Nucleotide sequence expressing an exosome-anchoring protein for use as vaccine

Abstract

The present invention concerns a nucleotide sequence expressing a fusion protein, said fusion protein comprising or consisting of an exosome-anchoring protein fused at its C-terminus with an antigen, or a DNA expression vector comprising said nucleotide sequence, for use as vaccine.

Claims

1. A method of inducing a therapeutically effective cytotoxic lymphocyte (CTL) immune response in a subject, the method comprising: administering to the muscle of a subject a nucleic acid vaccine comprising: a) a nucleic acid expression vector, wherein the expression vector comprises a polynucleotide encoding a fusion protein, wherein said fusion protein comprises: (i) human HIV-1 Nef protein with mutations 3C, 153L and 177G, fused at its C-terminus to (ii) an immunogenic antigen; and b) one or more of a pharmaceutically acceptable excipient and/or adjuvant; wherein the administration of the nucleic acid vaccine induces a therapeutically effective CTL immune response.

2. The method of inducing a CTL immune response according to claim 1, wherein the antigen is selected from the group consisting of a Human Papilloma virus antigen, an HIV antigen, an Ebola virus antigen, a West Nile virus antigen, an HBV antigen, an HCV antigen, a Crimean-Congo virus antigen, an Influenza A virus antigen, a human melanoma antigen, and a human tumor-associated antigen.

3. The method of inducing a CTL immune response according to claim 2, wherein the antigen is Human Papilloma virus E6 or E7.

4. The method of inducing a CTL immune response according to claim 2, wherein the antigen is HIV Gag or Tat.

5. The method of inducing a CTL immune response according to claim 2, wherein the antigen is Ebola virus VP24, VP40, NP, or GP.

6. The method of inducing a CTL immune response according to claim 2, wherein the antigen is West Nile virus NS3.

7. The method of inducing a CTL immune response according to claim 2, wherein the antigen is HBV Core antigen.

8. The method of inducing a CTL immune response according to claim 2, wherein the antigen is HCV Core antigen, NS3, E1 or E2.

9. The method of inducing a CTL immune response according to claim 2, wherein the antigen is Crimean-Congo virus GP or NP.

10. The method of inducing a CTL immune response according to claim 2, wherein the antigen is Influenza virus A NP or M1.

11. The method of inducing a CTL immune response according to claim 2, wherein the human melanoma antigen is MAGE-A3 or MART-1.

12. The method of inducing a CTL immune response according to claim 2, wherein the human tumor-associated antigen is Her2/Neu or Hox B7.

13. The method of inducing a CTL immune response according to claim 1, wherein the adjuvant is an adjuvant of CD8.sup.+ T cell response.

14. The method of inducing a CTL immune response according to claim 1, wherein the fusion protein consists of (i) human HIV-1 Nef protein with mutations 3C, 153L and 177G, fused at its C-terminus to (ii) an immunogenic antigen.

Description

(1) The present invention now will be described by an illustrative, but not limitative way, according to preferred embodiments thereof, with particular reference to enclosed drawings, wherein:

(2) FIG. 1 shows the scheme of the mechanism underlying the CTL activation induced by the inoculation of Nef.sup.mut-based DNA vectors. After injection with DNA vector expressing an antigen fused to Nef.sup.mut, transfected muscle cells release both unmodified and engineered exosomes. The contents of these latter, once internalized by APC and cross-presented, induce the priming/activation of CD8.sup.+ T lymphocytes specific for the antigens uploaded in endogenous engineered exosomes.

(3) FIG. 2 shows the detection of engineered exosomes in supernatants of transfected murine muscle cells. A. FACS analysis of both human 293T and murine C.sub.2C.sub.12 muscle cells two days after transfection with either Nef.sup.mut/GFP or Nef.sub.G2A/GFP expressing vectors. M1 marks the range of positivity as established by the analysis of mock-transfected cells. Percentages of positive cells are reported. B. Quantification in terms of AchE activity of exosomes recovered by differential centrifugations of supernatants from the same number (i.e., 5×10.sup.6) of both 293T and C.sub.2C.sub.12 transfected cells. C. Western blot analysis of exosomes from both 293T and C.sub.2C.sub.12 transfected cells. Nef-based products were detected in both cell lysates and exosomes, while β-actin and Alix served as markers for cell lysates and exosomes, respectively. Arrows sign the relevant protein products. Molecular markers are given in kDa. D. FACS analysis of exosomes from C.sub.2C.sub.12 transfected cells. 10 mU of exosomes from C.sub.2C.sub.12 cells transfected with either Nef.sup.mut-GFP- or Nef.sub.G2A-GFP-expressing vectors were analyzed by FACS in terms of both forward/side scatter (upper panels) and GFP fluorescence (lower panels). Quadrants indicate either the dimension of the detected particulate (upper panels), or the range of positivity as calculated by the analysis of exosomes from mock-transfected cells. Results are representative of two independent experiments.

(4) FIG. 3 shows the detection of fluorescent nanovesicles in plasma from mice inoculated with a Nef.sup.mut-GFP expressing DNA vector. A. Analysis of the expression of GFP-related products in muscle tissues from mice inoculated with the indicated DNA vectors. Magnification: 40×. B. C57 BI/6 mice were inoculated i.m. with DNA vectors expressing the indicated products, and after 3 and 9 days exosomes were isolated from plasma by differential centrifugations. Then, equivalent amounts (i.e., 1 mU) of exosomes were bound to surfactant-free white aldehyde/sulfate latex beads, and finally assayed for their fluorescence. As control, 10 μU of exosomes isolated from the supernatants of 293T cells transiently transfected with Nef.sup.mut-GFP vector were used (Ctrl+). Quadrants were set on the basis of the fluorescence of untreated beads. Percentages of positive events are indicated. Results are representative of two assays.

(5) FIG. 4 shows the inoculation of Nef.sup.mut/E7 DNA vector inducing an E7-specific CD8.sup.+ T cell immune response in the absence of antibody production. CD8.sup.+ T cell immune response in mice inoculated with DNA vectors expressing either E7 or Nef.sup.mut/E7, or with empty vector. C57 BI/6 mice (six per group) were inoculated two times with the different DNA vectors. Splenocytes recovered from mice were incubated with or without 5 μg/ml of either unrelated (not shown), E7, or Nef specific nonamers. Cell activation extents were evaluated by IFN-γ Elispot assay carried out in triplicate with 10.sup.5 cells/well. As control, untreated cells were also incubated with 5 ng/ml of PMA and 500 ng/ml of ionomycin. Shown are the number of IFN-γ spot-forming cells (SFU)/10.sup.5 cells from triplicate wells seeded with splenocytes from each inoculated mice. Intergroup means+SD of SFU were also reported. The results are representative of three independent experiments. *p<0.05. B. CTL assay carried out with CD8.sup.+ T cells from mice inoculated with the indicated vectors. CD8.sup.+ T cells isolated from splenocytes from different inoculated mice were pooled and cultured for 6 hours at different cell ratios (i.e., from 20:1 to 5:1) with EL-4 cells previously labeled with CFSE and pre-treated with either unrelated or E7 peptides for 16 h. Six h later, the EL-4 cell mortality levels were scored by FACS analysis upon 7-AAD labeling. Shown are the results representative of four independent experiments. C. Anti-E7 antibody detection in plasma from mice inoculated with the indicated DNA vectors. As internal positive control standard (Ctrl+), 1:10,000 dilutions of plasma from mice injected with 10 μg of either recombinant E7 or Nef proteins plus adjuvant were used. Shown are the mean absorbance values +SD of triplicates of plasma pooled from six mice per group.

(6) FIG. 5 shows that the injection of wtNef-expressing DNA vector fails to elicit Nef-specific CD8.sup.+ T cell immune response in mice. Nef-specific CD8.sup.+ T cell immune response in mice inoculated with DNA vectors expressing wtNef, Nef.sup.mut, or with empty vector. C57 BI/6 mice (four per group) were inoculated i.m. two times with the DNA vectors, and ten days after the last immunization, mice were sacrificed and splenocytes cultured in IFN-γ Elispot microwells for 16 hours in the absence or presence of either unrelated or Nef-specific nonamers. As control, untreated cells were also incubated with 5 ng/ml of PMA and 500 ng/ml of ionomycin. Shown are the mean+SD number of SFU/10.sup.5 cells. The results are representative of two independent experiments. *p<0.05.

(7) FIG. 6 shows E7-specific CD8.sup.+ T cell immunity induced in mice injected with exosomes from mice inoculated with Nef.sup.mut/E7 DNA vector. CD8.sup.+ T cell immune response in mice inoculated with exosomes isolated from plasma of syngeneic mice previously injected with vectors expressing E7, Nef.sup.mut/E7, or empty vector. C57 BI/6 mice (8 for group, donor mice) were inoculated two times with the indicated DNA vectors, and ten days after the last inoculation, PBMCs were recovered from retro orbital bleeding and tested in IFN-γ Elispot assay for the presence of E7-specific CD8.sup.+ T cell response (upper panels). Two days later, the mice were sacrificed, and exosomes isolated from plasma by differential centrifugations. Equivalent amounts of these exosomes were then used to inoculate syngeneic mice (3 per group) three times. Ten days after the last inoculation, the splenocytes were recovered and the CD8.sup.+ T cell activation extents evaluated by IFN-γ Elispot assay carried out in triplicate (lower panel).

(8) In all IFN-γ Elispot assays, cells were also incubated with 5 ng/ml of PMA and 500 ng/ml of ionomycin. Shown are the mean+SD number of SFU/10.sup.5 cells. Results are representative of two independent experiments. *p<0.05.

(9) FIG. 7 shows the therapeutic anti-tumor effect induced by i.m. inoculation of Nef.sup.mut/E7 DNA vector. C57 BI/6 mice were challenged with 2×10.sup.5 TC-1 cells and 4 days later, when tumor masses were detectable by palpation, were inoculated with DNA vector expressing Nef.sup.mut/E7 (seven mice) or, as control, Nef.sup.mut, empty vector, or vehicle (four mice per group). The DNA inoculations were repeated at day 11 after tumor cell implantation, and the growth of tumor mass was followed over time. A. E7-specific CD8.sup.+ T cell response by IFN-γ Elispot assay in PBMCs recovered from retro orbital bleeding 7 days after the last immunization, and cultivated for 16 hours in the presence of either unrelated or E7 peptides. As control, PBMCs were also incubated with 5 ng/ml of PMA and 500 ng/ml of ionomycin. Shown are the number of SFU/10.sup.5 cells from triplicate wells seeded with splenocytes from each inoculated mice B. Determination of the tumor size during the 30-day observation time. C. Weight measure of tumors from mice injected with either Nef.sup.mut or Nef.sup.mut/E7 DNA vectors at the time of sacrifice.

(10) Shown are the values detected for each inoculated mouse. Results are representative of two independent experiments.

(11) FIG. 8 shows the detection of exosomes engineered with HER2/neu ECD in supernatants of transfected cells. Western blot analysis of lysates of both cells and exosomes from cultures of 293T cells transfected with vector expressing either Nef.sup.mut, Nef.sup.mut/HER2 ECD, or the void vector. Nef-based products were detected in both cells and exosomes, while β-actin and Alix served as markers for cell lysates and exosomes, respectively. Arrows sign the relevant protein products. Molecular markers are given in kDa. Results are representative of five independent experiments.

(12) FIG. 9 shows the detection of anti-HER2/neu antibodies in plasma from inoculated mice. Plasma for mice injected with vectors expressing either Nef.sup.mut or Nef.sup.mut/HER2-ECD were incubated with 293T cells transfected two days before with an HER2/neu expressing vector. After incubation with secondary Abs, the cells were fixed and FACS analyzed. As positive controls, both plasma from mice injected with lysates of 676-1-25 tumor cells constitutively over-expressing HER2/neu (HER2/neu cells), and an anti-HER2/neu mAb (Ctrl+) were used. Results are presented as mean values +SD of the mean fluorescent intensities (MFI) detected by FACS using plasma from each injected mouse, and are representative of two assays.

(13) FIG. 10 shows the detection of HER2/neu-specific CD8.sup.+ T cell immunity induced in mice upon injection of DNA vector expressing Nef.sup.mut/HER2-ECD. CD8.sup.+ T cell immune response in mice inoculated with DNA vectors expressing either Nef.sup.mut or Nef.sup.mut/HER2-ECD, or with empty vector (Void). 129Sv-Neu T mice (five per group) were i.m. inoculated two times with the different DNA vectors. At the time of sacrifice, 10.sup.5 splenocytes were incubated o.n. with or without 5 μg/ml of either unrelated, Nef-, or HER2-ECD-specific nonamers in either duplicate or triplicate IFN-γ Elispot microwells. As control, cells were also incubated in the absence of peptides (Nil). Shown are the mean number of IFN-γ spot-forming units (SFU)/10.sup.5+SD. The results are representative of three independent experiments. *p<0.05. On the bottom, a developed IFN-γ Elispot plate from a representative assay is shown.

(14) FIG. 11 shows the detection of the HER2/neu-specific CD8.sup.+ T cell immunity induced in DNA injected mice couples with an antigen-specific CTL activity. CTL assay carried out with CD8.sup.+ T cells from mice inoculated with the indicated vectors. CD8.sup.+ T cells were isolated from pooled splenocytes, cultured in duplicate for 6 hours at 10:1 cell ratio with TC-1 cells previously labeled with CFSE, and treated for 16 h with either unrelated, Nef-, or HER2-ECD-specific peptides. Six h later, TC-1 cell mortality was scored by FACS analysis upon 7-AAD labeling. Shown are the mean values +SD calculated from three independent experiments. *p<0.05. Mean value of background conditions (i.e., co-culture of CD8.sup.+ T lymphocytes from naïve mice with untreated TC-1 cells): 8.1±3.5. On the bottom, representative dot plots from FACS analysis of the co-cultures are shown. The percentages of double-fluorescent over the total of CFSE-positive cells are indicated.

(15) FIG. 12 shows the Anti-tumor effect induced by inoculation of Nef.sup.mut/HER2-ECD DNA vector. 129Sv-NeuT mice (5 for group) were inoculated two times with either the indicated DNA vectors or the vehicle (Nil) at both 15 and 17 weeks of age. A. Tumor incidence, expressed as the number of mice with at least one tumor >1 mm in diameter. B. Tumor multiplicity, calculated as the cumulative number of tumors/total number of mice +SD. Data are representative of three independent experiments.

(16) FIG. 13 shows the Internalization in iDCs of exosomes released by human primary skeletal muscle cells. A. FACS analysis of SKMC 2 days after transfection with vectors expressing either GFP, Nef.sup.mut/GFP, or empty vector. Shown are GFP fluorescence levels as detected in a representative of five independent experiments. The percentages of GFP positive cells are indicated. M1: range of positivity. B. Confocal microscope analysis of co-cultures comprising iDCs and SKMC transfected with DNA vectors expressing either GFP or Nef.sup.mut/GFP, the latter carried out in the presence or not of both GW4869 and spiroepoxide. Slides were stained with both DAPI (blue fluorescence) and anti-CD45 mAb (red fluorescence) before analysis. For co-cultures comprising Nef.sup.mut/GFP-transfected SKMC, two sections of the same field are reported, the first one highlighting CD45 positive cells (top panel, black arrows), whereas in the image at the bottom, both Nef.sup.mut/GFP-expressing SKMC (greenblack arrow) and regions of fluorescence accumulation into iDCs (white arrows) are indicated.

(17) FIG. 14 shows the Nef-specific CTL activity elicited by human DCs co-cultivated with muscle cells expressing Nef.sup.mut-based DNA vectors. A. Scheme of the cross-priming assays. SKMC were transfected and, 48 hours later, put in co-culture with iDCs which, after additional 24 hours, were isolated and matured. Autologous PBLs were then added to mDCs, and the co-cultivation was carried out for 7 days. Afterwards, the PBL stimulation was repeated, and after additional 7 days, CD8.sup.+ T lymphocytes were isolated and tested in CTL assays through co-cultivation with syngeneic target cells. B. Western blot analysis of cell lysates from either parental or Nef.sup.mut stably transfected MCF-7 cells. Filters were incubated with either anti-Nef or anti-β-actin Abs. Arrow signs the relevant protein product. Molecular markers are given in kDa. C. CTL assay carried out by co-cultivating primed CD8.sup.+ T lymphocytes with MCF-7 cells expressing or not Nef.sup.mut in a 10:1 cell ratio. Results were presented as mean values +SD calculated from triplicate conditions of three independent experiments. *p<0.05. Mean value of background conditions (i.e., co-culture of naïve CD8.sup.+ T lymphocytes with MCF-7): 11.9±5.

(18) FIG. 15 shows that the treatment with inhibitors of exosome synthesis blocks the cross-priming induced by DCs isolated from co-cultures with transfected SKMC. SKMC were transfected with a DNA vector expressing the Nef.sup.mut/MART-1 fusion product and, after 2 days, put in co-culture with iDCs in the presence or not of both GW4869 and spiroepoxide. After 16 hours, iDCs were isolated, matured, and put in co-culture with autologous PBLs. After two cycles of stimulation, CD8.sup.+ T lymphocytes were isolated and challenged in a CTL assay by 10:1 co-cultivations with CFSE-labeled, syngeneic B-LCLs previously treated with either unrelated or MART-1 specific peptides. Shown are the mean percentages of target cell mortality +SD calculated from triplicate conditions of three independent experiments. Mean value of background conditions (i.e., co-culture of naïve CD8.sup.+ T lymphocytes with untreated syngeneic B-LCLs): 7.3±2.1

EXAMPLE 1

Study of Anti-Tumor HPV E7-specific CTL Activity Elicited by In Vivo Engineered Exosomes Produced Through DNA Inoculation

(19) Materials and Methods

(20) Molecular Constructs and Cell Cultures

(21) All molecular constructs were based on IE-CMV-promoted vectors. The constructions of vectors expressing Nef.sup.mut (13), Nef.sup.mut-GFP (13), Nef.sub.G2A-GFP (23), wtNef (24), and HPV-E7 (25), have been already described. 293T, murine muscle C.sub.2C.sub.12, and HPV-E7 expressing TC-1 tumor cells were grown in Dulbecco's modified Eagle's medium plus 10% heat-inactivated fetal calf serum (FCS). Transfection assays were carried out using the Lipofectamine 2000-based method, which in the case of C.sub.2C.sub.12 cells was modified by adding liposomes on freshly trypsinized cells. Both mouse splenocytes and EL-4 cells, i.e., murine thymic lymphoma CD4.sup.+ T cells originally obtained from C57 BI/6 mice upon treatment with 9,10-dimethyl-1,2-benzanthracene, were cultivated in RPMI medium supplemented with 10% FCS.

(22) Exosome Isolation, Detection, and Characterization

(23) Exosomes were isolated from cell supernatants through differential centrifugations. In detail, supernatants were centrifuged at 500×g for 10 min. Then, supernatants underwent differential centrifugations consisting in a first ultracentrifugation at 10,000×g for 30 min. Supernatants were then harvested, filtered with 0.22 μM pore size, and ultracentrifuged at 70,000×g for 1 h. Pelleted vesicles were resuspended in 1×PBS, and ultracentrifuged again at 70,000×g for 1 h. Afterwards, pellets were resuspended in 1:100 of the initial volume of 1×PBS. The recovery of exosomes from plasma of inoculated mice was carried out in a similar way except that samples were 5-fold diluted before starting centrifugations whose running times were doubled. The amounts of recovered exosomes were evaluated by measuring the activity of acetylcholinesterase (AchE), i.e., a classical exosome marker, through the Amplex Red kit (Molecular Probes) following the manufacturer's recommendations. The AchE activity was measured as mU/mL, where 1 mU is defined as the amount of enzyme which hydrolyzes 1 pmole of acetylcholine to choline and acetate per minute at pH 8.0 at 37° C.

(24) Fluorescent exosomes from transfected cell cultures were either directly detected by FACS (Gallios, Beckman Coulter), or, in the case of exosomes isolated from plasma, analyzed upon binding with aldehyde/sulfate latex beads (Invitrogen Molecular Probes). To this end, samples were incubated with 5 μl of beads overnight at r.t. on a rotating plate, and then washed, resuspended in 1×PBS-2% v/v formaldehyde, and FACS analyzed.

(25) For western blot analysis of exosomes, equivalent amounts of nanovesicles were lysed in PBS, 1% Triton X-100 in the presence of anti-proteolytic agents, and then separated by 10% SDS-PAGE. Meanwhile, western blot analysis was carried out also on lysates of transfected cells by washing cells twice with 1×PBS (pH 7.4) and lysing them for 20 min on ice with lysis buffer (20 mM HEPES pH 7.9, 50 mM NaCl, 10 mM EDTA, 2 mM EGTA, 0.5% nonionic detergent IGEPAL CA-630, supplemented with anti-proteolytic agents. Whole cell lysates were centrifuged at 6,000×g for 10 min at 4° C. Protein concentration of cell extracts was determined by the Lowry protein quantitation assay. Aliquots of 30 to 50 μg of total proteins were resolved by 10% SDS-PAGE. Proteins were transferred by electroblotting on a 0.45 μm pore size nitrocellulose membrane (Amersham) overnight using a Bio-Rad Trans-Blot. Filters were revealed using 1:1000 diluted sheep anti-Nef antiserum ARP 444 (a generous gift of M. Harris, University of Leeds, Leeds, UK), and both 1:250 diluted anti-β actin AC-74 mAb from Sigma, and anti-Alix H-270 polyclonal Abs from Santa Cruz.

(26) Mice Immunization and Detection of IFN-γ Producing CD8.sup.+ T Lymphocytes

(27) All studies with animals here described have been approved by the Ethical Committee of the Istituto Superiore di Sanità, Rome, Italy (protocol n. 555/SA/2012) according to Legislative Decree 116/92 which has implemented in Italy the European Directive 86/609/EEC on laboratory animal protection. Animals used in the research have been housed and treated according to the guidelines inserted in here above mentioned Legislative Decree. C57 BI/6 mice were purchased from Charles River Laboratories, and inoculated i.m. two times at ten day intervals with 50 μg each back leg of plasmid DNA purified with endotoxin-free Qiagen kit. Mice were also inoculated subcutaneously (s.c.) with 6 mU equivalents of AchE activity of exosomes purified from plasma of mice injected with DNA vectors for three times at ten day intervals, and sacrificed ten days after the last immunization. To detect both E7- and Nef-specific CD8.sup.+ T cell immune responses, splenocytes were put in culture in IFN-γ Elispot microwells (Millipore) in the presence of 5 μg/ml of either HPV-E7 or HIV-1 Nef 8- or 9-mer peptides already identified to efficiently bind the H-2 K.sup.b complex of C57 BI/6 mice, i.e., DLYCYEQL (aa 21-28) (SEQ ID NO: 3) and RAHYNIVTF (aa 49-57) (SEQ ID NO: 4) for E7 (HPV-16 Gene Bank accession n. AAD33252.1), and TAATNADCA (aa 48-56) (SEQ ID NO: 5) for Nef (HIV-1, F12 strain, accession number EMBL Z11530). H-2 K.sup.b binding HPV E6-specific KLPQLCTEL (aa. 18-26) (SEQ ID NO: 6) and YDFAFRDL (aa 50-57) (SEQ ID NO: 7) peptides (HPV-16 Gene Bank accession n. AAD33253.1) were used as unrelated peptides. After o.n. incubation, IFN-γ Elispot plates were developed (Mabtech AB), and spot-forming cells were analyzed and counted using an Elispot reader (A.EL.VIS. Elispot reader and Analysis software GmbH).

(28) Fluorescence Microscope Analysis

(29) For analysis by fluorescence microscope, 7 μM slices from quadriceps of inoculated mice were prepared by cryostat (Leika CM 3050) sectioning and placed to slides. The slices were then incubated with 4′,6′-diamidino-2-phenylindole (DAPI, Vector Laboratories) together with an antifade mounting medium. Finally, coverslips were mounted to slides which were then observed with a Zeiss Axioskop 2 Plus fluorescence microscope.

(30) CTL Assay

(31) CD8.sup.+ T cells were isolated from splenocytes of inoculated mice by positive immunomagnetic selection (Miltenyi Biotec). They were put in co-culture for 6 hours in RPMI 10% FCS with EL-4 cells previously labeled with carboxyfluorescein succinimidyl ester (CFSE, Invitrogen), and treated overnight with either E7 or unrelated peptides. The co-cultures were run at different cell ratios (i.e., from 20:1 to 5:1 effector/target cells) in 200 μl of RPMI 20% in U-bottom 96 well plates. Afterwards, EL-4 cell mortality was scored by FACS analysis soon after addition of 7-AAD at final concentration of 1 μg/ml.

(32) Detection of Anti-E7 and Anti-Nef Antibodies in Plasma

(33) Plasma from inoculated mice were pooled, and two-fold serial dilutions starting from 1:10 were assayed for the presence of anti-E7 Abs. The end-point dilution corresponded to a <0.1 OD absorbance at 450 nm. Each plasma was assayed in triplicate, and the mean of the absorbance value was taken as final readout. Both recombinant E7 and Nef were used for the assay. The proteins were adsorbed overnight at 4° C. in carbonate buffer (pH 9.4) into Maxisorp microtiter plates (NUNC) at the concentrations of 0.25 μg/well. After a blocking step of 2 h of at 37° C. in PBS containing 3% non-fat dry milk (NFDM), plates were incubated at 37° C. for 1 h with 100 μL of serially diluted plasma in 1% NFDM-PBS. Specific antigen-antibody complexes were detected by a peroxidase-conjugated goat anti-mouse IgG (GE Healthcare Ltd) using tetramethyl benzidine as substrate. After 30 min at room temperature, the enzymatic reaction was stopped by adding 50 μl of 1 M sulphuric acid/well. Washing steps were done with 200 μl/well of PBS containing 0.05% Tween-20 in an automatic washer.

(34) Anti-Tumor Effects of Nef.sup.mut/E7 Exosomes

(35) The anti-tumor activity induced by the inoculation of Nef.sup.mut/E7-expressing vector was evaluated in mice previously challenged with 2×10.sup.5 TC-1 cells. DNA inoculations were performed 4 and 11 days after tumor cell challenge following the above reported protocol, and only in mice which developed palpable tumors. Tumor growth was monitored by visual inspection, palpation, and measurement of tumor nodule diameter calculated as (length×width.sup.2)/2. At the end of the observation time, tumors were explanted and weighted.

(36) Statistical Analysis

(37) When appropriate, data are presented as mean+standard deviation (SD). In some instances, the paired Student's t-Test was used and confirmed using the non-parametric Wilcoxon rank sum test. p<0.05 was considered significant.

(38) Results

(39) Detection of Engineered Exosomes Released by DNA Transfected Murine Muscle Cells

(40) Muscle cells represent the ideal target for a both efficient and stable expression of ectopic DNA upon in vivo administration. The aim was to express Nef.sup.mut-based DNA vectors in vivo to engineer the exosomes constitutively released by cells expressing the inoculated DNA. These endogenous exosomes were expected to show characteristics at least similar to those produced in tissue cultures in terms of induction of antigen-specific CTL immune responses.

(41) As already assessed in human cell types of different origin, whether the internalization of a Nef.sup.mut-expressing DNA vector in murine muscle cells was sufficient for the production of engineered exosomes has been preliminarily investigated. Notably, murine muscle cells release nanovesicles with exosome-like characteristics whose biogenesis, however, differ from that of MVB-generated exosomes. For the sake of clarity, exosome-like nanovesicles released by murine muscle cells are here defined exosomes.

(42) Murine C.sub.2C.sub.12 muscle cells and, as control, human 293T cells were transfected with vector expressing GFP fused at the C-terminus of either Nef.sup.mut or a Nef isotype (i.e., Nef.sub.G2A) already characterized for its inefficiency to associate with exosomes (26). Transfected cell cultures were monitored for the respective efficiency of transfection (FIG. 2A) which in muscle cells appeared to be over 50% of that detected in 293T cells. The supernatants were collected, and exosomes isolated through differential centrifugations. Exosome preparations were then titrated in terms of AchE activity (FIG. 2B). The two cell types produced apparently similar levels of AchE positive nanovesicles whatever the transfection conditions. The western blot analysis of equal amounts of exosomes shown the presence of Nef-derived molecules in exosomes from both 293T and C.sub.2C.sub.12 cells transfected with Nef.sup.mut-GFP but not Nef.sub.G2A-GFP vectors (FIG. 2C). The FACS analysis of exosome preparations confirmed the association of fluorescence with the nanovesicles recovered from C.sub.2C.sub.12 cells transfected with Nef.sup.mut-GFP but not Nef.sub.G2A-GFP (FIG. 2D).

(43) In sum, it has been proved that exosome-like nanovesicles released by murine muscle cells can be engineered by Nef.sup.mut-derivatives as previously proven in epithelial-like, transformed human 293T cells.

(44) Nef.sup.mut-Derived Products Can Be Detected in Exosomes from Plasma of DNA Inoculated Mice

(45) On the basis of the in vitro results which were obtained with murine muscle cells, the expression of the Nef.sup.mut-based vector in vivo has been attempted. To this aim, 50 μg of either Nef.sup.mut-GFP, Nef.sub.G2A-GFP, or empty vector were inoculated in each quadriceps of C57 BI/6 mice. Three days later, a number of inoculated mice was sacrificed and their legs cryopreserved. Then, slices obtained from the zones of inoculation were analyzed for the expression of GFP-related products. Consistently with the already described features of Nef and its mutants/derivatives, Nef.sup.mut apparently accumulated at the plasma membrane meanwhile disposing also in an intracellular punctate pattern. Differently, the Nef.sub.G2A mutant, as consequence of the lack of N-terminal myristoylation, disposed in a more diffuse intracytoplasmic distribution (FIG. 3A). Three and nine days after inoculation, plasma were recovered from the remainder inoculated mice, and the exosomes isolated by differential centrifugations. Exosome preparations were then titrated in terms of AchE activity, and the same amounts of exosomes were bound to white aldehyde/sulphate latex beads. Through this method, even rare fluorescent nanovesicles were expected to be detectable by FACS analysis. Positive signals were scored in samples comprising exosomes isolated from plasma of mice both 3 and 9 days after injection with Nef.sup.mut-GFP but not Nef.sub.G2A-GFP vector (FIG. 3B). These results suggested that the inoculation in mice of vectors expressing Nef.sup.mut-derivatives can lead to generation of engineered exosomes.

(46) HPV-E7 Specific CTL Response Upon i.m. Inoculation of a Nef.sup.mut/E7 Expressing DNA Vector

(47) Next, the immunogenicity of the antigens uploaded in engineered exosomes generated by the inoculation of DNA vectors expressing Nef.sup.mut-derivatives was evaluated. To this aim, C57 BI/6 mice (six per group) were inoculated i.m. in each back lag with 50 μg of vectors expressing either Nef.sup.mut/E7 or E7 alone, or with empty vector. Of note, the analysis of the immune response after injection of a vector expressing E7 alone was instrumental to evaluate the benefit of the Nef.sup.mut-fusion in terms of CD3.sup.+ T cell immunogenicity. The inoculations were repeated 10 days later, and after additional 10 days the mice were sacrificed, and the splenocytes cultured o.n. in IFN-γ Elispot microwells in the presence of unrelated, Nef- or E7-specific H-2 K.sup.b nonamers. The levels of CD8.sup.+ T cell activation observed in cultures with unrelated peptides remained at background levels and similar to those detected in splenocytes cultured in the absence of peptides (not shown). On the other hand, cell activation was clearly detectable in splenocytes from mice inoculated with the Nef.sup.mut/E7 expressing vector after incubation with either E7 or Nef nonamers (FIG. 4A). Conversely, no CD8.sup.+ T cell response was detected in cultures of splenocytes from mice receiving either E7-expressing or empty vector, whatever the peptide used.

(48) To evaluate whether the CD8.sup.+ T cell response associated with a measurable CTL activity, CD8.sup.+ T cells were isolated from pools of splenocytes, and then put in co-culture for 6 h at different cell ratios (i.e., from 20:1 to 5:1) with CFSE-labelled EL-4 cells pre-treated o.n. with either unrelated or E7 nonamers. Afterwards, the co-cultures were labelled with 7-AAD, and the mortality levels of target cells scored by FACS analysis. The results reported in FIG. 4B show a clear increase of target cell mortality in both 20:1 and 10:1 co-cultures comprising CD8.sup.+ T lymphocytes only from mice inoculated with the Nef.sup.mut/E7-expressing vector with EL-4 pre-treated with E7-specific nonamers. This result demonstrated that activated CD8.sup.+ T lymphocytes detected in mice inoculated with the Nef.sup.mut/E7-expressing vector by IFN-γ Elispot assay possessed E7-specific cytotoxic activity. Notably, anti-E7 antibodies were detected only in plasma from mice inoculated with the vector expressing E7 alone (FIG. 4C).

(49) Taken together, these data indicated that the i.m. inoculation of a vector expressing an heterologous antigen fused with Nef.sup.mut leads to the induction of a strong antigen-specific CTL response in the absence of antibody production.

(50) The Inoculation of DNA Vector Expressing the Wild-Type Nef Isoform Does Not Elicit Nef-Specific CD8.sup.+ T Cell Activation

(51) The results provide evidence that the i.m. injection of DNA vectors expressing Nef.sup.mut-derivatives leads to the production of exosomes uploading Nef.sup.mut products correlating with the induction of a CTL response against the foreign antigen incorporated into the exosomes. To support the idea that the high levels of Nef.sup.mut incorporation in exosomes were mandatory to elicit the antigen specific CD8.sup.+ T cell response, the immunogenicity experiments were reproduced however by inoculating mice with vectors expressing the wild-type isoform of Nef which incorporates in exosomes at much lower extents compared to Nef.sup.mut (13).

(52) To this end, C57 BI/6 mice (four per group) were injected i.m. in each back lag with 50 μg of a vector expressing either wtNef or Nef.sup.mut, or with the empty vector. The inoculations were repeated 10 days later, and after additional 10 days the mice were sacrificed. Splenocytes were then isolated and cultured o.n. in IFN-γ Elispot microwells in the presence of either unrelated or Nef-specific nonamers. As shown in FIG. 5, mice inoculated with the vector expressing wtNef, differently to those receiving the Nef.sup.mut-vector, failed to mount a detectable CD8.sup.+ T Nef-specific response.

(53) These results indicate that the efficiency of antigen uploading in exosomes is critical for the induction of the immune response, also suggesting that the functions of wtNef were not per se involved in the CD8.sup.+ T cell activation we observed.

(54) Exosomes Isolated From Plasma of Mice Immunized With a DNA Vector Expressing Nef.sup.mut/E7 Induce an E7-Specific CD8.sup.+ T Cell Response in Syngeneic Mice.

(55) To enforce the hypothesis that the CD8.sup.+ T cell immune response detected upon inoculation of Nef.sup.mut-expressing vectors relies on the in vivo production of engineered exosomes, whether exosomes purified from the plasma of inoculated mice were immunogenic in recipient naïve mice was assessed. To this aim, eight mice were inoculated with vectors expressing E7, Nef.sup.mut/E7 or the empty vector following the here above detailed schedule. Eight day after the last immunization, PBMCs were recovered through retro orbital bleeding, and put in IFN-γ Elispot microwells to check the E7-specific CD8.sup.+ T cell response. As already observed, the injection of the Nef.sup.mut/E7 expressing vector, but not that expressing E7 alone, gave rise to a well detectable E7-specific CD8.sup.+ T cell response (FIG. 6A). Plasma from homogeneous groups were pooled, and exosomes isolated by differential centrifugations. Afterwards, exosomes were titrated in terms of AchE activity, and the equivalent of 6 mU of AchE activity of exosomes were injected s.c. in syngeneic mice three times with ten day intervals. Finally, mice were sacrificed, and splenocytes tested for the E7-specific CD8.sup.+ T cell responses. Interestingly, by o.n. culture in IFN-γ Elispot microwells we noticed a E7-specific cell activation only in splenocyte cultures from mice inoculated with exosomes purified from mice injected with the Nef.sup.mut/E7 expressing vector (FIG. 6B).

(56) These results indicate that the i.m. injection of DNA expressing Nef.sup.mut/E7 leads to the production of immunogenic exosomes, hence further supporting the idea that the DNA-directed production of endogenous, engineered exosomes was on the basis of the observed strong E7-specific CD8.sup.+ T cell immune response.

(57) Therapeutic Anti-Tumor Effect of the HPV-E7-Specific CTL Response Induced by i.m. Inoculation of Nef.sup.mut/E7-Expressing DNA Vector

(58) Finally, the potency of the CD8.sup.+ T cell immune response evoked by injection of Nef.sup.mut/E7 expressing vector in terms of anti-tumor effect has been evaluated. To this end, therapeutic immunization assays on C57 BI/6 mice inoculated s.c. with 2×10.sup.5 TC-1 cells have been set up. Mice developing a tumor mass detectable by palpation, i.e., of about 2 mm of diameter, were then inoculated with 50 μg/back leg of vectors expressing either empty vector, Nef.sup.mut (4 mice per each group) or Nef.sup.mut/E7 (six mice) at both days 4 and 11 after cell implantation. As control, 4 tumor-implanted mice were injected with the vehicle alone. At day 21, retro orbital bleeding carried out on mice injected with Nef.sup.mut- or Nef.sup.mut/E7-expressing vectors served to assess the induction of E7-specific CD8.sup.+ T cell immune response (FIG. 7A). The growth of tumors was monitored over 30 days, and thereafter mice were sacrificed, tumors explanted, and weighted. FIG. 7B clearly shows that, whereas the injection of control DNA vectors did not influence the growth of implanted tumor cells, their expansion was severely impaired in mice inoculated with Nef.sup.mut/E7 vector, being tumor cells still apparently cleared in 3 mice, as confirmed by the tumor weight evaluation (FIG. 7C).

(59) From these data it can be concluded that the inoculation of Nef.sup.mut/E7-expressing DNA vector elicits a CD8.sup.+ T cell immune response also in the presence of tumor cells. Most important, this immune response was both strong and rapid enough to strongly inhibit the growth of previously implanted syngeneic tumor cells.

(60) Taken together, these results represent a relevant milestone towards possible therapeutic applications of immunization strategies based on Nef.sup.mut-based endogenous exosomes.

EXAMPLE 2

Study on CD8+ T Cell Immunity Elicited by In Vivo Inoculation of Vectors Expressing Antigens Fused with Nef.SUP.mut

(61) The strategy of immunization based on inoculation of DNA vectors expressing an antigen fused to the C-terminus of Nef.sup.mut has been successfully applied also to a variety of additional viral antigens (see Tab. 1). In detail, vectors expressing such antigens fused with Nef.sup.mut have been injected in either C57 BI/6 or Balb/c mice following the here above described schedule. From 10 to 15 days after the last inoculation, IFNγ ELISPOT assays were carried out with splenocytes from the injected mice using the peptides listed in Table 1.

(62) TABLE-US-00005 TABLE 1 Antigen-specific CD8.sup.+ T cell immunity induced in mice inoculated with vectors expressing different antigens fused with Nef.sup.mut.sup.a Sequence Spot-forming Peptides for detecting CD8.sup.+ accession Antigen units/10.sup.6 cells T cell immunity number EboV VP24 310 ± 35 KFINKLDALH (SEQ ID NO: 8) AY142960 DAVLYYHMM (SEQ ID NO: 9) EboV VP40 285 ± 18 LRIGNQAFLQEFVLPP (SEQ ID NO: 10) L11365 EboV NP 409 ± 21 VYQVNNLEEIC (SEQ ID NO: 11) AY142960 DAVLYYHMM (SEQ ID NO: 12) HCV NS3 190 ± 57 ITQMYTNV (SEQ ID NO: 13) AFN53788.1 WYELTPAETSV (SEQ ID NO: 14) WNV NS3 210 ± 17 GYISTKVEL (SEQ ID NO: 15) ABG67747.1 DRRWCFDGPRTNTIL (SEQ ID NO: 16) Flu NP 232 ± 44 ASNENMETM (SEQ ID NO: 17) ACX46208.1 .sup.aShown are the mean values ±SD subtracted background values as calculated from data obtained with splenocytes from four inoculated mice each tested in triplicate wells.
The results support the idea that the injection of DNA expressing antigens fused to Nef.sup.mut is instrumental to induce CTL immunity against a wide range of full-length antigens.

EXAMPLE 3

Study of the CTL Activity Elicited by In Vivo Engineered Exosomes According to the Present Invention in Breast Cancer

(63) Materials and Methods

(64) Molecular Constructs

(65) DNA coding for the extra-cellular domain (ECD) of activated rHER2/neu was recovered by RT-PCR carried out on total RNA extracted from N202.1A cells, i.e., a cell line derived from FVB mice transgenic for rHER-2/neu (27). The following primers comprising the Nhe I and Eco RI restriction sites at the respective 5′ end were used: forward (just downstream to the signal peptide) 5′ CTAGCTAGCACCCAAGTGTGTACCGGC 3′(SEQ ID NO:18); reverse: 5′CCGGAATTCTCAGTGGGT CA GTTGATGGG 3′(SEQ ID NO:19). To obtain the vector expressing the Nef.sup.mut/HER2-ECD fusion product, the PCR product was Nhe I/Eco RI cut, and inserted in frame at the 3′ terminus of an Nhe I/Eco RI digested pcDNA3-based vector expressing Nef.sup.mut. Through this strategy, both rat and mouse HER2-ECD sequences were expected to be fused with Nef.sup.mut in the resulting molecular constructs. The selection was made on the basis of the presence of rHER2/neu sequence. Vectors expressing Nef.sup.mut, Nef.sup.mut/GFP, and Nef.sup.mut/MART-1 have been already described (13). The IE-CMV-promoted vector expressing the rHER2/neu was kindly provided by A. Amici, University of Urbino, Italy.

(66) Cell Cultures and Transfections

(67) 293T, MCF-7, murine muscle C.sub.2C.sub.12 (all obtained from American Type Culture Collection), and TC-1 cells (28) were grown in Dulbecco's modified Eagle's medium plus 10% heat-inactivated fetal calf serum (FCS). Transfection assays were carried out by Lipofectamine 2000-based method (Invitrogen, Thermo Fisher Scientific), which in the case of C.sub.2C.sub.12 cells was modified by adding liposomes on freshly trypsinized cells. HLA-A.02 B-LCLs (29), murine splenocytes, and CD8.sup.+ T lymphocytes were cultivated in RPMI medium plus 10% FCS. Human primary skeletal muscle cells (SKMC) were obtained from Lonza, and cultivated with the recommended medium.

(68) Human PBMCs were isolated from healthy donors by Fycoll-Hypaque density gradients. Monocytes were isolated from PBMCs using an immunomagnetic monocyte selection kit (Miltenyi). Purity of recovered cell populations was assayed by FACS analysis using PE-conjugated anti-CD14 mAb (Becton Dickinson). Monocytes were differentiated to iDCs upon 4-5 days of culture in RPMI medium supplemented with 20% FCS, 30 ng/mL granulocyte-macrophage colony-stimulating factor (GM-CSF) (Serotec Ltd), and 500 units/mL IL-4 (R&D Systems). DC maturation was obtained through o.n. treatment with 10 ng/mL of lipopolysaccharide (LPS).

(69) Exosome Preparation and Purification

(70) Exosomes were isolated through differential centrifugations as previously described (30) starting from supernatants of 293T cells 48 to 72 hours after transfection. The amounts of recovered exosomes were evaluated by measuring the activity of acetylcholinesterase (AchE, i.e., a classical exosome marker) (31) through Amplex Red kit (Molecular Probes, Thermo Fisher) following the manufacturer's recommendations.

(71) Western Blot

(72) Western blot analyses of both cell lysates and exosomes were carried out as described (13). Filters were revealed using 1:1000 diluted sheep anti-Nef antiserum ARP 444 (MRC), 1:250 diluted anti-β actin AC-74 mAb from Sigma, and 1:100 diluted anti-Alix H-270 polyclonal Abs from Santa Cruz.

(73) Mouse Model

(74) All studies with animals here described have been approved by the Ethical Committee of the ISS (protocol n. 107/2016-PR) according to Legislative Decree 116/92 which has implemented in Italy the European Directive 86/609/EEC on laboratory animal protection. Animals used in our research have been housed and treated according to the guidelines inserted in here above mentioned Legislative Decree. A colony of 129Sv-NeuT transgenic mice generated and bred in the ISS animal facility (32) was used. In these mice, the activated rHER-2/neu gene is promoted by MMLV LTR and virgin females spontaneously develop mammary carcinomas becoming palpable at 15-20 weeks of age. The presence of the rHER2/neu transgene was routinely checked by PCR as described (32). Mice were inoculated i.m. two times at 15 and 17 weeks of age with 50 μg for each quadriceps of plasmid DNA purified with endotoxin-free Qiagen kit. The mammary glands were inspected once a week for tumor monitoring. Mice bearing tumors exceeding 30 mm of diameter were euthanized.

(75) Antibody Detection

(76) Plasma from inoculated mice were 1:20 diluted and tested for the presence of anti-HER2/neu antibodies on 293T cells transfected two days before with a HER2/neu expressing vector. After 2 hours of incubation at 4° C., cells were washed and incubated with FITC-conjugated anti-mouse IgGs, and FACS analyzed 1 hour later. As a positive control, 1:20 diluted anti HER2/neu mAb clone 7.16.4 (Sigma) was used.

(77) ELISPOT Assay

(78) To detect both HER2/neu- and Nef-specific CD8.sup.+ T cell immune responses, splenocytes were put in IFN-γ Elispot microwells (Millipore) in the presence of 5 μg/ml of either HER2/neu or HIV-1 Nef 9-mer peptides binding the H-2 K.sup.b complex of 129Sv transgenic mice, i.e., ILHDGAYSL (aa 436-444) (33) (SEQ ID NO: 21) and TAATNADCA (aa 48-56) (34) (SEQ ID NO: 5), respectively. H-2 K.sup.b binding heterologous peptides (35) were used as control. After o.n. incubation, IFN-γ Elispot plates were developed (Mabtech), and spot-forming units (SFUs) counted.

(79) Cross-Priming Assay

(80) A total of 10.sup.6 SKMC was transfected with 10 μg of either Nef.sup.mut-based or control vectors. After 48 hours, the cells were put in co-culture with iDCs in a 1:5 cell ratio, and, in some instances, in the presence of 2 μM of the inhibitors of exosome biosynthesis GW4869 and spiroepoxide (36-41). After an overnight incubation, iDCs were isolated and matured by LPS treatment for 24 hours. Thereafter, iDCs were washed, and put in co-culture with autologous peripheral blood lymphocytes (PBLs) in a 1:10 cell ratio. A week later, the stimulation procedure was repeated, and, after an additional week, CD8.sup.+ T cells were recovered for CTL assays.

(81) CTL Assays

(82) CTL assays with murine cells were performed by isolating CD8.sup.+ T cells from splenocytes by positive immunomagnetic selection (Miltenyi). They were put in co-culture for 6 hours in RPMI 10% FCS with TC-1 cells previously labeled with carboxyfluorescein succinimidyl ester (CFSE, Invitrogen, Thermo Fisher) following the manufacturer's recommendations, and treated overnight with either HER2/neu, Nef, or unrelated peptides. The co-cultures were run at 10:1 effector/target cell ratio in 200 μL of RPMI 20% in U-bottom 96 well plates. Afterwards, TC-1 cell mortality was scored by FACS analysis soon after addition of 7-AAD at final concentration of 1 CTL assays in human cells were carried out in a similar way except that either MCF-7 or B-LCLs were used as target cells.

(83) Confocal Microscope Analysis

(84) Overnight co-cultures comprising iDCs and SKMC transfected two days before with vectors expressing either GFP or Nef.sup.mut/GFP, were carried out in a 1:5 cell ratio in the presence or not of GW4869 and spiroepoxide. Thereafter, cells were stained first with anti-CD45 (i.e., a marker of iDCs) for 1 hour at 4° C., and then with Alexa-Fluor 610-conjugated secondary Abs. Finally, co-cultures were labelled with 4′,6′ diamino-2-phenylindole (DAPI, Vector Laboratories), and fixed in buffered formaldehyde (2% v/v). Phase contrast and fluorescence images were recorded with an Olympus IX-81 device.

(85) Statistical Analysis

(86) When appropriate, data are presented as mean+standard deviation (SD). In some instances, the paired Student's t-Test was used and confirmed using the non-parametric Wilcoxon rank sum test. p<0.05 was considered significant.

(87) Results

(88) The Extra-Cellular Domain of rHER2/neu is Efficiently Uploaded in Exosomes Upon Fusion With Nef.sup.mut.

(89) ECD of rHER2/neu deprived of the signal peptide was fused at the C-terminus of Nef.sup.mut in the context of a IE-CMV-promoted eukaryotic vector. To check both stability and exosome incorporation of the fusion product, 293T cells were transiently transfected with vectors expressing either Nef.sup.mut or Nef.sup.mut/HER2-ECD, or with void vector. After 48 hours, cells were lysed and supernatants underwent differential centrifugations to isolate exosomes. Both cell and exosome lysates were analyzed by western blot (FIG. 8). The fusion product appeared stable and uploaded at valuable extents in exosomes. Similar results were obtained by transfecting C.sub.2C.sub.12 murine muscle cells (not shown).

(90) The Injection in rHER2/neu Transgenic Mice of a DNA Vector Expressing Nef.sup.mut/HER2-ECD Induces a Specific CD8.sup.+ T Lymphocyte Activation in the Absence of Antibody Response

(91) It has been assumed that, as already proven for other Nef.sup.mut-based fusion products (21), i.m. injection in mice of the Nef.sup.mut/HER2-ECD expressing vector leads to production of immunogenic endogenously engineered exosomes incorporating the Nef.sup.mut/HER2-ECD fusion product. The question was whether the expected CD8.sup.+ T lymphocyte immunogenicity of these exosomes was strong enough to break the tolerance towards HER2/neu.

(92) The induction of anti-HER2/neu antibodies, i.e., an effect already described in mice injected with rHER2/neu DNA vectors (42, 43) has been tested first( ). To this end, HER2/neu transgenic mice were injected with DNA vectors expressing either Nef.sup.mut or Nef.sup.mut/HER2-ECD (3 per group). Fifteen days after the second injection, plasma were recovered and tested for the presence of anti-HER2/neu Abs using as indicator cells 293T transiently transfected with a DNA vector expressing HER2/neu. As reported in FIG. 9, no HER2/neu-specific antibodies were detectable in plasma from mice injected with DNA vector expressing Nef.sup.mut/HER2-ECD. Differently, the Abs were detectable in plasma from mice injected with lysates of rHER2/neu expressing cells, as previously described (32). These results appeared fully consistent with what we previously reported about the lack of antibody response against the products incorporated into engineered exosomes (14, 21).

(93) Next, the antigen-specific CD8.sup.+ T lymphocyte response testing splenocytes from injected mice through IFN-γ Elispot assays carried out upon stimulation with H2.sup.b-restricted Nef and HER2-ECD nonamers was analyzed. As shown in FIG. 10, lymphocyte activation was detected when splenocytes from mice injected with Nef.sup.mut-expressing DNA were stimulated with the Nef peptide, but not with the HER2-ECD one. On the other hand, both Nef and HER2-ECD peptides induced lymphocyte activation in splenocyte cultures from mice injected with Nef.sup.mut/HER2-ECD. Similar results were obtained testing PBMCs recovered by retro-orbital bleeding (not shown).

(94) These data demonstrate the induction of both Nef and HER/neu specific CD8.sup.+ T lymphocyte responses in mice injected with Nef.sup.mut/HER2-ECD DNA vector.

(95) Induction of Antigen-Specific CTL Activity in rHER2/neu Transgenic mice injected with Nef.sup.mut/HER2-ECD-expressing DNA vector.

(96) Next, the aim of the study was to assess whether the injection of Nef.sup.mut/HER2-ECD-expressing DNA vector can induce an HER2/neu-specific CTL activity. To this end, CD8.sup.+ T lymphocytes were isolated from splenocytes of HER2/neu transgenic mice inoculated with void vector or with vectors expressing either Nef.sup.mut or Nef.sup.mut/HER2-ECD. The CD8.sup.+ T lymphocytes were then put in co-culture with syngeneic, CFSE-labeled TC-1 cells pre-treated with the appropriate peptides. After 5 hours, the co-cultures were stopped, labeled with 7-AAD, and analyzed by FACS to evaluate percentages of dead TC-1 target cells. As shown in FIG. 11, an increase of target cell mortality was detectable when CD8.sup.+ T lymphocytes from mice injected with Nef.sup.mut DNA vector were co-cultured with TC-1 pre-treated with the Nef peptide. More important, a CTL activity was evident also when CD8.sup.+ T lymphocytes from mice injected with Nef.sup.mut/HER2-ECD DNA vector were co-cultured with TC-1 pre-treated with either Nef- or HER2-specific, H2.sup.b-restricted peptides.

(97) These results established a link between the i.m. delivery of Nef.sup.mut/HER2-ECD DNA vector and the induction of HER2/neu-specific CTL activity.

(98) The Break of HER2/neu Tolerance Associates With an Anti-Tumor Activity

(99) Next, the aim of the study was to assess whether the HER2-ECD-specific CTL activity coupled with a detectable anti-tumor activity. Fifteen weeks old 129Sv-Neu T transgenic mice still free from palpable lesions were injected with either vehicle or DNA vectors expressing Nef.sup.mut and Nef.sup.mut/HER2-ECD. The injections were repeated two weeks later, and the appearance of palpable tumors was monitored weekly. As reported in FIG. 12, the injection of Nef.sup.mut/HER2-ECD expressing DNA associated with a significant delay in the development of tumors. The monitoring was stopped at the time of first sacrifices needed for ethical reasons.

(100) These data highlight a direct relationship between the HER2-ECD-specific CTL activity induced by DNA i.m. injection and anti-tumor activity.

(101) Translating the CTL Vaccine Platform to Humans: Induction of Antigen-Specific CTL Activity by Engineered Exosomes

(102) To open the possibility to exploit our CTL vaccine platform in clinic, demonstrating its effectiveness in human system is mandatory. To this end, experiments using conditions at least in part reproducing the mechanism underlying the induction of antigen-specific CD8.sup.+ T lymphocyte immune response previously described in mice injected with Nef.sup.mut-expressing DNA vectors were set up (1). The transfer of exosomes from transfected muscle cells to iDCs was first documented. SKMC were transfected with either GFP or Nef.sup.mut/GFP DNA vectors, and the transfection efficiency was checked by FACS analysis (FIG. 13A). On this subject, it has been previously documented that the expression of Nef.sup.mut/GFP leads to production of fluorescent exosomes (13). After co-cultivation of transfected SKMC with iDCs, the presence of fluorescent aggregates into iDCs was documented by confocal microscope analysis upon labeling recipient iDCs with anti-CD45 mAb (FIG. 13B, middle panels). Meanwhile, no GFP fluorescence was detected within the CD45.sup.+ cell population when GFP-transfected SKMC were used, as well as when the co-cultures were treated with the inhibitors of exosome biosynthesis GW4869 and spiroepoxide (FIG. 13B, left and right panels, respectively). This result supports the idea that the entry of Nef.sup.mut/GFP molecules in iDCs was mediated by intercellular transmission of exosomes.

(103) Next, cross-priming assays aimed at evaluating the induction of antigen-specific CTL activity were performed as summarized on FIG. 14A. In detail, SKMC were transfected with DNA vectors expressing Nef.sup.mut-derivatives, and then co-cultivated with HLA-A.02 iDCs. Twenty-four hours later, iDC were isolated, LPS-matured, and then put in co-culture with autologous PBLs. The mature (m)DC-PBLs co-cultures were carried out for seven days, and, thereafter, the lymphocytes were isolated and subjected to a second stimulation cycle by adding fresh mDC previously co-cultivated with transfected SKMC. After additional seven days, lymphocytes were recovered from the co-cultures, the CD8.sup.+ T fraction isolated, and put in co-culture in the context of a CTL assay with HLA-A.02 MCF-7 cells either parental or engineered for stable expression of Nef.sup.mut (FIG. 14B). The results from CTL assays (FIG. 14C) showed a mortality of MCF-7/Nef.sup.mut target cells appearing higher when they were challenged with CD8.sup.+ T cells stimulated by DCs co-cultivated with Nef.sup.mut expressing SKMC compared to that detected in co-cultures with CD8.sup.+ T cells stimulated by DCs from co-cultures with SKMC transfected with control vector. On the other hand, no antigen-specific CTL activity was detectable throughout using parental MCF-7 as target cells.

(104) Next, these investigations were extended towards antigens fused with Nef.sup.mut. In addition, whether the production of engineered exosomes was indeed on the basis of the induction of the antigen-specific CTL activity was verified. To this aim, cross-priming assays were reproduced using a DNA vector expressing Nef.sup.mut fused with MART-1, i.e., a human melanoma-associated antigen (44), and following the procedures depicted in FIG. 14A, except that SKMC-iDC co-cultures were carried out in the presence or not of the inhibitors of exosome biosynthesis GW4869 and spiroepoxide. CTL assays were finally performed by co-cultivating the CD8.sup.+ T lymphocytes with HLA-A.02 B-LCLs previously treated with either HLA-A.02-restricted MART-1 (i.e., AAGIGILTV (SEQ ID NO:20), aa 27-35) (45) or unrelated peptides. As reported in FIG. 15, stimulated CD8.sup.+ T lymphocytes showed MART-1 specific CTL activity. It, however, was no more detectable when CD8.sup.+ T lymphocytes stimulated by DCs from co-cultures with SKMC carried out in the presence of the exosome inhibitors were used.

(105) These data indicate that the production by transfected muscle cells of exosomes engineered for the incorporation of Nef.sup.mut or derivatives thereof are part of the mechanism underlying the induction of the antigen-specific CTL activity we observed with human cells. Hence, these findings support the idea that the CTL vaccine platform has the potential to be applied in humans against tumor antigens.

REFERENCES

(106) 1. Halstead S. B., S. J. Thomas. 2011. New Japanese encephalitis vaccines: alternatives to production in mouse brain. Expert Rev. Vaccines. 10: 355-64. doi:10.1586/erv.11.7. 2. Ng T., D. Hathaway, N. Jennings, D. Champ, Y. W. Chiang, H. J. Chu. 2013. Equine vaccine for West Nile virus. Dev. Biol.; 114: 221-7. 3. El Garch H., J. M. Minke, J. Rehder, S. Richard, C. Edlund Toulemonde, S. Dinic, C. Andreoni, J. C. Audonnet, R. Nordgren, V. Juillard. 2008. A West Nile virus (WNV) recombinant canarypox to virus vaccine elicits WNV-specific neutralizing antibodies and cell-mediated immune responses in the horse. Vet. Immunol. Immunopathol. 123: 230-9. 4. Stüve O., T. N. Eagar, E. M. Frohman, P. D. Cravens. 2007. DNA plasmid vaccination for multiple sclerosis. Arch. Neurol. 64: 1385-6. 5. Guescini M., D. Guidolin, L. Vallorani, L. Casadei, A. M. Gioacchini, P. Tibollo, M. Battistelli, E. Falcieri, L. Battistin, L. F. Agnati, V. Stocchi. 2010. C2C12 myoblasts release micro-vesicles containing mtDNA and proteins involved in signal transduction. Exp Cell Res. 16: 1977-84. doi:10.1016/j.yexcr.2010.04.006. 6. Romancino D. P., G. Paterniti, Y. Campos, A. De Luca, V. Di Felice, A. d'Azzo, A. Bongiovanni. 2013. Identification and characterization of the nano-sized vesicles released by muscle cells. FEBS Lett. 587: 1379-84. doi:10.1016/j.febslet.2013.03.012. 7. Morse M. A., J. Garst, T. Osada, S. Khan, A. Hobeika, T. M. Clay, N. Valente, R. Shreeniwas, M. A. Sutton, A. Delcayre, D. H. Hsu, J. B. Le Pecq, H. K. Lyerly. 2005. A phase I study of dexosome immunotherapy in patients with advanced non-small cell lung cancer. J. Transl Med. 3:9. 8. Escudier B., T. Dorval, N. Chaput, T. André, M. P. Caby, S. Novault, C. Flament, C. Leboulaire, C. Borg, S. Amigorena, C. Boccaccio, C. Bonnerot, O. Dhellin, M. Movassagh, S. Piperno, C. Robert, V. Serra, N. Valente, J. B. Le Pecq, A. Spatz, C O. Lantz, T. Tursz, E. Angevin, L. Zitvogel. 2005. Vaccination of metastatic melanoma patients with autologous dendritic cell (DC) derived-exosomes: results of the first phase I clinical trial. J. Transl Med. 3:10. 9. Dai S., D. Wei, Z. Wu, X. Zhou, X. Wei, H. Huang, G. Li. 2008. Phase I clinical trial of autologous ascites-derived exosomes combined with GM-CSF for colorectal cancer. Mol Ther. 16: 782-90. doi: 10.1038/mt.2008.1. 10. Tan A., H. De La Peña, A. M. Seifalian. 2010. The application of exosomes as a nanoscale cancer vaccine. Int J Nanomedicine. 5: 889-900. doi:10.2147/IJN.S13402. 11. Chaput N., C. Théry. 2011 Exosomes: immune properties and potential clinical implementations. Semin Immunopathol. 33:419-40. doi:10.1007/s00281. 12. Peretti S., I. Schiavoni, K. Pugliese, M. Federico. 2005. Cell death induced by the herpes simplex virus-1 thymidine kinase delivered by human immunodeficiency virus-1-based virus-like particles. Mol Ther. 12: 1185-96. 13. Lattanzi L., M. Federico. 2012. A strategy of antigen incorporation into exosomes: comparing cross-presentation levels of antigens delivered by engineered exosomes and by lentiviral virus-like particles. Vaccine. 30: 7229-37. doi: 10.1016/j.vaccine.2012.10.010. 14. Di Bonito P., B. Ridolfi, S. Columba-Cabezas, A. Giovannelli, C. Chiozzini, F. Manfredi, S. Anticoli, C. Arenaccio, M. Federico. 2015. HPV-E7 delivered by engineered exosomes elicits a protective CD8.sup.+ T cell-mediated immune response. Viruses. 7: 1079-99. doi: 10.3390/v7031079. 15. Fry E A, Taneja P, Inoue K. 2016. Clinical applications of mouse models for breast cancer engaging HER2/neu. Integr Cancer Sci Ther 3(5):593-603. 16. Rolla S, Nicolóo C, Malinarich S, Orsini M, Forni G, Cavallo F, Ria F. 2006. Distinct and non-overlapping T cell receptor repertoires expanded by DNA vaccination in wild-type and HER-2 transgenic BALB/c mice. J Immunol 177(11):7626-7633. 17. Rovero S, Amici A, Di Carlo E, Bei R, Nanni P, Quaglino E, Porcedda P, Boggio K, Smorlesi A, Lollini P L, Landuzzi L, Colombo M P, Giovarelli M, Musiani P, Forni G. 2000. DNA vaccination against rat her-2/Neu p185 more effectively inhibits carcinogenesis than transplantable carcinomas in transgenic BALB/c mice. J. Immunol 165(9):5133-5142. 18. Quaglino E, Iezzi M, Mastini C, Amici A, Pericle F, Di Carlo E, Pupa S M, De Giovanni C, Spadaro M, Curcio C, Lollini P L, Musiani P, Forni G, Cavallo F. 2004. Electroporated DNA vaccine clears away multifocal mammary carcinomas in her-2/neu transgenic mice. Cancer Res 64(8):2858-2864. 19. Quaglino E, Mastini C, Iezzi M, Forni G, Musiani P, Klapper L N, Hardy B, Cavallo F. 2005. The adjuvant activity of BAT antibody enables DNA vaccination to inhibit the progression of established autochthonous Her-2/neu carcinomas in BALB/c mice. Vaccine 23(25):3280-3287. 20. Schreiber R D, Old L J, Smyth M J. 2011. Cancer immunoediting: integrating immunity's roles in cancer suppression and promotion. Science 331(6024):1565-1570. 21. Di Bonito P, Chiozzini C, Arenaccio C, Anticoli S, Manfredi F, Olivetta E, Ferrantelli F, Falcone E, Ruggieri A, Federico M. 2017. Antitumor HPV E7-specific CTL activity elicited by in vivo engineered exosomes produced through DNA inoculation. Int J Nanomedicine 12:4579-4591. 22. van der Burg S H, Arens R, Ossendorp F, van Hall T, Melief C J. 2016. Vaccines for established cancer: overcoming the challenges posed by immune evasion. Nat Rev Cancer 16(4):219-233. 23. Keppler O. T., I. Allespach, L. Schüller, D. Fenard, W. C. Greene, O. T. Fackler. 2005. Rodent cells support key functions of the human immunodeficiency virus type 1 pathogenicity factor Nef. J. Virol. 79: 1655-65. 24. D'Aloja P., E. Olivetta, R. Bona, F. Nappi, D. Pedacchia, K. Pugliese, G. Ferrari, P. Verani, M. Federico. 1998. gag, vif, and nef genes contribute to the homologous viral interference induced by a nonproducer human immunodeficiency virus type 1 (HIV-1) variant: identification of novel HIV 1-inhibiting viral protein mutants. J. Virol. 72: 4308-19. 25. Massa S., P. Simeone, A. Muller, E. Benvenuto, A. Venuti, R. Franconi. 2008. Antitumor activity of DNA vaccines based on the human papillomavirus-16 E7 protein genetically fused to a plant virus coat protein. Hum. Gene Ther. 19: 354-64. doi: 10.1089/hum.2007.122. 26. Arenaccio C., C. Chiozzini, S. Columba-Cabezas, F. Manfredi, M. Federico. 2014. Cell activation and HIV-1 replication in unstimulated CD4.sup.+ T lymphocytes ingesting exosomes from cells expressing defective HIV-1. Retrovirology. 11: 46. doi: 10.1186/1742-4690-11-46. 27. Nanni P, Nicoletti G, De Giovanni C, Landuzzi L, Di Carlo E, Cavallo F, Pupa S M, Rossi I, Colombo M P, Ricci C, Astolfi A, Musiani P, Forni G, Lollini P L. 2001. Combined allogeneic tumor cell vaccination and systemic interleukin 12 prevents mammary carcinogenesis in HER-2/neu transgenic mice. J Exp Med 194:1195-1205. 28. Halbert C L, Demers G W, Galloway D A. 1991. The E7 gene of human papillomavirus type 16 is sufficient for immortalization of human epithelial cells. J. Virol 65: 473-478. 29. Di Bonito P, Grasso F, Mochi S, Petrone L, Fanales-Belasio E, Mei A, Cesolini A, Laconi G, Conrad H, Bernhard H, Dembek C J, Cosma A, Santini S M, Lapenta C, Donati S, Muratori C, Giorgi C, Federico M. 2009. Anti-tumor CD8+ T cell immunity elicited by HIV-1-based virus-like particles incorporating HPV-16 E7 protein. Virology 395:45-55. 30. Théry C, Amigorena S, Raposo G, Clayton A. 2006. Isolation and characterization of exosomes from cell culture supernatants and biological fluids. Curr Prot Cell Biol 3. doi: 10.1002/0471143030.cb0322s30. 31. Rieu S, Géminard C, Rabesandratana H, Sainte-Marie J, Vidal M. 2000. Exosomes released during reticulocyte maturation bind to fibronectin via integrin alpha4beta1. Eur J Biochem; 267:583-590. 32. Aricò E, Sestili P, Carpinelli G, Canese R, Cecchetti S, Schiavoni G, D'Urso M T, Belardelli F, Proietti E. 2016. Chemo-immunotherapy induces tumor regression in a mouse model of spontaneous mammary carcinogenesis. Oncotarget 7(37):59754-59765. 33. Gritzapis A D, Mahaira L G, Perez S A, Cacoullos N T, Papamichail M, Baxevanis C N. 2006. Vaccination with human HER-2/neu (435-443) CTL peptide induces effective antitumor immunity against HER-2/neu-expressing tumor cells in vivo. Cancer Res 66(10):5452-5460. 34. Liang X, Fu T M, Xie X, Emini E A, Shiver J W. 2002. Development of HIV-1 Nef vaccine components: immunogenicity study of Nef mutants lacking myristoylation and dileucine motif in mice. Vaccine 20:413-421. 35. Bauer 5, Heeg K, Wagner H, Lipford G B. 1995. Identification of H-2 Kb binding and immunogenic peptides from human papilloma virus tumour antigens E6 and E7. Scand J Immunol 42:317-323. 36. Chairoungdua A, Smith D L, Pochard P, Hull M, Caplan M J. 2010. Exosome release of beta-catenin: a novel mechanism that antagonizes Wnt signaling. J Cell Biol 190:1079-1091. 37. Kogure T, Lin W L, Yan I K, Braconi C, Patel T. 2011. Intercellular nanovesicle-mediated microRNA transfer: a mechanism of environmental modulation of hepatocellular cancer cell growth. Hepatology 54:1237-1248. 38. Kosaka N, Iguchi H, Yoshioka Y, Takeshita F, Matsuki Y, Ochiya T. 2010. Secretory mechanisms and intercellular transfer of microRNAs in living cells. J Biol Chem 285: 17442-17452. 39. Kosaka N, Iguchi H, Yoshioka Y, Hagiwara K, Takeshita F, Ochiya T. 2012. Competitive interactions of cancer cells and normal cells via secretory microRNAs. J Biol Chem 287:1397-1405. 40. Trajkovic K, Hsu C, Chiantia S, Rajendran L, Wenzel D, Wieland F, Schwille P, Brugger B, Simons M. 2008. Ceramide triggers budding of exosome vesicles into multivesicular endosomes. Science 319:1244-1247. 41. Yuyama K, Sun H, Mitsutake S, Igarashi Y. 2012. Sphingolipid-modulated exosome secretion promotes clearance of amyloid-beta by microglia. J Biol Chem 287:10977-10989. 42. Nanni P, Landuzzi L, Nicoletti G, De Giovanni C, Rossi I, Croci S, Astolfi A, Iezzi M, Di Carlo E, Musiani P, Forni G, Lollini P L. 2004. Immunoprevention of mammary carcinoma in HER-2/neu transgenic mice is IFN-gamma and B cell dependent. J Immunol 173(4):2288-2296. 43. Rolla S, Marchini C, Malinarich S, Quaglino E, Lanzardo S, Montani M, Iezzi M, Angeletti M, Ramadori G, Forni G, Cavallo F, Amici A. 2008. Protective immunity against neu-positive carcinomas elicited by electroporation of plasmids encoding decreasing fragments of rat neu extracellular domain. Hum Gene Ther 19(3):229-240. 44. Busam K J, Jungbluth A A. 1996. Melan-A, a new melanocytic differentiation marker. Adv Anat Pathol 6: 12-18. 45. Rivoltini L, Kawakami Y, Sakaguchi K, Southwood S, Sette A, Robbins P F, Marincola F M, Salgaller M L, Yannelli Y R, Appella E, Rosenberg S A. 1995. Induction of tumor-reactive CTL from peripheral blood and tumor-infiltrating lymphocytes of melanoma patients by in vitro stimulation with an immunodominant peptide of the human melanoma antigen MART-1. J Immunol 154: 2257-2265.