Transit peptide from Arabidopsis chloroplast chaperonin 10-2 and methods of use

Abstract

The present invention provides a recombinant DNA molecule encoding a fusion protein, comprising a first DNA sequence encoding a high-efficiency transit peptide operably linked to a second DNA sequence encoding a passenger protein, wherein the high-efficiency transit peptide is selected from the group consisting of transit peptides of the precursors of translocon at the inner envelope membrane of chloroplasts 40 kD (prTic40), chaperonin 10-2 (prCpn10-2), Fibrillin 1B (prFibrillin), ATP sulfurylase 1 (prAPS1), ATP sulfurylase 3 (prAPS3), 5-adenylylsulfate reductase 3 (prAPR3), stromal ascorbate peroxidase (prsAPX), prTic40-E2A (a prTic40 variant), prCpn10-1-C7C37S (a chaperonin 10-1 variant), a functional fragment of any of the transit peptides and an equivalent thereof. And the present invention also provides a method of high efficiency delivery of a protein into plastids using the high-efficiency transit peptides.

Claims

1. A recombinant DNA molecule encoding a fusion protein, wherein said recombinant DNA molecule comprises a first DNA sequence encoding a transit peptide operably linked to a second DNA sequence encoding a passenger protein, wherein the transit peptide consists of the first 40 amino acids of SEQ ID NO: 11 and wherein the transit peptide is heterologous to the passenger protein.

2. A DNA construct comprising the recombinant DNA molecule according to claim 1, wherein said recombinant DNA molecule is operably linked to a promoter.

3. The DNA construct according to claim 2, wherein the promoter is functional in a plant cell.

4. A plant material comprising the DNA construct according to claim 3.

5. The plant material according to claim 4, wherein the plant material is selected from the group consisting of a plant cell, a plant tissue, a plant tissue culture, a callus culture and a transgenic plant.

6. The plant material according to claim 4, wherein the plant material is obtained from a monocotyledon or a dicotyledon plant.

7. A method of delivering a passenger protein into leucoplasts, comprising: (a) providing a recombinant DNA molecule encoding a fusion protein; (b) linking the recombinant DNA molecule operably with a promoter to form a DNA construct, wherein the promoter is functional in a plant cell; and (c) introducing the DNA construct into a plant material to express the fusion protein; wherein the recombinant DNA molecule comprises a first DNA sequence encoding a transit peptide operably linked to a second DNA sequence encoding a passenger protein, wherein the transit peptide consists of the first 40 amino acids of SEQ ID NO: 11 and wherein the transit peptide is heterologous to the passenger protein.

8. The method according to claim 7, wherein the plant material is selected from the group consisting of a plant cell, a plant tissue, a plant tissue culture, a callus culture and a transgenic plant.

9. The method according to claim 7, wherein the plant material is obtained from a monocotyledon or a dicotyledon plant.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIGS. 1A and 1B show that prRBCS imported much less efficiently into leucoplasts than into chloroplasts no matter whether the comparison was done based on equal proteins or on equal plastids, and prTic40 had much higher leucoplast import efficiencies than prRBCS. In FIG. 1A, leucoplasts and chloroplasts were isolated from roots of 4-day-old pea seedlings grown in the dark and leaves of 7-day-old pea seedlings grown under 12-h photoperiod, respectively. The isolated leucoplasts (500 or 113.67 g protein) and chloroplasts (500 g protein) were incubated under import conditions with 18 L in vitro-translated [.sup.35S]Met-prTic40 or [.sup.35S]Met-prRBCS and 3 mM ATP in import buffer in a final volume of 200 L for 25 min. The two different concentrations of leucoplasts, 500 and 113.67 g of protein, are for comparing with chloroplasts based on equal amounts of proteins and equal numbers of plastids, respectively. 500 g of leucoplasts have the same amount of proteins as 500 g of chloroplasts, while 113.67 g of leucoplasts have the same number of plastids as 500 g of chloroplasts. After import, intact leucoplasts and chloroplasts were re-isolated through a 10% and 40% Percoll cushion, respectively. The import samples were analyzed by SDS-PAGE, stained with Coomassie blue, and dried for fluorography. 4% of the plastids in each import reaction (20 g or 4.55 g of proteins) were loaded. Tr, 1% of the in vitro-translated precursor proteins used in each import reaction. In FIG. 1B, the imported mature proteins in experiments as those shown in FIG. 1A were quantified and the import efficiencies were calculated. Data shown are meanSD of three independent experiments. Cpt, chloroplasts; Leu, leucoplasts. pr, precursor protein; m, mature protein derived after import.

(2) FIGS. 2A and 2B show that different precursor proteins had different plastid preference. The precursor prFd-protein A serves as an example of highly preferring chloroplasts. The precursor prPDH E1 serves as an example of mildly preferring chloroplasts. The precursor prCpn10-2 serves as an example of showing no preference and being able to import well into both chloroplasts and leucoplasts. In FIG. 2A, isolated leucoplasts (113.67 g protein) and chloroplasts (500 g protein) were incubated with in vitro-translated prFd-protein A, prPDH E1, or prCpn10-2 under import conditions for 25 min. After import, intact leucoplasts and chloroplasts were re-isolated through a 10% and 40% Percoll cushion, respectively. The import samples were analyzed by SDS-PAGE, stained with Coomassie blue, and dried for fluorography. 4% of the plastids in each import reaction were loaded. Tr, 1% (for prFd-protein A and prPDH E1) or 1.2% (for prCpn10-2) of the in vitro-translated precursor proteins used in the import reactions. In FIG. 2B, imported mature proteins in experiments as those shown in FIG. 2A were quantified and the import efficiencies were calculated. Data shown are meanSD of three independent experiments. Cpt, chloroplasts; Leu, leucoplasts. pr, precursor protein; m, mature protein derived after import.

(3) FIGS. 3A to 3C show that nine precursor proteins had high import efficiencies into both leucoplasts and chloroplasts, and these nine precursor proteins all had much higher leucoplast import efficiency than prRBCS. In FIG. 3A, isolated leucoplasts (113.67 g proteins) and chloroplasts (500 g proteins) were incubated with in vitro-translated [.sup.35S]Met-precursor proteins under import conditions for 25 min. After import, intact leucoplasts and chloroplasts were re-isolated through a 10% and 40% Percoll cushion, respectively. The samples were analyzed by SDS-PAGE, stained with Coomassie blue, and dried for fluorography. 4% of the plastids in each import reaction were loaded. Tr, 1.2% of the in vitro-translated precursor proteins used in each import reaction. pr, precursor protein; m, mature protein derived after import. In FIGS. 3B and 3C, imported mature proteins in chloroplasts (3B) and leucoplasts (3C) in experiments as those shown in FIG. 3A were quantified and the import efficiency of each precursor was calculated. The import efficiency of prRBCS was set as 1. Data shown are meanSD of at least three independent experiments. Cpt, chloroplasts; Leu, leucoplasts.

(4) FIGS. 4A and 4B show that the nine high-efficiency transit peptides of the present invention indeed delivered a higher amount of passenger proteins into leucoplasts than the prRBCS transit peptide. In FIG. 4A, protoplasts isolated from tobacco BY2 cells were co-transformed with GFP or transit-peptide-GFP fusion plasmids and the plasmid pBI221, which directed the expression of -glucuronidase (GUS) in the cytosol and served as an internal control for transformation and protein expression efficiency. After transformation, the protoplasts were incubated in the dark at 25 C. for 16 h, analyzed by SDS-PAGE and immunodetected with antibodies indicated on the left. Thirty micrograms of proteins were loaded in each lane. Plasmid DNA used for each lane is labeled at the top. Lane 1, control protoplasts with no plasmid DNA added during the transformation. Lane 2, protoplasts transformed with pBI221 and the GFP vector without fusing to any transit peptide. Lanes 3 to 12, protoplasts transformed with pBI221 and a plasmid encoding GFP fused to prRBCS transit peptide (lane 3), or GFP fused to one of the nine transit peptides of the present invention (lanes 4 to 12). The transit peptide part is indicated with subscript tp. Filled circles mark the precursor form of each fusion protein and brackets mark GFP imported into BY2 cell leucoplasts. In FIG. 4B, the amount of GUS and imported GFP in experiments as those shown in FIG. 4A were quantified. The efficiency of each transit peptide was calculated by the amount of GFP normalized to the amount of GUS in the same sample. The GFP/GUS ratio of RBCS.sub.tp-GFP was set as 1. Data shown are meanSD of two independent experiments.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT

(5) The accompanying drawings are included to provide a further understanding of the invention, and are incorporated in and constitute a part of this specification. The drawings illustrate embodiments of the invention and, together with the description, serve to explain the principles of the invention.

(6) As a first step in identifying precursors with high leucoplast import efficiency, the present invention optimized the in vitro leucoplast protein import system for higher efficiency import and fast, accurate and quantitative comparisons, between leucoplasts and chloroplasts, and among transit peptides. A group of nine precursors that imported into chloroplasts equally well as prRBCS, but imported into leucoplasts much more efficiently than prRBCS, were identified. The present invention further showed that a higher amount of passenger proteins were imported into leucoplasts in vivo when the passenger protein was fused to these high efficiency transit peptides of the present invention, than when fused to the prRBCS transit peptide.

(7) Definition

(8) Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In the case of conflict, the present document, including definitions will control.

(9) As used herein, promoters suitable for the practice of this invention include all promoters that have been shown to drive RNA expression in plants, including those that are constitutive, inducible or tissue-specific. Examples include, but are not limited to, maize RS81 promoter, rice ubiquitin promoters, rice glutelin (Gt1) promoter, maize RS324 promoter, maize PR-1 promoter, maize A3 promoter, maize L3 oleosin promoter, rice actin promoters, prRBCS promoter, phytoene desaturase promoter, sporamin promoter, gamma-coixin promoter, maize chloroplast aldolase promoter, nopaline synthase (NOS) promoter, octopine synthase (OCS) promoter, cauliflower mosaic virus (CaMV) 19S and 35S promoters, figwort mosaic virus 35S promoter, Arabidopsis sucrose synthase promoter, R gene complex promoter, chlorophyll a/b binding protein gene promoter, CaMV35S promoter with enhancer sequences e35S, FMV35S promoter, FLt36 promoter of peanut chlorotic streak virus, At.Act 7 promoter, At.ANT1 promoter, FMV.35S-EF1a promoter, eIF4A10 promoter, AGRtu.nos promoter, and rice cytosolic triose phosphate isomerase promoter.

(10) As used herein, passenger proteins suitable for the practice of this invention are any protein the one of ordinary skill in the art wishes to express in plastids. Examples include, but are not limited to, GFP, -glucuronidase (GUS), dicamba monooxygenase (DMO), enolpyruvyl shikimate-3-phosphate (EPSP) synthase, glyphosate oxidase (GOX), phytoene synthase (psy), AtOR (R90H) (the R90H mutant of Arabidopsis ORANGE protein), -carotene ketolase and phytoene desaturase.

(11) As used herein, monocotyledon plant refers to any of a class of angiosperm plants having a single cotyledon in the seed, and includes (but is not limited to) rice, rye, wheat, barley, sorghum, maize, oat, orchids, lily, banana, taro and sugar cane.

(12) As used herein, dicotyledon plant refers to an angiosperm that is not a monocotyledon, having two cotyledons in the seed, and includes (but is not limited to) Arabidopsis, tobacco, potato, sweet potato, canola, soybean, bean, cotton, sunflower, white cauliflower, chrysanthemum, cassava and roses.

(13) As used herein, a high-efficiency transit peptide refers to a transit peptide which is capable of delivering an amount of passenger proteins that is equal or higher than the amount of passenger proteins a prRBCS transit peptide is capable of delivering into chloroplasts, and is capable of delivering an amount of passenger proteins that is higher than the amount of passenger proteins a prRBCS transit peptide is capable of delivering into leucoplasts. The method used for comparing the amounts of passenger proteins being delivered into different groups of chloroplasts and leucoplasts can be the optimized method as described herein, or any such method that is capable of differentiating between a higher and a lower amount of a particular protein that has accumulated in chloroplasts and leucoplasts of at least two experimental groups of cells.

(14) As used herein, the terms construct and vector are used interchangeably.

(15) Transit peptides are known to function across species. For example, the prRBCS transit peptide from pea was used in the Golden rice creation. The pea prRBCS transit peptide is also used in creating the Dicamba resistant soybean and the initial studies for the creation were performed in Arabidopsis and tobacco. The prRBCS transit peptide from Arabidopsis was used in the Roundup Ready corn (USDA, 1996). A transit peptide from the waxy protein of corn was shown to function well in potato. For the current invention, the high-efficiency transit peptides were identified from pea and Arabidopsis and the initial tests were performed in pea, tobacco and rice and will also be tested in Arabidopsis. It is expected that these nine transit peptides of the present invention will provide high efficiency delivery of proteins into leucoplasts of all monocotyledon and dicotyledon plants, for example leucoplasts in the tubers, endosperms and roots of rice, barley, wheat, corn, cassava, potato and soybean and into leucoplasts of white colored petals of all flowers. Furthermore, because precursors containing these transit peptides also import very efficiently into chloroplasts, these transit peptides will also be expected to deliver proteins into chloroplasts with high efficiency.

Example 1

Plastid Isolation, Protein Concentration Assays, and Plastid Number Counting

(16) Pea seedlings (Pisum sativum cv. Green Arrow) were grown at 20 C. on vermiculite. Leucoplasts were prepared from roots of 4- to 5-day-old dark grown seedlings as described (Chu and Li, 2015). Chloroplasts were isolated from leaves of 7-day-old seedlings grown under a 12-h photoperiod with a light intensity of approximately 150 mol m.sup.2 s.sup.1 as described (Perry et al., 1991), except 2 mM ascorbic acid, 0.1 mM dithiothreitol, and 1.2 mM glutathione were added in the grinding buffer used for homogenization. Isolated chloroplasts were adjusted to 1 mg chlorophyll mL.sup.1 in import buffer.

Example 2

Optimization of the Protocol for Isolation of Import-Competent Leucoplasts

(17) To set up a quantitative leucoplast import system, the present invention first optimized the conditions for leucoplast isolation. The present invention increased the concentration of EDTA and BSA in the homogenization buffer and also added reducing agents into the buffer. After these modifications, the import efficiencies of precursor proteins into isolated leucoplasts were increased (Chu and Li, 2015).

Example 3

Plasmid Construction and In Vitro Translation of Precursors for In Vitro Import into Isolated Plastids

(18) Plasmids encoding prRBCS, prTic40, prFd-protein A, prPDH E1, and prCpn10-2 have been described (Teng et al., 2012). The cDNA clones of pda02149 for precursor of ATP sulfurylase 1 (prAPS1, AT3G22890) and pda04912 for precursor of 5-adenylylsulfate reductase 3 (APR3, AT4G21990) were obtained from RIKEN BioResource Center. The leaf cDNA pools of Arabidopsis thaliana (Columbia ecotype) were used as templates to amplify the coding regions of Fibrillin 1B precursor (prFibrillin, AT4G22240), ATP sulfurylase 3 precursor (prAPS3, AT4G14680), and stromal ascorbate peroxidase precursor (prsAPX, AT4G08390) with specific forward and reverse primer pairs as described in Table 1. The PCR products of prFibrillin were digested with HindIII and PstI and cloned into the HindIII/PstI of pSP72. The PCR products of prAPS3 and prsAPX were digested with XhoI and SalI and cloned into the XhoI/SalI site of pSP72, respectively. The sequences of prFibrillin, prAPS3, and prsAPX were confirmed by sequencing and the plasmid was named pSP72-Fibrillin, pSP72-APS3, and pSP72-sAPX, respectively. Since the prFibrillin has only two Met in the transit peptide region, the sequence encoding 2 extra Met were inserted into the 3end of cDNA before the stop codon using the QuikChange II Site-Directed Mutagenesis Kit (AGILENT TECHNOLOGIES) with primers fibrillin-2M-F and fibrillin-2M-R (Table 1). The sequence was confirmed by sequencing and the plasmid was named pSP72-Fibrillin-2M and this plasmid was used in the subsequent analyses. The prTic40 cording region in the pBS plasmid was digested with XhoI and PstI and cloned into the XhoI/PstI site of pSP72 to generate the pSP72-Tic40 plasmid. This pSP72-Tic40 construct was used to generate the prTic40 variant using the QuikChange II Site-Directed Mutagenesis Kit (AGILENT TECHNOLOGIES) with primers pSP72-Tic40-E2A-F and pSP72-Tic40-E2A-R (Table 1). The sequence was confirmed by sequencing and the plasmid was named pSP72-Tic40-E2A. For the prCpn10-1 variant, prCpn10-1-C7C37S, the prCpn10-1 plasmid (Teng et al., 2012) was used for site-directed mutagenesis via the QuikChange II Site-Directed Mutagenesis Kit (AGILENT TECHNOLOGIES) with primers Cpn10-1-C7-F and Cpn10-1-C7-R to generate the plasmid pSP72-Cpn10-1-C7 first. Then pSP72-Cpn10-1-C7 was used for site-directed mutagenesis with primers Cpn10-1-C37S-F and Cpn10-1-C37S-R. The sequence was confirmed by sequencing and the plasmid was named pSP72-Cpn10-1-C7C37S. The in vitro expression of prAPS1 and prAPR3 was under the control of the T7 promoter. The in vitro expression of prFibrillin, prAPS3, prsAPX, prTic40-E2A, and prCpn10-1-C7C37S was under the control of the SP6 promoter.

(19) [.sup.35S]Met-labeled prPDH E1 was generated by in vitro transcription for synthesizing RNA followed by in vitro translation using the Rabbit Reticulocyte Lysate system (PROMEGA). All other precursors were synthesized using the TNT Coupled Wheat Germ Extract system or TNT Coupled Reticulocyte Lysate system (PROMEGA).

(20) TABLE-US-00001 TABLE1 Primersusedforcloningintheinvention Primer Nucleotidesequence Purpose fibrillin-F1- 5-cgaagcttatggcgacgg Toclonethecodingregionof HindIII tacaattgtc-3 prFibrillinintopSP72 SEQIDNO:21 fibrillin-R1-PstI 5-cgctgcagtcaaggattc Toclonethecodingregionof aagagagg-3 prFibrillinintopSP72 SEQIDNO:22 APS3-F1-XhoI 5-cactcgagatggcttcca Toclonethecodingregionof tgtccaccgtcttcc-3 prAPS3intopSP72 SEQIDNO:23 APS3-R1-SalI 5-cagtcgacttaaaccgga Toclonethecodingregionof atcttttccggaagtt-3 prAPS3intopSP72 SEQIDNO:24 sAPX-F2-XhoI 5-agctcgagatggcagagc Toclonethecodingregionof gtgtgtctc-3 prsAPXintopSP72 SEQIDNO:25 sAPX-R2-SalI 5-gcgtcgacttagataacg Toclonethecodingregionof ataccctccg-3 prsAPXintopSP72 SEQIDNO:26 fibrillin-2M-F 5-tctcttgaatcctatgat Toaddtwoextramethionine gtgactgcaggtcg-3 residuesintheCterminusof SEQIDNO:27 fibrillin fibrillin-2M-R 5-cgacctgcagtcacatca Toaddtwoextramethionine taggattcaagaga-3 residuesintheCterminusof SEQIDNO:28 fibrillin pSP72-Tic40-E2A-F 5-cgataagcttgatatggc Tomutatetheglutamicacid gaatcttaacttagccc-3 residueatposition2of SEQIDNO:29 prTic40intoalanineresidue pSP72-Tic40-E2A-R 5-gggctaagttaagattcg Tomutatetheglutamicacid ccatatcaagcttatcg-3 residueatposition2of SEQIDNO:30 prTic40intoalanineresidue Cpn10-1-C7-F 5-gcttccactttcgtctct Todeletethecysteineresidue ctaccaaatcct-3 atposition2ofprCpn10-1 SEQIDNO:31 Cpn10-1-C7-R 5-aggatttggtagagagac Todeletethecysteineresidue gaaagtggaagc-3 atposition2ofprCpn10-1 SEQIDNO:32 Cpn10-1-C37S-F 5-cggaagtcgaagaggttc Tomutatethecysteineresidue ccttagaatcaaagcga-3 atpositionof37ofprCpn10-1 SEQIDNO:33 intoserine Cpn10-1-C37S-R 5-tcgctttgattctaaggg Tomutatethecysteineresidue aacctcttcgacttccg-3 atpositionof37ofprCpn10-1 SEQIDNO:34 intoserine

Example 4

Protein Import into Isolated Plastids and Post-Import Analyses

(21) After setting up the leucoplast isolation conditions, the present invention next compared the import behavior of various precursor proteins into leucoplasts and chloroplasts. An equal amount of proteins (Yan et al., 2006) or an equal number of plastids (Wan et al., 1996) was usually used as the basis when comparing among import efficiencies of different plastids. To determine the number of plastids, the isolated leucoplasts and chloroplasts were counted using the Multisizer 3 Coulter Counter (BECKMAN COULTER). The present invention used chloroplasts isolated from 7-day-old seedlings for robust import and for decreasing the age difference between the leucoplast and chloroplast samples. The average size of the isolated leucoplasts and chloroplasts was estimated to be 1.810.21 m and 3.240.23 m, respectively. The same plastid preparations were then used for protein concentration determination and the average protein content was calculated to be 1.850.63 and 8.131.42 g/plastid for leucoplasts and chloroplasts, respectively. The present invention then used protein content as an estimate of plastid numbers in the experiments thereafter. For example, 500 g of plastid proteins would represent approximately 2.7110.sup.8 leucoplasts and 6.1510.sup.7 chloroplasts. For import comparison between chloroplasts and leucoplasts on an equal protein basis, 18 L [.sup.35S]Met-labeled precursors were incubated with isolated plastids equivalent to 500 g plastid proteins in the presence of 3 mM ATP in import buffer in a final volume of 200 L. For import comparison on an equal plastid number basis, 113.67 g leucoplast proteins (2.7110.sup.8 leucoplasts) and 500 g chloroplast proteins (2.7110.sup.8 chloroplasts) were used instead. Import reactions were carried out at room temperature for 25 min and stopped by transferring to a new tube containing 1 mL ice-cold import buffer. The plastids were pelleted by centrifugation at 3,000 g at 4 C. for 3 min and re-suspended in 200 L import buffer. The leucoplast suspensions were underlaid with 1 mL 10% Percoll (v/v) in import buffer and the chloroplast suspensions were laid on top of a 40% Percoll (v/v) cushion to re-isolate the intact plastids with a swinging-bucket rotor by 2,900 g for 6 min at 4 C. The plastids were washed once with import buffer and re-suspended in a small volume of import buffer. Protein concentrations of the plastid samples were measured with the BCA protein assay kit (THERMO). Samples were analyzed by SDS-PAGE. Quantification of gel bands was performed using the Fuji FLA5000 PhosphorImager (FUJIFILM, Tokyo).

Example 5

prRBCS Imported Poorly into Leucoplasts and prTic40 Imported Efficiently into Both Chloroplasts and Leucoplasts

(22) To provide quantitative comparison of the import efficiency of prRBCS into chloroplasts and leucoplasts, import was compared based on equal proteins or on equal plastid numbers. The results showed that the import efficiency of prRBCS into leucoplasts was much lower than its import efficiency into chloroplasts no matter whether the comparison was done on an equal amount of proteins or on an equal number of plastids basis (FIGS. 1A and 1B). Furthermore, in initial screenings from our original collection of precursor proteins, prTic40 showed the best import activity into isolated leucoplasts and it was therefore used to compare with prRBCS. prTic40 imported into chloroplasts with similar efficiency to prRBCS, and imported into leucoplast much more efficiently than prRBCS.

Example 6

Identification of Transit Peptides with High Leucoplast Import Efficiencies

(23) The present invention further tested another three precursors, ferredoxin precursor (prFd), pyruvate dehydrogenase E1 subunit precursor (prPDH E1), and chaperonin 10-2 (prCpn10-2) precursor, to confirm that different precursors have different plastid preferences. For prFd, the present invention used the construct prFd-protein A, which contains ferredoxin transit peptide fused to Staphylococcal protein A, as described (Smith et al., 2004). As shown in FIGS. 2A and 2B, prFd-protein A imported efficiently into chloroplasts but minimally imported into leucoplasts, similar to the results of prRBCS. In comparison, although prPDH E1 also imported more efficiently into chloroplasts, but its import into leucoplasts was about half that of chloroplasts. In comparison, prCpn10-2 imported equally well into both chloroplasts and leucoplasts.

(24) Precursors like prTic40 and prCpn10-2 are of particular interests because they can import very efficiently into both chloroplasts and leucoplasts. The present invention further cloned and tested the import of more than 60 plastid precursor proteins from Arabidopsis in the leucoplast import system the present invention set up. The present invention found another five precursors that also exhibited very high import efficiency into both chloroplasts and leucoplasts (FIGS. 3A to 3C and Table 2). They include precursors to Fibrillin 1B (prFibrillin), ATP sulfurylase 1 (prAPS1) and 3 (prAPS3), 5-adenylylsulfate reductase 3 (prAPR3) and stromal ascorbate peroxidase (prsAPX). Another two precursor variants, prTic40-E2A and prCpn10-1-C7C37S, also showed high import efficiency into both chloroplasts and leucoplasts (FIGS. 3B and 3C and Table 2). For these nine precursors, their chloroplast import efficiency was comparable to that of prRBCS (FIG. 3B), but their leucoplast import efficiency was 28 times higher than that of prRBCS (FIG. 3C).

(25) TABLE-US-00002 TABLE2 Transitpeptideswithhighimportefficienciesinplastids. Aminoacidsofthetransitpeptideareshowninlowercase lettersandthefirstthreeaminoacidsinthematureregion areshownincapitalletters.TheprRBCStransitpeptide usedasacontrolisalsoshownhere. Precursors (Accession Transit number) Fullname Nucleotidesequences peptidesequence prTic40 Translocon atggagaatcttaacttagcccttgtttcttcccctaaac menlnlalvsspkplllghs (AY157668) atthe ccctgcttttaggacattcctcctcaaaaaacgttttctc ssknvfsgrksftfgtfrvs innerenvelope aggaaggaagtctttcacttttgggacgtttcgcgtttct ansssshvtraaskshqnlk membraneof gctaactcttcatcctctcatgtcaccagggctgcttcta svqgkvnahdFAS chloroplasts40 aatctcaccaaaatctaaaatctgtgcaggggaaggtgaa SEQIDNO:10 kD tgcgcatgattttgctagcSEQIDNO:1 prCpn10-2 chaperonin10-2 atggcttcgagtttcattacagtacctaaacccttcttgt massfitvpkpflsfpiktn (AT3G60210) ccttccccatcaaaaccaatgctcctactctacctcagca aptlpqqtllgirrnsfrin gacccttctcggaattcgaagaaattcctttagaattaac AVS gccgtttccSEQIDNO:2 SEQIDNO:11 prFibrillin1B Fibrillin1B atggcgacggtacaattgtccacccaatttagctgccaaa matvqlstqfscqtrvsisp (AT4G22240) ccagagtttcaatctcaccgaactctaaatctatctccaa nsksiskppflvpvtsiihr gcctccgtttctggtaccggtgacctcaattattcaccgc pmistggiavsprrvfkvra ccgatgatctccaccggaggaatcgctgtttccccccgta tdtgeigsallaaEEA gagttttcaaagtccgagccacagatacgggagagatagg SEQIDNO:12 atcagctctattggcggcggaggaagca SEQIDNO:3 prAPS1 ATP atggcttcaatggctgccgtcttaagcaaaactccattcc masmaavlsktpflsqpltk (AT3G22890) sulfurylase1 tctctcaaccactaaccaaatcatctccaaactccgatct sspnsdlpfaaysfpskslr ccccttcgccgcggtttccttcccttccaaatccctacgc rrvgsiragliapdggklve cgccgcgtaggatcaatccgagccggattaatcgctcccg liveepkrrekKHE acggtggtaagcttgtagagctcatcgtggaagagccaaa SEQIDNO:13 gcggcgagagaagaaacacgag SEQIDNO:4 prAPS3 ATP atggcttccatgtccaccgtcttccccaaaccaacctctt masmstvfpkptsfisqplt (AT4G14680) sulfurylase3 tcatctctcaacctctaacaaaatctcacaaatccgattc kshksdsvttsisfpsnskt cgtaaccacatccatttcattcccttcgaattcgaaaact rslrtisvragliepdggkl cgtagcttaagaaccatctctgtacgagctggcttaatcg vdlvvpeprrrEKK agccagatggtgggaaacttgtggatcttgttgtaccgga SEQIDNO:14 accgagacggcgagagaagaaa SEQIDNO:5 prAPR3 5- atggcactagcaatcaacgtttcttcatcttcttcttctg malainvssssssaissssf (AT4G21990) adenylylsulfate cgatctcaagctctagcttcccttcttcagatctcaaagt pssdlkvtkigslrllnrtn reductase3 aacaaaaatcggatcattgaggttattgaatcgtaccaat vsaaslslsgkrssvkalnv gtctctgcggcttctctgagtttgtccgggaagagatcct gsitkesivasevtekldvv ccgtgaaagctcttaatgtgcaatcaattacaaaggaatc EVE cattgttgcttctgaggttacagagaagctagatgtggtg SEQIDNO:15 gaagttgaa SEQIDNO:6 prsAPX stromal atggcagagcgtgtgtctctcacactcaacggaaccctcc maervsltlngtllsppptt (AT4G08390) ascorbate tttctcctcctcccacaacaacaacaacaacaatgtcttc ttttmssslrsttaaslllr peroxidase ttctctccgatctaccaccgccgcttctcttctcctccgc ssssssrSTL tcctcctcctcctcctccagatccactctc SEQIDNO:16 SEQIDNO:7 prTic40-E2A Translocon atggcgaatcttaacttagcccttgtttcttcccctaaac manlnlalvsspkplllghs (AY157668 atthe ccctgcttttaggacattcctcctcaaaaaacgttttctc ssknvfsgrksftfgtfrvs variant) innerenvelope aggaaggaagtctttcacttttgggacgtttcgcgtttct ansssshvtraaskshqnlk membraneof gctaactcttcatcctctcatgtcaccagggctgcttcta svqgkvnahdFAS chloroplasts40 aatctcaccaaaatctaaaatctgtgcaggggaaggtgaa SEQIDNO:17 kDvariant tgcgcatgattttgctagc SEQIDNO:8 prCpn10- chaperonin10-1 atggcttccactttcgtctctctaccaaatcctttctttg mastfvslpnpffafpvkat 1-C7C37S variant cttttccggtcaaagcaactactccttcgacggctaacca tpstanhtllgsrrgslrik (AT2G44650 tacgcttctcggaagtcgaagaggttcccttagaatcaaa AIS variant) gcgatttcc SEQIDNO:18 SEQIDNO:9 prRBCS Ribulose-1,5- atggcttcctcaatgatctcctccccagctgttaccaccg massmisspavttvnragag (NM_001248385) bisphosphate tcaaccgtgccggtgccggcatggttgctccattcaccgg mvapftglksmagfptrktn carboxylase cctcaaatccatggctggcttccccacgaggaagaccaac nditsiasnggrvqcMQV smallsubunit aatgacattacctccattgctagcaacggtggaagagtac SEQIDNO:20 aatgcatgcaggtg SEQIDNO:10

Example 7

Plasmid Construction for In Vivo Expression of Fusion Proteins in Tobacco BY-2 Suspension Culture Cells and Rice Calli

(26) Plasmids for transient in vivo expression were prepared as follows. The coding region corresponding to the transit peptide and the first three amino acids in the mature region of prRBCS, prTic40, prCpn10-2, prFibrillin, prAPS1, prAPS3, prAPR3, prsAPX, prTic40-E2A, prCpn10-1-C7C37S (Table 2) were amplified by PCR using a forward primer that added a XbaI site and a reverse primer that added a BamHI site to the amplified fragment. The PCR fragment for each transit peptide was digested and cloned into the XbaI/BamHI site of the plasmid p326GFP (Lee et al., 2002), resulting in translational fusion of the transit peptide to the N terminus of GFP. The sequence was confirmed by sequencing and the plasmid was named prRBCS.sub.tp-GFP, prTic40.sub.tp-GFP, prCpn10-2.sub.tp-GFP, prFibrillin.sub.tp-GFP, prAPS1.sub.tp-GFP, prAPS3.sub.tp-GFP, prAPR3.sub.tp-GFP, prsAPX.sub.tp-GFP, prTic40-E2A.sub.tp-GFP and prCpn10-1-C7C37S.sub.tp-GFP, respectively. The transit peptide-GFP fusion constructs were placed under the control of the cauliflower mosaic virus 35S (CaMV35S) promoter and the nopaline synthase (nos) terminator. These transit peptide-GFP fusion constructs were co-transformed with the plasmid pBI221, which contains CaMV35S driven -glucuronidase (GUS) gene and serves as an internal control for transformation and protein expression efficiency. Protoplasts isolated from tobacco BY-2 suspension cells were transformed by polyethylene glycol mediated transformation. The amounts of GFP and GUS protein produced were determined by immunoblotting. The efficiency of each transit peptide was calculated by the amount of GFP produced normalized to the amount of GUS produced for each transformation. Rice embryo-induced calli were transformed by particle bombardment and Agrobacteria-mediated transformation. Multiple transformation experiments were performed for each construct and the average efficiency of each transit peptide was calculated and compared to the average efficiency of prRBCS transit peptide. The subcellular localization of the expressed proteins was confirmed by confocal microscopy.

Example 8

Demonstration of Transit Peptide Efficiency by In Vivo Expression of Fusion Proteins

(27) The present invention further fused the transit peptides from the nine high-import-efficiency precursors to GFP as described above and tested the in vivo leucoplast import efficiency of these nine fusion proteins. The present invention used transient expression in tobacco BY-2 suspension culture cells and rice calli, which are widely used and represent established model systems for non-green leucoplast-containing tissues of dicotyledon and monocotyledon plants, respectively. Both systems can be easily transformed and served as a quick and reliable tool for evaluating the in vivo leucoplast import efficiency of the fusion proteins. The results (FIGS. 4A and B) showed that, when GFP was fused to eight of nine transit peptides of the present invention, the amount of GFP imported into leucoplasts was much higher than when GFP was fused to the transit peptide of prRBCS. One of the transit peptides of the present invention had a similar efficiency to the prRBCS transit peptide.

Example 9

Plasmid Construction and Protein Expression in Transgenic Arabidopsis Plants

(28) The DNA fragment encoding GFP from the plasmid p326GFP (Lee et al., 2002) was amplified by PCR using a forward primer that added a BamHI site and a reverse primer that added an XbaI site to the amplified fragments. The fragment was digested and cloned into the BamHI/XbaI site of pSP72. The sequences were confirmed by sequencing and the plasmid was named pSP72-GFP. The DNA fragments encoding the transit peptide and the first three amino acids of the mature region of prRBCS, prTic40, prCpn10-2, prFibrillin, prAPS3, prAPR3, prsAPX, prTic40-E2A, prCpn10-1-C7C37S (Table 2) were amplified by PCR using a forward primer that added a SacI site and a reverse primer that added a BamHI site to the amplified fragment. The fragments were digested and cloned into the SacI/BamHI site of pSP72-GFP to generate the transit peptide-GFP fusion constructs. The DNA fragment encoding the transit peptide and the first three amino acids of the mature region of prAPS1 was amplified by PCR using a forward primer that added a KpnI site and a reverse primer that added a BamHI site to the amplified fragment. The fragments were digested and cloned into the KpnI/BamHI site of pSP72-GFP. All sequences were confirmed by sequencing. The DNA fragments encoding the transit peptide-GFP were excised by SacI/PstI (for prRBCS.sub.tp-GFP, prTic40.sub.tp-GFP, prCpn10-2.sub.tp-GFP, prFibrillin.sub.tp-GFP, prAPS3.sub.tp-GFP, prAPR3.sub.tp-GFP, prsAPX.sub.tp-GFP, prTic40-E2A.sub.tp-GFP and prCpn10-1-C7C37S.sub.tp-GFP) and KpnI/PstI (for prAPS1.sub.tp-GFP) and cloned into the SacI/PstI site and KpnI/PstI site of the binary vector pCHF1 (Hajdukiewicz et al., 1994), respectively. The transit peptide-GFP fusion constructs were placed under the control of the CaMV35S promoter and the RBCS terminator. The resulting plasmids were transformed into Agrobacterium tumefaciens GV3101. Arabidopsis (Columbia ecotype) plants will be transformed by the floral spray method (Chung et al., 2000). Transgenic plants harboring the introduced transit peptide-GFP fusion transgene will be identified on MS medium containing 100 g/mL G418. Multiple independent transgenic plants will be obtained for each transit peptide-GFP construct. The RNA and protein amount of the expressed GFP will be detected by quantitative RT-PCR and immunoblotting. The localization of GFP in root leucoplasts will be verified by confocal microscopy. The size of GFP should also be the processed mature-size GFP on immunoblots, corroborating with delivery to plastids and removal of the transit peptide. After normalization to the GFP RNA level, the efficiency of each transit peptide in delivering GFP to root leucoplasts in each transgenic plant will be calculated. The average efficiency of each transit peptide will be compared to the average efficiency of prRBCS transit peptide. The efficiency of each transit peptide in delivering GFP to leaf chloroplasts will also be compared to that of prRBCS transit peptide. It is expected that the efficiency of each of the high-efficiency transit peptides as described herein, in delivering GFP to chloroplasts, will be equal or higher than that of prRBCS transit peptide. It is further expected that the efficiency of each of the high-efficiency transit peptides as described herein, in delivering GFP to leucoplasts, will be higher than that of prRBCS transit peptide.

(29) The present invention provides a group of nine transit peptides that have very high import efficiency into both chloroplasts and leucoplasts. They are transit peptides of the precursors of translocon at the inner envelope membrane of chloroplasts 40 kD (prTic40), chaperonin 10-2 (prCpn10-2), Fibrillin 1B (prFibrillin), ATP sulfurylase 1 (prAPS1), ATP sulfurylase 3 (prAPS3), 5-adenylylsulfate reductase 3 (prAPR3), stromal ascorbate peroxidase (prsAPX), prTic40-E2A (a prTic40 variant) and prCpn10-1-C7C37S (a chaperonin 10-1 variant). These nine transit peptides of the present invention all have similarly high chloroplast-import efficiency, and much higher leucoplast-import efficiency, than the prRBCS transit peptide. The more than 60 precursors the present invention tested and the nine precursors of the present invention have never been tested for leucoplast import before. The transit peptide of prRBCS is the most widely used transit peptide for delivering engineered proteins into plastids. Examples include the famous Golden Rice, Roundup Ready corn and Dicamba resistant soybean. In the case of Golden rice, for example, they have used the prRBCS transit peptide to deliver the bacterial carotene desaturase into rice grain leucoplasts. The present invention has shown quantitatively here that, for delivering proteins into leucoplasts, the nine transit peptides of the present invention are much more efficient than the prRBCS transit peptide. If the one of ordinary skill in the art had used one of the transit peptides from the present invention, the production of provitamin A in the rice grains may be even higher. The next step is to test which of the nine transit peptides offer the highest protein import efficiency into plastids in stably transformed plants.

(30) Although the present invention has been described with reference to the preferred embodiments thereof, it is apparent to those skilled in the art that a variety of modifications and changes may be made without departing from the scope of the present invention which is intended to be defined by the appended claims.