A APPLICATION OF CYATHANE DITERPENOIDS IN PREPARATION OF DRUGS FOR TREATING NEUROINFLAMMATION
20230227392 · 2023-07-20
Inventors
Cpc classification
A61P29/00
HUMAN NECESSITIES
A61P25/28
HUMAN NECESSITIES
International classification
A61P25/28
HUMAN NECESSITIES
A61P29/00
HUMAN NECESSITIES
Abstract
The present invention discloses the application of cyathane diterpenoids in preparation of drugs for treating neuroinflammation. Seven cyathane diterpenoids 1-7 can significantly prevent LPS-induced BV-2 microglia from producing NO. The most active compound as 6 can reverse M1/M2 polarization of the microglia. 6 inhibits the pro-inflammatory proteins including iNOS and COX-2 through MAPK/NF-κB signaling pathways and promote the anti-inflammatory factors including IL-10 and ARG-1. An application prospect of the anti-inflammatory cyathane diterpenoids in the treatment of the neurodegenerative diseases is achieved.
Claims
1. The cyathane diterpenoid sarcodonin A numbered as 1 is isolated from fruiting bodies of Sarcodon scabrosus (Fr.) Karst and the derivatives of sarcodonin A numbered as 2-7 are synthesized;
2. According to claim 1, the cyathane diterpenoids 1-7 exhibit anti-neuroinflammatory effects by reversing M1/M2 microglia polarization through MAPK/NF-κB signaling pathway and thus the cyathane diterpenoids, hydrates thereof, pharmaceutically acceptable salts thereof, pharmaceutically acceptable carriers thereof and/or compositions containing cyathane diterpenoids can be applicated in preparation of drugs for treating neuroinflammation-associated neurodegenerative diseases comprising but not limited to Alzheimer's disease, Amyotrophic lateral sclerosis, Huntington's disease or Parkinson's disease.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0018] The accompanying drawings are configured to provide a further understanding of the present disclosure, and form a part of the description. Together with the following detailed embodiments, the accompanying drawings are configured to explain the present disclosure, but do not constitute a limitation on the present disclosure. In the figures:
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
DETAILED DESCRIPTION OF EMBODIMENTS
[0026] Hereinafter, the technical solutions in the embodiments of the present invention will be further explained in detail in combination with the drawings in the embodiments of the present invention. Obviously, the embodiments described below are only part and not all of the embodiments of the present invention, and do not limit the present invention in any form.
[0027] Without departing from the spirit and scope of the inventive concept, variations and advantages conceivable by those skilled in the art are included in the present invention, and the appended claims are taken as the scope of protection.
[0028] The processes, conditions, reagents, experimental methods and the like for the implementation of the present invention are all general knowledge and common knowledge in the art, except those specifically mentioned below, and the present invention does not particularly limit the content.
[0029] The compound cyathane diterpenoid sarcodonin A (1) according to the present invention is isolated from fruiting bodies of Sarcodon scabrosus (Fr.) Karst, which were collected in Ailao Mountain, Yunnan, China in 2002 and identified by Ms. WANG Xianghua, Kunming Institute of Botany, Chinese Academy of Sciences. The compounds 2-7 are obtained by reacting sarcodonin A with dried Ac.sub.2O or corresponding benzoyl chloride derivatives in the presence of 4-dimethylaminopyridine (DMAP) at room temperature. Specifically including:
##STR00002##
[0030] Scheme 1. Semisynthesis of sarcodonin A derivatives 2-7.
[0031] Preparation of the compounds according to the present invention, and determination and application of anti-neuroinflammation;
[0032] Experimental Materials
[0033] Experimental Cell Line:
[0034] BV-2 mouse microglia were purchased from the cell bank of Peking Union Medical College (Beijing, China).
[0035] Reagents and Instruments:
[0036] Commonly used biochemical reagents: high-sugar culture medium DMEM (Gibco, USA); fetal bovine serum (FBS) (Gibco, USA); lipopolysaccharide (LPS) (Sigma, USA); antibiotics (100 U/mL of streptomyces and penicillin) (HyClone, USA); cell culture bottles and petri dishes (Corning, China); pancreatic enzyme (Gibco, USA); sulfonyl rhodamine B (SRB); nitric oxide detection kit (Biyuntian, China); ELISA kit (TNFα, IL-1β, IL-6, IL-10) (R&D, USA); reverse transcription kit (Clontech, USA); real-time PCR kit (Roche, USA); primary antibody: anti-p-Tubulin, anti-GAPDH, anti-iNOS, anti-COX-2, anti-ARG-1, anti-ERK1/2, anti-phosphorylated ERK1/2, anti-p38 MAPK, anti-phosphorylated p38 MAPK, anti-JNK, anti-phosphorylated INK, anti-NF-κBp65 and anti-Lamin B1 (Abcam; Santa Cruz; CST, USA), peroxidase (HRP)-bound secondary antibody (Biyuntian, China), high-sensitivity ECL luminescent liquid (Biyuntian, China).
[0037] Commonly used instruments: superclean bench: SW-CJ-1F (Suzhou Antai Air Technology Co., Ltd.); vertical steam sterilizer: GI100T (Xiamen Zhiwei Instrument Co., Ltd.); carbon dioxide thermostatic cell incubator: Thermo forma 310 (Thermofisher Scientific, USA); water purifier: EQ 7000 (Merck, Germany); enzyme reader: Synergy HTX (BioTek Instrument Company, USA); ultraviolet-visible spectrophotometer: Nanodrop 2000 (ThermoFisher Scientific, USA); Real-time quantitative PCR instrument: Applied Biosystems QuantStudio 5 (Thermo Fisher Scientific, USA); PCR amplifier: C1000 (Bio-rad, USA); Chemiluminescence instrument: ChemiDocXRS+ (Bio-rad, USA).
[0038] 1. Extraction and Separation of Sarcodonin A and Synthesis of Derivatives:
[0039] The dried fruiting bodies (10 kg) were ground and extracted with methanol for three times (10 L×3), and extracting solutions were concentrated under reduced pressure and combined (300 g), suspended with water, and extracted with ethyl acetate to obtain 200 g of paste and water-soluble part. The ethyl acetate part was mixed with crude silica gel (100-200 meshes), loaded on a silica gel column, subjected to gradient elution with a chloroform-acetone (9:1-1:9) mixed solvent, detected and combined by TLC, and divided into 9 components. Component 4 was subjected to silica gel column chromatography (CHCl.sub.3-MeOH 98:2, 95:5, 90:10) to obtain five components (4.1-4.5). The component 4.1 was purified by a methanol gel column to obtain compound sarcodonin A(1) (250 mg).
[0040] 15.6 mg (0.05 mmol) of sarcodonin A was dissolved in 3 mL of well-dried dichloromethane solvent, added with 20 μL of triethylamine and 2 mg of DMAP, stirred for 30 min, and slowly dropwise added with 1 mL (containing 8.8 mg, 0.05 mmol) of dichloromethane solution of o-fluorobenzoyl chloride for reaction at room temperature for 12 h, a raw material point detected by silica gel thin layer chromatography disappeared, 10 mL of water was added to quench the reaction, concentration under reduced pressure was performed to remove dichloromethane, extraction was performed with ethyl acetate (20 mL×3), an organic phase was washed with saturated ammonium chloride, water and saturated saline in turn, drying was performed with anhydrous magnesium sulfate, concentration under reduced pressure was performed to remove the solvent, and 45 mg of yellow-green resinous compound was obtained and isolated by silica gel (C-200-300, 6 mg) column chromatography (V petroleum ether:V ethyl acetate=10:1) to obtain 30 mg of yellow-green resinous compound 2 and the yield was 70.7%. A synthesis method for the compounds (3-6) was the same as above; 0.2 mmol of acyl chloride was added in the synthesis of the compound 7.
[0041] 1.1 The Physical and Chemical Properties of 7 Cyathane Diterpenoids are:
[0042] The physical and chemical properties of the cyathane diterpenoid 1 according to the invention are:
[0043] C.sub.20H.sub.30O.sub.4, yellow-green resin (CHCl.sub.3); ESI-MS, 339.4 [M+Na].sup.+; IR ν.sub.max: 3406.9 (OH), 2930, 1657 (C═O), 1567, 1168, 1039, 751, 733 cm.sup.−1. .sup.13C-NMR (125 MHz, CDCl.sub.3) δ: 194.41, 154.23, 146.69, 144.56, 141.09, 138.12, 19.87, 74.10, 66.44, 49.64, 48.40, 38.33, 36.42, 35.27, 33.71, 29.46, 29.26, 26.54, 24.36, 15.94; .sup.1H-NMR (500 MHz, CDCl.sub.3) δ: 9.42 (s, 1H), 6.82 (dd, J=8.2, 2.5 Hz, 1H), 6.17 (d, J=8.2 Hz, 1H), 3.72 (br.d, J=4.6 Hz, 1H), 3.57 (dd, J=7.5, 2.8 Hz, 2H), 3.14 (dd, J=18.3, 5.8 Hz, 1H), 2.99-2.89 (m, 1H), 2.59-2.48 (m, 2H), 2.47-2.31 (m, 2H), 1.79-1.65 (m, 7H), 1.34 (dt, J=14.0, 3.6 Hz, 1H), 1.02 (s, 4H), 0.95 (s, 3H), 0.94 (d, J=6.9 Hz, 4H).
[0044] The physical and chemical properties of the cyathane diterpenoid 2 according to the invention are:
[0045] C.sub.27H.sub.31FO.sub.4, yellow resin. IR (KBr): ν.sub.max=2962, 1714, 1670, 1913, 1572, 1456, 1296, 1259, 1165, 1123, 1081, 1033, 1018, 780, 756 cm.sup.−1; .sup.1H-NMR (500 MHz, CDCl.sub.3) δ: 9.43 (s, 1H, CHO), 7.94 (td, J=7.6, 1.7 Hz, 1H), 7.56-7.47 (m, 1H), 7.21 (t, J=7.6 Hz, 1H), 7.15 (dd, J=10.3, 8.8 Hz, 1H), 6.77 (dd, J=8.2, 2.4 Hz, 1H), 6.14 (d, J=8.2 Hz, 1H), 4.38 (dd, J=10.7, 8.6 Hz, 1H), 4.23 (dd, J=10.8, 6.7 Hz, 1H), 3.73 (d, J=5.0 Hz, 1H), 3.34-3.20 (m, 1H), 3.16 (dd, J=18.2, 5.9 Hz, 1H), 2.60-2.50 (m, 2H), 2.50-2.44 (m, 2H), 1.78 (m, 1H), 1.74-1.65 (m, 3H), 1.36 (dt, J=14.0, 3.5 Hz, 1H), 1.07 (d, J=6.9 Hz, 3H), 0.99 (s, 3H), 0.98 (s, 3H); .sup.13C-NMR (125 MHz, CDCl.sub.3) δ: 194.2 (C═O), 164.4 (C═O of 2-fluorobenzol), 160.9, 153.9, 145.8, 144.4, 140.4, 138.0, 134.7, 134.6, 132.1, 124.1, 124.0, 119.8, 117.2, 117.0, 74.1, 68.2, 49.4, 48.3, 38.4, 36.4, 33.5, 32.0, 29.5, 29.1, 26.5, 23.7, 16.2; HR-ESI-MS: m/z 461.2094 [M+Na].sup.+;
[0046] The physical and chemical properties of the cyathane diterpenoid 3 according to the invention are:
[0047] C.sub.27H.sub.31ClO.sub.4, yellow resin. IR(KBr): ν.sub.max=2931, 1729, 1668, 1570, 1455, 1431, 1290, 1247, 1166, 116, 1043, 1028, 744 cm.sup.−1; .sup.1H-NMR (500 MHz, CDCl.sub.3) δ: 9.41 (s, 1H, CHO), 7.77 (dd, J=7.3, 2.2 Hz, 1H), 7.68 (dd, J=7.6, 1.5 Hz, 1H), 7.44-7.30 (m, 2H), 6.75 (dd, J=8.2, 2.4 Hz, 1H), 6.10 (d, J=8.2 Hz, 1H), 4.37 (dd, J=10.7, 8.3 Hz, 1H), 4.24 (dd, J=10.8, 6.9 Hz, 1H), 3.72 (d, J=5.1 Hz, 1H), 3.28-3.18 (m, 1H), 3.15 (dd, J=18.3, 5.8 Hz, 1H), 2.60-2.44 (m, 4H), 1.79 (ddd, J=12.6, 7.7, 4.9 Hz, 1H), 1.75-1.65 (m, 5H), 1.35 (dt, J=13.9, 3.6 Hz, 1H), 1.07 (d, J=6.9 Hz, 3H), 1.00 (s, 3H), 0.97 (s, 3H); .sup.13C-NMR (125 MHz, CDCl.sub.3) δ: 194.3 (C═O), 166.2 (C═O of 2-chlorobenzoyl), 154.0, 146.0, 144.4, 140.5, 138.2, 134.6, 132.8, 132.3, 131.3, 127.4, 121.8, 120.0, 74.1, 68.6, 49.5, 48.4, 38.5, 36.5, 33.7, 32.2, 29.7, 29.2, 26.6, 24.0, 16.5; HR-ESI-MS: m/z 477.1801 [M+Na].sup.+;
[0048] The physical and chemical properties of the cyathane diterpenoid 4 according to the invention are:
[0049] C.sub.27H.sub.31BrO.sub.4, yellow resin. IR(KBr): ν.sub.max=2931, 1778, 1668, 1571, 1435, 1369, 1292, 1247, 1166, 1116, 1049, 1014, 747, 719 cm.sup.−1; .sup.1H-NMR (500 MHz, CDCl.sub.3) δ: 9.41 (s, 1H, CHO), 7.81 (dd, J=7.8, 1.5 Hz, 1H), 7.46 (td, J=7.8, 1.4 Hz, 1H), 7.42 (dd, J=8.1, 1.6 Hz, 1H), 7.32 (td, J=7.7, 1.4 Hz, 1H), 6.74 (dd, J=8.2, 2.5 Hz, 1H), 6.10 (d, J=8.2 Hz, 1H), 4.37 (dd, J=10.7, 8.4 Hz, 1H), 4.24 (dd, J=10.8, 6.9 Hz, 1H), 3.72 (d, J=5.0 Hz, 1H), 3.30-3.19 (m, 1H), 3.15 (dd, J=18.3, 5.8 Hz, 1H), 2.57-2.50 (m, 2H), 2.49-2.44 (m, 2H), 1.79 (ddd, J=12.7, 7.7, 4.9 Hz, 1H), 1.75-1.67 (m, 3H), 1.35 (dt, J=13.9, 3.7 Hz, 1H), 1.07 (d, J=6.9 Hz, 3H), 1.00 (s, 3H), 0.97 (s, 3H); .sup.13C-NMR (126 MHz, CDCl.sub.3) δ: 194.3 (C═O), 165.8 (C═O of 2-bromobenzoyl), 154.0, 145.9, 144.4, 140.5, 138.2, 133.8, 132.8, 131.5, 131.4, 130.2, 126.8, 120.0, 74.1, 68.6, 49.6, 48.4, 38.5, 36.6, 33.7, 32.2, 29.6, 29.2, 26.6, 24.0, 16.4; HR-ESI-MS: m/z 521.1290[M+Na].sup.+;
[0050] The physical and chemical properties of the cyathane diterpenoid 5 according to the invention are:
[0051] C.sub.27H.sub.31IO.sub.4, yellow resin. IR(KBr): ν.sub.max=2933, 1725, 1666, 1570, 1428, 1246, 1116, 1133, 1099, 1043, 1015, 741 cm.sup.−1. .sup.1H-NMR (500 MHz, CDCl.sub.3) δ: 9.42 (s, 1H, CHO), 8.01 (dd, J=7.9, 0.6 Hz, 1H), 7.79 (dd, J=7.8, 1.6 Hz, 1H), 7.49-7.33 (m, 1H), 7.16 (td, J=7.7, 1.6 Hz, 1H), 6.77 (dd, J=8.2, 2.4 Hz, 1H), 6.09 (d, J=8.2 Hz, 1H), 4.36 (dd, J=10.7, 8.2 Hz, 1H), 4.24 (dd, J=10.7, 7.0 Hz, 1H), 3.72 (d, J=5.0 Hz, 1H), 3.28-3.19 (m, 1H), 3.15 (dd, J=18.3, 5.8 Hz, 1H), 2.63-2.44 (m, 1H), 1.79 (ddd, J=12.6, 7.8, 4.7 Hz, 1H), 1.75-1.64 (m, 1H), 1.35 (dt, J=14.0, 3.7 Hz, 1H), 1.07 (d, J=6.8 Hz, 1H), 1.01 (s, 1H), 0.97 (s, 1H); .sup.13C-NMR (126 MHz, CDCl.sub.3) δ: 194.3 (C═O), 166.4 (C═O of 2-iodobenzoyl), 154.0, 146.0, 144.4, 141.7, 140.4, 138.2, 135.1, 132.9, 130.9, 128.1, 120.0, 94.3, 74.1, 68.6, 49.5, 48.4, 38.5, 36.5, 33.7, 32.2, 29.7, 29.2, 26.6, 24.0, 16.46; HR-ESI-MS:m/z 569.1147 [M+Na].sup.+;
[0052] The physical and chemical properties of the cyathane diterpenoid 6 according to the invention are:
[0053] C.sub.27H.sub.31BrO.sub.4, yellow resin. IR(KBr): ν.sub.max=2937, 1737, 1672, 1577, 1371, 1229, 1166, 1022 cm-1; .sup.1H-NMR (500 MHz, CDCl.sub.3) δ: 9.43 (s, 1H, CHO), 7.88 (d, J=8.5 Hz, 1H), 7.59 (d, J=8.5 Hz, 1H), 6.73 (dd, J=8.2, 2.4 Hz, 1H), 6.08 (d, J=8.2 Hz, 1H), 4.28 (dd, J=16.1, 7.6 Hz, 1H), 3.74 (d, J=5.3 Hz, 1H), 3.29-3.19 (m, 1H), 3.18 (d, J=5.8 Hz, 1H), 2.59-2.43 (m, 1H), 2.17 (s, 1H), 1.84-1.72 (m, 1H), 1.72-1.58 (m, 2H), 1.36 (dt, J=13.9, 3.6 Hz, 1H), 1.06 (d, J=6.9 Hz, 1H), 0.99 (s, 1H), 0.98 (s, 1H); .sup.13C-NMR (126 MHz, CDCl.sub.3) δ: 194.2, 165.8, 154.2, 146.1, 144.2, 140.4, 138.3, 132.0, 131.1, 129.3, 128.4, 119.8, 74.2, 68.2, 49.6, 48.5, 38.5, 36.5, 33.6, 32.2, 29.7, 29.2, 26.6, 24.0, 16.3; HR-ESI-MS:m/z 521.1290 [M+Na].sup.+;
[0054] The physical and chemical properties of the cyathane diterpenoid 7 according to the invention are:
[0055] C.sub.24H.sub.32O.sub.5, yellow resin. IR(KBr): ν.sub.max=2937, 1737, 1672, 1577, 1371, 1229, 1166, 1022 cm.sup.−1; .sup.1H-NMR (500 MHz, CDCl.sub.3) δ:9.40 (s, 1H, CHO), 6.75 (dd, J=8.1, 2.2 Hz, 1H), 6.05 (d, J=8.1 Hz, 1H), 4.97 (d, J=5.6 Hz, 1H), 4.14 (dd, J=10.7, 7.9 Hz, 1H), 3.91 (dd, J=10.7, 7.2 Hz, 1H), 3.69 (d, J=5.3 Hz, 1H), 3.18 (dd, J=18.1, 6.3 Hz, 1H), 3.12-3.00 (m, 1H), 2.49 (d, J=18.2 Hz, 1H), 2.45-2.32 (m, 3H), 2.06 (s, 3H), 2.06-1.98 (m, 3H), 1.96 (s, 4H), 1.76 (ddd, J=12.3, 8.5, 3.7 Hz, 2H), 1.71-1.64 (m, 3H), 1.60 (ddd, J=13.2, 4.7, 3.2 Hz, 2H), 1.39-1.34 (m, 1H), 1.02 (s, 4H), 0.99 (d, J=6.9 Hz, 4H), 0.97 (s, 4H); .sup.13C-NMR (126 MHz, CDCl.sub.3) δ:193.8, 171.0, 170.4, 152.6, 145.6, 144.9, 139.8, 138.3, 120.5, 75.4, 67.5, 49.5, 46.6, 38.6, 36.2, 33.3, 32.1, 29.5, 26.2, 23.8, 21.1, 21.1, 16.2; ESI-MS (positive) m/z: 423.2117 [M+Na].sup.+.
[0056] 2 Cell Culture
[0057] The mouse microglia (BV-2) were cultured in the DMEM culture medium containing 10% of fetal bovine serum (FBS) and 1% of antibiotics (100 U/mL of streptomyces and penicillin) at 37° C. in the incubator of 5% CO.sub.2.
[0058] 3 Determination of Anti-Neuroinflammatory Activity of LPS-Induced BV-2 Cells
[0059] 3.1 Cell Vitality Test
[0060] The viability of the BV-2 cells was measured by the SRB method. The cells with a density of 1.5×10.sup.4 cells/mL were incubated in a 96-well plate until they attached to the wall for 24 h. The culture medium was replaced with a fresh culture medium containing indicated compounds, and cultured for another 24 h. Then the cells were fixed with trichloroacetic acid (10%, w/v) for 5 minutes, and the excess acid was washed with distilled water for 5 times. The cells were treated with SRB (0.4%, w/v) for 30 minutes, and excess dye was washed with trichloroacetic acid (1%, w/v). The bound dye was dissolved in TBS (10 mM, pH 10.5), and the absorbance was measured at 510 nm on a Bio-Tek micropore plate reader. The absorbance of the DMSO control was assumed as 100%.
[0061] As shown in
[0062] 3.2 Inhibition of Nitric Oxide (NO) Production
[0063] NO is an important inflammatory mediator. Excessive production of NO is common in neurons and glial cells of brains with ND.sup.[8]. Griess reagent was configured to evaluate the influence on NO production in order to measure the anti-inflammatory effects of sarcodonin A and its derivative in LPS-induced BV-2 microglia. Before adding the detection reagent, BV-2 cells (2×10.sup.5/mL) were incubated in the 96-well plate and cultured at 37° C. for 24 h. The experimental groups were divided into a control group (DMSO), an LPS-treated group (1 g/mL of LPS) and a compound-treated group (1 μg/mL of LPS+10 μM compound), and then incubation was performed for 24 h. The nitrite concentration in the culture medium was measured by a commercial analysis kit. The main principle was based on the griess method. Supernatant of the BV-2 cells (50 μL) reacted with the griess reagent (50 μL of griess regent I and 50 μL of griess regent II). The absorbance was measured at 540 nm on the Bio-Tek micropore plate reader, and the nitrite concentration was calculated by a nitrite standard curve with sodium nitrite as the standard.
The inhibition rate %=(A.sub.LPS−A.sub.compound)/(A.sub.LPS−A.sub.blank)×100;
[0064] As shown in
[0065] Therefore, the preliminary SAR study shows that 19-hydroxyl and 14-hydroxyl can be modified to enhance the anti-inflammatory activity of sarcodonin A. [0066] [8] F. J. Jimenez-Jimenez, H. Alonso-Navarro, M. T. Herrero, E. Garcia-Martin, J. A. Agundez, 2016. An Update on the Role of Nitric Oxide in the Neurodegenerative Processes of Parkinson's Disease, Curr. Med. Chem. 23(24):2666-2679.
[0067] 4 Effects of Compounds 1 and 6 on mRNA Levels of M1/M2 Biomarkers in LPS-Induced BV-2 Cells
[0068] In order to detect the regulation of M1/M2 phenotype switch by 1 and 6, the effects on the mRNA expression of representative M1 and M2 biomarkers in the LPS-stimulated BV-2 cells were evaluated. The cells were incubated into a 6 cm of culture dish (5 mL/dish) at a density of 2×10.sup.5 cfu, and cultured in a constant-temperature incubator of 5% CO.sub.2 at 37° C. for 12 h. According to the manufacturer's instructions, total RNA was extracted by Trizol, and concentration and purity thereof were measured by a UV-Vis spectrophotometer. 2 μg of isolated RNA was reversely transcribed into cDNA by Prime Script RTMaster Mix kit. By using a Syr Green quantitative RT-PCR kit, an mRNA level was evaluated by qRT-PCR response. β-actin was used as an internal standard. The primer sequences are as follows (Table 1).
TABLE-US-00001 TABLE 1 Primer sequences of real-time quantitative PCR Primer (5′-3′) Gene Accession ID F, forward; R, reverse IL-1β XM_006498795.3 F: CGCAGCAGCACATCAACAAGAGC R: TGTCCTCATCCTGGAAGGTCCACG IL-6 NM_010548.2 F: CCAGAGATACAAAGAAATGATGG R: ACTCCAGAAGACCAGAGGAAA TNF-α NM_001278601.1 F: AGCCCCCAGTCTGTATCCTT R: ACAGTCCAGGTCACTGTCCC IL-10 NM_010548.2 F: GCTCTTACTGACTGGCATGAG R: CGCAGCTCTAGGAGCATGTG iNOS XM_006532446.3 F: TGGAGCGAGTTGTGGATTGTC R: GGTCGTAATGTCCAGGAAGTAG COX-2 NM_011198.4 F: CCAGCACTTCACCCATCAGT R: ACACCTCTCCACCAATGACC ARG-1 NM_007482.3 F: CGCCTTTCTCAAAAGGACAG R: CCAGCTCTTCATTGGCTTTC β-actin NM_007393 F: GGCATCGTGATGGACTCCG R: GCTGGAAGGTGGACAGCGA
[0069] As shown in
[0070] 5 Effects of Compounds 1 and 6 on M1/M2 Marker Cytokines Secretion in LPS-Induced BV-2 Cells
[0071] To further evaluate the role of 1 and 6 in M1 polarization of the LPS-induced microglia, the release of pro-inflammatory M1 cytokines (including TNF-α, IL-6 and IL-1β) and anti-inflammatory M2 cytokines (including IL-10) in the LPS-induced BV-2 cells was detected by ELISA. The BV-2 cells were incubated in a 6-well plate (2 mL/well) at a density of 2×10.sup.5 cfu, cultured in a constant-temperature incubator of 5% CO.sub.2 at 37° C. for 24 h, then pretreated with different concentrations of compounds 1 and 6 (3 μM, 10 μM), LPS (1 μg/mL) and DMSO for 1 h, and then induced by the LPS for 24 h. Supernatant of the cell culture medium was collected, and the concentrations of TNF-α, IL-6, IL-10 and IL-1β were measured according to manufacturer's instructions.
[0072] As shown in
[0073] 6 Effects of Compounds 1 and 6 on M1/M2 Marker Protein Expression in LPS-Induced BV-2 Cells
[0074] The protein expression of iNOS, COX-2(M1 marker) and ARG-1(M2 marker) was analyzed by Western blotting. The BV-2 cells (5×10.sup.5 cfu) cultured in a 6 cm dish were pretreated with 1 or 6 (3.10 μM) respectively for 1 h, and then 1 μg/ml LPS was added for 24 h. The cells were lysed in an ice-cold RIPA lysis buffer with a mixed solution of 10 mM of PMSF and 1% of protein inhibitors. The cytosol lysate was centrifuged at 4° C. at 12000 rpm for 30 minutes. Total protein was isolated from the lysate and their concentration was determined by BCA.
[0075] A sample was separated by 8%-12% SDS-PAGE and transferred to a 0.45 m PVDF membrane. The membrane was blocked with 5% BSA in TBST (20 mM of Tris-HCl, 150 mM of NaCl, 0.1% of Tween-20) for 1 h at room temperature, and then incubated with appropriate primary antibodies: anti-β-tubulin (1:1000), anti-GAPDH (1:1000), anti-iNOS (1:500), anti-COX-2 (1:1000) and anti-ARG-1 (1:500) at 4° C. overnight. The membrane was washed in the TBST for 3×5 minutes, and then incubated with the secondary antibody bound to appropriate peroxidase (HRP) and left at room temperature for 1 h. The blot was washed in the TBST for 3×5 minutes and exposed to an ECL chemiluminescence reagent. At last, the signal was detected by the Bio-Rad ChemiDoc XRS+ system.
[0076] As shown in
[0077] 7 Compound 6 Inhibits the M1 Polarization of the Microglia by Inhibiting MAPK Activation in the LPS-Induced BV-2 Cells.
[0078] Previous studies have shown that the over-activation of MAPK signaling cascade is related to neuroinflammatory reaction.sup.[9-10]. In order to clarify the action mode of 6 in reversing the M1 polarization of the microglia, the effects of 6 on phosphorylation levels of ERK1/2, INK and p38 MAPK in the LPS-induced BV-2 microglia are further studied. BV-2 cells (5×10.sup.5 cfu) cultured in a 6 cm dish are pretreated with compound 1 or 6 (3.10 μM) respectively for 1 h, and then added with the LPS (1 μg/mL) for 30 min. The similar method is used by Western blotting, and the primary antibodies are: anti-p-tubulin (1:1000), anti-GAPDH (1:1000), anti-ERK1/2 (1:1000), anti-phosphorylated ERK1/2 (1:1000), anti-p38 MAPK (1:2000), anti-phosphorylated p38 MAPK (1:1000), anti-JNK (1:2000) and anti-phosphorylated JNK (1:1000).
[0079] As shown in
[0080] The activation of MAPK directly affects NF-κB-mediated transcription of inflammatory factors. Therefore, 6 antagonizes the activation of ERK1/2 and JNK induced by the LPS, which possibly leads to a decrease in the production of pro-inflammatory molecules, thereby hindering the dominant M1 phenotypic polarization. [0081] [12] B. Dinda, M. Dinda, G. Kulsi, A. Chakraborty, S. Dinda, 2019. Therapeutic potentials of plant iridoids in Alzheimer's and Parkinson's diseases: A review, Eur J Med Chem 169, 185-199. [0082] [10] R. Dhapola, S. S. Hota, P. Sarma, A. Bhattacharyya, B. Medhi, D. H. Reddy, 2021. Recent advances in molecular pathways and therapeutic implications targeting neuroinflammation for Alzheimer's disease, Inflammopharmacology 29(6).
[0083] 8 Compound 6 Blocks Nuclear Translocation of NF-1B in the LPS-Induced BV-2 Cells to Reverse the M1 Polarization of Microglia.
[0084] NF-κB is a transcription factor with good characteristics, and is considered to be the key factor of microglia-mediated neuroinflammation.sup.[11]. Normally, NF-κB, as p50/p65/IκB trimer, is bound to inhibitor protein IκB and confined in the cytoplasm. Once activated by various stimuli such as the LPS, the molecule is subjected to nuclear shift. In the nucleus, NF-κB initiates the gene transcription of related inflammatory factors.sup.[12].
[0085] The nuclear translocation of NF-κB subunit p65 as an activation index of NF-κB is examined. The cells were collected in the same way for Western blotting. A extraction kit is configured to isolate and extract nuclear and cytoplasmic parts according to the instructions. The primary antibodies are anti-NF-κB p65 (1:1000), anti-Lamin B1 (1:1000) and anti-GAPDH (1:1000).
[0086] As shown in
[0090] 9 Binding of 1 and 6 to iNOS by Molecular Simulation
[0091] L-arginine mainly produces NO in the immune response to the stimuli such as the LPS through inducible nitric oxide synthase.sup.[14]. In order to understand the inhibition of sarcodonin A compound on the LPS-induced NO production molecularly, molecular docking is conducted to study the interaction between 1 and 6 and iNOS. As shown in
[0095] In summary, in the aspect of prevention and treatment of the neurodegenerative diseases, the cyathane diterpenoids can be developed as potential lead compounds.
[0096] The preferred embodiments of the present disclosure have been described in detail in combination with the drawings above, but the present disclosure is not limited to the specific details of the above embodiments. Within a technical concept scope of the present disclosure, many simple transformations can be made to the technical solutions of the present disclosure, and these simple transformations all belong to the scope of protection of the present disclosure.
[0097] In addition, it should be noted that respective specific technical features described in the above specific embodiments can be combined in any suitable way without contradiction. In order to avoid unnecessary repetitions, the present disclosure will not separately explain various possible combinations.
[0098] In addition, any combination of different embodiments of the present disclosure can also be made, as long as the combination does not violate the idea of the present disclosure, it should also be regarded as the content of the present disclosure.