FLUIDIC CENTRIPETAL DEVICE
20200061607 · 2020-02-27
Inventors
Cpc classification
B01L2200/0631
PERFORMING OPERATIONS; TRANSPORTING
B01L2200/16
PERFORMING OPERATIONS; TRANSPORTING
B01L2400/082
PERFORMING OPERATIONS; TRANSPORTING
B01L2300/0609
PERFORMING OPERATIONS; TRANSPORTING
B01F35/7137
PERFORMING OPERATIONS; TRANSPORTING
B01L3/50273
PERFORMING OPERATIONS; TRANSPORTING
B01L2300/0867
PERFORMING OPERATIONS; TRANSPORTING
B01L2400/0683
PERFORMING OPERATIONS; TRANSPORTING
B01L3/502715
PERFORMING OPERATIONS; TRANSPORTING
B01L9/527
PERFORMING OPERATIONS; TRANSPORTING
B01L2300/069
PERFORMING OPERATIONS; TRANSPORTING
B01L2200/147
PERFORMING OPERATIONS; TRANSPORTING
B01L2300/18
PERFORMING OPERATIONS; TRANSPORTING
B01L2200/0668
PERFORMING OPERATIONS; TRANSPORTING
B01L2200/0684
PERFORMING OPERATIONS; TRANSPORTING
B01L2400/0677
PERFORMING OPERATIONS; TRANSPORTING
B01L2300/023
PERFORMING OPERATIONS; TRANSPORTING
B01F2101/23
PERFORMING OPERATIONS; TRANSPORTING
G01N35/00871
PHYSICS
B01L2300/087
PERFORMING OPERATIONS; TRANSPORTING
B01L7/525
PERFORMING OPERATIONS; TRANSPORTING
International classification
B01L3/00
PERFORMING OPERATIONS; TRANSPORTING
G01N35/00
PHYSICS
Abstract
A fluidic centripetal apparatus for testing components of a biological material in a fluid is presented. The fluidic centripetal device is adapted to be received within a rotatable holder. The apparatus comprises a fluidic component layer having fluidic features on at least a front face and a bottom component layer bonded to a rear of the fluidic component layer thereby creating a fluidic network through which the fluid flows under centripetal force. In one embodiment, the fluidic feature may be a bottom-Tillable chamber coupled to an entry channel for receiving the fluid, the chamber inlet being provided at an outer side of the bottom-fillable chamber. In another embodiment, the fluidic feature may be a retention chamber coupled to an entry channel for receiving the fluid, a container wholly provided in the retention chamber and containing a liquid diluent, the container maintaining the liquid diluent in the container until it releases it in the retention chamber upon application of an external force to the container, thereby restoring the fluidic connection between the liquid diluent and the fluid in the retention chamber. Additionally, the retention chamber can have a flow decoupling receptacle for receiving the fluid, located at the outer side of the retention chamber and interrupting a fluidic connection between the entry and exit of the retention chamber. A test apparatus and a testing method using a fluidic centripetal device for testing components of a biological material in a fluid are also provided.
Claims
1-11. (canceled)
12. A fluidic centripetal apparatus for testing components of a biological material in a fluid, said fluidic centripetal device having a shape adapted to be received within a rotatable holder, said rotatable holder having a center of rotation and an outer edge, said fluidic centripetal device extending radially between said center of rotation and said outer edge, an inner side of said fluidic centripetal device being located towards said center of rotation and an outer side of said fluidic centripetal device being located towards said outer edge, the apparatus comprising: a fluidic component layer having fluidic features on at least a front face, said fluidic features including an entry channel for circulating said fluid, said entry channel being coupled to a intake receptacle outlet; a retention chamber, said retention chamber being coupled to said entry channel via said intake receptacle outlet for receiving said fluid into said retention chamber; a container wholly provided in said retention chamber and containing a liquid diluent; and a bottom component layer bonded to a rear of said fluidic component layer thereby creating a fluidic network through which said fluid flows under centripetal force.
13. The apparatus as claimed in claim 12, wherein said retention chamber has a flow decoupling receptacle for receiving said fluid, wherein said flow decoupling receptacle is located at said outer side of said retention chamber, said flow decoupling receptacle interrupting a fluidic connection between the intake receptacle outlet and a distribution outlet of said retention chamber.
14. The apparatus of claim 12, wherein said flow decoupling receptacle includes a dried reactant.
15. The apparatus of claim 12, wherein said retention chamber has a distribution outlet for said retention chamber, said distribution outlet being located at an outer side of said retention chamber, said distribution outlet being coupled to a transversal distribution channel at an inner side of said transversal distribution channel at a first transversal end of said distribution channel, said transversal distribution channel having a series of at least one cuvette provided at an outer side of said transversal distribution channel.
16. The apparatus as claimed in claim 15, wherein at least one of said cuvettes include at least one of a dried reagent and a phase-change material.
17. The apparatus as claimed in claim 15, wherein said cuvette is adapted to be optically queried for at least one parameter, said parameter is one of fluorescence, absorbance, and colorimetry.
18. The apparatus as claimed in claim 15, wherein said transversal distribution channel includes a waste chamber at a second transversal end of said distribution channel.
19. The apparatus as claimed in claim 18, wherein said waste chamber includes a phase-change material.
20. The apparatus as claimed in claim 19, wherein said distribution channel, said cuvettes and said waste chamber are provided on a portion of said fluidic layer component which extends beyond said outer edge of said rotatable holder.
21. The apparatus of claim 20, wherein said fluidic component layer is adapted to be divided in at least two distinct temperature-controllable sections, wherein a first of said two distinct temperature controllable sections includes at least said retention chamber and a second of said two distinct temperature controllable sections includes at least said distribution channel and said cuvettes.
22-25. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0178] Having thus generally described the nature of the invention, reference will be made to the accompanying drawings, showing by way of illustration example embodiments thereof and in which:
[0179]
[0180]
[0181]
[0182]
[0183]
[0184]
[0185]
[0186]
[0187]
[0188]
[0189]
[0190]
[0191]
[0192]
[0193]
[0194]
[0195]
[0196]
[0197]
[0198]
[0199]
[0200]
[0201]
[0202]
[0203]
[0204]
[0205]
[0206]
[0207]
[0208]
[0209] It will be noted that throughout the appended drawings, like features are identified by like reference numerals.
DETAILED DESCRIPTION
[0210] Fluidic Centripetal Device Structure Assembly
[0211]
[0212] Fluidic centripetal device 1 is composed of at least two component layers. As shown in
[0213] The fluidic layer 3 and thin bottom layer 4 can be made of thermoplastic material. The thermoplastic material may be at least one of cyclic olefin copolymer (COC), polycarbonate (PC), polystyrene (PS), polyoxymethylene (POM), perfluoralkoxy (PFA), polyvinylchloride (PVC), polypropylene (PP), polymethyl-methacrylate (PMMA), cyclic olefin copolymer (COC), polyamide (PA), polysulfone (PSU), polyvinylidene (PVDF) as well as other materials known to those skilled in the art. They may be used with unmodified surface or modified surface. The surface modification may be applied to one or both faces or on a specific region of interest on one or both faces.
[0214] Several mating techniques to assemble the fluidic centripetal device fluidic layer 3 with the flat bottom layer 4 are available such as thermal bonding, radio frequency bonding, laser welding, ultrasonic bonding, adhesion or pressure sensitive adhesion and other techniques known to those skilled in the art.
[0215] In an example embodiment, the mating technique allows to incorporate dried or liquids reagent within the fluidic centripetal device prior to assembly.
[0216] In another example embodiment, the mating technique is at a temperature from about 4 C. to about 80 C.
[0217] In one example embodiment, the rotation of the fluidic centripetal device is created by placing the fluidic centripetal device on a dedicated rotor 2, which is rotated about a center of rotation. The rotor 2 has a center of rotation and an outer edge, in this case, a circumference. The fluidic centripetal device 1 radially extends between the center of rotation and the outer edge. It even extends beyond the outer edge in the example shown. An inner side of the fluidic centripetal device 1 is located towards the center of rotation and an outer side of the fluidic centripetal device 1 is located towards the outer edge.
[0218] The fluidic centripetal device can be a portion of a disc having an internal diameter of about 5 mm and an external diameter from about 20 mm to about 50 mm. The portion of a disc can be of a disc. There are no limitations to the shape of the fluidic centripetal device and to the number of fluidic centripetal devices a rotor can receive.
[0219] In an alternative embodiment, the fluidic centripetal device has a disc shape and the rotor is adapted to receive a single fluidic centripetal device.
[0220] In another alternative embodiment, the shape of the fluidic centripetal device corresponds to a standard microscope slide of 25 mm75 mm. The rotor may be adapted to receive between 2 to 12 microscope slides.
[0221] Fluidic Layer
[0222]
[0223]
[0224] Intake Receptacle, Vented Channels and Fluidic Centripetal Device Sample Inlet Cap
[0225]
[0226] In one embodiment, the vented chamber 905 is connected to intake receptacle 5 with the inlet vent connection 906 on the upper face of the fluidic centripetal device near the inner portion of intake receptacle 5.
[0227] In an example embodiment, a cover 907 includes base piece 908 in direct contact with the intake receptacle 5, a flexible connecting arm 909, and a cap 910 linked to base piece 908 by connecting arm 909. Cover 907 can be placed in a closed configuration with the cap 910 secured on the base piece 908 or can be placed in an open configuration as shown in
[0228] In an alternative embodiment (not illustrated), vented chamber 905 is disconnected from chamber 901 (inlet vent connection 906 is absent). The air venting is provided by a hole provided on base piece 908 of cover 907 which allows air communication between chamber 901 and vented chamber 905 via the free cavity formed between base piece 908 and cap 910 when cover 907 is in the closed configuration.
[0229] Bottom-Fillable Chamber
[0230]
[0231] In one embodiment, specific solid phase chromatography material (such as ion exchange material) can be placed into the receptacle 5. During centrifugation to fill the bottom-fillable chamber, the solid phase chromatography material will fill the channel 302 enabling the formation of an exclusion column able to adsorb some nucleic acid amplification inhibitor from the crude sample.
[0232] The bottom inlet 304 of the bottom-fillable chamber 315 is located at the outer side of the bottom-fillable chamber 315. Since flow of the sample will be from the intake receptacle 5 to the outer side of the bottom-fillable chamber, the outer side of the bottom-fillable chamber is referred to as the bottom of the bottom-fillable chamber. A vent channel 305a is connected to the chamber outlet 306 at the inner side of the bottom-fillable chamber.
[0233] Dimension of the chamber is comprised between several centimeters in width, several centimeters in height and several millimeters in depth. In an example embodiment, the chamber 315 dimension is comprised between 1 cm wide, 2 cm high and 2 mm deep. In another example embodiment, the dimensions are 0.5 cm wide, 1.5 cm high and 1.3 mm deep.
[0234] Reagents and Translocatable Member
[0235] Referring now to
[0236] In an example embodiment, fixed magnets are permanent magnets made of rare-earth magnetic material. In another embodiment, they are electromagnets.
[0237] The chamber may also optionally contain solid material 308 that does not respond to a magnetic field. The solid material can be used to provide a chemical or biochemical reaction and may include salt, buffer or enzyme. The solid material can be used to purify the sample by adsorbing enzymatic inhibitors and may include a chromatography matrix, a solid support for affinity binding, a solid phase extraction, a chelating material, anionic and cationic resins and different types of zeolite. The solid material can be used for cell breakage and may include hard matrix. The solid material can be used for process control and may include bacterial cells or spores. The solid material can be used to concentrate the lysate using hygrometric matrix to absorb liquids. The solid material can be functionalized with ligands such as specific antibodies and can be used to capture targets inside the bottom-fillable chamber. The solid material can be a filter able to stop or trap target microbes inside the bottom-fillable chamber. The solid material can be functionalized with ion exchange moieties able to adsorb target microbes at its surface, immobilizing them inside the bottom-fillable chamber. These different solid materials can be used alone or in combination.
[0238] When the solid materials are hard matrix for cell wall and membrane disruption, the material can be made of silica or zirconium beads with diameters from about 50 m to about 200 m. The beads can be optionally coated with chelating agent for absorption of the enzymatic inhibitors.
[0239] In one example embodiment, the translocatable object is a metallic disc and the solid material is composed of hard beads mixed with anionic and cationic resin and spores.
[0240] Overflow
[0241]
[0242] Metering
[0243]
[0244] The volume of fluid metered by the exit outlet can be comprised between 10 to and 50 l. In an example embodiment, the volume defined is 20 l.
[0245]
[0246]
[0247]
[0248]
[0249] Referring now to
[0250] Retention Chamber
[0251] One example embodiment of a fluidic structure to retain and/or dilute a sample is illustrated in
[0252] In the example embodiment of
[0253] Optionally, the receptacle may contain dried reagents 408 as shown in
[0254] In the example embodiment illustrated in
[0255] The above described structures can be used as a novel valve type we call Flow Decoupling Valve. The Flow Decoupling Valve contains two elements, a flow decoupling receptacle to interrupt the fluidic connection between the inlet and outlet of a retention chamber, and a liquid container enclosing a diluent which can be released upon application of an external force. Release of the diluent restores fluidic connection within the circuit.
[0256] In an example embodiment, a phase-change material extremity 411 of the container 410 releases the liquid when the retention chamber is heated above a certain temperature. The liquid container can help prevent evaporation of the enclosed liquid for a period of about 1 to 3 years and has a capacity of one microliter to two milliliters.
[0257]
[0258] An alternative example embodiment is illustrated in
[0259] An example embodiment of a fluid metering system connected to retention chamber is shown in
[0260] Upon heating, the diluent 410 contained in the dilution container 409 is released into the retention chamber 403. The released liquid 410 mixes with the measured volume contained in the retention chamber receptacle 406. Once the diluent and the measured volume are mixed together, the total volume is large enough to bring the dilution in contact with outlet 405 acting as a burst valve. Thus, release of the liquid from container 409 brings a liquid in the right place at the right time and also reactivates the fluidic circuitry. Indeed, before the liquid container is heated, the liquid coming from chamber 315 is retained into the receptacle 406. In this particular embodiment, the retention chamber receptacle allows a high RPM burst rate for the metering outlet burst valve 312 and helps prevent the liquid from coming out of the retention chamber by controlling the localization of the fluid to help prevent contact with the retention chamber outlet valve 405. The mechanism of this novel Flow Decoupling Valve dissociates the passive metering outlet burst valve 312 from passive outlet valve 405, enabling a robust fluidic control without the need for complex active valving.
[0261] In another example embodiment, the phase change material 411 of the liquid container 409 has a density superior to the measured liquid 407 retained in the receptacle 406 and the diluent 410. When heated, the liquid 410 contained in the liquid container 409 is released into chamber 403. The phase change material 411 will move below the mixture of diluent 410 and fluid 407 and displace the latter so it can be in contact with outlet 405 which can act as a burst valve. In this particular embodiment, the retention chamber can be emptied once the higher density liquid is released.
[0262] In some embodiments, dried reagents 408 can be stored into the retention chamber 403.
[0263] Cuvette, Detection Chamber and Distribution Chamber
[0264]
[0265] In an example embodiment of
[0266] In another embodiment shown in
[0267] In another embodiment illustrated in
[0268] In another embodiment, a phase-change material 612 is placed into the waste. The liquid coming from the retention chamber is brought to the distribution canal with a temperature inferior to the melting point of the phase-change material present in the waste.
[0269] In an embodiment, a phase-change material is placed both into the cuvettes and into the waste. In this particular embodiment the melting point of the phase-change material 612 placed into the waste is equal or lower than the melting point of the phase-change material 608 placed into the cuvettes.
[0270]
[0271]
[0272] Exemplary Configuration of Instrument
[0273]
[0274]
[0275] This example instrument 1000 provides multiple temperature zone controls to control the temperature at predetermined regions of interest of a fluidic centripetal device. In this example embodiment, centrifugation enclosure 1004, rotor assembly 1003 and lid 1001 are designed to ensure a dual zone air temperature control.
[0276] Excitation module 1007 provides at least one excitation wavelength. The excitation beam path goes upward to excite fluorescent species inside the cuvettes of the fluidic centripetal devices from the bottom face.
[0277] The detection module 1009 is located at the back of the centrifugation enclosure. The detection module 1009 houses the optical elements which collect light emitted by fluorescent species in the fluidic centripetal device at least one wavelength. In this example embodiment, the detector is a PMT.
[0278] Instrument Functions Overview
[0279] The instrument includes integrated modules: motor 1005, centrifugation enclosure 1004, multiple zone temperature controller 2000, optics 1014, controller 1008 and a human machine interface 1006. It will be understood that arrangement of the various components or modules shown in
[0280] Centrifugation Enclosure
[0281] The rotor assembly 1003 is placed inside a centrifugation enclosure 1004 which revolves to control fluid motion into fluidic centripetal device 1. The rotational movement of the rotor assembly is produced by motor 1005. The rotor assembly may be permanently fixed inside the centrifugal enclosure or may be removed from the centrifugal enclosure to allow placing fluidic centripetal device(s) onto the rotor before placing the rotor inside the centrifugal enclosure. The rotor assembly may revolve in a plane parallel to the base of the instrument or alternatively in a plane perpendicular to the base of the instrument. Revolution speeds of the rotor assembly may vary between 0 and 10000 RPM clockwise and/or counter clockwise with an acceleration rate between 0 and 20000 RPM/s. For example, the rotating sequence is performed automatically by controller 1008.
[0282] A permanent magnet (not shown) may be placed inside the centrifugation enclosure to magnetically activate translocatable member 307 located in the bottom-filling chamber of some fluidic centripetal device embodiments. An example of magnetic action for a centrifugal fluidic disc has been described by Kido et al., in A novel, compact disk-like centrifugal microfluidics system for cell lysis and sample homogenization, Colloids Surfaces B: Biointerfaces, 58 (2007) 44-51.
[0283] Multiple Zone Temperature Control
[0284] Instrument 1000 also allows multiple zone temperature controller 2000 to modulate the temperature of predetermined regions of interest (ROI) 1300, 1302 of a fluidic centripetal device. Heating/cooling may be achieved with resistive techniques (nichrome wire, ceramic heater), with or without fan, thermoelectric (Peltier) techniques, halogen bulb heating as well as other heating/cooling systems known to those skilled in the art.
[0285] Now referring to
[0286] Referring back to
[0287] In some embodiments, a fan can be used to recirculate hot air around a ROI. Alternatively or in addition, a fan can force fresh air to be heated by a heater before contacting the ROI of interest.
[0288] In some embodiments, a least one vent (not shown) allows hot air to exit the compartment of the centrifugal enclosure. The vent can be momentary or permanently opened.
[0289] In some embodiments, fan 2002 may be used to cool a specific ROI of the fluidic centripetal device. A fan can be used to force cold air (room temperature) to enter into a specific compartment of the centrifugal enclosure to cool a specific ROI of the fluidic centripetal device.
[0290] In some embodiments, a least one ROI of the fluidic centripetal device can be maintained below 35 C. when heating another ROI between 25 C. and 99 C.
[0291] Preferably, a temperature feedback loop algorithm may be implemented on the controller 1008 to make an isothermal incubation of at least one of the ROI of the fluidic centripetal device. Alternatively or in addition, temperature feedback loop algorithms may be implemented to perform thermal cycling into at least one ROI of the fluidic centripetal device.
[0292] In one embodiment, isothermal incubation of one ROI may be used to control nucleic acid amplification inhibition, more specifically, to control inhibition of PCR amplification. Alternatively or in addition, isothermal incubation may be used to heat phase-change material. In a more specific embodiment, the ROI of interest into the fluidic centripetal device includes at least the retention chamber of fluidic centripetal device embodiment described above.
[0293] In one embodiment, isothermal incubation of at least one ROI of a fluidic centripetal device may be used to perform an isothermal acid nucleic amplification. In a more specific embodiment, the ROI comprises the cuvettes of an embodiment fluidic centripetal device described above.
[0294] In another embodiment, thermal cycling of at least one ROI of a fluidic centripetal device may be used to performed PCR amplification. In a more specific embodiment, the ROI comprises the cuvettes of an embodiment fluidic centripetal device described above.
[0295] Now referring to
[0296] In another alternative embodiment, a sub-controller can be integrated into the rotating rotor assembly to implement the temperature control feedback loop of one or more heating elements directly onto the rotor. Electric power may be supplied to the rotating electronic board by one of the batteries placed on the rotating electronic board, induction power transfer between non-rotating part and the electronic board placed on the rotor or with a slip ring interface between the motor and the rotor. A communication interface between this sub-controller and controller 1008 may be implemented through serial communication via a slip ring, RF communication or any other wireless transmission mode. In some embodiments, temperature may be measured into different ROIs of a fluidic centripetal device. Conditioning of the sensing element and conversion from analog to digital may be implemented directly on the rotating controller, thereby avoiding analog sensor signal transmission through a slip ring and diminishing the noise. This embodiment is suitable to calibrate enzymatic amplification reaction such as PCR amplification. In an alternative embodiment, rotating controller may be used to measure electric signal of electrode coated on one of the layer of the fluidic centripetal device. Electrode may be used to detect the presence of liquid in various ROI of the fluidic centripetal device.
[0297]
[0298] Optics
[0299] Referring back to
[0300] In another embodiment, optics 1014 only include a detection module to interrogate the liquid in the fluidic centripetal device.
[0301] Excitation module 1007 includes light source(s) and mechanical and optical elements to both spectrally and spatially shape an excitation beam. Several light sources may be housed into an excitation module and their outputs may be coupled to a single beam path. Alternatively, an actuator may allow switching between light sources to excite fluorescent species at different wavelength. In one embodiment, wavelength selection and output power adjustment is performed automatically by controller 1008 of the instrument.
[0302] In one embodiment, light sources are light emitting diode (LED). In another embodiment, laser, halogen or mercury lamps may be used.
[0303] In some embodiments, excitation module 1007 contains 1 to 6 LEDs to excite fluorescent species at 1 to 6 different wavelengths. Each LED may be spectrally filtered by a single bandpass interferential filter before being coupled to a single beam path. Alternatively, a multiple bandpass interferential filter may be used to filter LEDs after being coupled to a single beam path.
[0304] Detection module 1009 comprises optical elements to collect light emitted by species of interest within the fluidic centripetal device. Optical elements can be lens, to shape spatially collected light to a photodetector, interferential filter to select a wavelength band corresponding to the emission spectrum of the fluorescent species. In one embodiment, the detector is a PMT. In another embodiment, detectors can be photodiodes.
[0305] In some embodiments, the detection module may detect 1 to 6 different wavelengths onto a single detector. Each wavelength may be filtered by a single bandpass interferential filter and an actuator may allow switching between filter to sequentially detect fluorescent species. Alternatively, a multi bandpass interferential filter may be used to avoid the need of an actuator to switch between wavelengths. In this case, all wavelengths will be detected simultaneously by the detector. It may be necessary to excite fluorescent species sequentially with the excitation module to distinguish each species. For example, this task is performed automatically by controller 1008.
[0306]
[0307]
[0308] Now referring to
[0309]
[0310]
[0311] Testing Method for Thermocycling Amplification
[0312]
[0313] First step 1201 consists in loading a biological sample into the intake receptacle 5. Then, place the fluidic centripetal device into the instrument and press start button 1202. From this point, the instrument will take care of the whole process. The rotation will start at speed #1 1203 to transfer the liquid from the intake receptacle 5 to the lysis chamber 315 and evacuate part of the sample into the overflow chamber 309. The rotation speed will change to speed #2 1204 to activate the movement of translocating member 307 inside the bottom-fillable lysis chamber. Permanent magnets placed under rotor 2 create a fluctuating magnetic field when fluidic centripetal devices rotate over it. After a predetermined amount of time, the rotation is changed again to speed #3 1205 to clarify the lysate and burst the metering outlet 312.
[0314] The metered volume is transferred into retention chamber receptacle 406. At step 1206, the rotation is changed again to speed #4. Compartment #1 is heated so the ROI #1 of fluidic centripetal device reaches 95 C. for 3 minutes, for example, to control inhibitors potentially present in the biological sample. This heating will also melt liquid container wax cap 411 to release diluent 410 inside retention chamber 403. It should be noted that compartment #2 of the instrument and ROI #2 of the fluidic centripetal device are kept at a temperature under 35 C., for example, by activating the blower if needed.
[0315] At the end of step 1206, the lysate is generally well mixed with the diluent and is ready to be transferred into the distribution channel and cuvettes 602. The transfer is done by heating compartment #2 at a temperature such that ROI #2 reaches a temperature above 50 C., for example, to melt wax 608 in waste chamber 605 and by changing the rotation to speed #3, step 1207. The dilution reservoir outlet 405 bursts and the liquid is transferred into cuvettes 602 to resuspend pre-stored PCR dried reagents 607. At step 1208, the rotation speed is changed to speed #4 and the hot start enzyme contained in reagents 607 is activated by heating compartment #2 so that ROI #2 of fluidic centripetal device reaches 94 C., for example, for a period between 3 to 10 minutes depending on the specific reagents used.
[0316] During this time, heating zone #1 naturally cools down to a temperature about 45 C. Continuing at rotation speed #4, real-time PCR cycling protocol 1209 is started. The temperature in compartment #2 is cycled so that temperature in ROI #2 is cycled between about 95 C., 56 C. and 72 C. for periods varying respectively from 1 to 15 s, 0 to 15 s and 1 to 20 s. At the end of each 72 C. cycle, the fluorescence measurement is taken at 1 to 6 different excitation/detection wavelengths simultaneously or sequentially. The cycling is done 35 to 45 times. The real-time-PCR fluorescence curve is then analyzed, and interpreted by a computer-based algorithm. Results are logged in a database and are optionally transmitted to the test operator or to a physician.
[0317]
[0318] In another embodiment, the instrument may alternatively process sample-preparation and real-time isothermal detection. The isothermal amplification used can be, but is not limited to, RMA (ribonuclease-mediated amplification), HDA (Helicase Dependent Amplification), RPA (Recombinase Polymerase Amplification) and SPIA (Single Primer Isothermal Amplification), LAMP (Loop mediated isothermal Amplification).), SDA (Strand displacement amplification), NASBA (Nucleic Acid Sequence Based Amplification), wGA (Whole Genome Amplification), pWGA (primase-based Whole Genome Amplification), ICAN (Isothermal and Chimeric primer-initiated Amplification of Nucleic acids), EXPAR (Exponential amplification reaction), NEAR (Nicking enzyme amplification reaction), RCA (Rolling circle amplification), TMA (Transcription-Mediated Amplification).
[0319] It will be recognized by those skilled in the art that a plurality of fluidic centripetal devices can be manufactured with specific applications in mind, permitting sample volume definition, sample homogenization, sample lysis, sample metering, sample dilution, sample mixing and sample detection.
[0320] Testing Method for Isothermal Amplification
[0321] In an alternative embodiment of the flow chart illustrated on
[0322] The steps are as follows: load a biological sample into the intake receptacle 5. Then, place the fluidic centripetal device into the instrument and press the start button. From this point, the instrument will take care of the whole process. The rotation will start a speed #1 to transfer the liquid from the intake receptacle 5 to the lysis chamber 315 and evacuate part of the sample into the overflow chamber 309. The rotation speed will change to speed #2 to activate the movement of the translocating member 307 inside the bottom-fillable lysis chamber. Permanent magnets placed under the rotor 2 create a fluctuating magnetic field when fluidic centripetal devices rotate over it. After a predetermined amount of time, the rotation is changed again to speed #3 to clarify the lysate and burst the metering outlet 312.
[0323] The metered volume is transferred into the retention chamber receptacle 406. The rotation is changed again to speed #4. The compartment #1 is heated so that in ROI #1 of fluidic centripetal device the temperature is at 95 C. for 3 minutes, for example, to control inhibitors potentially present in the biological sample. This heating will also melt the liquid container wax cap 411 to release the diluent 410 inside the retention chamber 403. It should be noted that compartment #2 is kept at a lower temperature so that ROI #2 is kept at a temperature under 35 C., for example, by activating the blower if needed.
[0324] The lysate is generally well mixed with the diluent and is cooled down at a temperature equal or below 42 C. and ready to be transferred into the distribution channel and cuvettes 602. In this embodiment the diluent is water and magnesium. The transfer is done by keeping compartment #2 at a temperature so that ROI #2 is kept at 37-42 C., and by changing the rotation to speed #3. The dilution reservoir outlet 405 bursts and the liquid is transferred into cuvettes 602 to resuspend pre-stored PCR dried reagents 607. In this embodiment, dried reagent 607 comprises RPA fluorescent probe, primers, recombinase, polymerase, exonuclease, the crowding agent, GP32, uvsY, and uvsX. The rotation speed is changed to speed #4 and the compartment #2 is heated so that ROI #2 reaches 37-42 C.
[0325] During this time, heating zone #1 naturally cools down to a temperature below 45 C. The fluorescence measurement is taken at 1 to 6 different excitation/detection wavelengths simultaneously or sequentially every few minutes. The amplification step is stopped after 20 minutes. The real-time-RPA fluorescence signal is then analyzed, and interpreted by a computer-based algorithm. Results are logged in a database and are optionally transmitted to the test operator or to a physician.
[0326] In another embodiment, the instrument may alternatively process sample-preparation and real-time isothermal detection. The isothermal amplification used can be, but is not limited to, RMA (ribonuclease-mediated amplification), HDA (Helicase Dependent Amplification), RPA (Recombinase Polymerase Amplification) and SPIA (Single Primer Isothermal Amplification), LAMP (Loop mediated isothermal Amplification).), SDA (Strand displacement amplification), NASBA (Nucleic Acid Sequence Based Amplification), wGA (Whole Genome Amplification), pWGA (primase-based Whole Genome Amplification), ICAN (Isothermal and Chimeric primer-initiated Amplification of Nucleic acids), EXPAR (Exponential amplification reaction), NEAR (Nicking enzyme amplification reaction), RCA (Rolling circle amplification), TMA (Transcription-Mediated Amplification).
[0327] It will be recognized by those with skill in the art that a plurality of fluidic centripetal devices can be manufactured with specific applications in mind, permitting sample volume definition, sample homogenization, sample lysis, sample metering, sample dilution, sample mixing and sample detection.
Example 1
[0328] The following example is illustrative and is not intended to be limiting.
[0329] The present example concerns the detection of the presence of Group B streptococcus from a pregnant woman vaginal-anal swab.
[0330] The fluidic centripetal device used for the purpose of this example has the external shape described in
TABLE-US-00001 TABLE1 Summaryofthedetailsofthefluidiccentripetaldevicestructures FluidicLayer Material:clearpolycarbonate(LexanHP1-112) Fabricationprocess:injectionmolded+ micromillingoflysis chamberoutletandretentionchamberoutlet Thinbottomlayer Polycarbonate(thickness= 0.015) (McMasterCarr#85585K14) Pressuresensitiveadhesive 9493R,3M Translocatablemember MagneticStainlessSteelTumbleStirElements V&PScientific,Inc.#721-F(diameter= 4mm,thickness= 0.5mm) Lysischamberreagents SlurryofglassbeadsG1145in1%PVPaqueoussolution PCRreagents 2lofspecificGBSprimers Sag59TTTCACCAGCTGTATTAGAAGTA(SEQID NO:4) Sag190GTTCCCTGAACATTATCTTTGAT(SEQID NO:2) Taqmanprobe: (FAM)CCCAGCAAATGGCTCAAAAGC(SEQIDNO:3) (BHQ-1)OmniMixHS(Takara#700-2102) Liquidcontainer Plasticrestaurantstraw(diameter= 4mm) HotgluearrowBAP5-4 Paraffinwax(Calwax #CAL-140) PCRtreatedwater Wastechamber Paraffinwax(Calwax #CAL-120)
[0331] The liquid container was fabricated using the following protocol: close one extremity of the plastic straw with hot glue; load 140 l of PCR treated water; seal the container with melted paraffin wax.
[0332] The fluidic centripetal device was assembled using the following protocol: place paramagnetic disc in the lysis chamber; load 60 l of glass beads slurry; load 2 l primers in each cuvette; load 0.5 l of TaqMan probe; dry the slurry and the primers under vacuum overnight; place the liquid container in the retention chamber; dispense Low Melting Paraffin wax in the waste chamber.
[0333] The following steps are done in a glove box under Argon atmosphere: place one bead of OmniMix HS per detection cuvette; bond the thin bottom layer to the fluidic layer using the pressure sensitive adhesive; place assembled fluidic centripetal device in an aluminum pouch with desiccant and seal the pouch.
Experiment
[0334] During a clinical study, vaginal/anal swabs were collected from pregnant women using Clinical Packaging snap valve technology filled with 600 l of Tris EDTA 10 mM (TE).
[0335] After resuspension of the swab with the 600 l of TE, a quantity of 170 l of the swab dilution is placed directly into the intake receptacle of the fluidic centripetal device described above.
[0336] The fluidic centripetal device is laced into the instrument and the following protocol is performed in the dual zone temperature control instrument for the sample preparation.
[0337] Parameters for metering, lysis and control of PCR inhibitors used in this example are the following:
TABLE-US-00002 TABLE 2 Bottom-fillable chamber loading Step Parameters Condition 1 Acceleration Speed -900 RPM, acceleration rate 50 RPM/s 2 Waiting 25 s
TABLE-US-00003 TABLE 3 Lysis step Step Parameters Condition 3 Acceleration Speed -200 RPM, acceleration rate 1000 RPM/s 4 Waiting 300 s
TABLE-US-00004 TABLE 4 Clarification step and transfer to retention chamber receptacle Step Parameters Condition 5 Acceleration Speed -3500 RPM, acceleration rate 50 RPM/s 6 Waiting 60 s
TABLE-US-00005 TABLE 5 PCR Inhibitors control Step Parameters Condition 7 Acceleration Speed -600 RPM, acceleration rate 50 RPM/s 8 Heat zone #1 Temp 110 C., 180 s 9 Waiting 20 s
TABLE-US-00006 TABLE 6 PCR cuvette filling Step Parameters Condition 10 Acceleration Speed -3000 RPM, acceleration rate 500 RPM/s 11 Wait 155 s 12 Stop heating zone #1 13 Start blower zone #2 14 Waiting 30 s 15 Stop Blower zone #2 16 Stop
[0338] The fluidic centripetal device is then transferred onto an adapted rotor specifically designed to work on a RotorGene to process the real-time PCR using the following conditions.
TABLE-US-00007 TABLE 7 Process conditions Cycle Cycle point Hold @ 94 C., 3 min Cycling (45) Step 1 @ 95 C., hold 20 s Step 2 @ 56 C., hold 60 s Step 3 @ 72 C., hold 30 s
[0339] Results:
[0340] Swab found positive for the presence of GBS detection at a CT of 28.30.
Example 2
[0341] The following example is illustrative and is not intended to be limiting.
[0342] The present example concerns the use of an example embodiment of the fluidic centripetal device to detect the presence of Group B streptococcus from pregnant women vaginal-anal swabs.
[0343] The fluidic centripetal device used for the purpose of this example has the external shape described in
TABLE-US-00008 TABLE 8 Summary of the details of the fluidic centripetal device structures Fluidic Layer Material: Clear polycarbonate (Lexan HP1-112) Fabrication process: Injection molded Thin bottom Polycarbonate (thickness = 0.015) layer (McMaster Carr #85585K14) Pressure 9795R, 3M, in contact with fluidic layer. sensitive 467 MP, 3M, in contact with bottom layer and adhesives 9795R layer Translocatable Magnetic Stainless Steel Tumble Stir Elements member V&P Scientific, Inc. #721-F (diameter = 4 mm, thickness = 0.5 mm) Lysis chamber Slurry of glass beads Sigma #G1145 (150-212 (Bottom- microns) in 0.5% PVP aqueous solution fillable chamber) reagents PCR reagents, Primers and probes for the GBS assays as listed in dried in each Table 15 at 0.4 M for primers SEQ ID 1-2 and SEQ cuvettes, per ID 4-5; 0.2 M for probes SEQ ID 3 and SEQ ID 6; reaction internal control target sequence SEQ ID 7 at 500 copies per reaction PCR buffer, 1X BSA, 3.3 mg/ml dATP, 0.2 mM dCTP, 0.2 mM dGTP, 0.2 mM dTTP, 0.2 mM GoTaq polymerase, Promega #PRM3005 Trehalose, 6% Liquid container Polyallomer Tubes, 5 20 mm Beckman Coulter #34263 Hot glue Arrow BAP 5-4 Paraffin wax (Calwax #CAL-140) PCR diluent liquid (5.83 mM MgCl.sub.2) Waste chamber Paraffin wax (Calwax #CAL-120)
[0344] The liquid container was fabricated using the following protocol: load 120 ul of PCR diluent liquid; seal the polyallomer tube with Hot glue Arrow BAP 5-4.
[0345] The fluidic centripetal device was assembled using the following protocol: Place paramagnetic disc in the lysis chamber; load 60 l of glass beads slurry; load 4.6 l of PCR reagents in each cuvette; dry the slurry and the PCR reagents under heat and vacuum; place the liquid container in the retention chamber; dispense Low Melting Paraffin wax in the waste chamber.
[0346] Bind the pre-assembled layers 9795R/467 MP/polycarbonate to the fluidic layer and apply a pressure using a press with a torque of 90 in. lbs. Place assembled fluidic centripetal device in an aluminum pouch with desiccant and seal the pouch.
Experiment
[0347] During a clinical study, vaginal/anal swabs were collected from pregnant women using Medical Packaging snap valve technology filled with 600 l of Tris EDTA 10 mM (TE).
[0348] After resuspension of the swab with the 600 l of TE, 170 l of the swab dilution are placed directly into the sample intake receptacle of the fluidic centripetal device described above.
[0349] The fluidic centripetal device is placed into the instrument and the following protocol is performed in the dual zone temperature control instrument for the sample preparation.
[0350] Parameters for metering, lysis and control of PCR inhibitors used in this example are the following:
TABLE-US-00009 TABLE 9 Bottom-fillable chamber loading Step Parameters Condition 1 Acceleration Speed -1000 RPM, acceleration rate 300 RPM/s 2 Waiting 30 s
TABLE-US-00010 TABLE 10 Lysis step Step Parameters Condition 3 Acceleration Speed -180 RPM, acceleration rate 1000 RPM/s 4 Waiting 300 s
TABLE-US-00011 TABLE 11 Clarification step and transfer to retention chamber receptacle Step Parameters Condition 5 Acceleration Speed -1500 RPM, acceleration rate 50 RPM/s 6 Acceleration Speed -3500 RPM, acceleration rate 300 RPM/s 7 Waiting 30 s
TABLE-US-00012 TABLE 12 PCR Inhibitors control by heating and fluid dilution Step Parameters Condition 8 Acceleration Speed -450 RPM, acceleration rate 1000 RPM/s 9 Heat zone #1 Temp 165 C., 180 s 10 Waiting Speed -3000 RPM, acceleration rate 300 RPM/s
TABLE-US-00013 TABLE 13 PCR cuvette filling Step Parameters Condition 11 Acceleration Speed -3000 RPM, acceleration rate 500 RPM/s 12 Wait 155 s 13 Stop heating zone #1 14 Start blower zone #2 15 Waiting 30 s 16 Stop Blower zone #2 17 Stop
[0351] The fluidic centripetal device is then transferred onto an adapted rotor specifically designed to work on a RotorGene to process the real-time PCR using the following conditions.
TABLE-US-00014 TABLE 14 Thermocycling conditions Cycle Cycle point Hold @ 94 C., 3 min Cycling (45) Step1 @9 7 C., hold 20 s Step2 @ 58 C., hold 20 s Step3 @ 72 C., hold 20 s
[0352] Results:
[0353] Swabs were found positive for the presence of GBS detection at CT between 27 and 32.
Example 3
[0354] The following example is illustrative and is not intended to be limiting.
[0355] The present example concerns the use of an example embodiment of the fluidic centripetal device to detect the presence of human beta-globin gene from a human cheek swab sample, Escherichia coli from human urine samples, and methicillin resistant Staphyloccus aureus (MRSA) from human nose swabs samples.
TABLE-US-00015 TABLE15 Listofselectedamplificationprimersanddetectionprobesforthe differentassays Assay combination Oligonucleotidetype SEQID Sequencea GBS Amplificationprimer SEDID1 TTTCACCAGCTGTATTAGAAGTA Amplificationprimer SEDID2 GTTCCCTGAACATTATCTTTGAT DetectionTaqmanprobeFAM- SEDID3 CCCAGCAAATGGCTCAAAAGC BHQ ICAmplificationprimer SEDID4 TTTCACCAGCTGTATTAGAAGTA ICAmplificationprimer SEDID5 GTTCCCTGAACATTATCTTTGAT ICDetectionTaqmanprobe SEDID6 TCTCTTGGATCTTGCTCATGCCCC CalRed-BHQ ICTarget SEDID7 TTTCACCAGCTGTATTAGAAGTAAGCTT GTAATGGACCTCCCGGTGGAACACGGT TTACTTCTAGATAATCTCTTGGATCTTG CTCATGCCCCATTCACTCATACATCCAC TTTTGCAAAAGGCTGGAGTGTCCCAAG TTTGGTGAAGTTTTTAACACCTACCTCG GGTCTCCAAGGATACTGGGATCCATAT CCAATCGATATCAAAGATAATGTTCAG GGAAC Bglobin Amplificationprimer SEDID8 GAAGAGCCAAGGACAGGTAC Amplificationprimer SEDID9 CAACTTCATCCACGTTCACC DetectionTaqmanprobeFAM- SEDID10 CATCACTTAGACCTCACCCTGTGGAG BHQ UTI/E.coli Amplificationprimer SEDID11 GTGGGAAGCGAAAATCCTG Amplificationprimer SEDID12 CCAGTACAGGTAGACTTCTG DetectionTaqman-LNAprobe SEDID13 CTTCTTcacCAAcTTTgATG FAM-BHQ ICAmplificationprimer SEDID14 GTGGGAAGCGAAAATCCTG ICAmplificationprimer SEDID15 CCAGTACAGGTAGACTTCTG ICDetectionTaqmanprobe SEDID16 TCTCTTGGATCTTGCTCATGCCCC CalRed-BHQ ICTarget SEDID17 GGGAAGCGAAAATCCTGCTTCTTTACA GCCTCCATCAGGGTTTTTAATTCATGCT GAGCTTGTAATGGACCTCCCGGTGGAA CACGGTTTACTTCTAGATAATCTCTTGG ATCTTGCTCATGCCCCATTCACTCATAC ATCCACTTTTGCAAAAGGCTGGAGTGT CCCAAGTTTGGTGAAGTTTTTAACACCT ACCTCGGGTCTCCAAGGATACTGGGAT CCATATCCAATCGATATGGAATTTAAA CCACCGTGTATTGTTTTATCGACAATCG GGATATCAAAACCCGGGAAACTAGAAG GCAAAAGCACACAGCAGTGAGCAACA CATCTTCATCAACTCCAGAAGTCTACCT GTACT MRSA Amplificationprimer SEDID14 GGATCAAACGGCCTGCACA Amplificationprimer SEDID15 GTCAAAAATCATGAACCTCATTACTTAT G Amplificationprimer SEDID16 ATTTCATATATGTAATTCCTCCACATCT C Amplificationprimer SEDID17 CAAATATTATCTCGTAATTTACCTTGTT C Amplificationprimer SEDID18 CTCTGCTTTATATTATAAAATTACGGCT G Amplificationprimer SEDID19 CACTTTTTATTCTTCAAAGATTTGAGC DetectionTaqmanprobeFAM- SEDID20 CGTCTTACAACGCAGTAACTACGCACT BHQ ATCATTCAGC ICAmplificationprimer SEDID21 CAAATATTATCTCGTAATTTACCTTGTT C ICAmplificationprimer SEDID22 CTCTGCTTTATATTATAAAATTACGGCT G ICDetectionTaqmanprobe SEDID23 ATGCCTCTTCACATTGCTCCACCTTTCC CalRed-BHQ TGTG ICTarget SEDID24 TCTCGTAATTTACCTTGTTCGAAGGTCG GTACAAACAGTCACCGGAGTAGAGATG TTGAAATTGCAGGCAAATTGATTGATTT CACCAGCTGTATTAGAAGTACAAGAAG GTTGGTTACAACCCAAAGACAGCTGTG CATGAATTGCAGAAAATTTATTGCAGC TTCGCCACAGGAAAGGTGGAGCAATGT GAAGAGGCATCATGCCATCTGCTGTAG GCTATCAACCAATGGTAAGACTCTTCT GGAAGCAATTGAGCTATGGTCATGCCA GGTGACAACATATGATGAGTCATCAGC CGTAATTTTATAATATAAAGCAGAG .sup.a Lower case in Taqman-LNA probe indicates Locked nucleic acids (LNA).
TABLE-US-00016 TABLE 16 Summary of the details of the fluidic centripetal device structures Fluidic Layer Material: Clear polycarbonate (Lexan HP1-112) Fabrication process: Injection molded Thin bottom Polycarbonate (thickness = 0.015) layer (McMaster Carr #85585K14) Pressure 9795R, 3M, in contact with fluidic layer. sensitive 467 MP, 3M, in contact with bottom layer and adhesives 9795R layer Translocatable Magnetic Stainless Steel Tumble Stir Elements member V&P Scientific, Inc. #721-F (diameter = 4 mm, thickness = 0.5 mm) Lysis chamber Slurry of glass beads Sigma #G1145 (150-212 (Bottom- microns) in 0.5% PVP aqueous solution fillable chamber) reagents PCR reagents, Primers and probes for the different assays as listed in dried in Table 15 at concentrations ranging from 0.2-1.0 M cuvettes, depending on the assay. Internal controls when present per reaction in the multiplex assay were at 500 copies per cuvette BSA, 2.15 mg/ml 1.15 Units polymerase, HGS Diamond Taq (Eurogentec) Trehalose, 6% Liquid container Polyallomer Tubes, 5 20 mm Beckman Coulter #34263 Hot glue Arrow BAP 5-4 Paraffin wax (Calwax #CAL-140) 120 L PCR diluent liquid (3.5 mM MgCl.sub.2 in HGS PCR buffer 1X) Waste chamber Paraffin wax (Calwax #CAL-120)
[0356] The fluidic centripetal devices used for the purpose of this example have the external shape described in
[0357] The fluidic centripetal devices used for the purpose of this example contained the components listed in Table 16.
[0358] The liquid container was fabricated using the following protocol: load 120 l of PCR diluent liquid; seal the polyallomer tube with Hot glue Arrow BAP 5-4.
[0359] The fluidic centripetal device was assembled using the following protocol: place paramagnetic disc in the lysis chamber; load 60 l of glass beads slurry; load 4.6 l of PCR reagents in each cuvette; dry the slurry and the PCR reagents under heat and vacuum; place the liquid container in the retention chamber; dispense Low Melting Paraffin wax in the waste chamber.
[0360] Bind the pre-assembled layers 9795R/467 MP/polycarbonate to the fluidic layer and apply a pressure using a press with a torque of 90 in. lbs.
Experiment
[0361] A cheek brushing swab was collected from a human volunteer using Medical Packaging swab with snap valve technology filled with 600 l of Tris EDTA 10 mM (TE). The swab was placed in contact with the inside surface of the cheek and swirled for 30 s. The swab was placed back into its sleeve and the snap valve was broken to release the 600 l of TE. After 5 minutes wait time, the swab is vortexed for 1 minute. This suspended diluted sample served for testing.
[0362] Urine samples collected from patients were diluted 1/56 in TE. This diluted sample served for testing.
[0363] During a clinical study, nose swabs were collected from volunteers and resuspended in 600 l of TE. This suspended diluted sample served for testing.
[0364] A volume of 140 l of the diluted samples is placed directly into the sample intake receptacle of the fluidic centripetal device described above.
[0365] The fluidic centripetal devices are placed into the instrument and the protocols were performed according to Tables 9, 10, 11, 12, and 13.
[0366] In some tests, the protocol was paused and resumed at step 8 to examine the position of the fluid in the retention chamber receptacle.
[0367] Thermocycling was performed either under conditions listed in Table 17 or Table 18, depending on the assay.
TABLE-US-00017 TABLE 17 Thermocycling conditions for beta-globin assay Cycle Cycle point Hold @ 94 C., 3 min Cycling (45) Step1 @ 95 C., hold 5 s Step2 @ 55 C., hold 15 s Step3 @ 72 C., hold 20 s
TABLE-US-00018 TABLE 18 Thermocycling conditions for UTI and MRSA assays Cycle Cycle point Hold @99 C., 12 min Cycling (45) Step1 @ 95 C., hold 20 s Step2 @ 61 C., hold 40 s Step3 @ 72 C., hold 40 s
[0368] Results:
[0369] Internal controls revealed no or only minimal inhibition by samples. All samples already known to contain the target DNA by another test method were indeed found positive with the fluidic centripetal device and similarly, samples already known to be negative for the target DNA were indeed found negative with the fluidic centripetal device.
[0370] This example illustrates the versatility of the fluidic centripetal technology of this invention for detecting nucleic acids from a variety of biological samples and cells. Diluted fecal samples were also successfully tested for the detection of bacterial pathogens responsible for diarrhea.
Example 4
[0371] The following example is illustrative and is not intended to be limiting.
[0372] The present example concerns the use of an example embodiment of the fluidic centripetal device and more specifically of the bottom-fillable chamber and other elements of this invention to concentrate cells and microbes.
TABLE-US-00019 TABLE 19 Summary of the details of the fluidic centripetal device structures. Fluidic Layer Material: Clear polycarbonate (Lexan HP1-112) Fabrication process: Injection molded Thin bottom Polycarbonate (thickness = 0.015) layer (McMaster Carr #85585K14) Pressure 9795R, 3M, in contact with fluidic layer sensitive 467 MP, 3M, in contact with bottom layer and 9795R adhesives layer Translocatable Magnetic Stainless Steel Tumble Stir Elements member V&P Scientific, Inc. #721-F (diameter = 4 mm, thickness = 0.5 mm) Lysis chamber Slurry of glass beads Sigma #G1145 (150-212 microns) (Bottom- in 0.5% PVP aqueous solution fillable chamber) reagents
[0373] The fluidic centripetal devices used for the purpose of this example have the external shape described in
[0374] The fluidic centripetal devices used for the purpose of this example contained the components listed in Table 19.
[0375] The fluidic centripetal device was assembled using the following protocol: place paramagnetic disc in the lysis chamber; load 60 l of glass beads slurry; dry the slurry overnight under vacuum; bind the pre-assembled layers 9795R/467 MP/polycarbonate to the fluidic layer and apply a pressure using a press with a torque of 90 in. lbs.
Experiment
[0376] 10 l (10.sup.5 Colony Forming Units; CFU) of a diluted culture of the bacteria Enterococcus faecalis were mixed with 190 l of TE.
[0377] The 200 l mixture was placed directly into the sample intake receptacle of the fluidic centripetal device described above.
[0378] The fluidic centripetal devices were placed into the instrument and the following protocols were performed according to Tables 9 and 10.
[0379] The fluidic centripetal device were disassembled by removing the pressure sensitive layers so that the liquid in the bottom-fillable chamber and in the overflow chamber could be harvested and diluted to perform plate counts of the bacterial cells present in each chambers.
[0380] Results:
[0381] Plate counts revealed that the number of bacterial cells was superior in the bottom-fillable chamber compared to number of bacterial cells present in the overflow chamber by a factor of 1.5 to 3 times.
[0382] The embodiments described above are intended to be exemplary only. The scope of the invention is therefore intended to be limited solely by the appended claims.