NANOPLASMONIC SENSOR AND KIT FOR BIOMOLECULE ANALYSIS, AND METHOD OF ANALYZING BIOMOLECULE USING THE SAME
20200072830 ยท 2020-03-05
Inventors
Cpc classification
G01N21/554
PHYSICS
G01N33/54373
PHYSICS
International classification
Abstract
Provided is a nanoplasmonic sensor and a kit for biomolecule analysis, and a method of analyzing a biomolecule using the same. The method includes: providing the nanoplasmonic sensor including a dielectric grating extending in one direction, and a metal structure disposed to cover an upper surface and a side surface of the dielectric grating and have at least one bent portion; immobilizing a first probe molecule on a surface of the metal structure; hybridizing an analyte with the first probe molecule by introducing the analyte having a base sequence complementary to the first probe molecule; binding a second probe molecule that is hybridized with the first probe molecule to the analyte; binding an enzyme to the second probe molecule; introducing a substrate that reacts with the enzyme to produce a precipitate by an enzymatic reaction; and measuring localized surface plasmon resonance in the metal structure.
Claims
1. A method for analyzing a biomolecule using a nanoplasmonic sensor comprising: providing the nanoplasmonic sensor including a dielectric grating extending in one direction, and a metal structure disposed to cover an upper surface and a side surface of the dielectric grating and have at least one bent portion; immobilizing a first probe molecule on a surface of the metal structure; hybridizing an analyte with the first probe molecule by introducing the analyte having a base sequence complementary to the first probe molecule; binding a second probe molecule that is hybridized with the first probe molecule to the analyte; binding an enzyme to the second probe molecule; introducing a substrate that reacts with the enzyme to produce a precipitate by an enzymatic reaction; and measuring localized surface plasmon resonance in the metal structure.
2. The method according to claim 1, wherein the first probe molecule has a hairpin structure, in the step of immobilizing the first probe molecule.
3. The method according to claim 1, wherein the analyte has a shorter length than a length of the first probe molecule, and is bound to a melted lower end of the first probe molecule, in the step of hybridizing the analyte.
4. The method according to claim 1, wherein the analyte is microRNA (miRNA), and the first probe molecule is a locked nucleic acid (LNA).
5. The method according to claim 4, wherein the step of hybridizing the analyte includes hybridizing the analyte at a temperature range of about 60 C. or higher, and cooling the hybridized analyte to a temperature range of about 10 C. or lower.
6. The method according to claim 1, wherein the metal structure includes gold (Au), and the first probe molecule has a thiol group that is bound to the metal structure.
7. The method according to claim 1, wherein the second probe molecule has a molecular end group that is bound to the enzyme.
8. The method according to claim 7, wherein the second probe molecule has a biotin molecular end group, and the enzyme has a streptavidin molecular end group.
9. The method according to claim 1, wherein the substrate is at least one of 4-chloronaphthol, 3,3-diaminobenzidine (DAB), 3-amino-9-ethylcarbazole (AEC), 3,3,5,5-tetramethylbenzidine (TMB), 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT), 4-chloro-2-methylbenzenediazonium (TR)/3-hydroxy-2-naphthoic acid 2,4-dimethylanilide phosphate (Naphthol AS-MX phosphate), 5-bromo-4-chloro-3-indolyl -D-galactopyranoside (X-gal), 3,4-cyclohexenoesculetin -D-galactopyranoside (S-gal), 5-bromo-3-indolyl -D-galactopyranoside (Bluo-gal), and 6-chloro-3-indolyl--D-galactopyranoside (Red-gal).
10. The method according to claim 1, wherein the nanoplasmonic sensor further comprises a base layer on which the dielectric grating is disposed, wherein the metal structure comprises: a first horizontal portion disposed on the upper surface of the dielectric grating; a vertical portion bent from the first horizontal portion and disposed along the side surface of the dielectric grating; and a second horizontal portion bent from the vertical portion and disposed along an upper surface of the base layer.
11. The method according to claim 10, wherein the second horizontal portion is bent from the vertical portion in a direction opposite to a bending direction of the first horizontal portion.
12. The method according to claim 1, wherein the total width of the metal structure is in a range of 10 nm to 500 nm.
13. The method according to claim 1, wherein a thickness of the metal structure is in a range of 1 nm to 200 nm.
14. A nanoplasmonic sensor for biomolecule analysis comprising: a sensing portion including at least one dielectric grating disposed on a base layer to extend in one direction, and a metal structure disposed to cover an upper surface and a side surface of the dielectric grating and have at least one bent portion; a material supplying portion sequentially providing: a first probe molecule, an analyte having a base sequence complementary to the first probe molecule, a second probe molecule that is hybridized with the first probe molecule, an enzyme that is bound to the second probe molecule, and a substrate that reacts with the enzyme to form a precipitate, to the metal structure; and a measurement portion for measuring localized surface plasmon resonance phenomenon in the metal structure, including a light source unit disposed on an upper portion of the base layer and generating incident light incident on the metal structure, and a light receiving unit disposed on a lower portion of the base layer and detecting a change in optical characteristics in the metal structure.
15. A kit for biomolecule analysis comprising: at least one dielectric grating disposed on a base layer to extend in one direction; a metal structure disposed to cover an upper surface and a side surface of the dielectric grating and have at least one bent portion; a first probe molecule hybridized with an analyte and bound to a surface of the metal structure; a second probe molecule hybridized with the first probe molecule at an end not bound to the analyte; an enzyme bound to the second probe molecule; and a substrate reacting with the enzyme to form a precipitate on a surface of the metal structure.
16. The kit according to claim 15, wherein the first probe molecule is a locked nucleic acid (LNA).
17. The kit according to claim 15, wherein the kit is used for detecting the analyte having a base sequence complementary to the first probe molecule.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0009] The above and other aspects, features, and advantages of the present disclosure will be more clearly understood from the following detailed description, taken in conjunction with the accompanying drawings, in which:
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
DETAILED DESCRIPTION
[0018] Hereinafter, embodiments of the present disclosure will be described as follows with reference to the attached drawings.
[0019] Embodiments of the present disclosure may be modified into various other forms, or various embodiments may be combined, and the scope of the present disclosure is not limited to embodiments to be described below. Further, embodiments of the present disclosure may be provided to more fully explain the present disclosure to those skilled in the art. Therefore, the shapes and sizes of the elements in the drawings may be exaggerated for clarity, and the elements denoted by the same reference numerals in the drawings are the same elements.
[0020] Nanoplasmonic Sensor and Kit for Biomolecular Analysis
[0021]
[0022] Referring to
[0023] The nanoplasmonic sensor 10 may be used for detection, measurement, and analysis of biomolecules and chemicals such as a gene, a biotic enzyme, a cell, and a protein, by using a localized surface plasmon resonance phenomenon.
[0024] The sensing portion 100 may include a base layer 101, a dielectric grating 110, and a metal structure 120. The sensing portion 100 may further include well-type chambers 150 that distinguish the dielectric grating 110 and the metal structure 120 as predetermined regions. Analysis may be carried out in each of the well-type chambers 150 under conditions identical to or different from each other.
[0025] The base layer 101 may be selected from a conventional semiconductor substrate such as a silicon substrate, or an insulating substrate. In particular, the base layer 101 may be a light-transmitting substrate for transmitting a specific light source, and may be made of, for example, polyurethane acrylate (PUA) or polyethylene terephthalate (PET). In an exemplary embodiment, the base layer 101 may be made of a transparent oxide such as titanium oxide (TiO.sub.2), tantalum oxide (Ta.sub.2O.sub.5), aluminum oxide (Al.sub.2O.sub.3), or the like.
[0026] The dielectric grating 110 may be disposed on the base layer 101. A plurality of the dielectric gratings 110 may be spaced apart from each other by a predetermined gap in one direction. In addition, the dielectric grating 110 may have a rectangular parallelepiped shape, and may be disposed to extend in one direction. The dielectric grating 110 may be made of a thermosetting material, a thermoplastic material and/or a photocurable material, and may be a polymer resin layer. In accordance with an embodiment, the dielectric grating 110 may be a layer in which an upper portion of the base layer 101 is processed. In this case, the dielectric grating 110 may be formed integrally with the base layer 101. In an exemplary embodiment, the dielectric grating 110 may be made of PUA.
[0027] The metal structure 120 may sense an analyte, and may sense an analyte by directly contacting the analyte or by disposing the metal structure 120 close to the analyte. Plasmon resonance characteristic in the metal structure 120 may be changed, and a shape of the electromagnetic field may be changed, by the analyte. The analyte may include, for example, a chemical, or a biomolecule such as a gene, RNA, DNA, a protein, and the like. The metal structure 120 may be disposed on an upper surface of the base layer 101 to cover an upper surface and one side surface of the dielectric grating 110. The metal structure 120 may have a bent structure on a lower portion of the dielectric grating 110. The metal structure 120 may include at least one of gold (Au), silver (Ag), copper (Cu), aluminum (Al), and platinum (Pt), and may be made of an alloy thereof. A first probe molecule 20 for receiving the analyte may be adsorbed and immobilized on a surface of the metal structure 120. According to embodiments, one or more probe materials may be adsorbed on the surface of the metal structure 120, depending on the analyte, and a type of the probe material may be changed, depending on the analyte.
[0028] The measurement portion 200 may include a light source unit 210 disposed on an upper portion of the sensing portion 100 and generating incident light incident on the metal structure 120, and a light receiving unit 220 disposed on a lower portion of the sensing portion 100 and detecting light that may be changed by the analyte placed on a surface or a periphery of the metal structure 120. An SPR sensor, rather than an LSPR sensor, may be generally based on a Kretschmann configuration that irradiates light according to a condition for total reflection to generate a surface plasmon along a surface of a metal thin film, and measures a change in reflected light. In this case, a prism may be attached to a lower portion of the sensing portion 100. Meanwhile, since the nanoplasmonic sensor 10 of the present embodiment uses the LSPR, a light incidence condition for total reflection may be not required. In addition, the light source unit 210 and the light receiving unit 220 may be disposed on upper and lower portions of the sensing portion 100, respectively, to detect light transmitted through the metal structure 120.
[0029] The light source unit 210 may generate light having a wavelength of about 200 nm to 2000 nm, and, for example, may generate infrared rays or visible light. In some embodiments, the light source unit 210 may also comprise a polarizer for polarizing incident light. In some embodiments, the light receiving unit 220 may be disposed on the upper portion of the base layer 101, such as the light source unit 210, depending on a material of the base layer 101, and may further include a separate monitoring unit such as a microscope to observe a change of the analyte 30.
[0030] The measurement portion 200 may include a UV-Vis spectrometer, which measures a plasmon resonance phenomenon in the metal structure 120, and, for example, scattering, absorption, or extinction characteristics. The measurement portion 200 may measure a change in the analyte such as presence or absence and a chemical reaction of the analyte around the metal structure 120, based on a change in the resonant frequency or a change in scattering, absorption, or extinction value, due to the same.
[0031] The material supplying portion 300 may sequentially provide the first probe molecule 20, an analyte, a second probe molecule, an enzyme, and a substrate, to the metal structure 120 in the respective well-type chambers 150. The first probe molecule 20 may be a material for receiving an analyte, and the second probe molecule, the enzyme, and the substrate may be materials for an enzymatic reaction to amplify an LSPR signal. The materials provided by the material supplying portion 300 and the analysis method using the same will be described in more detail with reference to
[0032] The kit for biomolecule analysis may include a sensing portion 100 including the dielectric grating 110 and the metal structure 120 on the base layer 101. In addition, the kit for biomolecule analysis may further comprise materials provided on the metal structure 120. Specifically, the kit for biomolecule analysis may further include a first probe molecule that is hybridized with an analyte and is bound to a surface of the metal structure 120, a second probe molecule that is hybridized with the first probe molecule at an end not bound to the analyte, an enzyme that is bound to the second probe molecule, and a substrate that reacts with the enzyme to form a precipitate on a surface of the metal structure 120. After completion of the enzymatic reaction in the kit for biomolecule analysis, a plasmon resonance phenomenon in the kit for biomolecule analysis may be measured using an optical characteristic analyzer such as the measurement portion 200 of the nanoplasmonic sensor 10. The above materials and analysis methods using the same will be described in more detail with reference to
[0033] Method for Manufacturing Nanoplasmonic Sensor for Biomolecule Analysis
[0034] A sensing portion 100 of a nanoplasmonic sensor 10 may be manufactured by the following process.
[0035] First, a dielectric layer may be formed on a base layer 101.
[0036] The base layer 101 may be a layer on which a metal structure 120 is subsequently formed on an upper surface thereof, and corresponds to a substrate constituting a portion of the nanoplasmonic sensor. The base layer 101 may be selected from a semiconductor substrate or an insulating substrate. Further, the base layer 101 may be a light-transmitting substrate, and may transmit light having a specific wavelength.
[0037] The dielectric layer may be a layer forming a dielectric grating 110 through a subsequent process, may be formed of a thermosetting material, a thermoplastic material, and/or a photocurable material, and may be a polymer resin layer. The dielectric layer may be formed evenly using an air brush, but is not limited thereto. For example, the dielectric layer may be applied on the base layer 101 by a silver spin coating process, a screen printing process, a spray process, or the like. A thickness of the dielectric layer may be determined, depending on a size of the metal structure 120 to be formed.
[0038] Next, the dielectric layer may be patterned to form the dielectric grating 110.
[0039] The dielectric grating 110 may be formed using a nanoimprint process. In this case, an imprint mold in which a nanosized line pattern is formed may be used. In an exemplary embodiment, the imprint mold may be made of a flexible material, and may be prepared in the form of a roller. In this case, the imprint mold may be made of, for example, polydimethylsiloxane (PDMS). The dielectric layer may be pressed and patterned by the imprint mold to form the dielectric grating 110. When the roller-shaped imprint mold is used as described above, the dielectric grating 110 may be formed with a large area. The method of manufacturing the dielectric grating 110 is not limited thereto, and the dielectric grating 110 may be formed by a photolithography process and an etching process.
[0040] Next, a metal material may be deposited on the base layer 101 and the dielectric grating 110 to form the metal structure 120.
[0041] The metal structure 120 may be formed on an upper surface of the exposed base layer 101 and on an upper surface and a side surface of the dielectric grating 110. The metal structure 120 may be formed by arranging the base layer 101 and a source of the metal material, such that the base layer 101 and the source of the metal material have a predetermined inclination, and supplying and depositing the source of the metal material to have a predetermined angle with respect to the base layer 101. The metal structure 120 may be formed using a physical vapor deposition (PVD) process such as a thermal evaporation process, an electron beam evaporation process, or a sputtering process.
[0042] In this case, depending on an angle, a shape of the formed metal structure 120 may be changed. Accordingly, in the present embodiment, as the metal material is deposited on the upper surface and the one side surface of the dielectric grating 110, the angle may be adjusted, such that the metal structures 120 are not connected between dielectric gratings 110 adjacent to each other. The angle may be, for example, in the range of 20 to 60, and may be selected at an angle satisfying the following conditions, taking into account a height and a width of the dielectric grating 110, a spacing distance between the dielectric gratings 110, a thickness of the metal structure 120, and the like. In the present embodiment, the metal material may be supplied and deposited at a predetermined angle with respect to the base layer 101, such that a bent portion may be realized only by one deposition process. In addition, the manufacturing process may be simplified because no separate process such as a lift-off process is required.
[0043] In this embodiment, since the dielectric grating 110 is not separately removed from the base layer 101, the manufacturing process may be simplified. The present disclosure is not limited thereto. In an exemplary embodiment, the dielectric grating 110 may be removed using a separate wet etching process or the like, such that only the metal structure 120 may be left.
[0044] Finally, the nanoplasmonic sensor 10 may be manufactured by respectively arranging a light source unit 210 and a light receiving unit 220 on upper and lower portions of the sensing portion 100 prepared to include the base layer 101, the dielectric grating 110, and the metal structure 120, and by then providing a material supplying portion 300 for providing materials for analysis to the sensing portion 100.
[0045] Method for Analyzing Biomolecule Using Nanoplasmonic Sensor
[0046]
[0047]
[0048] Referring to
[0049] The dielectric grating 110 may extend in one direction, e.g., in a Y direction, to form a strip. The dielectric grating 110 may have a width having a first distance L1 in an X direction, and may have a first height H1. The first distance L1 may range from 5 nm to 500 nm, and may range, for example, from 50 nm to 90 nm. The first height H1 may range from 20 nm to 500 nm, and may range, for example, from 80 nm to 120 nm. The dielectric gratings 110 may be spaced apart from each other by a gap having a second distance L2 in the X direction. The second distance L2 may range from 40 nm to 500 nm, and may range, for example, from 100 nm to 160 nm. The second distance L2 may be determined to the extent that neighboring metal structures 120 are only formed on one side wall of the dielectric grating 110 and are not connected to each other between neighboring dielectric gratings 110.
[0050] The metal structure 120 may have a shape curved along the upper and side surfaces of the dielectric grating 110. For example, the metal structure 120 may have a bent structure including a bent portion BE. Although
[0051] A third distance L3, which is the overall width of the metal structure 120, may range from 10 nm to 500 nm, and may range, for example, from 70 nm to 130 nm. The metal structure 120 may be disposed to extend along the dielectric grating 110 in an unbent direction. A distance L4 of the metal structure 120 in this direction may be determined in consideration of the size of the sensing portion 100, and may range from several hundreds of nanometers to several tens of centimeters. A thickness T1 of the metal structure 120 may range from 1 nm to 200 nm, and may range, for example, from 10 nm to 50 nm.
[0052] A shape of the metal structure 120 is not limited thereto, and may be changed into various shapes as illustrated in
[0053] Referring to
[0054] A distance L5 of the first horizontal portion 121 on the dielectric grating 110 may be longer than a distance L6 of the second horizontal portion 123 on the base layer 101. Such a structure may be formed to be stably separated from the metal structure 120a. The relative distances of the first horizontal portion 121 and the second horizontal portion 123 are not limited thereto, and may be variously changed in the embodiments. The distance L5 of the first horizontal portion 121 may be in the range of 5 nm to 500 nm, and may be, for example, in the range of 50 nm to 90 nm. The distance L6 of the second horizontal portion 123 may be in the range of 5 nm to 500 nm, and may be, for example, in the range of 20 nm to 60 nm.
[0055] Referring to
[0056] In this embodiment, in a different manner to the embodiment of
[0057] Referring to
[0058] The first probe molecule 20 may be a biomolecule including a sequence complementary to an analyte 30 (see
[0059] As illustrated in
[0060] The first probe molecule 20 may be prepared to have a specific functional group in advance to be easily immobilized on the metal structure 120. As a result, the first probe molecule 20 may be stably bound to the surface of the metal structure 120 made of gold (Au), and may form a self-assembled monolayer according to an embodiment. As such, the first probe molecule 20 may be processed to have a specific functional group, depending on a material of the metal structure 120.
[0061] In one embodiment, when the analyte 30 is microRNA (miRNA), the first probe molecule 20 may be LNA. LNA may have a structure similar to DNA, but may be bound strongly to complementary oligonucleotides, and therefore may exhibit a relatively high sequence specificity without additional labeling operation.
[0062] Referring to
[0063] The analyte 30 may be a biomolecule to be detected, for example, miRNA, DNA, RNA, a small molecule, an antigen, a protein, and the like. In particular, the analyte 30 may include a gene, but is not limited thereto. The analyte 30 may have a base sequence complementary to the first probe molecule 20, and may be complementarily matched with and bound to the first probe molecule 20 by a hybridization operation. The analyte 30 may be dissolved and provided in a buffer solution such as PBS.
[0064] The first probe molecule 20 may be bound to the analyte 30, in a melting state in which the three-dimensional structure is released, while one end thereof is spaced away from the metal structure 120. For example, a binding between the first probe molecule 20 and the analyte 30 may be stronger than a binding that forms the three-dimensional structure in the first probe molecule 20, and sequence specificity may be secured by such a binding. As illustrated in
[0065] Referring to
[0066] The second probe molecule 40 may be bound to an end of the analyte 30, and may have a sequence complementary to a sequence not bound to the analyte 30 in the first probe molecule 20, to be hybridized with a portion of the first probe molecule 20. The second probe molecule 40 may include, for example, DNA, PNA, LNA, and the like, and, in particular, may include functional groups, atomic groups, and/or molecular end groups. Thereby, the second probe molecule 40 may be bound to an enzyme 50 subsequently.
[0067] Referring to
[0068] The enzyme 50 may be a protein material for an enzymatic reaction, and may be a material capable of forming a binding with the second probe molecule 40. The enzyme 50 may be, for example, horseradish peroxidase (HRP), alkaline phosphatase (AP), or beta-galactosidase. In particular, the enzyme 50 may be a functional group, an atomic group, and/or a molecular end group capable of performing a biotin-streptavidin binding, a digoxigenin(DIG)-antiDIG binding, or a host-guest interaction, with the second probe molecule 40.
[0069] The substrate may be a material that reacts with the enzyme 50 to form a precipitate. The substrate may be, for example, at least one of 4-chloronaphthol (4-CN), 3,3-diaminobenzidine (DAB), 3-amino-9-ethylcarbazole (AEC), 3,3,5,5-tetramethylbenzidine (TMB), 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT), 4-chloro-2-methylbenzenediazonium (TR)/3-hydroxy-2-naphthoic acid 2,4-dimethylanilide phosphate (Naphthol AS-MX phosphate), 5-bromo-4-chloro-3-indolyl -D-galactopyranoside (X-gal), 3,4-cyclohexenoesculetin -D-galactopyranoside (S-gal), 5-bromo-3-indolyl -D-galactopyranoside (Bluo-gal), and 6-chloro-3-indolyl--D-galactopyranoside (Red-gal). When 4-CN is used, an enzymatic reaction may be carried out relatively easily. When BCIP/NBT is used, an amount of the precipitate may be relatively increased.
[0070] The enzyme 50 may convert a water-soluble substrate to a water-insoluble product by an enzymatic reaction. A precipitate 60 formed by an enzymatic reaction may be adsorbed onto a surface of the metal structure 120. A thickness of the precipitate 60 may be determined, depending on a concentration of the analyte 30, a concentration of the enzyme 50, a type of the enzyme 50, a time of the enzymatic reaction, a type of the substrate, and the like. After the precipitate 60 is formed, a localized surface plasmon resonance phenomenon such as a change in absorbance at the sensor 10 may be measured. The precipitate 60 may be formed on a surface of the metal structure 120 to change a refractive index around the metal structure 120. Therefore, a sensitivity of the sensor 10 may be enhanced by amplifying an LSPR signal.
[0071]
[0072] Referring to
[0073] As illustrated in
[0074] Example of Method for Analyzing Biomolecule
[0075] Hereinafter, one embodiment of the present disclosure will be described in detail with reference to
[0076] A nanoplasmonic sensor 10 was formed to include dielectric gratings 110 on a base layer 101 made of PUA. The dielectric gratings 110 were formed by performing an imprint process using a PDMS mold and a roll-to-roll method, and were formed to have a width of 100 nm at a period of 200 nm. Metal structures 120 were formed by depositing gold (Au) at an angle of 35 using a thermal evaporation process. The dielectric gratings 110 were arranged at a period of 200 nm with a width of 70 nm and a height of 90 nm, and the metal structure 120 was formed with a thickness of 30 nm.
[0077] LNA, which is a first probe molecule 20, may be prepared by performing a treatment operation for having a thiol group, a dilution operation using phosphate-buffered saline (PBS) at a concentration of 10 M, an annealing operation at a temperature range of about 95 C. for about 5 minutes, and a cooling operation slowly. By such operations, relatively weak bonds between bases in the solution may be removed. Therefore, the first probe molecule 20 having a stable hairpin structure may be prepared. A PBS solution in which the LNA is dissolved may be supplied onto the metal structure 120 together with 3-mercapto-1-propanol to control a concentration of LNA, and the metal structure 120 may be cleaned with PBS. The LNA, which is the first probe molecule 20, may be self-assembled on the metal structure 120 to form a self-assembled monolayer.
[0078] miRNA, an analyte 30, may be provided in a predetermined concentration of total RNA dissolved in a buffer solution or PBS, and may be bound to the first probe molecule 20 at room temperature. After a hybridization operation proceeded at a melting temperature of about 70 C. for about 1 hour, the metal structures 120, and the like, may be cleaned with PBS, and the sensor 10 in PBS after the washing operation may be cooled to about 4 C. Therefore, the LNA, which is the first probe molecule 20 not bound to the analyte 30, may have a hairpin structure, and, in this case, may not be bound to a second probe molecule 40 in a subsequent operation.
[0079] Biotinylated DNA as a second probe molecule 40 may be provided by being dissolved in PBS at a concentration of about 500 nM. After a hybridization operation proceeded for about 3 hours, the sensor 10 may be cleansed with PBS, and may be incubated for about 1 hour in PBS containing about 1% bovine serum albumin (BSA). By blocking with BSA, an enzyme 50 may be prevented from non-specifically adsorbing to a surface of the metal structure 120 in a subsequent operation.
[0080] The enzyme 50 may be provided to the sensor 10 in a concentration of about 25 g/mL of the streptavidin-HRP binding solution in PBS containing 1% BSA for 1 hour. After washing with PBS, the sensor 10 may be incubated in a mixture of 980 L of 4-CN solution and 20 L of 100 mM hydrogen peroxide (H.sub.2O.sub.2) for about 10 minutes. The hydrogen peroxide may play a role in inducing an enzymatic reaction of HRP.
[0081]
[0082] Referring to
[0083]
[0084] Referring to
[0085]
[0086] Referring to
[0087] Table 1 below shows the base sequences of the first probe molecule 20 and the analyte 30. In the base sequence of the let-7a LNA, which is the first probe molecule 20, positions of the LNA were underlined. In the miR-let-7c and miR-let-7f of Comparative Example 1 and Comparative Example 2, portions of the base sequence, which are different from the miR-let-7a of the Example were underlined.
TABLE-US-00001 TABLE1 Material BaseSequence FirstProbe Thiol-GCCAACTATACAACCTACTACCT Molecule CATGTATAGTTGGC (let-7aLNA) Example UGAGGUAGUAGGUUGUAUAGUU (miR-let-7a) Comparative UGAGGUAGUAGGUUGUAUGGUU Example1 (miR-let-7c) Comparative UGAGGUAGUAGAUUGUAUAGUU Example2 (miR-let-7f)
[0088] As shown in the graphs of
[0089] According to such results, when analyzing a specific analyte by the analysis method of the present disclosure, only the analyte perfectly matching with the first probe molecule may be detected, and the anylytes having a difference of even one base sequence may be distinguished from each other. Therefore, it can be seen that the specific analyte may be distinguished from materials having similar base sequences, and may be analyzed.
[0090]
[0091]
[0092] As illustrated in
[0093] The various and advantageous advantages and effects of the present disclosure are not limited to the above description, and may be more easily understood in the course of describing a specific embodiment of the present disclosure.
[0094] A nanoplasmonic sensor and kit for molecular analysis may be provided by extending an oscillation path of localized surface plasmon using a metal structure having at least one bent portion, and utilizing a probe molecule that is specifically bound to an analyte, and an enzymatic reaction on a surface of the metal structure
[0095] In addition, a method of analyzing a biomolecule using the nanoplasmonic sensor and kit for high sensitive biomolecule analysis may be provided.
[0096] While exemplary embodiments have been shown and described above, it will be apparent to those skilled in the art that modifications and variations could be made without departing from the scope of the present disclosure as defined by the appended claims.