NOVEL L-TRYPTOPHAN EXPORTER AND METHOD OF PRODUCING L-TRYPTOPHAN USING THE SAME

20200063219 ยท 2020-02-27

    Inventors

    Cpc classification

    International classification

    Abstract

    The present disclosure relates to a microorganism producing L-tryptophan in which the microorganism is modified such that a protein having an L-tryptophan-exporting activity comprising the amino acid sequence of SEQ ID NO: 1 is expressed, and a method for producing L-tryptophan using the microorganism.

    Claims

    1. A microorganism producing L-tryptophan, wherein the microorganism is modified such that a protein having an L-tryptophan-exporting activity comprising the amino acid sequence of SEQ ID NO: 1 is expressed.

    2. The microorganism according to claim 1, wherein the microorganism belongs to the genus Corynebacterium or the genus Escherichia.

    3. The microorganism according to claim 2, wherein the microorganism is Corynebacterium glutamicum or Escherichia coli.

    4. A method for producing L-tryptophan, comprising: culturing a microorganism producing L-tryptophan, wherein the microorganism is modified such that a protein having an L-tryptophan-exporting activity comprising the amino acid sequence of SEQ ID NO: 1 is expressed, in a medium; and recovering the L-tryptophan from the cultured microorganism or cultured medium.

    5. The method according to claim 4, wherein the microorganism belongs to the genus Corynebacterium or the genus Escherichia.

    6. The method according to claim 5, wherein the microorganism is Corynebacterium glutamicum or Escherichia coli.

    7. (canceled)

    8. (canceled)

    Description

    BRIEF DESCRIPTION OF DRAWINGS

    [0054] FIG. 1 shows the intracellular concentrations of tryptophan in CA04-8352 and CA04-8405, which are modified strains of Corynebacterium glutamicum, according to glucose consumption.

    DETAILED DESCRIPTION OF THE INVENTION

    [0055] Hereinafter, the present disclosure will be described in detail through exemplary embodiments. However, these exemplary embodiments are provided for the purpose of illustration only and are not intended to limit the scope of the present disclosure.

    Example 1: Screening and Selection of Exporting Genes

    [0056] As a result of a PSI-BLAST screen based on NCBI and KEGG databases with the amino acid sequence of YdeD (i.e., an EamA family derived from E. coli) as a query sequence, 30 candidate genes, which are considered as membrane proteins capable of exporting tryptophan, and bioorganisms possessing these genes were selected. Among them, 5 kinds of bioorganisms were selected in consideration of biosafety levels, which are applicable to producing strains, and availability as shown in Table 1 below.

    TABLE-US-00001 TABLE 1 Microorganisms expected to possess membrane protein capable of exporting aromatic amino acids Protein Genome Biosafety No. Strain Registration No. Registration No. Level 1 Herbaspirillum rhizosphaerae WP_050478745.1 NZ_LFLU01000012.1 1 (KCTC12558) 2 Pseudomonas stutzeri WP_037022429.1 NC_018177.1 1 (KCTC22466) 3 Alcaligenes faecalis WP_045930186.1 NZ_CP013119.1 1 (KCTC2678) 4 Cupriavidus necator WP_011616478.1 AM260480.1 1 (KCTC22469) 5 Escherichia coli str. WP_000198205.1 NC_000913.3 1 K-12 substr. MG1655

    Example 2: Preparation of Microorganism of the Genus Corynebacterium where Gene Derived from Herbaspirillum rhizosphaerae is Introduced

    [0057] The gene encoding the membrane protein derived from Herbaspirillum rhizosphaerae selected in Example 1 has the amino acid sequence of SEQ ID NO: 1. The information on the gene encoding the membrane protein and adjacent nucleotide sequences thereof (Registration No. NZ_LFLU01000012.1) was obtained from NIH GenBank.

    [0058] Primers to insert a gene derived from Herbaspirillum rhizosphaerae into the genomic DNA of Corynebacterium glutamicum were synthesized based on the obtained information of the nucleotide sequences. To amplify the gene derived from Herbaspirillum rhizosphaerae, PCR was performed using the chromosomal DNA of the Herbaspirillum rhizosphaerae strain as a template along with the primers of SEQ ID NO: 3 and SEQ ID NO: 4. Solg Pfu-X DNA polymerase was used as the polymerase, and PCR was performed as follows: denaturation at 95 C. for 2 minutes; 27 cycles of denaturation at 95 C. for 20 seconds, annealing at 62 C. for 40 seconds, and polymerization at 72 C. for 1 minute; and polymerization at 72 C. for 5 minutes.

    [0059] As a result, a 956 bp gene fragment which comprises the 924 bp gene (SEQ ID NO: 2) was obtained.

    TABLE-US-00002 (wex-1) SEQ ID NO: 3 TAGAGGAGACACAACATGAATAGCAAGAAGGCCAC (wex-2) SEQ ID NO: 4 ggctcttcctgtttAGTCTACAAACAGTCCGCCAC

    [0060] To obtain the gapA promoter derived from Corynebacterium glutamicum, PCR was performed using the genomic DNA of Corynebacterium glutamicum as a template along with the primers of SEQ ID NO: 5 and SEQ ID NO: 6. Solg Pfu-X DNA polymerase (SolGent Co., Ltd.) was used as the polymerase, and PCR was performed as follows: denaturation at 95 C. for 2 minutes; 27 cycles of denaturation at 95 C. for 20 seconds, annealing at 62 C. for 40 seconds, and polymerization at 72 C. for 30 seconds; and polymerization at 72 C. for 5 minutes.

    TABLE-US-00003 (PgapA-1) SEQ ID NO: 5 cccttccggtttAGTTTGAAGCCAGTGTGAGTTGC (PgapA(-wex)-2) SEQ ID NO: 6 CTTCTTGCTATTCATGTTGTGTCTCCTCTAAAGATTGTA

    [0061] The amplified gapA promoter region, the gene fragments derived from Herbaspirillum rhizosphaerae, and the pDZTn vector (KR Patent No. 10-1126041), which was cleaved with ScaI restriction enzyme, were cloned by the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL. 6 NO. 5, May 2009, NEBuilder HiFi DNA Assembly Master Mix), and thereby a recombinant plasmid was obtained. The recombinant plasmid was named as pDZTn-PgapA-Hrh. The cloning was performed by mixing the Gibson assembly reagent and each of the gene fragments in a calculated number of moles followed by incubating at 50 C. for 1 hour.

    [0062] The prepared pDZTn-PgapA-Hrh vector was transformed into a wild-type Corynebacterium glutamicum ATCC13869 strain by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541 to 545) and subjected to a secondary crossover to obtain a strain in which one copy of the PgapA-Hrh gene is inserted into transposon on the chromosome. The corresponding genetic manipulation was confirmed through genome sequencing and a PCR method using the primers of SEQ ID NO: 7 and SEQ ID NO: 8, each of which can respectively amplify the external region of the upstream region and downstream region of homologous recombination where the corresponding gene is inserted.

    TABLE-US-00004 (Confirm_PgapA-wex-1) SEQ ID NO: 7 CGGATTATGCCAATGATGTG (Confirm_PgapA-wex-2) SEQ ID NO: 8 CACGATCACCAACATTCAGG

    [0063] The thus-obtained strain was named as Corynebacterium glutamicum ATCC13869::PgapA-Hrh.

    Example 3: Preparation of Microorganism of the Genus Corynebacterium where Gene Derived from Pseudomonas stutzeri is Introduced

    [0064] The gene encoding the membrane protein derived from Pseudomonas stutzeri selected in Example 1 has the amino acid sequence of SEQ ID NO: 9. The information on the corresponding gene and adjacent nucleotide sequences thereof (Registration No. NC_018177.1) was obtained from NIH GenBank.

    [0065] Primers to insert a gene derived from Pseudomonas stutzeri into the genomic DNA of Corynebacterium glutamicum were synthesized based on the obtained information of the nucleotide sequences. To amplify the gene derived from Pseudomonas stutzeri, PCR was performed in the same manner as in Example 2 using the chromosomal DNA of the Pseudomonas stutzeri strain as a template along with the primers of SEQ ID NO: 11 and SEQ ID NO: 12.

    [0066] As a result, a 977 bp gene fragment which comprises the 945 bp exporter gene (SEQ ID NO: 10) was obtained.

    TABLE-US-00005 (Pst-1) SEQ ID NO: 11 TAGAGGAGACACAACATGAAAAACCAGCGTAAAGC (Pst-2) SEQ ID NO: 12 ggctcttcctgtttAGTTTATCCGTTTCGACGCGG

    [0067] For the use of gapA promoter derived from Corynebacterium glutamicum, PCR was performed in the same manner as in Example 2 using the genomic DNA of Corynebacterium glutamicum ATCC13869 as a template along with the primers of SEQ ID NO: 5 and SEQ ID NO: 13.

    TABLE-US-00006 (PgapA(-Pst)-2) SEQ ID NO: 13 ACGCTGGTTTTTCATGTTGTGTCTCCTCTAAAGATTGTA

    [0068] The amplified gapA promoter region, the gene fragments derived from Pseudomonas stutzeri, and the pDZTn vector, which was cleaved with ScaI restriction enzyme, were cloned by the Gibson assembly method, and thereby a recombinant plasmid was obtained. The recombinant plasmid was named as pDZTn-PgapA-Pst. The cloning was performed by mixing the Gibson assembly reagent and each of the gene fragments in a calculated number of moles followed by incubating at 50 C. for 1 hour.

    [0069] The prepared pDZTn-PgapA-Pst vector was transformed into a wild-type Corynebacterium glutamicum ATCC13869 strain by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541 to 545) and subjected to a secondary crossover to obtain a strain in which one copy of the PgapA-Pst gene is inserted into transposon on the chromosome. The corresponding genetic manipulation was confirmed through genome sequencing and PCR method using the primers of SEQ ID NO: 7 and SEQ ID NO: 8, each of which can respectively amplify the external region of the upstream region and downstream region of homologous recombination where the corresponding gene is inserted.

    [0070] The thus-obtained strain was named as Corynebacterium glutamicum ATCC13869::PgapA-Pst.

    Example 4: Preparation of Microorganism of the Genus Corynebacterium where Gene Derived from Alcaligenes faecalis is Introduced

    [0071] The gene encoding the membrane protein derived from Alcaligenes faecalis selected in Example 1 has the amino acid sequence of SEQ ID NO: 14. The information on the corresponding gene and adjacent nucleotide sequences thereof (Registration No. NZ_CP013119.1) was obtained from NIH GenBank.

    [0072] Primers to insert a gene derived from Alcaligenes faecalis into the genomic DNA of Corynebacterium glutamicum were synthesized based on the obtained information of the nucleotide sequences. To amplify the gene derived from Alcaligenes faecalis, PCR was performed in the same manner as in Example 2 using the chromosomal DNA of the Alcaligenes faecalis strain as a template along with the primers of SEQ ID NO: 16 and SEQ ID NO: 17.

    [0073] As a result, a 943 bp gene fragment which comprises the 912 bp exporter gene (SEQ ID NO: 15) was obtained.

    TABLE-US-00007 (Afa-1) SEQ ID NO: 16 TAGAGGAGACACAACATGAAGCAATCTGATAAGGC (Afa-2) SEQ ID NO: 17 gctcttcctgtttAGTTCAGGCAGCGCTTTTTAGT

    [0074] To obtain the gapA promoter derived from Corynebacterium glutamicum, PCR was performed in the same manner as in Example 2 using the genomic DNA of Corynebacterium glutamicum as a template along with the primers of SEQ ID NO: 5 and SEQ ID NO: 18.

    TABLE-US-00008 (PgapA(-Afa)-2) SEQ ID NO: 18 ATCAGATTGCTTCATGTTGTGTCTCCTCTAAAGATTGTA

    [0075] The amplified gapA promoter region, gene fragments derived from Alcaligenes faecalis, and the pDZTn vector, which was cleaved with ScaI restriction enzyme, were cloned by the Gibson assembly method, and thereby a recombinant plasmid was obtained. The recombinant plasmid was named as pDZTn-PgapA-Afa. The cloning was performed by mixing the Gibson assembly reagent and each of the gene fragments in a calculated number of moles followed by incubating at 50 C. for 1 hour.

    [0076] The prepared pDZTn-PgapA-Afa vector was transformed into a wild-type Corynebacterium glutamicum ATCC13869 strain by electroporation and subjected to a secondary crossover to obtain a strain in which one copy of the PgapA-Afa gene is inserted into transposon on the chromosome. The corresponding genetic manipulation was confirmed through genome sequencing and PCR method using the primers of SEQ ID NO: 7 and SEQ ID NO: 8, each of which can respectively amplify the external region of the upstream region and downstream region of homologous recombination where the corresponding gene is inserted.

    [0077] The thus-obtained strain was named as Corynebacterium glutamicum ATCC13869::PgapA-Afa.

    Example 5: Preparation of Microorganism of the Genus Corynebacterium where Gene Derived from Cupriavidus Necator is Introduced

    [0078] The gene encoding the membrane protein derived from Cupriavidus necator selected in Example 1 has the amino acid sequence of SEQ ID NO: 19. The information on the corresponding gene and adjacent nucleotide sequences thereof (Registration No. AM260480.1) was obtained from NIH GenBank.

    [0079] Primers to insert a gene derived from Cupriavidus necator into the genomic DNA of Corynebacterium glutamicum were synthesized based on the obtained information of the nucleotide sequences. To amplify the gene derived from Cupriavidus necator, PCR was performed in the same manner as in Example 2 using the chromosomal DNA of the Cupriavidus necator strain as a template along with the primers of SEQ ID NO: 21 and SEQ ID NO: 22.

    [0080] As a result, a 977 bp gene fragment which comprises the 945 bp exporter gene derived from Cupriavidus necator (SEQ ID NO: 20) was obtained.

    TABLE-US-00009 (Cne-1) SEQ ID NO: 21 TAGAGGAGACACAACATGCAAAGCAAGAGCAAAGC (Cne-2) SEQ ID NO: 22 ggctcttcctgtttAGTTCACGGTTCCTGGACACG

    [0081] To obtain the gapA promoter derived from Corynebacterium glutamicum, PCR was performed in the same manner as in Example 2 using the genomic DNA of Corynebacterium glutamicum as a template along with the primers of SEQ ID NO: 5 and SEQ ID NO: 23.

    TABLE-US-00010 (PgapA(-Cne)-2) SEQ ID NO: 23 GCTCTTGCTTTGCATGTTGTGTCTCCTCTAAAGATTGTA

    [0082] The amplified gapA promoter region, gene fragments derived from Cupriavidus necator, and the pDZTn vector, which was cleaved with ScaI restriction enzyme, were cloned by the Gibson assembly method, and thereby a recombinant plasmid was obtained. The recombinant plasmid was named as pDZTn-PgapA-Cne. The cloning was performed by mixing the Gibson assembly reagent and each of the gene fragments in a calculated number of moles followed by incubating at 50 C. for 1 hour.

    [0083] The prepared pDZTn-PgapA-Cne vector was transformed into a wild-type Corynebacterium glutamicum ATCC13869 strain by electroporation and subjected to a secondary crossover to obtain a strain in which one copy of the PgapA-Cne gene is inserted between transposon genes on the chromosome. The corresponding genetic manipulation was confirmed through genome sequencing and a PCR method using the primers of SEQ ID NO: 7 and SEQ ID NO: 8, each of which can respectively amplify the external region of the upstream region and downstream region of homologous recombination where the corresponding gene is inserted.

    [0084] The thus-obtained strain was named as Corynebacterium glutamicum ATCC13869::PgapA-Cne.

    Example 6: Preparation of Microorganism of the Genus Corynebacterium where Gene Derived from Escherichia coli Str. K-12 Substr. MG1655 is Introduced

    [0085] The gene encoding the membrane protein derived from Escherichia coli str. K-12 substr. MG1655 selected in Example 1 has the amino acid sequence of SEQ ID NO: 24. The information on the corresponding gene and adjacent nucleotide sequences thereof (Registration No. NC_000913.3) was obtained from NIH GenBank.

    [0086] Primers to insert a gene derived from Escherichia coli into the genomic DNA of Corynebacterium glutamicum were synthesized based on the obtained information of the nucleotide sequences. To amplify the gene derived from Escherichia coli, PCR was performed in the same manner as in Example 2 using the chromosomal DNA of the Escherichia coli strain as a template along with the primers of SEQ ID NO: 26 and SEQ ID NO: 27.

    [0087] As a result, a 913 bp gene fragment which comprises the 882 bp exporter gene (SEQ ID NO: 25) was obtained.

    TABLE-US-00011 (Eco-1) SEQ ID NO: 26 TAGAGGAGACACAACATGACACGACAAAAAGCAAC (Eco-2) SEQ ID NO: 27 gctcttcctgtttAGTTTAACCACGACGTGTCGCC

    [0088] To obtain the gapA promoter derived from Corynebacterium glutamicum, PCR was performed in the same manner as in Example 2 using the genomic DNA of Corynebacterium glutamicum as a template along with the primers of SEQ ID NO: 5 and SEQ ID NO: 28.

    TABLE-US-00012 (PgapA(-Eco)-2) SEQ ID NO: 28 TTTTTGTCGTGTCATGTTGTGTCTCCTCTAAAGATTG

    [0089] The amplified gapA promoter region, gene fragments derived from Escherichia coli, and the pDZTn vector, which was cleaved with ScaI restriction enzyme, were cloned by the Gibson assembly method, and thereby a recombinant plasmid was obtained. The recombinant plasmid was named as pDZTn-PgapA-Eco. The cloning was performed by mixing the Gibson assembly reagent and each of the gene fragments in a calculated number of moles followed by incubating at 50 C. for 1 hour.

    [0090] The prepared pDZTn-PgapA-Eco vector was transformed into a wild-type Corynebacterium glutamicum ATCC13869 strain by electroporation and subjected to a secondary crossover to obtain a strain in which one copy of the PgapA-Eco gene is inserted between transposon genes on the chromosome. The corresponding genetic manipulation was confirmed through genome sequencing and a PCR method using the primers of SEQ ID NO: 7 and SEQ ID NO: 8, each of which can respectively amplify the external region of the upstream region and downstream region of homologous recombination where the corresponding gene is inserted.

    [0091] The thus-obtained strain was named as Corynebacterium glutamicum ATCC13869::PgapA-Eco.

    Example 7: Measurement of MICs in Microorganism Strains of the Genus Corynebacterium where Gene Derived from Various Microorganisms are Introduced

    [0092] To confirm the presence of tryptophan-exporting activity in the 5 types of Corynebacterium glutamicum strains prepared in Examples 2 to 6 (i.e., ATCC13869::PgapA-Hrh, ATCC13869::PgapA-Pst, ATCC13869::PgapA-Afa, ATCC13869::PgapA-Cne, and ATCC13869::PgapA-Eco), the minimum inhibitory concentration (MIC) experiment was performed using a tryptophan analogue and an analogue of phenylalanine (i.e., another aromatic amino acid). The 5 different strains of Corynebacterium glutamicum, each introduced with a gene encoding a membrane protein, were cultured in the minimal liquid medium at 30 C. for 24 hours, diluted to a concentration of 310.sup.3 cells and 310.sup.4 cells, respectively, and then spotting-cultured in minimal solid medium where a tryptophan analogue and a phenylalanine analogue is added.

    [0093] For the minimum inhibitory concentration (MIC) experiment, p-fluoro-DL-phenylalanine (2.5 mg/mL) or 5-fluoro-DL-tryptophan (0.25 g/mL) was added to the minimal solid medium, and the cell growth was observed after 60 hours (Table 2).

    [0094] All of the introductions of the selected 5 types of genes enabled cell growth under a condition where the phenylalanine analogue was added at a concentration of 2.5 mg/mL. Among them, the introduction of genes derived from Herbaspirillum rhizosphaerae, Alcaligenes faecalis, and Escherichia coli showed the highest cell growth. The introduction of the gene derived from Pseudomonas stutzeri showed slightly reduced cell growth and the introduction of the gene derived from Cupriavidus necator showed the lowest cell growth. Under the same condition, the wild-type ATCC13869 strain did not grow. Additionally, under the condition where the tryptophan analogue was added at a concentration of 0.25 g/mL, only the introduction of the gene derived from Herbaspirillum rhizosphaerae enabled cell growth.

    [0095] From the above results, it was observed that all of the introductions of the selected 5 types of genes showed resistance to phenylalanine and the phenylalanine analogue even though there were differences in activities among the introductions. In contrast, with regard to tryptophan and the tryptophan analogue, only the introduction of the gene derived from Herbaspirillum rhizosphaera showed specific and excellent resistance thereto. Based on these results, it can be interpreted that only the membrane protein encoded by the gene derived from Herbaspirillum rhizosphaera can act as an exporter protein for tryptophan.

    [0096] Minimal Medium (pH 7.2)

    [0097] Glucose 10 g, KH.sub.2PO.sub.4 1 g, K.sub.2HPO.sub.4 2 g, MgSO.sub.4 7H.sub.2O 0.4 g, Urea 2 g, (NH.sub.4).sub.2SO.sub.4 5 g, NaCl 0.5 g, Nicotinamide 5 g, Calcium pantothenate 0.1 g, Biotin 0.2 g, Thiamine HCl 3 g, Trace elements solution 1 mL (based on 1 L of distilled water)

    [0098] Trace Elements Solution

    [0099] Na.sub.2B.sub.4O.sub.7 10H.sub.2O 0.09 g, (NH.sub.4).sub.6Mo.sub.7O.sub.27 4H.sub.2O 0.04 g, ZnSO.sub.4 7H.sub.2O 0.01 g, CuSO.sub.4 5H.sub.2O 0.27 g, MnCl.sub.2 4H.sub.2O 0.01 g, FeCl.sub.3 6H.sub.2O 1 g, CaCl.sub.2 0.01 g (based on 1 L of distilled water)

    TABLE-US-00013 TABLE 2 Growth of Corynebacterium glutamicum strains, in which genes derived from various microorganisms are introduced, in minimal medium containing a phenylalanine analogue or tryptophan analogue Growth 5-Fluoro p-Fluoro phenylalanine tryptophan Strain (2.5 mg/mL) (0.25 g/mL) ATCC13869 ATCC13869::PgapA-Hrh ++ +++ ATCC13869::PgapA-Pst ++ ATCC13869::PgapA-Afa +++ ATCC13869::PgapA-Cne + ATCC13869::PgapA-Eco +++

    Example 8: Preparation of Expression Vector for Escherichia coli in which Genes Derived from Various Microorganisms are Introduced

    [0100] To confirm the resistance of the genes derived from various microorganisms selected in Example 1 to tryptophan or an analogue thereof in Escherichia coli, each of the genes was cloned into pCL1920 (i.e., an E. coli expression vector) and expressed with the yccA promoter of E. coli W3110.

    [0101] To obtain a fragment of the gene derived from Herbaspirillum rhizosphaerae, PCR was performed using the chromosomal DNA of the Herbaspirillum rhizosphaerae strain as a template along with the primers of SEQ ID NO: 29 and SEQ ID NO: 30. Solg Pfu-X DNA polymerase (SolGent Co., Ltd.) was used as the polymerase, and PCR was performed as follows: denaturation at 95 C. for 2 minutes; 27 cycles of denaturation at 95 C. for 20 seconds, annealing at 62 C. for 40 seconds, and polymerization at 72 C. for 1 minute; and polymerization at 72 C. for 5 minutes.

    TABLE-US-00014 (Hrh-3) SEQ ID NO: 29 ATAGAGAGTGACTCAATGAATAGCAAGAAGGCCAC (Hrh-4) SEQ ID NO: 30 TCGAGCTCGGTACCCCTACAAACAGTCCGCCAC

    [0102] To obtain the yccA promoter derived from E. coli W3110, PCR was performed using the genomic DNA of the E. coli W3110 as a template along with the primers of SEQ ID NO: 31 and SEQ ID NO: 32. Solg Pfu-X DNA polymerase (SolGent Co., Ltd.) was used as the polymerase, and PCR was performed as follows: denaturation at 95 C. for 2 minutes; 27 cycles of denaturation at 95 C. for 20 seconds, annealing at 62 C. for 40 seconds, and polymerization at 72 C. for 10 seconds; and polymerization at 72 C. for 5 minutes.

    TABLE-US-00015 (PyccA-1) SEQ ID NO: 31 CTCTAGAGGATCCCCTTCCAGATCAAATGCGTAA (PyccA(-Hrh)-2) SEQ ID NO: 32 CTTCTTGCTATTCATTGAGTCACTCTCTATGACAG

    [0103] The amplified yccA promoter region, gene fragments derived from Herbaspirillum rhizosphaerae, and the pCL1920 vector (pSC101 ori, Sp.sup.r), which was cleaved with SmaI restriction enzyme, were cloned by the Gibson assembly method, and thereby a recombinant plasmid was obtained. The recombinant plasmid was named as pCL1920-PyccA-Hrh. The cloning was performed by mixing the Gibson assembly reagent and each of the gene fragments in a calculated number of moles followed by incubating at 50 C. for 1 hour. The obtained pCL1920-PyccA-Hrh was introduced into the wild-type E. coli W3110, and thereby W3110/pCL1920-PyccA-Hrh (i.e., a transformant where the gene is expressed) was prepared.

    [0104] To obtain a fragment of the gene derived from Pseudomonas stutzeri, PCR was performed using the chromosomal DNA of the Pseudomonas stutzeri strain as a template along with the primers of SEQ ID NO: 33 and SEQ ID NO: 34. Additionally, PCR was performed in the same manner as in obtaining the gene fragment from Herbaspirillum rhizosphaerae strain described above except that the primer of SEQ ID NO: 35, which was used to obtain the yccA promoter derived from E. coli W3110 for use, was used.

    TABLE-US-00016 (Pst-3) SEQ ID NO: 33 ATAGAGAGTGACTCAATGAAAAACCAGCGTAAAGC (Pst-4) SEQ ID NO: 34 TCGAGCTCGGTACCCTTATCCGTTTCGACGCGG (PyccA(-Pst)-2) SEQ ID NO: 35 ACGCTGGTTTTTCATTGAGTCACTCTCTATGACAG

    [0105] As such, the recombinant plasmid was obtained and it was named as pCL1920-PyccA-Pst. The expression vector pCL1920-PyccA-Pst was transformed into wild-type E. coli W3110, and thereby W3110/pCL1920-PyccA-Pst (i.e., a transformant where the gene is expressed) was prepared.

    [0106] The process of preparing a transformant, where the gene derived from Alcaligenes faecalis strain is expressed, was the same as described above except that PCR was performed using the chromosomal DNA of Alcaligenes faecalis as a template along with the primers of SEQ ID NO: 36 and SEQ ID NO: 37, and the primer of SEQ ID NO: 38 for obtaining the yccA promoter were used.

    TABLE-US-00017 (Afa-3) SEQ ID NO: 36 ATAGAGAGTGACTCAATGAAGCAATCTGATAAGGC (Afa-4) SEQ ID NO: 37 TCGAGCTCGGTACCCTCAGGCAGCGCTTTTTAGT (PyccA(-Afa)-2) SEQ ID NO: 38 ATCAGATTGCTTCATTGAGTCACTCTCTATGACAG

    [0107] As such, a recombinant plasmid into which the gene derived from Alcaligenes faecalis is cloned was obtained and named as pCL1920-PyccA-Afa. The expression vector pCL1920-PyccA-Afa was transformed into the wild-type E. coli W3110, and thereby W3110/pCL1920-PyccA-Afa (i.e., a transformant) was prepared.

    [0108] To obtain a fragment of the gene derived from Cupriavidus necator strain, PCR was performed using the chromosomal DNA of the Cupriavidus necator strain as a template along with the primers of SEQ ID NO: 39 and SEQ ID NO: 40. Additionally, PCR was performed in the same manner as in obtaining the gene fragment from Herbaspirillum rhizosphaerae strain described above except that the primer of SEQ ID NO: 41, which was used to obtain the yccA promoter derived from E. coli W3110 for use, was used.

    TABLE-US-00018 (Cne-3) SEQ ID NO: 39 ATAGAGAGTGACTCAATGCAAAGCAAGAGCAAAGC (Cne-4) SEQ ID NO: 40 TCGAGCTCGGTACCCTCACGGTTCCTGGACACG (PyccA(-Cne)-2) SEQ ID NO: 41 GCTCTTGCTTTGCATTGAGTCACTCTCTATGACAG

    [0109] As such, a recombinant plasmid was obtained and named as pCL1920-PyccA-Cne. The expression vector pCL1920-PyccA-Cne was transformed into the wild-type E. coli W3110, and thereby W3110/pCL1920-PyccA-Cne (i.e., a transformant where the gene is expressed) was prepared.

    [0110] To obtain a fragment of the gene derived from Escherichia coli strain, PCR was performed using the chromosomal DNA of the Escherichia coli str. K-12 substr. MG1655 strain as a template along with the primers of SEQ ID NO: 42 and SEQ ID NO: 43. Additionally, PCR was performed in the same manner as in obtaining the gene fragment from Herbaspirillum rhizosphaerae strain described above except that the primer of SEQ ID NO: 44, which was used to obtain the yccA promoter derived from E. coli W3110 for use, was used.

    TABLE-US-00019 (Eco-3) SEQ ID NO: 42 ATAGAGAGTGACTCAATGACACGACAAAAAGCAAC (Eco-4) SEQ ID NO: 43 TCGAGCTCGGTACCCTTAACCACGACGTGTCGCC (PyccA(-Eco)-2) SEQ ID NO: 44 TTTTTGTCGTGTCATTGAGTCACTCTCTATGACAG

    [0111] As such, a recombinant plasmid was obtained and named as pCL1920-PyccA-Eco. The expression vector pCL1920-PyccA-Eco was introduced into the wild-type E. coli W3110, and thereby W3110/pCL1920-PyccA-Cne (i.e., a transformant where the gene is expressed) was prepared.

    Example 9: Measurement of MIC of E. coli in which Genes for Membrane Proteins Derived from Various Microorganisms are Overexpressed

    [0112] To confirm the resistance of E. coli strains where the 5 types of genes prepared in Example 8 are overexpressed (i.e., W3110/pCL1920-PyccA-Hrh, W3110/pCL1920-PyccA-Pst, W3110/pCL1920-PyccA-Afa, W3110/pCL1920-PyccA-Cne, and W3110/pCL1920-PyccA-Eco), the minimum inhibitory concentration (MIC) experiment was performed using a tryptophan analogue and a phenylalanine analogue. The E. coli strains where the 5 types of genes are overexpressed were cultured in M9 minimal liquid medium containing spectinomycin (50 g/mL) at 37 C. for 15 hours, diluted at concentrations of 10.sup.4 cells and 10.sup.5 cells, respectively, and then spotting-cultured in M9 glucose minimal solid medium containing spectinomycin (50 g/mL) where a tryptophan analogue or a phenylalanine analogue was added. For the minimum inhibitory concentration (MIC) experiment, p-fluoro-DL-phenylalanine (2 mg/mL) or 5-fluoro-DL-tryptophan (0.7 g/mL) was added to the M9 minimal solid medium, and the cell growth was observed after 48 hours (Table 3).

    [0113] E. coli strains showed excellent growth under the condition where the phenylalanine analogue was added when the genes derived from E. coli were overexpressed, and the overexpression of the gene derived from Alcaligenes faecalis also showed significant growth. However, the overexpression of the genes derived from Herbaspirillum rhizosphaerae, Pseudomonas stutzeri, and Cupriavidus necator failed to show comparable growth as in W3110/pCL1920 (i.e., the control group). In contrast, the overexpression of all of the 5 types of selected genes made it possible to grow all of the cells under the condition where the tryptophan analogue was added. Among them, the overexpression of the gene derived from Herbaspirillum rhizosphaerae showed the highest growth, and the overexpression of the exporter genes derived from Alcaligenes faecalis and E. coli showed the second highest growth. The overexpression of the exporter genes derived from Pseudomonas stutzeri and Cupriavidus necator showed negligible growth.

    [0114] The results of the MIC experiment about the 5 types of genes in E. coli strain were similar to that in C. glutamincum. The gene derived from Herbaspirillum rhizosphaerae showed specific and excellent resistance to tryptophan and its analogue in both Corynebacterium glutamicum and E. coli strains, and the exporter gene derived from E. coli showed higher resistance of exportation to phenylalanine and its analogue than to tryptophan. From these results, it was suggested that the gene derived from Herbaspirillum rhizosphaerae shows a specific and excellent exporting ability for tryptophan in both Corynebacterium glutamicum and E. coli strains.

    TABLE-US-00020 TABLE 3 Growth of E. coli strains where each gene is overexpressed in a minimal medium containing a phenylalanine analogue or a tryptophan analogue Growth 5-Fluoro p-Fluorophenylalanine tryptophan Strain (2.5 mg/mL) (0.7 g/mL) W3110/pCL 1920 W3110/pCL 1920-Py ccA-Hrh ++++ W3110/pCL 1920-Py ccA-Pst + W3110/pCL 1920-Py ccA-Afa ++ ++ W3110/pCL 1920-Py ccA-Cne + W3110/pCL 1920-Py ccA-Eco +++ ++

    Reference Example 1: Preparation of Microorganism of the Genus Corynebacterium glutamicum Producing L-Tryptophan

    [0115] The L-tryptophan-producing strains were developed from wild-type Corynebacterium glutamicum ATCC13869. Since the wild-type Corynebacterium glutamicum cannot produce L-tryptophan, or if possible, can produce only a very small amount, an attempt was made to use the strain where the biosynthesis pathway essential for the production of L-tryptophan was enhanced as the parent strain. Specifically, the expression of the operon of L-tryptophan biosynthetic genes were increased by enhancing the promoter. Additionally, to release the feedback inhibition of the TrpE protein, the 38th amino acid of trpE (i.e., serine) was substituted with arginine (Journal of Bacteriology, November 1987, p. 5330 to 5332).

    [0116] For the above genetic manipulation, first, the upstream region of the trpE promoter and the downstream region of the 38.sup.th amino acid mutation of trpE were obtained for homologous recombination on the chromosome. Specifically, the genetic fragment of the upstream region of the trpE promoter was obtained by performing PCR using the chromosomal DNA of Corynebacterium glutamicum as a template along with the primers of SEQ ID NO: 45 and SEQ ID NO: 46, whereas the genetic fragment of the downstream region of the 38th amino acid mutation of trpE was obtained by performing PCR using the chromosomal DNA of Corynebacterium glutamicum as a template along with the primers of SEQ ID NO: 47 and SEQ ID NO: 48.

    TABLE-US-00021 (Pspl7-trpE(S38R)_L-1) SEQ ID NO: 45 TCGAGCTCGGTACCCAAACAACTGCGACGTGTGTC (Pspl7-trpE(S38R)_L-2) SEQ ID NO: 46 CATGAAGCGCCGGTACCTTAATCATTTTTGGGTTC (Pspl7-trpE(S38R)_R-1) SEQ ID NO: 47 GCCCTGTTGGAACGCGCTGATATCACCACCAAGAA (Pspl7-trpE(S38R)_R-2) SEQ ID NO: 48 CTCTAGAGGATCCCCAGATGTCACCGTTGTAAATG

    [0117] Sole Pfu-X DNA polymerase (SolGent Co., Ltd.) was used as the polymerase, and PCR was performed as follows: denaturation at 95 C. for 5 minutes; 30 cycles of denaturation at 95 C. for 30 seconds, annealing at 60 C. for 30 seconds, and polymerization at 72 C. for 60 seconds; and polymerization at 72 C. for 5 minutes.

    [0118] The PCR was performed using the synthesized promoter SPL7 (SEQ ID NO: 49) as a template along with the primers of SEQ ID NO: 50 and SEQ ID NO: 51.

    TABLE-US-00022 (Pspl7-1) SEQ ID NO: 50 CCCAAAAATGATTAAGGTACCGGCGCTTCATGTCA (Pspl7-2) SEQ ID NO: 51 GGGATTCGTGCTCATGATATCTGTTTTGATCTCCTCC

    [0119] Sole Pfu-X DNA polymerase (SolGent Co., Ltd.) was used as the polymerase, and PCR was performed as follows: denaturation at 95 C. for 5 minutes; 30 cycles of denaturation at 95 C. for 30 seconds, annealing at 60 C. for 30 seconds, and polymerization at 72 C. for 30 seconds; and polymerization at 72 C. for 5 minutes.

    [0120] To obtain the fragment of front sequences of trpE, including from 1.sup.st to the 38.sup.th amino acid mutation, derived from Corynebacterium glutamicum, PCR was performed using the genomic DNA of Corynebacterium glutamicum as a template along with the primers of SEQ ID NO: 52 and SEQ ID NO: 53.

    TABLE-US-00023 (trpE (S38R)-1) SEQ ID NO: 52 ATCAAAACAGATATCATGAGCACGAATCCCCATGT (trpE (S38R)-2) SEQ ID NO: 53 GTGGTGATATCAGCGCGTTCCAACAGGGCTGCATC

    [0121] Solg Pfu-X DNA polymerase (SolGent Co., Ltd.) was used as the polymerase, and PCR was performed as follows: denaturation at 95 C. for 5 minutes; 30 cycles of denaturation at 95 C. for 30 seconds, annealing at 60 C. for 30 seconds, and polymerization at 72 C. for 30 seconds; and polymerization at 72 C. for 5 minutes.

    [0122] A recombinant plasmid was obtained by cloning the amplified upstream region of the trpE promoter and the downstream region of the 38.sup.th amino acid mutation of trpE, the SPL7 promoter and the fragment of front sequence of trpE, and the pDZ vector which is cleaved by SmaI restriction enzyme using the Gibson assembly method. The recombinant plasmid was named as pDZ-PSPL7-trpE (S38R). The cloning was performed by mixing the Gibson assembly reagent and each of the gene fragments in a calculated number of moles followed by incubating at 50 C. for 1 hour.

    [0123] The prepared pDZ-PSPL7-trpE (S38R) vector was transformed into the Corynebacterium glutamicum ATCC13869 strain by electroporation and subjected to a secondary crossover. Then a strain which a promoter of the trpE is replaced with SPL7 promoter (i.e., a stronger promoter) and the 38th amino acid of trpE (i.e., serine) is substituted with arginine on the chromosome was obtained. The corresponding genetic manipulation was confirmed through genome sequencing and a PCR method using the primers of SEQ ID NO: 54 and SEQ ID NO: 55, which can amplify the upstream region and downstream region of homologous recombination where the gene is inserted, and the resulting strain was named as CA04-8325.

    TABLE-US-00024 (Confirm_Pspl7-trpE(S38R)-1) SEQ ID NO: 54 GAAGAAGAGGCTGCAGATG (Confirm_Pspl7-trpE(S38R)-2) SEQ ID NO: 55 GATCAGCGCCATCATGTT

    [0124] Tryptophan production occurs via the aromatic amino acid metabolic pathway, and this metabolic pathway starts from the condensation reaction between phosphoenolpyruvate and erythrose 4-phosphate. Accordingly, a smooth supply of these two precursors is essential for the production of tryptophan, and the overexpression of the tkt gene was performed for the smooth supply of erythrose 4-phosphate, which is known to be relatively deficient.

    [0125] For the above genetic manipulation, PCR was performed using the chromosomal DNA of Corynebacterium glutamicum as a template along with the primers of SEQ ID NO: 56 and SEQ ID NO: 57 to obtain the upstream region for the additional insertion of the tkt gene, and along with the primers of SEQ ID NO: 58 and SEQ ID NO: 59 to obtain the downstream region for the additional insertion of the tkt gene.

    TABLE-US-00025 (Pn-tkt_L-1) SEQ ID NO: 56 TCGAGCTCGGTACCCAAACTTTGAGTGGGTGCGTG (Pn-tkt_L-2) SEQ ID NO: 57 TCGAGCTACGAGGGCGGTTCCCAGCCCTTCATTAG (Pn-tkt_R-1) SEQ ID NO: 58 ATTAACGGTTAATTGATTCTGGACGTCATGACTAC (Pn-tkt_R-2) SEQ ID NO: 59 CTCTAGAGGATCCCCGCCTCGATGATGCAGTCGTC

    [0126] Solg Pfu-X DNA polymerase was used as the polymerase, and PCR was performed as follows: denaturation at 95 C. for 2 minutes; 27 cycles of denaturation at 95 C. for 20 seconds, annealing at 62 C. for 40 seconds, and polymerization at 72 C. for 30 seconds; and polymerization at 72 C. for 5 minutes.

    [0127] To obtain the tkt gene and its promoter, PCR was performed using the chromosomal DNA of wild-type Corynebacterium glutamicum ATCC13869 as a template along with the primers of SEQ ID NO: 60 and SEQ ID NO: 61, and thereby the tkt gene comprising its promoter was obtained.

    TABLE-US-00026 (Pn-tkt-1) SEQ ID NO: 60 GAAGGGCTGGGAACCGCCCTCGTAGCTCGAGAGTT (Pn-tkt-2) SEQ ID NO: 61 CATGACGTCCAGAATCAATTAACCGTTAATGGAGTCC

    [0128] Solg Pfu-X DNA polymerase was used as the polymerase, and PCR was performed as follows: denaturation at 95 C. for 2 minutes; 27 cycles of denaturation at 95 C. for 20 seconds, annealing at 62 C. for 40 seconds, and polymerization at 72 C. for 1 minute and 20 seconds; and polymerization at 72 C. for 5 minutes.

    [0129] A recombinant plasmid was obtained by cloning the amplified upstream region for the additional insertion of the tkt gene and downstream region for the additional insertion of the tkt gene, the tkt gene comprising tkt promoter, and the pDZ vector for chromosomal transformation, which is cleaved by SmaI restriction enzyme using the Gibson assembly method, and the resultant recombinant plasmid was named as pDZ-Pn-tkt. The cloning was performed by mixing the Gibson assembly reagent and each of the gene fragments in a calculated number of moles followed by incubating at 50 C. for 1 hour.

    [0130] The prepared pDZ-Pn-tkt vector was transformed into the CJ04-8325 strain by electroporation and subjected to a secondary crossover to obtain a strain in which the tkt gene comprising tkt promoter is inserted on the chromosome. The corresponding genetic manipulation was confirmed through genome sequencing and a PCR method using the primers of SEQ ID NO: 62 and SEQ ID NO: 63, which can respectively amplify the external region of the upstream region and downstream region of homologous recombination where the corresponding gene is inserted. The resulting strain was named as CA04-8352.

    TABLE-US-00027 (Confirm_Pn-tkt-1) SEQ ID NO: 62 ACCCAGAACCCCAAATTTTC (Confirm_Pn-tkt-2) SEQ ID NO: 63 TTGAGTTCGACAACTTTGG

    Example 10: Tryptophan Production by Microorganism of the Genus Corynebacterium where Genes Derived from Herbaspirillum rhizosphaerae and E. coli are Introduced

    [0131] The gene derived from Herbaspirillum rhizosphaerae, which showed excellent activity in the minimum inhibitory concentration of the tryptophan analogue in Example 7, was introduced into CA04-8352, which is a tryptophan-producing strain prepared in Reference Example 1. For this purpose, the pDZTn-PgapA-Hrh vector for the introduction of the gene derived from Herbaspirillum rhizosphaerae prepared in Example 2 was transformed into CA04-8352 (i.e., a tryptophan-producing strain) by electroporation and subjected to the process as in Example 2, and thereby a strain was obtained in which one copy of the gene derived from Herbaspirillum rhizosphaerae is inserted between transposon genes. The resulting strain was named as CA04-8405.

    [0132] Additionally, the gene derived from E. coli was introduced into the CA04-8352 (i.e., a tryptophan-producing strain) as the control group. The pDZTn-PgapA-Eco vector for the introduction of the gene derived from E. coli prepared in Example 6 was transformed into CA04-8352 (i.e., a tryptophan-producing strain) by electroporation and subjected to the process as in Example 6, and thereby a strain was obtained in which one copy of the gene derived from E. coli is inserted between transposon genes. The resulting strain was named as CA04-8406.

    [0133] The strains CA04-8405 and CA04-8406 obtained by the processes described above were cultured by the following method so as to confirm the amount of tryptophan production relative to the CA04-8352 strain prepared in Reference Example 1 as the control group. Each strain was inoculated into a 250 mL corner-baffle flask containing seed medium (25 mL) and cultured with shaking at 30 C. at 200 rpm for 20 hours. Then, each seed culture solution (1 mL) was inoculated into a 250 mL corner-baffle flask containing production medium (25 mL) and cultured with shaking at 30 C. at 200 rpm for 24 hours. Upon completion of the cultivation, the amount of L-tryptophan production was measured by HPLC.

    [0134] Seed Medium (pH 7.0)

    [0135] glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH.sub.2PO.sub.4 4 g, K.sub.2HPO.sub.4 8 g, MgSO.sub.4 7H.sub.2O 0.5 g, biotin 100 g, thiamine HCl 1,000 g, calcium pantothenate 2,000 g, nicotinamide 2,000 g (based on 1 L of distilled water)

    [0136] Production Medium (pH 7.0)

    [0137] glucose 30 g, (NH.sub.4).sub.2SO.sub.4 15 g, MgSO.sub.4 7H.sub.2O 1.2 g, KH.sub.2PO.sub.4 1 g, yeast extract 5 g, biotin 900 g, thiamine HCl 4,500 g, calcium pantothenate 4,500 g, CaCO.sub.3 30 g (based on 1 L of distilled water)

    TABLE-US-00028 TABLE 4 Confirmation of amount of L-tryptophan production by CA04-8352 (a Corynebacterium glutamicum strain producing L-tryptophan), CA04-8405 (a strain where a gene derived from Herbaspirillum rhizosphaerae is inserted), and CA04-8406 (a strain where a gene derived from E. coli is inserted) Amount of Tryptophan Tryptophan Production Yield OD.sub.562 (g/L) (*100 g/g, %) CA04-8352 56.5 0.25 0.83 CA04-8405 52.3 1.52 5.07 CA04-8406 56.1 0.24 0.80

    [0138] The results of the L-tryptophan production CA04-8352, CA04-8405, and CA04-8406 strains in the medium are shown in Table 4 above.

    [0139] The CA04-8405 strain in which the gene derived from Herbaspirillum rhizosphaerae is introduced produced L-tryptophan at a final concentration of 1.52 g/L in flask cultivation, and this is an improvement of about 5-fold compared to that of the CA04-8352 strain, the control group. This indicates that the gene derived from Herbaspirillum rhizosphaerae significantly improves L-tryptophan production in a Corynebacterium glutamicum strain. In contrast, the CA04-8406 strain, in which an E. coli-derived gene was introduced, produced L-tryptophan at a concentration of 0.23 g/L, which is almost the same as the amount of L-tryptophan production by the CA04-8352 strain (i.e., the parent strain of the CA04-8406 strain). As confirmed in the minimum inhibitory concentration (MIC) experiment of the tryptophan analogue and the phenylalanine analogue confirmed in Examples 7 and 9, the gene derived from E. coli is considered to be an exporter gene that shows higher specificity to phenylalanine than to tryptophan.

    [0140] The CA04-8405 strain was internationally deposited at the Korean Culture Center of Microorganisms (KCCM), an international depositary, on Aug. 21, 2017, under the provisions of the Budapest Treaty and assigned accession number KCCM12099P (CA04-8405).

    Example 11: Analysis of Intracellular Tryptophan Metabolites in Corynebacterium glutamicum where a Gene Derived from Herbaspirillum rhizosphaerae is Introduced

    [0141] To explicitly confirm whether the intracellular tryptophan concentration decreased as the tryptophan-exporting ability of the CA04-8405 strain (i.e., a tryptophan-producing strain) improved, the intracellular tryptophan concentration was measured for the CA04-8405 strain and its parent strain (i.e., CA04-8352), using the extraction method using an organic solvent.

    [0142] The method for analyzing the intracellular metabolites was performed according to the method described in the reference (Nakamura J et al., Appl. Environ. Microbiol. 73(14): 4491 to 4498, 2007).

    [0143] First, with regard to the modified Corynebacterium glutamicum strains of CA04-8352 and CA04-8405, each strain was inoculated into a 250 mL corner-baffle flask containing seed medium (25 mL) and cultured with shaking at 30 C. at 200 rpm for 20 hours. Then, each seed culture solution (1 mL) was inoculated into a 250 mL corner-baffle flask containing production medium (25 mL) and cultured with shaking at 30 C. at 200 rpm. The intracellular tryptophan concentration was analyzed three times according to glucose consumption. The cultured cells in each step were separated from the culture liquid by rapid vacuum filtration (Durapore HV, 0.45 m; Millipore, Billerica, Mass., USA). The filter to which cells were adsorbed was washed twice with distilled water (10 mL) and soaked in methanol containing 5 M morpholine ethanesulfonic acid and 5 M methionine sulfone for 10 minutes. Chloroform (1.6 mL) and distilled water (0.644) were added to the cell extract (1.6 mL) obtained above and thoroughly mixed, and only the aqueous phase was applied to the spin column to remove protein impurities. The filtered extract was analyzed using the capillary electrophoresis mass spectrometry, and the results are shown in FIG. 1.

    [0144] As shown in FIG. 1, it was confirmed that the CA04-8405 strain showed a decrease of the intracellular tryptophan concentration to a level of 33% to 41%, compared to that of its parent strain, CA04-8352. From this, it can be interpreted that as the tryptophan produced within the cells of a Corynebacterium glutamicum strain due to the expression of the gene derived from Herbaspirillum rhizosphaerae was smoothly exported extracellularly, the intracellular tryptophan concentration of the CA04-8405 strain decreased. From the above results, it was confirmed that the gene derived from Herbaspirillum rhizosphaerae is a gene encoding a membrane protein having an exporting ability specific to tryptophan.

    Reference Example 2: Preparation of Microorganism of the Genus Escherichia Producing L-Tryptophan

    [0145] The microorganism of the genus Escherichia producing L-tryptophan was developed from the wild-type E. coli W3110. To confirm whether the amount of tryptophan production significantly increases as the protein having an L-tryptophan-exporting activity is modified to be expressed, the strain prepared to produce L-tryptophan was used as the parent strain. Specifically, the expression of the L-tryptophan biosynthesis genes (trpEDCBA), which are involved in the production of L-tryptophan from chorismate, is inhibited by TrpR. Accordingly, the trpR gene encoding the TrpR was removed. Additionally, to release the feedback inhibition of the TrpE polypeptide according to the improvement of L-tryptophan production, the 21.sup.st amino acid from the N-terminus of TrpE (i.e., proline) was substituted with serine (J. Biochem. Mol. Biol. 32, 20 to 24 (1999)).

    [0146] The Mtr membrane protein has the role of introducing extracellular L-tryptophan into a cell, and the TnaA protein has the role of separating the intracellular L-tryptophan and water molecules into indole, pyruvate, and ammonia (NH.sub.3). Accordingly, the mtr and tnaA genes that inhibit L-tryptophan production and decompose the same were removed.

    [0147] For the removal of these genes, the -red recombination method (One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products, Datsenko K A, Wanner B L., Proc Natl Acad Sci USA. 2000 Jun. 6; 97(12): 6640 to 6645) was used. For the removal of the mtr gene, PCR was performed using the pKD4 vector as a template along with the primers of SEQ ID NO: 64 and SEQ ID NO: 65, and thereby a gene fragment (1,580 bp), in which a FRT-kanamycin-FRT cassette and a pair of 50 bp homologous nucleotides flanking the mtr gene, where chromosomal homologous recombination occurs therebetween, are bound, was obtained. The kanamycin antibiotic marker of the pKD4 vector was used for the confirmation of removal of a target gene and insertion of an antibiotic gene, and the FRT region has the role of removing the antibiotic marker after the removal of the target gene. Solg Pfu-X DNA polymerase was used as the polymerase, and PCR was performed as follows: denaturation at 95 C. for 2 minutes; 27 cycles of denaturation at 95 C. for 20 seconds, annealing at 62 C. for 40 seconds, and polymerization at 72 C. for 1 minute; and polymerization at 72 C. for 5 minutes.

    TABLE-US-00029 (mtr cassette-1) SEQ ID NO: 64 TGCAATGCATAACAACGCAGTCGCACTATTTTTCACTGGAGAGAAGCCC TGTGTAGGCTGGAGCTGCTTC (mtr cassette-2) SEQ ID NO: 65 TGCAATGCATAACAACGCAGTCGCACTATTTTTCACTGGAGAGAAGCCC TGTCCATATGAATATCCTCCT

    [0148] The pKD46 vector which expresses lambda red recombinase (gam, bet, and exo genes) were transformed into the E. coli W3110 strain by electroporation, and each strain was spread on LB solid medium containing kanamycin (50 mg/L). The E. coli W3110 strain in which the transformation of the pKD46 vector was confirmed induced the expression of a recombinant enzyme by adding 10 mM L-arabinose when the OD.sub.600 reached about 0.1. When the OD.sub.600 reached about 0.6, the strains were prepared into competent cells, and the linear gene fragment obtained in the above process, in which a FRT-kanamycin-FRT cassette and a pair of 50 bp homologous nucleotides flanking the mtr gene are bound, was transformed by electroporation. For the colonies grown on LB solid medium containing kanamycin (25 mg/L), colony PCR was performed using the primers of SEQ ID NO: 66 and SEQ ID NO: 67, and the colonies where the 782 bp gene fragment is prepared were selected.

    TABLE-US-00030 (Confirm_Cassette-1) SEQ ID NO: 66 GGGCAGGATCTCCTGTCATC (Confirm_mtr-2) SEQ ID NO: 67 AAATGTCGGATAAGGCACCG

    [0149] The strains in which the mtr gene was removed due to homologous recombination were prepared into competent cells so as to remove the kanamycin antibiotic marker and then transformed with the pCP20 vector by electroporation. The pCP20 vector expresses the FLP protein and thereby recognizes the FRT sites flanking the kanamycin antibiotic and binds thereto on the chromosome, thereby removing the antibiotic marker between the FRT sites. The pCP20 vector-transformed strain grown on LB solid medium containing ampicillin (100 mg/L) and chloramphenicol (25 mg/L) was cultured in LB liquid medium at 30 C. for 1 hour, further cultured at 42 C. for 15 hours, and spread on LB solid medium. The grown colonies were cultured in LB solid medium containing ampicillin (100 mg/L) and chloramphenicol (25 mg/L); LB solid medium containing kanamycin (12.5 mg/L); and LB solid medium containing no antibiotic. Only the colonies which grew in LB solid medium containing no antibiotic were selected. The removal of the mtr gene was finally confirmed by genome sequencing and the strain was named as CA04-9300.

    [0150] Genetic manipulation was performed by the method described above so as to remove the tnaA gene. PCR was performed using the pKD4 vector as a template along with the primers of SEQ ID NO: 68 and SEQ ID NO: 69, and thereby a gene fragment (1,580 bp), in which an FRT-kanamycin-FRT cassette and a pair of 50 bp homologous nucleotides flanking the tnaA gene, where chromosomal homologous recombination occurs therebetween, are bound, was obtained. Solg Pfu-X DNA polymerase was used as the polymerase, and PCR was performed as follows: denaturation at 95 C. for 2 minutes; 27 cycles of denaturation at 95 C. for 20 seconds, annealing at 62 C. for 40 seconds, and polymerization at 72 C. for 1 minute; and polymerization at 72 C. for 5 minutes.

    TABLE-US-00031 (tnaA cassette-1) SEQ ID NO: 68 TGTAATATTCACAGGGATCACTGTAATTAAAATAAATGAAGGATTATGT AGTGTAGGCTGGAGCTGCTTC (tnaA cassette-2) SEQ ID NO: 69 TGTAGGGTAAGAGAGTGGCTAACATCCTTATAGCCACTCTGTAGTATTA AGTCCATATGAATATCCTCCT

    [0151] The pKD46 plasmid was transformed into the CA04-9300. The CA04-9300, in which the recombinases were expressed by the addition of 10 mM L-arabinose was transformed by electroporation with the linear gene fragment obtained in the above process, in which an FRT-kanamycin-FRT cassette and a pair of 50 bp homologous nucleotides flanking the tnaA gene are bound. For the colonies grown on LB solid medium containing kanamycin (25 mg/L), colony PCR was performed using the primers of SEQ ID NO: 66 and SEQ ID NO: 70, and the colonies where the 787 bp gene fragment is prepared were selected.

    TABLE-US-00032 (Confirm_tnaA-2) SEQ ID NO: 70 ACATCCTTATAGCCACTCTG

    [0152] The strains in which the tnaA gene was removed due homologous recombination were prepared into competent cells so as to remove the kanamycin antibiotic marker and then transformed with the pCP20 vector, and a strain where the kanamycin antibiotic marker was removed by the expression of the FLP protein was prepared. The removal of the tnaA gene was finally confirmed by genome sequencing and the strain was named as CA04-9301.

    [0153] To remove the trpR gene, PCR was performed using the pKD4 vector as a template along with the primers of SEQ ID NO: 71 and SEQ ID NO: 72, and thereby the gene fragment (1,580 bp), in which an FRT-kanamycin-FRT cassette and a pair of 50 bp homologous nucleotides flanking the trpR gene, where chromosomal homologous recombination occurs therebetween, are bound, was obtained. Solg Pfu-X DNA polymerase was used as the polymerase, and PCR was performed as follows: denaturation at 95 C. for 2 minutes; 27 cycles of denaturation at 95 C. for 20 seconds, annealing at 62 C. for 40 seconds, and polymerization at 72 C. for 1 minute; and polymerization at 72 C. for 5 minutes.

    TABLE-US-00033 (trpR cassette-1) SEQ ID NO: 71 TACAACCGGGGGAGGCATTTTGCTTCCCCCGCTAACAATGGCGACATAT TGTGTAGGCTGGAGCTGCTTC (trpR cassette-2) SEQ ID NO: 72 GCATTCGGTGCACGATGCCTGATGCGCCACGTCTTATCAGGCCTACAAA AGTCCATATGAATATCCTCCT

    [0154] The pKD46 plasmid was transformed into the CA04-9301. The CA04-9301 in which the recombinases were expressed by the addition of 10 mM L-arabinose was transformed by electroporation with the linear gene fragment obtained in the above process, in which an FRT-kanamycin-FRT cassette and a pair of 50 bp homologous nucleotides flanking the trpR gene are bound. For the colonies grown on LB solid medium containing kanamycin (25 mg/L), colony PCR was performed using the primers of SEQ ID NO: 66 and SEQ ID NO: 73, and the colonies where the 838 bp gene fragment is prepared were selected.

    TABLE-US-00034 (Confirm_trpR-2) SEQ ID NO: 73 AGGACGGATAAGGCGTTCAC

    [0155] The strains in which the trpR gene was removed due to homologous recombination were prepared into competent cells so as to remove the kanamycin antibiotic marker and then transformed with the pCP20 vector, and a strain where the kanamycin antibiotic marker was removed by the expression of the FLP protein was prepared. The removal of the trpR gene was finally confirmed by genome sequencing and the strain was named as CA04-9307.

    [0156] To provide the CA04-9307 strain with the feedback resistant trpE trait, PCR was performed using the E. coli W3110 gDNA as a template along with the primers of SEQ ID NO: 74 and SEQ ID NO: 75, which contain an EcoRI restriction site, and thereby a trpE gene fragment containing an EcoRI restriction site (1,575 bp) was obtained. Solg Pfu-X DNA polymerase was used as the polymerase, and PCR was performed as follows: denaturation at 95 C. for 2 minutes; 27 cycles of denaturation at 95 C. for 20 seconds, annealing at 62 C. for 1 minute, and polymerization at 72 C. for 1 minute; and polymerization at 72 C. for 5 minutes.

    TABLE-US-00035 (trpE-1) SEQ ID NO: 74 GAATTCATGCAAACACAAAAACCGAC (trpE-2) SEQ ID NO: 75 GAATTCTCAGAAAGTCTCCTGTGCA

    [0157] Cloning was performed after treating the trpE gene fragment obtained by the above method and the pSG76-C plasmid (Journal of Bacteriology, July 1997, p. 4426 to 4428) with EcoRI restriction enzyme, respectively. The cloned plasmid was transformed into E. coli DH5a by electroporation, and the transformed E. coli DH5a strains were selected on LB plates containing chloramphenicol (25 g/mL) and thereby the pSG76-C-trpE plasmid was obtained.

    [0158] The pSG76-C-trpE(P21S) was prepared using the obtained pSG76-C-trpE plasmid along with the primers of SEQ ID NO: 76 and SEQ ID NO: 77 by site-directed mutagenesis (Stratagene, USA).

    TABLE-US-00036 (trpE(P21S)-1) SEQ ID NO: 76 CGCTTATCGCGACAATTCCACCGCGCTTTTTCACCAG (trpE(P21S)-2) SEQ ID NO: 77 CTGGTGAAAAAGCGCGGTGGAATTGTCGCGATAAGCG

    [0159] The pSG76-C-trpE(P21S) plasmid was transformed into the CA04-9307 strain, cultured in LB-Cm medium (yeast extract 10 g/L, NaCl 5 g/L, tryptone 10 g/L, and chloramphenicol 25 g/L), and colonies having resistance to chloramphenicol were selected. The selected transformants are strains in which the pSG76-C-trpE(P21S) plasmid is incorporated into the trpE region of the genome by first insertion. The strain in which the obtained trpE(P21S) gene is inserted was transformed with the pAScep plasmid (Journal of Bacteriology, July 1997, p. 4426 to 4428), which expresses restriction enzyme I-SceI that cleaves the I-SceI region present in the pSG76-C plasmid, and the strain which grew in the LB-Ap (yeast extract 10 g/L, NaCl 5 g/L, tryptone 10 g/L, and ampicillin 100 g/L) was selected. The trpE gene in the selected strain was amplified using the primers of SEQ ID NO: 74 and SEQ ID NO: 75, and it was confirmed that the amplified trpE gene was replaced with the trpE(P21S) gene by sequencing. The thus prepared strain was named as CA04-4303.

    Example 12: L-Tryptophan Production by Microorganism of the Genus Escherichia in which a Gene Derived from Herbaspirillum rhizosphaerae is Introduced

    [0160] The pCL1920-PyccA-Hrh prepared in Example 8 was introduced into the CA04-4303 strain prepared in Reference Example 2, and thereby a CA04-4306 strain in which a gene derived from Herbaspirillum rhizosphaerae is overexpressed was prepared. Additionally, the pCL1920 vector, as a control group, was transformed into the CA04-4303 strain. To examine the amount of L-tryptophan production in the two strains (i.e., CA04-4303/pCL1920 and CA04-4306), these strains were cultured in LB liquid medium containing spectinomycin (50 mg/L) for 12 hours. Then, these strains were each inoculated into a 250 mL corner-baffle flask containing 25 mL of production medium such that the initial OD.sub.600 value becomes 0.01 and then cultured with shaking at 37 C. at 200 rpm for 48 hours. Upon completion of the cultivation, the amount of L-tryptophan production was measured by HPLC.

    [0161] The results with regard to the L-tryptophan production in CA04-4303/pCL1920 and CA04-4306 strains in medium are shown in Table 5 below. The strain CA04-4306, in which a gene derived from Herbaspirillum rhizosphaerae was introduced and overexpressed, showed a final L-tryptophan of 2.1 g/L in the flask cultivation, which is about 50% higher than that of the control group. This indicates that the gene derived from Herbaspirillum rhizosphaerae exports L-tryptophan even in E. coli, thereby significantly improving its L-tryptophan production.

    [0162] Production Medium (pH 7.0)

    [0163] Glucose 70 g, (NH.sub.4).sub.2SO.sub.4 20 g, MgSO.sub.4 7H.sub.2O 1 g, KH.sub.2PO.sub.4 2 g, yeast extract 2.5 g, Na-citrate 5 g, NaCl 1 g, CaCO.sub.3 40 g (based on 1 L of distilled water)

    TABLE-US-00037 TABLE 5 Confirmation of L-tryptophan production in E. coli-derived L-tryptophan-producing strain (CA04-4303) and the L-tryptophan- producing strain where the exporter gene derived from Herbaspirillum rhizosphaerae is overexpressed (CA04-4306) Amount of Tryptophan Tryptophan Production Yield OD.sub.600 (g/L) (*100 g/g, %) CA04-4303/pCL1920 43.7 1.4 2 CA04-4306 42 2.1 3

    [0164] Accordingly, as can be seen in the results of Examples 7 and 9, the gene derived from Herbaspirillum rhizosphaerae showed high specificity and excellent resistance to L-tryptophan and its analogue, whereas as can be seen in the results of Examples 10 and 12, the gene derived from Herbaspirillum rhizosphaerae improved L-tryptophan production in both Corynebacterium glutamicum and E. coli strains. Additionally, it was observed in Example 11 that the gene derived from Herbaspirillum rhizosphaerae substantially exported tryptophan extracellularly. As a result, the gene derived from Herbaspirillum rhizosphaerae was named as wex (tryptophan (W) exporter).

    [0165] From the foregoing, a skilled person in the art to which the present disclosure pertains will be able to understand that the present disclosure may be embodied in other specific forms without modifying the technical concepts or essential characteristics of the present disclosure. In this regard, the exemplary embodiments disclosed herein are only for illustrative purposes and should not be construed as limiting the scope of the present disclosure. On the contrary, the present disclosure is intended to cover not only the exemplary embodiments but also various alternatives, modifications, equivalents, and other embodiments that may be included within the spirit and scope of the present disclosure as defined by the appended claims.