SEQ ID NO: 3) of the wild-type HSV-1 virus genome (GenBank: JQ673480.1) was cloned into the commercially available PUC57 vector by using restriction endonucleases SacI and PmeI, thereby obtaining plasmid PUC57-27p0. Subsequently, the sequence of base 113590 (nt113590) to base 115194 (nt115194) (SEQ ID NO: 4) of the wild-type HSV-1 viral genome (GenBank: JQ673480.1) was cloned into the plasmid PUC57-27p0 by using restriction enzymes SpeI and PstI, thereby obtaining plasmid PUC57-27p1. In the plasmid PUC57-27p1, the native promoter sequence of the ICP27 gene (nt113422 to nt113590 of the wild-type HSV-1 genome (GenBank: JQ673480.1)) had been deleted.

    [0186] Subsequently, the sequence between the PmeI and SpeI cleavage sites in the plasmid PUC57-27p1 was substituted with the LacZ expression sequence (SEQ ID NO: 2), thereby obtaining plasmid PUC57-27p/lacZ. In addition, the sequence between the PmeI and SpeI cleavage sites in the plasmid PUC57-27p1 was substituted for the core promoter sequence of the adult telomerase reverse transcriptase hTERT (SEQ ID NO: 5; see, Takakura M, Kyo S, Kanaya T, et al. Cloning of human telomerase catalytic subunit (hTERT) gene promoter and identification of proximal core promoter sequences essential for transcriptional activation in immortalized and cancer cells [J]. Cancer Res, 1999, 59 (3): 551-557), thereby obtaining plasmid PUC57-27p/htert. In the plasmid PUC57-27p/htert, the ICP27 gene was regulated by a tumor-specific promoter (i.e., the hTERT core promoter).

    [0187] Subsequently, referring to the construction methods described in (1.3.1) and (1.3.2), the recombinant virus OVN was used as a starting virus, and the hTERT core promoter sequence was introduced into the recombinant virus OVN genome by using the plasmids PUC57-27p/lacZ and PUC57-27p/htert for regulating the ICP27 gene, thereby constructing a recombinant virus OVH. After being verified by sequencing, the native promoter sequence of the ICP27 gene (nt113423 to nt113589 of the wild-type HSV-1 genome (GenBank: JQ673480.1)) had been substituted by the hTERT core promoter (SEQ ID NO: 5) in the recombinant virus OVH genome as compared with the recombinant virus OVN.

    [0188] (1.4) Comparison of Recombinant Viruses OVN and OVH with Known Recombinant HSV Viruses

    [0189] Currently, a variety of recombinant HSV viruses had been developed for use in tumor therapy, including, for example, HSV1716, NV1020, G207, OncoVex.sup.GM-CSF (T-VEC), and the like. The genome modifications comprised in these recombinant HSV viruses and the recombinant viruses OVN and OVH of the present invention are summarized in Table 2 below.

    TABLE-US-00002 TABLE 2 Genome modifications comprised in various recombinant HSV viruses Name Genetic modification Country HSV1716 Deletion of dual copies of ICP34.5 UK NV1020 Deletion of 15 kb fragment at UL/US USA junction (i.e., deletion of single copies ICP34.5, ICP0, ICP4 and UL56) G207 Deletion of dual copies of ICP34.5 USA and ICP6 OncoVex.sup.GM-CSF Deletion of dual copies of ICP34.5 USA (T-VEC) and ICP47 OVN Deletion of dual copies of China (ICP34.5 and ICP0) OVH Deletion of dual copies of (ICP34.5 China and ICP0), and the native promoter of the ICP27 gene was substituted with the hTERT core promoter

    [0190] FIG. 2 is a schematic illustration of the genome modifications comprised in recombinant viruses HSV1716, NV1020, G207, OncoVex.sup.GM-CSF (T-VEC) and OVN.

    Example 2. Characterization of Recombinant Viruses OVN and OVH

    [0191] The recombinant virus dICP0 was constructed with reference to the method described in Example 1, which had the deletion of two copies of the ICP0 gene as compared to the strain KOS. The virus strain KOS and the recombinant virus dICP0 were used as control viruses to characterize the recombinant viruses OVN and OVH. FIG. 3 is a schematic illustration of the genome modifications comprised in the recombinant viruses OVN, OVH and dICP0 compared to the virus strain KOS; wherein the recombinant virus dICP0 had the deletion of two copies of the ICP0 gene compared to the virus strain KOS; the recombinant virus OVN had the deletion of the two copies of the ICP34.5 gene and the two copies of the ICP0 gene; the recombinant virus OVH had the deletion of the two copies of the ICP34.5 gene and the two copies of the ICP0 gene, and the native promoter of the ICP27 gene was substituted with the hTERT core promoter.

    [0192] The gene deletions in the recombinant viruses OVN, OVH and dICP0 were verified by PCR. Briefly, the PCR was carried out using primers for specific amplification of ICP0 gene, ICP34.5 gene, ICP27 gene or hTERT core promoter and using the genome of the virus strain KOS, OVN, OVH or dICP0 as a template. The primers used in the PCR are summarized in Table 3.

    TABLE-US-00003 TABLE3 Primersequences SEQ ID Primer NO: name Sequence(5-3) 9 ICP0-F GACGTGTGCGCCGTGTGCACGGATGA 10 ICP0-R ACTCTGTTCTTGGTTCGCGGCCTGAGCCA 11 ICP34.5-F ATGGCCCGCCGCCGCCATCGC 12 ICP34.5-R TTAGACCGAGTTCGCCGGGC 13 ICP27-F ATGGCGACTGACATTGATATGCTAATTGA 14 ICP27-R CTAAAACAGGGAGTTGCAATAAAAATATTTGC 15 htertp-F CTCCCAGTGGATTCGCGGGCACAGAC 16 htertp-R CTGCCTGAAACTCGCGCCGCGAGGA

    [0193] After the reaction was completed, the PCR product was analyzed by gel electrophoresis. The results are shown in FIG. 4. FIG. 4 shows the gel electrophoresis results of the products obtained by PCR using a genome of virus strain KOS, OVN, OVH or dICP0 as template and primers capable of specifically amplifying ICP0 gene, ICP34.5 gene, ICP27 gene or hTERT core promoter; wherein lane 1 represents a DNA molecular weight marker; lane 2 represents a PCR product using the virus strain KOS genome as template; lane 3 represents a PCR product using the recombinant virus dICP0 genome as template; lane 4 represents a PCR product using the recombinant virus OVN genome as template; Lane 5 represents a PCR product using the recombinant virus OVH genome as template; Lane 6 represents a PCR product using water as template.

    [0194] The results in FIG. 4 show that the genome of the virus strain KOS comprised the ICP0 gene, the ICP34.5 gene and the ICP27 gene, but did not comprise the hTERT core promoter; the genome of the recombinant virus dICP0 comprised the ICP34.5 gene and the ICP27 gene, but did not comprise the ICP0 gene and the hTERT core promoter; the genome of recombinant virus OVN comprised the ICP27 gene, but did not comprise the ICP34.5 gene, the ICP0 gene and the hTERT core promoter; the genome of the recombinant virus OVH comprised the ICP27 gene and the hTERT core promoter, but did not comprise the ICP34.5 gene and the ICP0 gene.

    [0195] In addition, the gene expression (mRNA) of cells after infection with KOS, OVN, OVH or dICP0 was also analyzed by using real-time quantitative PCR. Briefly, the U-2 OS host cells were infected with KOS, OVN, OVH and dICP0, respectively. After cytopathic effect was observed, the cells were harvested and total mRNA was extracted. The total mRNA was reverse transcribed into cDNA, and real-time quantitative PCR was carried out using primers specifically amplifying the ICP0 gene, the ICP34.5 gene or the ICP27 gene, respectively. The result is shown in FIG. 5.

    [0196] FIG. 5 shows the results of real-time quantitative PCR analysis of IE gene expression (mRNA) of KOS, OVN, OVH or dICP0. The results in FIG. 5 show that the strain KOS was capable of expressing the ICP0 gene, the ICP34.5 gene and the ICP27 gene; the recombinant virus dICP0 was capable of expressing the ICP34.5 gene and the ICP27 gene, but did not express the ICP0 gene; the recombinant virus OVN and OVH were capable of expressing the ICP27 Gene, but expressed neither the ICP34.5 gene nor the ICP0 gene. This indicates that the recombinant virus dICP0 had the deletion of the two copies of the ICP0 gene, and the ICP0 protein could not be expressed after infection of the host cells; and the recombinant viruses OVN and OVH both had the deletion of the two copies of the ICP34.5 gene and the ICP0 gene, and thus the ICP0 protein and the ICP34.5 protein could not be expressed after infection of the host cells.

    Example 3. Evaluation of Replication Ability and Killing Ability of Recombinant Virus OVN/OVH

    [0197] Normal cells (L-O2 cells) and tumor cells (U-2 OS cells) in logarithmic growth phase were seeded in 6 cm culture plates at a density of 5-7.510.sup.6 cells/plate. Subsequently, the cultured cells were infected with the virus KOS, OVN, OVH or dICP0 at a MOI of 1. After 48 hours of infection, the state of the cells was observed under a microscope and photographed. Subsequently, the virus-infected cells were digested, and the survival rate of the cells was calculated by trypan blue staining. Cell survival rate (%)=(number of viable cells after infection with virus)/(number of control cells not infected with virus)100. A 3-well replicate was set for each group of experiments and the experimental result was the average of 3 independent experiments. In addition, the virus titers at different time points after infection of normal cells (L-O2 cells) and tumor cells (U-2 OS cells) with virus KOS, OVN, OVH or dICP0 were determined with reference to the protocol described in Example 1. A 3-well replicate was set for each group of experiments and the experimental result was the average of 3 independent experiments. The experimental results are shown in FIG. 6-8.

    [0198] FIG. 6 shows the virus titers after 48 h of infection of L-O2 cells (FIG. 6A) or U-2 OS cells (FIG. 6B) with virus KOS, OVN, OVH or dICP0 at a MOI of 1. The results in FIG. 6A show that both virus KOS and dICP0 had a high level of replication after infection of L-O2 cells, and their virus titers reached approximately 1.9410.sup.7 and 3.0110.sup.6 pfu/ml after 48 h of infection; while the replication ability of the virus OVN and OVH were decreased significantly, and their virus titers were only about 2.1410.sup.5 and 1.8510.sup.3 pfu/ml after 48 h of infection. The results in FIG. 6B show that the viruses KOS, OVN, OVH and dICP0 had a high level of replication after infection of U-2 OS cells, and their virus titers were 1.01-1.8310.sup.8 pfu/ml after 48 h of infection. These results indicate that the viruses KOS and dICP0 were capable of replicating at high levels in normal cells (e.g., L-O2 cells) and tumor cells (e.g., U-2 OS cells); whereas the viruses OVN and OVH were only capable of replicating at high levels in tumor cells (e.g., U-2 OS cells) (their replication abilities were only slightly decreased as compared to the viruses KOS and dICP0), and their replication abilities were significantly decreased in normal cells (e.g., L-O2 cells). For example, in L-O2 cells, the replication abilities of the viruses OVN and OVH were decreased by about 90 times and 10.sup.4 times, respectively, as compared to that of the virus KOS; and the replication abilities of the viruses OVN and OVH were decreased by about 14 times and 1.610.sup.3 times, respectively, as compared to that of the virus dICP0.

    [0199] FIG. 7 shows the virus titers at different time points (12 h, 24 h, 36 h, 48 h and 60 h after infection) after infection of monolayer U-2 OS cells with virus KOS, OVN, OVH or dICP0 at a MOI of 0.01. The results in FIG. 7 show that the virus KOS, OVN, OVH or dICP0 had substantially comparable replication ability in tumor cells (e.g., U-2 OS cells).

    [0200] FIG. 8 shows the cell survival rate after 72 h of infection of L-O2 cells (FIG. 8A) or U-2 OS cells (FIG. 8B) with virus KOS, OVN, OVH or dICP0 at a MOI of 1; wherein MOCK represents the cells without being infected with the virus. The results in FIG. 8A show that after 72 h of infection, the killing abilities of the viruses KOS and dICP0 to L-O2 cells were about 91.5% and 89%, respectively (both of them had significantly killing abilities to L-O2 cells); the killing abilities of the viruses OVN and OVH to L-O2 cells were about 42% and 5%, respectively (their killing abilities to L-O2 cells were significantly decreased). The results in FIG. 8B show that the viruses KOS, OVN, OVH and dICP0 could kill 100% of U-2 OS cells after infection for 72 h (all of them had very strong killing abilities to U-2 OS cells). These results indicate that the viruses KOS and dICP0 had extremely high killing abilities to normal cells (e.g., L-O2 cells) and tumor cells (e.g., U-2 OS cells); while the viruses OVN and OVH only had high killing abilities to tumor cells (e.g., U-2 OS cells) (their killing abilities were substantially the same as those of the viruses KOS and dICP0), but their killing abilities to normal cells (e.g., L-O2 cells) were significantly decreased. For example, in L-O2 cells, the killing abilities of the viruses OVN and OVH were decreased by about 54.1% and 94.5%, respectively, as compared with the virus KOS; and the killing abilities of the viruses OVN and OVH were decreased by about 52.8% and 94.4%, respectively, as compared with the virus dICP0.

    [0201] The experimental results in FIG. 6-8 show that compared with the wild-type virus KOS and the recombinant virus dICP0, the replication abilities and killing abilities of the recombinant viruses OVN and OVH in normal cells are significantly decreased, while their replication abilities and killing abilities in tumor cells were substantively the same (or only slightly decreased). This indicates that the recombinant viruses OVN and OVH of the present invention are capable of not only maintaining high replication ability and high killing ability (with good antitumor activity) in tumor cells, but also significantly reducing the virulence to normal cells. Therefore, the recombinant viruses OVN and OVH of the present invention are useful for antitumor treatment, and they have higher safety to normal cells and can be used at higher doses.

    [0202] In addition, the killing abilities of the recombinant viruses OVN and OVH to various tumor cells were also determined with reference to the method described above. Briefly, tumor cells in good state and in logarithmic growth phase were seeded in 6 cm culture plates at a density of 5-7.510.sup.6 cells/plate. Subsequently, the cultured tumor cells were infected with the virus OVN or OVH at a MOI of 1. After 48 hours of infection, the infected tumor cells were digested, and the survival rate of the tumor cells was calculated by trypan blue staining. In this experiment, the cells without being infected with virus were used as controls. Cell survival rate (%)=(number of viable cells after infection with virus)/(number of control cells not infected with virus)100. A 3-well replicate was set for each group of experiments and the experimental result was the average of 3 independent experiments. The experimental results are shown in FIG. 9.

    [0203] FIG. 9 shows the results of cell survival rate after infection of various tumor cells with the virus OVN or OVH for 48 h; wherein MOCK represents tumor cells that were not infected with the virus. The experimental results in FIG. 9 show that the recombinant viruses OVN and OVH could significantly kill a variety of tumor cells, including, for example, lung cancer cells H1299, H520, H1975, NCI-H358 and A549 (5 strains); liver cancer cells Huh7, Hep3B, HepG2, GSG7701, SMMC7721, Hepal-6, BEL7404, PLC/PRF, QGY7703 (9 strains); breast cancer cells MADMB231, MCF7, MADMB468 (3 strains); osteosarcoma cells U2OS and SAOS2 (2 strains); ovarian cancer cells SKOV3 and CAOV3 (2 strain); cervical cancer cells SiHA and Hela (2 strains); prostate cancer cell PC-3 (1 strain); glioma cell U87MG (1 strain); melanoma A375 (1 strain); colorectal cancer HCT116 (1 strain) and pancreatic cancer Panc1 (1 strain); and the OVN and OVH had comparable tumor killing abilities. These experimental results show that the recombinant viruses OVN and OVH of the present invention have good killing activity to various tumor cells and can be used for tumor treatment.

    Example 4. Evaluation of Neurotoxicity and In Vivo Safety of Recombinant Virus OVN/OVH

    [0204] Herpes viruses are neurotoxic and neurologically latent, with the greatest danger being the ability to infect the central nervous system of humans or animals, leading to serious side effects such as encephalitis. Therefore, the most direct and sensitive way to assess the safety of herpes viruses is to inject the virus intracranially into young mice and assess the direct killing of the mouse central nervous system by the virus. In this example, we evaluated the neurotoxicity and safety of various recombinant HSV-1 viruses in mice using a mouse encephalitis model induced by intracranial injection of virus.

    [0205] Briefly, 4-6 weeks old BALB/c female mice (n=10) were used as experimental subjects, and 20 l of virus was slowly injected intracranially at the left anterior lobe of brain, near the junction of coronal suture and sagittal suture. After the injection, the incidence and survival of the mice were observed every day. FIG. 10 shows the survival rate of mice after intracranial injection of virus KOS, dICP0, OVN or OVH at a given dose; wherein Vehicle represents mice without being injected with virus.

    [0206] The results show that when intracranial injection of 110.sup.4 PFU of wild-type virus KOS, 100% of the mice developed moderate to severe side effects; after the onset of disease, the mice were often accompanied by symptoms such as hair rising, anorexia, cold, dilatory, and even paralyzed; and 100% of mice died within 4-6 days after virus injection (FIG. 10). When intracranial injection of 110.sup.5 PFU of virus dICP0, about 80% of mice died within 4-8 days after virus injection, and only 20% of the mice gradually recovered after one week.

    [0207] When a high dose (110.sup.7 PFU) of virus OVN was injected intracranially, no mice (0/10) died during the entire experimental period, and the survival rate of the mice was 100%. This indicates that compared with the wild-type virus KOS and the recombinant virus dICP0, the neurotoxicity of the virus OVN was significantly decreased, the safety in vivo was remarkably improved, and the doses used could be increased by at least 1000 times and 100 times, respectively.

    [0208] When a higher dose (410.sup.7 PFU) of virus OVN was injected intracranially, only one mouse (1/10) died during the entire experimental period, and the mouse survival rate was 90%. This indicates that the virus OVN had a half-lethal dose higher than 410.sup.7 PFU in mice, and thus had excellent in vivo safety.

    [0209] When 410.sup.7 PFU of virus OVH was injected intracranially, no mice (0/10) died during the entire experimental period, and the mouse survival rate was 100%. And, more importantly, the mice did not show any adverse reactions throughout the experimental period. This indicates that the virus OVH had further significantly decreased neurotoxicity and further significantly improved the safety in vivo, as compared to the virus OVN.

    [0210] The above experimental results show that the viruses OVN and OVH of the present invention have low neurotoxicity, high safety in vivo, and have broad application prospects.

    Example 5. Evaluation of Therapeutic Potential of Recombinant Virus OVN/OVH

    [0211] Tumor cells (Huh7 and Hepal-6) were cultured in complete medium comprising 10% calf serum in a 37 C., 5% CO.sub.2 incubator. When the cells were grown to logarithmic growth phase, the cells were digested with 0.05% trypsin and washed with PBS to obtain a cell suspension (cell density of 510.sup.7/mL) resuspended in PBS.

    [0212] 0.1 mL of Huh7 cell suspension was inoculated subcutaneously into the right flank of each of 5-6 weeks old nude mice. When the tumor on mouse back grew to 6 mm6 mm (tumor volume was approximately 100 mm.sup.3), the mice were grouped (n=8/group) and treatment was started (Day 0). The treatment regimen was as follows: 110.sup.7 PFU virus (OVN or OVH) or the same volume of DMEM (used as a control) was injected intratumorally, once every 3 days, for a total of 3 injections.

    [0213] 0.1 mL of Hepal-6 cell suspension was inoculated subcutaneously on the left and right flanks of each of 5-week-old mice (C57BL/6). When the tumor on mouse back grew to 6 mm6 mm (tumor volume was approximately about 100 mm.sup.3), the mice were grouped and treatment was started. The treatment regimen was as follows: 110.sup.7 PFU virus (OVN or OVH) or the same volume of DMEM was injected intratumorally, once every 3 days, for a total of 3 injections.

    [0214] The status of mice was monitored every 3 days and the tumor size was measured using an electronic vernier caliper. Tumor volume and tumor inhibition rate were calculated according to the following formula:


    V(volume)=[L(W).sup.2]/2; L represents a long diameter, and W represents a short diameter.


    Tumor inhibition rate=(tumor volume of control grouptumor volume of experimental group)/tumor volume of control group100%.

    [0215] The experimental results are summarized in FIG. 11-12.

    [0216] FIG. 11 shows the tumor volume-time curves (FIG. 11A) and survival rate-time curves (FIG. 11B) of the nude mice inoculated with Huh7 cells after treatment with OVN or OVH; wherein DMEM represents untreated mice. The results of FIG. 11A show that after three doses of virus injections, both the recombinant viruses OVN and OVH significantly inhibited tumor growth; on day 21, the inhibition rate of OVN reached 86.1%, and the inhibition rate of OVH reached 78%. The results in FIG. 11B show that after three virus injections, the recombinant viruses OVN and OVH significantly prolonged the survival time of tumor-bearing nude mice; on day 60, the control group of nude mice died completely, while the nude mice administrated with the recombinant virus OVN or OVH still had a survival rate of 75% after the end of the experiment.

    [0217] FIG. 12 shows the tumor volume-time curves of tumors on left flank (FIG. 12A) and tumors on right flank (FIG. 12B) of mice (C57BL/6) inoculated with Hepal-6 cells after treatment with OVN or OVH; wherein DMEM represents untreated mice. The results in FIG. 12 show that after three doses of virus injections on the right flank tumors, the recombinant viruses OVN and OVH not only safely cleared the right flank tumors of the mice, but also cleared the left flank tumors.

    [0218] These experimental results have confirmed that the viruses OVN and OVH of the present invention have significant potential for treating tumors in vivo, and have broad application prospects.

    Example 6. Construction and Characterization of Other Recombinant Viruses (1)

    [0219] In this example, a series of derived recombinant viruses were constructed based on the recombinant viruses OVN and OVH.

    [0220] Referring to the method described in Example 1 (particularly 1.3.1 to 1.3.3), the recombinant virus OVN was used as the starting virus, and the hTERT core promoter sequence was introduced into the recombinant virus OVN genome by the recombinant plasmid for regulating the VP5 gene or the ICP4 gene, thereby constructing recombinant viruses OVH1 and OVH2.

    [0221] After being verified by sequencing, the native promoter sequence of the VP5 gene (nt40729 to nt40475 of the wild-type HSV-1 genome (GenBank: JQ673480.1)) had been substituted with the hTERT core promoter sequence (SEQ ID NO: 5) in the recombinant virus OVH1 genome compared with the recombinant virus OVN; in the recombinant virus OVH2 genome, the native promoter sequence of the ICP4 gene (nt146151 to nt146867 and nt131706 to nt130990 of the wild-type HSV-1 genome (GenBank: JQ673480.1)) had been substituted with the hTERT core promoter sequence (SEQ ID NO: 5).

    [0222] FIG. 13 is a schematic illustration showing the differences in genome structure between the recombinant viruses OVH, OVH1 and OVH2 and the recombinant virus OVN; wherein, the native promoter sequence of the ICP27 gene of the recombinant virus OVH, the native promoter sequence of the VP5 gene of the recombinant virus OVH1, and the native promoter sequence of the ICP4 gene of the recombinant virus OVH2 were substituted with the hTERT core promoter sequence, respectively, as compared with the recombinant virus OVN.

    [0223] Further, referring to the method described in Example 1 (particularly 1.3.1 to 1.3.3), the recombinant virus d34.5/01acZ was used as the starting virus, and the nucleotide sequence encoding the GFP protein (SEQ ID NO: 7) and the nucleotide sequence encoding the anti-human PD-1 single chain antibody (SEQ ID NO: 8) were introduced into the recombinant virus d34.5/01acZ genome to replace the lacZ gene by using recombinant plasmids, thereby constructing and obtaining the recombinant viruses OVN-GFP And OVN-PD-1-scfv. After being verified by sequencing, compared with the recombinant virus d34.5/01acZ, in the recombinant virus OVN-GFP genome, the two copies of the lacZ gene had been substituted with the nucleotide sequence encoding the GFP protein (i.e., in the genome of the recombinant virus OVN-GFP, the sequence of nt510 to nt5439 and the sequence of nt120802 to nt125731 of the wild-type HSV-1 genome (GenBank: JQ673480.1) were substituted with the nucleotide sequence encoding the GFP protein); in the genome of the recombinant virus OVN-PD-1-scfv, the two copies of the lacZ gene had been substituted with the nucleotide sequence encoding the PD-1 single-chain antibody (i.e., in the genome of the recombinant virus OVN-PD-1-scfv, the sequence of nt510 to nt5439 and the sequence of nt120802 to nt125731 of the wild-type HSV-1 genome (GenBank: JQ673480.1) were substituted with the nucleotide sequence encoding the PD-1 single chain antibody).

    [0224] Further, the recombinant virus OVN-GFP and OVN-PD-1-scfv were used as the starting viruses, and the hTERT core promoter sequence was introduced into the starting virus genome to regulate the ICP27 gene by using plasmids PUC57-27p/lacZ and PUC57-27p/htert, thereby constructing and obtaining recombinant viruses OVH-GFP and OVH-PD-1-scfv.

    [0225] After being verified by sequencing, compared with recombinant virus OVN-GFP, the native promoter sequence of the ICP27 gene (nt113423 to nt113589 of the wild-type HSV-1 genome (GenBank: JQ673480.1)) in the recombinant virus OVH-GFP genome had been substituted with the hTERT core promoter sequence (SEQ ID NO: 5). Compared with the recombinant virus OVN-PD-1-scfv, the native promoter sequence of the ICP27 gene (nt113423 to nt113589 of the wild-type HSV-1 genome (GenBank: JQ673480.1)) in the recombinant virus OVH-PD-1-scfv genome had been substituted with the hTERT core promoter sequence (SEQ ID NO: 5).

    [0226] FIG. 14 is a schematic illustration showing the genome structure differences of recombinant viruses d34.5/01acZ, OVN, OVN-GFP, OVN-PD-1-scfv, OVH-GFP and OVH-PD-1-scfv.

    [0227] U-2 OS cells (purchased from ATCC, USA, item number HTB-96) were seeded in 6 cm culture plates at a density of 110.sup.6 cells. After the cells were grown into a monolayer, the cells were infected with the recombinant viruses OVN-GFP and OVH-GFP, respectively. After cytopathic effect was observed, the cells infected with the recombinant viruses OVN-GFP and OVH-GFP were observed under a fluorescence microscope. The results are shown in FIG. 15. FIG. 15 shows the results of the fluorescence microscopic observation of the U-2 OS cells infected with the recombinant virus OVN-GFP or OVH-GFP. The results in FIG. 15 show that the OVN-GFP and OVH-GFP infected U-2 OS cells were capable of emitting green fluorescence. This indicates that the recombinant viruses OVN-GFP and OVH-GFP were capable of expressing GFP protein after infection of the host cells.

    [0228] U-2 OS cells (purchased from ATCC, USA, catalogue number HTB-96) were seeded in 6 cm culture plates at a density of 110.sup.6 cells. After the cells were grown into a monolayer, the cells were infected with the recombinant viruses OVH and OVH-PD-1-scfv, respectively. The culture supernatants of the cells were harvested for after 24 h and 48 h of infection, respectively, for subsequent analysis. The supernatant collected 48 h after infection was subjected to serial 2-fold gradient dilutions, and the ability of supernatant of each dilution to inhibit interaction between PD-1 and PD-L1 was determined by an ELISA method based on competition between PD-1 single-chain antibody and PD-L1 protein for binding to PD-1 protein. In addition, the abilities of the supernatants collected at 24 h and 48 h after infection to bind PD-1 was also determined by an ELISA method based on the reactivity between PD-1 single-chain antibody and PD-1 protein. The experimental results are shown in FIG. 16.

    [0229] FIG. 16 shows after infection of U-2 OS cells with recombinant virus OVH or OVH-PD-1-scfv for 24 h or 48 h, the ability of the cell supernatants to inhibit the specific binding of PD-1/PD-L1 (FIG. 16A), and the results of analysis of the interaction between the cell supernatants and the PD-1 protein (FIG. 16B); wherein MOCK represents tumor cells without being infected with the virus. The results in FIG. 16 show that the supernatants of OVH-PD-1-scfv-infected U-2 OS cells were capable of inhibiting the specific binding of PD-1/PD-L1 and were capable of specifically binding to PD-1. This indicates that the recombinant virus OVH-PD-1-scfv expressed a PD-1 single-chain antibody after infection of host cells, which bound to PD-1 and blocked the interaction between PD-1 and PD-L1.

    [0230] The experimental results of FIG. 15-16 indicate that the genomes of the recombinant viruses OVN and OVH of the present invention are useful as viral vectors for carrying and expressing foreign genes.

    [0231] In addition, the abilities of the recombinant viruses OVH and OVH-PD-1-scfv to treat tumors were also verified in mice (C57BL/6) inoculated with Hepal-6 cells according to the method described in Example 5. The results are shown in FIG. 17.

    [0232] FIG. 17 shows the tumor volume-time curves of tumors on left flank (FIG. 17A) and tumors on right flank (FIG. 17B) of mice (C57BL/6) inoculated with Hepal-6 cells after treatment with OVH or OVH-PD-1-scfv; wherein Vehicle represents untreated mice. The results in FIG. 17 show that after three doses of virus injections on the right flank tumors, the recombinant viruses OVH and OVH-PD-1-scfv not only safely cleared the right flank tumors of the mice, but also cleared the left flank tumors.

    [0233] These experimental results confirm that the recombinant viruses OVH-PD-1-scfv and OVH of the present invention have significant potential for treating tumors in vivo, and have broad application prospects.

    Example 7. Construction and Characterization of Other Recombinant Viruses (2)

    [0234] In this example, a series of derived recombinant viruses were constructed based on the recombinant virus OVN. Briefly, with reference to the method described in Example 1 (especially 1.3.1 to 1.3.3), the recombinant virus OVN was used as the starting virus, and the non-essential gene UL41, UL43, UL48, UL55, US2, LAT or NF in the recombinant virus OVN genome was deleted by using recombinant plasmids, respectively, thereby constructing and obtaining recombinant viruses OVN-dUL41, OVN-dUL43, OVN-dUL48, OVN-dUL55, OVN-dUS2, OVN-dLAT and OVN-dNF.

    [0235] According the verification by sequencing, compared with the recombinant virus OVN, the recombinant virus OVN-dUL41 genome had a deletion of the UL41 (vhs) gene (GenBank: AFE62869.1; corresponding to nt91088 to nt92557 of the wild-type HSV-1 genome (GenBank: JQ673480.1)); the recombinant virus OVN-dUL43 genome had a deletion of the UL43 gene (GenBank: AFE62871.1; corresponding to nt94721 to nt95968 of the wild-type HSV-1 genome (GenBank: JQ673480.1)); the recombinant virus OVN-dUL48 genome had a deletion of the UL48 (VMW65) gene (GenBank: AFE62876.1; corresponding to nt103527 to nt104999 of the wild-type HSV-1 genome (GenBank: JQ673480.1)); the recombinant virus OVN-dUL55 genome had a deletion of the UL55 gene (GenBank: AFE62884.1; corresponding to nt115418-nt115978 of the wild-type HSV-1 genome (GenBank: JQ673480.1)); the recombinant virus OVN-dUS2 genome had a deletion of the US2 gene (GenBank: AFE62890.1; corresponds to nt133911 to nt134786 of the wild-type HSV-1 genome (GenBank: JQ673480.1); the recombinant virus OVN-dLAT genome had a deletion of the LAT gene (corresponding to nt4781 to nt7062 of the wild-type HSV-1 genome (GenBank: JQ673480.1)); and, the recombinant virus OVN-dNF genome had a deletion of the nucleotide fragment (NF) (corresponding to nt5853 to nt7485 of the wild-type HSV-1 genome (GenBank: JQ673480.1)).

    [0236] Alternatively, CRISPR technology can also be used, for example, by designing specific sgRNA primers and using the commercially available LentiCRISPR v2 vector (Addgene), the non-essential gene UL41, UL43, UL48, UL55, US2, LAT or NF in the recombinant virus OVN genome could be deleted, respectively.

    [0237] Information on the non-essential genes UL41, UL43, UL48, UL55, US2, LAT and NF is also provided in Table 4.

    TABLE-US-00004 TABLE 4 Information on non-essential genes Gene name GenBank No. Sites in genome SEQ ID NO: UL41 (vhs) AFE62869.1 nt91088-nt92557 17 UL43 AFE62871.1 nt94721-nt95968 18 UL48 (VMW65) AFE62876.1 nt103527-nt104999 19 UL55 AFE62884.1 nt115418-nt115978 20 US2 AFE62890.1 nt133911-nt134786 21 LAT Derived from nt4781-nt7062 22 JQ673480.1 Nucleotide fragment Derived from nt5853-nt7485 23 (NF) JQ673480.1

    [0238] Tumor cells (U-2 OS cells) in good condition and in logarithmic growth phase were seeded in 6 cm culture plates at a density of 5-7.510.sup.6 cells/plate. Subsequently, the cultured cells were infected with the recombinant virus OVN, OVN-dUL41, OVN-dUL43, OVN-dUL48, OVN-dUL55, OVN-dUS2, OVN-dLAT or OVN-dNF, respectively, at a MOI of 0.01. After 60 h of infection, the virus titer of the above recombinant virus was determined by referring to the protocol described in Example 1. A 3-well replicate was set for each group of experiments and the experimental result was the average of 3 independent experiments. The experimental results are shown in FIG. 18.

    [0239] FIG. 18 shows the virus titers after 60 h of infection of U-2 OS cells with virus OVN, OVN-dUL41, OVN-dUL43, OVN-dUL48, OVN-dUL55, OVN-dUS2, OVN-dLAT or OVN-dNF, respectively, at a MOI of 0.01. The results in FIG. 18 show that after infection of U-2 OS cells, the viruses OVN, OVN-dUL55, OVN-dUS2, OVN-dLAT and OVN-dNF showed replication at high levels: after 60 h of infection, their viral titers were between 1.01-1.1810.sup.8 pfu/ml, on the order of 10.sup.8 pfu/ml; while the viruses OVN-dUL43, OVN-dUL41 and OVN-dUL48 showed replication at low levels: after 60 h of infection, their virus titers were lower than 10.sup.7 pfu/ml, on the order of 10.sup.4 to 10.sup.6 pfu/ml. The viral titers of these recombinant viruses are also provided in Table 5.

    TABLE-US-00005 TABLE 5 Viral titers of recombinant viruses after 60 h of infection of U-2 OS cells Recombinant virus Viral titer (pfu/ml) Recombinant virus Viral titer (pfu/ml) OVN 1.01 10.sup.8 8.54 10.sup.6 OVN-dUL55 1.05 10.sup.8 5.00 10.sup.6 OVN-dUL41 1.80 10.sup.5 2.65 10.sup.4 OVN-dUS2 1.18 10.sup.8 2.89 10.sup.6 OVN-dUL43 1.83 10.sup.6 2.89 10.sup.5 OVN-dLAT 1.07 10.sup.8 5.77 10.sup.6 OVN-dUL48 3.37 10.sup.4 3.21 10.sup.3 OVN-dNF 1.02 10.sup.8 7.64 10.sup.6

    [0240] These results indicate that the viruses OVN, OVN-dUL55, OVN-dUS2, OVN-dLAT, and OVN-dNF were capable of replicating at high levels in tumor cells (e.g., U-2 OS cells); whereas the replication abilities of the viruses OVN-dUL43, OVN-dUL41 and OVN-dUL48 in tumor cells (e.g., U-2 OS cells) were significantly decreased. For example, in U-2 OS cells, the replication abilities of the viruses OVN-dUL41, OVN-dUL43 and OVN-dUL48 were decreased by about 561 times, 55 times, and 310.sup.3 times, respectively, as compared to the virus OVN.

    [0241] In addition, the cultured normal cells (L-O2 cells) or tumor cells (U-2 OS cells) were infected with the recombinant virus OVN, OVN-dUL41, OVN-dUL43, OVN-dUL48, OVN-dUL55, OVN-dUS2, OVN-dLAT or OVN-dNF, respectively, at a MOI of 0.5. After 72 hours of infection, the survival rate of the cells was determined. A 3-well replicate was set for each set of experiments and the experimental result was the average of 3 independent experiments. The experimental results are shown in FIG. 19.

    [0242] FIG. 19 shows the cell survival rate of normal cells (L-O2 cells; FIG. 19A) or tumor cells (U-2 OS cells; FIG. 19B) after 72 h of infection with the virus OVN, OVN-dUL41, OVN-dUL43, OVN-dUL48, OVN-dUL55, OVN-dUS2, OVN-dLAT or OVN-dNF, respectively, at a MOI of 0.5.

    [0243] The results of FIG. 19A show that the killing rates of the viruses OVN-dUL41 and OVH-dUL48 on L-O2 cells after 72 h of infection were about 17.67% and 14.33%, respectively; the killing abilities of both on L-O2 cells were stronger than that of the virus OVN. The killing rates of the viruses OVN-dUL43, OVN-dUL55, OVN-dUS2, OVN-dLAT and OVN-dNF on L-O2 cells were between 8.33% and 11.00%, which were not significantly different from that of the virus OVN.

    [0244] The results in FIG. 19B show that the killing rates of the viruses OVN, OVN-dUL55, OVN-dUS2, OVN-dLAT and OVN-dNF on U-2 OS cells after 72 h of infection were 100% (i.e., having extremely high killing ability on the tumor cells). The killing abilities of the viruses OVN-dUL41, OVN-dUL43 and OVN-dUL48 on U-2 OS cells was significantly decreased.

    [0245] The killing rates of these recombinant viruses against L-O2 and U-2 OS cells are also provided in Table 6.

    TABLE-US-00006 TABLE 6 Killing rates of recombinant viruses against L-O2 cells and U-2 OS cells Killing rate Recombinant virus L-O2 cells U-2 OS cells OVN 90.00% 1.00% 0.87% 0.71% OVN-dUL41 82.33% 0.58% 76.00% 2.65% OVN-dUL43 89.00% 1.00% 52.67% 0.58% OVN-dUL48 85.67% 1.15% 68.33% 0.58% OVN-dUL55 90.33% 0.58% 0.90% 0.10% OVN-dUS2 90.67% 0.58% 0.77% 0.06% OVN-dLAT 90.33% 0.58% 0.46% 0.05% OVN-dNF 91.67% 0.58% 0.90% 0.10%

    [0246] These results indicate that, similar to the virus OVN, the viruses OVN-dUL55, OVN-dUS2, OVN-dLAT and OVN-dNF had only very limited killing activity to normal cells (e.g., L-O2 cells), whereas their killing abilities to tumor cells (e.g., U-2 OS cells) were extremely high; this indicates that the four recombinant viruses were equivalent to the virus OVN. Compared with the virus OVN, the viruses OVN-dUL41 and OVH-dUL48 not only had enhanced killing ability to normal cells (e.g., L-O2 cells), but also had significantly decreased killing ability to tumor cells (e.g., U-2 OS cells); which indicate that the two recombinant viruses had increased toxicity to normal cells and decreased antitumor activity. Although the killing activity of the virus OVN-dUL43 to normal cells (e.g., L-O2 cells) was not significantly enhanced as compared with the virus OVN, its killing activity to tumor cells (e.g., U-2 OS cells) was significantly decreased.

    [0247] Specifically, in normal cells, the killing abilities of the viruses OVN-dUL41, OVN-dUL43 and OVH-dUL48 were increased by about 7.67%, 1.00%, and 4.33%, respectively, as compared to the virus OVN. In tumor cells, the killing abilities of the viruses OVN-dUL41, OVN-dUL43 and OVH-dUL48 were decreased by about 75.13%, 51.80% and 67.46%, respectively, as compared to the virus OVN.

    [0248] The above experimental results indicate that in the recombinant HSV virus of the present invention, non-essential genes other than UL41, UL43 and UL48 (e.g., UL55, US2, LAT and NF) may be further modified, for example, inserted with a loss-of-function mutation, or deleted.

    [0249] Although the specific embodiments of the invention have been described in detail, it would be understood by those skilled in the art that various modifications and changes can be made in the details of the present invention. The full scope of the invention is given by the appended claims and any equivalents thereof.