Composition comprising chlorella extract for preventing or treating liver disease
10568918 ยท 2020-02-25
Assignee
Inventors
- Hee-Guk Byun (Gangwon-do, KR)
- Joong-Kyun Jeon (Gangwon-do, KR)
- Se-Kwon Kim (Busan, KR)
- Jung Kwon Lee (Gangwon-do, KR)
Cpc classification
A23L33/105
HUMAN NECESSITIES
A61K9/0053
HUMAN NECESSITIES
A61K36/05
HUMAN NECESSITIES
A61P1/00
HUMAN NECESSITIES
A61P1/16
HUMAN NECESSITIES
International classification
A61K36/05
HUMAN NECESSITIES
A23L33/105
HUMAN NECESSITIES
A61K9/00
HUMAN NECESSITIES
Abstract
The present invention relates to a composition comprising chlorella extract for preventing or treating liver diseases. The composition comprising the chlorella extract according to the present invention may be applied to medical supplies and health supplementary food and the like, and the chlorella extract of the present invention may be usefully used as a composition for preventing or treating liver diseases because it shows inhibitory effect on liver function injury in a liver function injured model.
Claims
1. A method for treating alcoholic fatty liver in a patient, comprising administering to a patient in need thereof an effective amount of a pharmaceutical composition comprising an effective dosage of chlorella extract, wherein the chlorella extract is an ethanolic extract which comprises chlorophyll a, and wherein the dosage amount of the chlorella extract is 50 mg to 100 mg per kg body weight of the subject per day.
2. The method of claim 1, wherein the composition induces quinone reductase activity.
3. A method for treating alcoholic fatty liver in a patient, comprising administering to a patient in need thereof an effective amount of a health functional food composition comprising an effective dosage of chlorella extract, wherein the chlorella extract is an ethanolic extract which comprises chlorophyll a, and wherein the dosage amount of the chlorella extract is 50 mg to 100 mg per kg body weight of the subject per day.
4. The method of claim 3, wherein the health functional food is in the form of a powder, granule, tablet, capsule or beverage.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The above and other features of the present invention will now be described in detail with reference to certain exemplary embodiments thereof illustrated the accompanying drawings which are given hereinbelow by way of illustration only, and thus are not limitative of the present invention, and wherein:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
DETAILED DESCRIPTION
(18) Hereinafter, the preferred embodiments of the present invention will now be described in detail to enable any person skilled in the art to make and use the invention.
(19) The present invention relates to a composition comprising chlorella extract as an active ingredient for preventing or treating liver diseases. More specifically, the present invention relates to a pharmaceutical composition comprising the chlorella extract as an active ingredient for preventing or treating the liver diseases.
(20) The chlorella of the present invention may be a condensed freshwater chlorella, and the condensed freshwater chlorella powder may be extracted with an organic solvent to obtain the chlorella extract. More specifically, the extract may be the extract of C.sub.14 alcohols, ethyl acetate or hexane, and particularly, it may be an ethanol extract.
(21) The composition according to the present invention induces the activity of a quinone reductase, and therefore, it may show a liver function improving effect.
(22) The liver diseases may include fatty liver, hepatitis and liver cirrhosis. In one embodiment according to the present invention, the liver function injury may have been inhibited by the composition because the liver injury indexes (ALT, AST, -GT and LDH) increased by liver injury are improved.
(23) The chlorella extract may comprise chlorophyll a, and the chlorophyll a may have an effect in preventing or treating the liver diseases.
(24) In the pharmaceutical composition of the present invention for preventing or treating liver diseases, the chlorella extract may be used at the concentration of 0.01 mg to 10 g based on the total composition.
(25) However, the said constitution is not limited thereto, and it is changeable depending on health status of a patient, and kind and severity of diseases.
(26) The composition comprising the extract of the present invention may further include appropriate carrier, excipient or diluent commonly used for preparing a pharmaceutical composition.
(27) The composition comprising the extract of the present invention may be prepared into oral medicine like powder, granulum, tablet, capsule, suspension, emulsion, syrup and aerosol; external medicine; or suppository or sterile injection solution. The carrier, excipient and diluent that may be included in the composition comprising the extract of the present invention may include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microchrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, prophylhydroxybenzoate, talc, magnesium stearate or mineral oil. When prepared into medicines, diluent or excipient such as generally used filing agents, expanders, compounding agents, humectants, disintegrators or surfactants may be added. Solid products for oral administration include tablets, pills, powder, granulum, capsules and others. The solid products may be prepared by mixing with at least one or more excipients like starch, calcium carbonate, sucrose, lactose or gelatin to the extract. Not only the simple excipient but also lubricants like magnesium stearate talc may be used. For liquid oral products, suspension, peroral liquid preparation, emulsion or syrup may be used, but commonly used simple diluents like water and liquid paraffin as well as various excipients such as humectants, sweetening agents, odorants or preservatives may also be used. Non-oral administrative products may include sterile aqueous suspension, non-aqueous solvent, suspension, emulsion, freeze-dried products or suppository. For non-aqueous solvent and suspension, propylene glycol, polyethylene glycol, vegetable oil like olive oil, or injectable ester such as ethyloleate may be used. For suppository base, witepsol, macrogol, tween 61, cacao butter, laurin fat, glycerol gelatin or others may be used.
(28) The administration dose of the extract of the present invention may vary depending on health status and body weight of a patient, severity of disease, preparation form, pathway and period of medication, but it may be properly selected by those skilled in the art. However, for desirable effect, the extract of the present invention may be administered in single or multiple doses in the amount of 0.01 mg/kg to 10 g/Kg, preferably 1 mg/kg to 1 g/kg per day. Therefore, the above dose by no means limits the scope of the present invention.
(29) The composition of the present invention may be administered to mammals like rat, mouse, livestock or humans through a variety of paths. For instance, it may be administered perorally, perrectum, or intravenous (IV), intramuscular (IM), subcutaneous, uterine dura mater or intracerebroventricular injection
(30) Further, the present invention relates to a health functional food comprising the chlorella extract as an active ingredient for preventing or improving liver diseases.
(31) The chlorella extract may comprise chlorophyll a, and the chlorophyll a has a positive effect in preventing or improving liver diseases.
(32) Further, the present invention relates to a food or food additives comprising the chlorella extract as an active ingredient having positive effects of preventing or improving liver diseases.
(33) The composition comprising the extract of the present invention may be used in various forms of medicine, food, and beverage for preventing or improving liver diseases. The extracts of the present invention may be added to various foods like candies, beverage, gum, tea, vitamin complex, and health supplementary food, and may be used in the form of powder, granule, tablet, capsule, or drink.
(34) The extracts of the present invention may be safely used for a long time for the purpose of prevention since they have little toxicity or adverse effect.
(35) The extract of the present invention may be added to various food or beverage for preventing or improving liver diseases. At this time, the amount of the extracts in foods or beverages may generally be 0.01 to 15 weight % of the total food weight. For health beverage composition, 0.02 to 10 g, preferably 0.3 to 1 g, of the extract may be added to 100 ml.
(36) For the health beverage composition, only the extract is an essential ingredient with prescribed ratio, and there are no special restrictions on the liquid ingredients. Like common beverages, various kinds of flavors and natural carbohydrate may be added. The examples of the above mentioned natural carbohydrate would be mono-saccharides, disaccharides such as glucose and fructose, polysaccharides such as maltose and sucrose, general sugar such as dextrin and cyclodextrin, and sugar alcohol such as xylitol, sorbitol, and erithritol. In addition to the above mentioned flavors, natural flavors (thaumatin, stevia extract (i.e., rebaudiosid A, glycyrrhizin)) and synthetic flavors (i.e., saccharides, aspartame) may be used. For the above natural carbohydrate composition, generally about 1 to 20 g per 100 ml of the composition of the present invention, preferably 5 to 12 g, may be used.
(37) Other than the above, the composition of the present invention may contain various nutrients, vitamins, minerals (electrolyte), synthetic and natural flavoring agents, colorants, extenders (such as cheese, chocolate), pectic acid and pectinate, alginic acid and alginate, organic acid, protective colloid thickening agents, pH adjusting agent, stabilizer, preservatives, glycerin, alcohol, carbonator used in carbonated beverages and others. Additionally, the composition of the present invention may contain the flesh of fruits to produce natural fruit juice, fruit juice beverages, and vegetable beverages. These ingredients may be used alone or in combination. The ratios of these additives are not significant, but generally 0 to 20 weight parts per 100 weight parts of the composition of the present invention may be used.
(38) Hereinafter, the present invention is explained by the following examples and experimental examples in more detail. The following examples are intended to further illustrate the present invention, and the scope of the present invention cannot be limited thereby in any way. The embodiments of the present invention are provided for illustration purpose only to a person having ordinary skill in the art.
EXAMPLE
Example 1
Ethanol Extraction of Condensed Freshwater Chlorella
(39) 99.9% Ethanol (Daejeong, Korea) 500 Ml was added to the powdered condensed freshwater chlorella 100 g, and stirred under dark condition. Then, the resulting mixture was extracted two times every 12 hours, and concentrated under reduced pressure to obtain an ethanol extract. Then, the activity of a quinone reductase was measured using a certain weight of the concentrated ethanol extract.
Example 2
Isolation and Purification of Material for Preventing and Treating Liver Disease from Chlorella Using Thin Layer Chromatography
(40) Ingredients of the fractions were identified using thin-layer chromatography (TLC). The chlorella ethanol extract was isolated on TLC. TLC may fractionate the organic solvent extract into non-polar and polar materials, and the chlorella ethanol extract and chlorophyll a were isolated using an eluent (hexane:ethylacetate:acetone=7:3:0.1) (
Example 3
Quinone Reductase Activity of Extract
(41) For the ethanol extract and the ingredients of the isolated fractions, the quinone reductase activity induction was analyzed. In order to measure the quinone reductase activity induction effect of the fractions obtained from the chlorella, the experiment was conducted using a liver cancer cell line (Hepa1c1c7) of a white rat.
(42) First of all, a-MEM (minimum essential medium)/10% FBS (fetal bovine serum) solution was mixed with a liver cell culture solution to make the cell number of 110.sup.5 cells/Ml, and the resulting solution 100 l was added to a 96-well plate followed by incubating for 24 hours under a condition of 5% CO.sub.2 and 37 C. After the cells were stabilized, the compounds of the extract from the chlorella and the fractions obtained from the extract were added thereto with seven different concentrations as increased twice from 3.125 to 200 g/Ml followed by incubating for 24 hour under a condition of 5% CO.sub.2 and 37 C. After completing the incubation, the cells were washed with PBS (phosphate buffered saline) solution, and the cell membranes were lyzed with 80 l solution containing 0.08% digitonin and 2 mM EDTA to obtain a protein solution.
(43) The protein solution 50 l and reaction solution A (49 Ml 25 mM Tris buffer, 34 mg BSA, 0.34 Ml 1.5% tween-20 solution, 0.34 Ml co-enzyme solution, 100 unit glucose-6-phosphate dehydrogenase, 15 mg MTT, 50 l 50 mM menadione) 200 l were mixed together, and the absorbance increasing rate was measure at 610 nm using a microplate reader. The protein amount was measured at 595 nm using Bradford solution. In the reaction solution A, the co-enzyme solution was made up of 150 mM glucose-6-phosphate, 4.5 mM NADP and 0.75 mM FAD, and the MTT is an abbreviation for 3-(4,5-dimethylthiazo-2-yl)-2,5-diphenyltetrazolium bromide. The quinone reductase activity of the extract and the fraction was expressed as CD (the concentration of the sample where the quinone reductase activity of the sample-treated cell becomes twice). Table 1 shows the quinone reductase activity of the ethanol extract.
(44) TABLE-US-00001 TABLE 1 Hepa1c1c7 Sample CD (g/Ml) Chlorella ethanol 15.65 Sulforaphane (5 M) 1.94 5 10.sup.3 cell/wells Treatment Concentration 200 g/Ml
(45) As shown in Table 1, when the quinone reductase activity of the ethanol extract was expressed as CD (g/Ml), it was 15.65. In order to identify the active material, isolation and purification were performed. By comparing ethanol extract with chlorophyll a from TLC the active fraction of quinone reductase, which has the same R.sub.f value, was confirmed. The activity of each fraction is listed in Tables 2 and 3. Tables 2 and 3 show the quinone reductase activities of the fractions isolated from the ethanol extract on TLC.
(46) TABLE-US-00002 TABLE 2 Hepa1c1c7 Sample CD(g/Ml) 1 35.86 2 39.48 3 31.56 4 25.85 5 18.85 6 12.94 7 30.58 8 40.45 Sulforaphane (5 M) 2.48 Chlorella ethanol 17.5 5 10.sup.3 cell/wells Treatment Concentration 200 g/Ml
(47) TABLE-US-00003 TABLE 3 Hepa1c1c7 Sample CD(g/Ml) CH1 10.85 CH2 15.31 Sulforaphane (5 M) 2.07 Fraction 6 16.89 5 10.sup.3 cell/wells Treatment Concentration 200 g/Ml
Example 4
Evaluation of Effect of Chlorella Ethanol Extract for Preventing and Treating Liver Disease in Liver-Injured Animal Model
(48) 4.1: Sample
(49) The chlorella ethanol extract (CH) was used. The CH was dissolved in ethanol, and mixed with AlN-76 diet to be a daily intake of 50 mg or 100 mg per kg of a test animal weight and supplied to the animal.
(50) 4.2: Test Animal and Feeding
(51) Specific pathogen free male SD rats of 5-week-old were purchased from Orient Bio Inc. (Seongnam, South Korea). After inspection and adaptation for 1 week, healthy animals without weight loss were selected and used for the test. Test animals were bred under a condition of temperature: 233, relative humidity: 5010%, air change rate: 10-15 times/hour, lighting time: 12 hours (08:00-20:00) and luminous intensity: 150-300 Lux. During adaptation period of 1 week, the test animals were freely fed with solid feed for test animal (Superfeed Co., Ltd., Wonju, South Korea) and drinking water. After the adaptation period of 1 week, healthy animals were selected, and divided to 5 groups by randomized block design. Namely, those were divided into a control group not treated with ethanol and the test material, a group orally administered with ethanol, a group orally administered with ethanol and fed with CH 50 mg/kg, a group orally administered with ethanol and fed with CH 100 mg/kg and a group orally administered with ethanol and fed with sulforaphane 10 mg/kg. The primary feed used in this experiment, AlN-76 was purchased from Research Diets, Inc. (New Brunswick, N.J., USA), and its composition is listed in Table 1. Test feeds were prepared by mixing each test compounds to the feed to the daily feeding amount of 50 or 100 mg per 1 kg of test animal weight as described above, and fed. In order to induce the fatty liver by ethanol, 20% ethyl alcohol 5 g per kg (body weight) was orally administered twice a day (morning and afternoon) for 16 days. The feeds containing the test compounds were fed for 10 days after 17.sup.th day of the ethanol administration, and the ethanol was orally administered together with the feed continuously. During the test period, drinking water was freely supplied. The feed intake was measured every two days, and body weight was measured every week from the day of starting the oral administration of ethanol (0 day) to the final day of the experiment. All animal tests in the experiment were performed with the approval of hallym university experimental animal experiment ethics committe (Hallym 2010-102).
(52) 4.3: ALT, AST, -GT and LDH Contents in Blood Serum
(53) To analyze contents of ALT, AST, -GT and LDH in a blood serum isolated from the blood collected on the day of the autopsy, alanine aminotransferase (ALT), aspartate aminotransferase (AST), gamma-glutamyl transferase (-GT) and lactic dehydrogenase (LDH) were analyzed using a blood biochemistry analyzer (KoneLab 20, Thermo Fisher Scientific, Waltham, Finland).
(54) The contents of the ALT, AST, -GT and LDH in the blood serum are shown in
(55) 4.4: SOD, CAT, GPx, ADH and ALDH Activities in Liver Cytosol
(56) 1 g liver tissue was homogenized with 0.25 M sucrose (pH 7.0). The homogenate was centrifuged at 700 rpm for 10 min and at 4,000 rpm for 10 min followed by collecting the supernatant, and then centrifuged again at 50,000 rpm for 1 hour. The supernatant was used as a cytosolic zymogen. The activities of superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPx) were measured using a kit of Cayman chemical company (Ann Arbor, Mich., USA). The activity of alcohol dehydrogenase (ADH) was measured by adding 0.2 M ethanol 10 l, 0.05 M semicarbazide HCl 10 l and 0.1 M NAD (in 0.01 M HCl) 10 l to 0.1 M Tris-HCl buffer (pH 8.5) 160 l followed by adding the cytosolic zymogen 10 l thereto at 340 nm. The activity values were expressed based on the ethanol administration group as 100%. The activity of acetaldehyde dehydrogenase (ALDH) was measured by adding 1 M KCl 10 l, 0.1 M pyrazole 10 l, 1 M 2-mercaptoethanol 10 l, 0.1 M propione aldehyde 10 l and 0.1 M NAD (in 0.01 M HCl) 10 l to 0.2 M Tris-HCl buffer (pH 8.3) 150 l followed by adding the cytosolic zymogen 10 l at 340 nm, and the enzyme protein assay was conducted by a method of Lowry et al. (Lowry O H et al., 1957, J Biol Chem 193: 265-276).
(57) The activities of SOD, CAT, GPx, ADH and ALDH in the liver cytosol are shown in
(58) 4.5: Contents of Total Lipid, Triglyceride and Total Cholesterol in Liver Tissue
(59) Total lipid content in the liver tissue was analyzed by homogenizing 1 g liver tissue in a saline 3 ml followed by homogenizing again with CM solution (Chloroform:Methanol=2:1) 9 ml. The homogenate was centrifuged at 3,000 rpm for 10 min, and the lower layer was collected and evaporated followed by measuring the total lipid content using a precision scale. The measured total lipid was dissolved in isopropanol, and the triglyceride content and the total choresterol content were measured by a quantitative analysis kit using an enzyme method (Asan Pharm. Co., Ltd., Hwaseong, South Korea). The contents of the total lipid, the triglyceride and the total cholesterol in the liver are listed in Table 5. The total liver lipid contents were not significantly different between all groups (Table. 5). The liver triglyceride contents decreased significantly in the sample-treated groups, compared with the group orally administered with ethanol, but did not show the significant difference in all groups (Table 4). The total liver cholesterol contents decreased in the CH 50 mg/kg group and the Sulforaphane 10 mg/kg group, compared with the group orally administered with ethanol, and showed the significant difference (Table 5).
(60) 4.6: Content of Lipid Peroxide in Liver Microsome
(61) 1 g Liver tissue was homogenized in 0.25 M sucrose (pH 7.0). The homogenate was centrifuged at 700 rpm for 10 min and at 4,000 rpm for 10 min followed by collecting the supernatant, and then centrifuged at 50,000 rpm for 1 hour. The obtained precipitate was suspended in 0.25 M sucrose 10 ml again and centrifuged at 10,000g for 15 min, and the supernatant thereof was centrifuged again at 50,000 rpm for 1 hour to obtain a precipitate. The obtained precipitate was suspended in PBS. The content of the lipid peroxide was measured by a lipid peroxide measuring kit (BioAssay Systems, Hayward, Calif., USA), and the protein quantification was conducted by a method of Lowry et al. (Lowry O H et al., 1957, J Biol Chem 193: 265-276). The lipid peroxide contents in the liver microsome are listed in Table 4. The lipid peroxide contents tended to be reduced in the CH 50 mg/kg group and the CH 100 mg/kg group, compared with the group orally administered with ethanol, but did not show the statistically significant difference (Table 4). The following Table 4 shows the contents of the total lipid, the triglyceride, the total cholesterol and the lipid peroxide in the liver.
(62) TABLE-US-00004 TABLE 4 EtOH Total Tri- Total Lipid (20% ethyl lipid glyceride cholesterol peroxide alcohol Treat- (mg/g (mg/g (mg/g (M/mg 5 g/kg) ment liver) liver) liver) protein) 46.04 13.06 4.71 2.02 2.72 1.58 0.10.sup.a 0.16 + 49.34 15.08 4.88 2.19 1.27 0.61 0.0.sup.9a 0.09 + CH 50 47.37 14.07 4.61 1.93 (mg/kg) 1.14 2.16 0.12.sup.ab 0.23 + CH 100 47.93 14.82 4.72 1.78 (mg/kg) 1.25 1.24 0.09.sup.a 0.18 + Sulfo- 48.26 13.28 4.39 2.07 raphane 0.99 0.77 0.11.sup.b 0.24 10 (mg/kg) Values are expressed as mean SEM Means with the different lettered superscripts in a same column are significantly different at the p < 0.05 levels by Duncan's multiple range test.
4.7: Contents of Triglyceride, Total Cholesterol and HDL-Cholesterol in Blood Serum
(63) The contents of the triglyceride, the total cholesterol and the HDL-cholesterol in the serum are listed in Table 5. The triglyceride contents tended to be reduced in all groups, compared with the group orally administered with ethanol, but did not show the significant difference (Table 5). The total serum cholesterol contents increased significantly in the group orally administered with ethanol only, compared with the control group, and decreased significantly in the CH 100 mg/kg group, compared with the group orally administered with ethanol only (Table 5). The HDL-cholesterol contents decreased in the ethanol administration group, compared with the control group. Further, when the CH was administered, the HDL-cholesterol content increased significantly, compared with the ethanol administration group (Table 5). The following Table 5 shows the contents of the triglyceride, the total cholesterol and the HDL-cholesterol in the serum.
(64) TABLE-US-00005 TABLE 5 EtOH (20% ethyl Tri- Total HDL- alcohol Treat- glyceride cholesterol cholesterol 5 g/kg) ment (mg/dL) (mg/dL) (mg/dL) 130.84 64.84 32.72 26.61 5.16.sup.b 1.80.sup.ab + 136.03 102.08 29.77 14.30 7.68.sup.a 2.73.sup.b + CH 50 126.46 101.44 38.30 (mg/kg) 13.66 5.49.sup.a 2.69.sup.a + CH 100 101.22 82.61 38.54 (mg/kg) 8.28 5.71.sup.ab 2.33.sup.a + Sulforaphane 126.11 94.25 33.39 10 (mg/kg) 15.65 7.32.sup.a 1.48.sup.ab Values are expressed as mean SEM Means with the different lettered superscripts in a same column are significantly different at the p < 0.05 levels by Duncan's multiple range test.
4.8: Histological Analysis of Liver
(65) After the autopsy of the control group and the test compound-treated groups, the liver was collected, washed with phosphate buffered saline and fixed with 4% paraformaldehyde (Sigma, USA). The tissue was put in a Histo Cassette (Hyunil, Korea), and treated with a automatic tissue processor (Leica, Germany), and a paraffin (Sigma, USA) block was prepared by a paraffin embedding station (Leica, Germany) followed by slicing the tissue using a tissue microtome (Leica, Germany). The section was stained by a hematoxyline and eosin staining procedure (Sigma, USA), and analyzed histologically using an optical microscope (Zeiss, Germany).
(66) The hematoxyline and eosin staining of liver are shown in
Example 5
Gene Expression of NQO-1, HO-1, GT and GSTP
(67) In order to confirm the gene expressions of detoxifying enzymes acting on the liver function improvement of the chlorella ethanol extract, the degree of the gene expressions in the hepa1c1c7 cells were measured by reverse transcription polymerase chain reaction (RT-PCR). First of all, as described in Example 3, the hepa1c1c7 cells were mixed with a-MEM (minimum essential medium)/10% FBS (fetal bovine serum) solution and the solution of the cultured liver cancer cells to make the cell number to 510.sup.5 cells/Ml, and put into a petri-dish followed by incubating for 24 hours under a condition of 5% CO.sub.2 and 37. When the Hepa1c1c7 cells were grown to 80% or more of the petri-dish, chlorella ethanol extract 200 g/Ml was added thereto. After treating the extract, the cells were incubated in a-MEM (minimum essential medium)/10% FBS (fetal bovine serum) for 24 hours under a condition of 5% CO.sub.2 and 37 C. After 24 hours, RNA isolation, cDNA synthesis and RT-PCR from the cells were conducted according to the method of Komoroski et al. (Drug Metab. Dispos. 32:512-518, 2004). The gene expressions of GAPDH (glyceraldehyde phosphate dehydrogenas), NQO-1 (NAD(P)H quinone oxidoreductase), HO-1 (heme oxygenase-1), GR (Glutathione reductase), GSTP (glutathione S-transferase Pi) were confirmed by RT-PCR.
(68) Primer sequences of each gene are listed in Table 6. cDNA was synthesized by mixing the extracted RNA as a template, oligo dT-adaptor primer and DEPC water to the total volume of 15 L, denaturing at 70 for 5 min and performing reverse transcription of moloney murine leukemia virus (M-MLV) RNA at 42 for 60 min and at 94 for 5 min. The synthesized cDNA was amplified by PCR, and the total volume of the reaction solution was 25 L. The final concentration of each reactant was: 100 pmol primer, 1.0 M dNTP mixture, 0.2 mM 5green or coloreless GoTaq Reaction buffer, 11.5 mM, MgCl.sub.2 (PCR buffer) and GoTaq DNA polymerase 1.25 units. PCR conditions about denaturation, annealing and extension were as follows: 95 for 2 min, 95 for 30 sec, 60 for 30 sec, 72 for 1 min, 72 for 5 min and 3040 cycles. After completing the PCR, 10 L of each product was electrophoresed in an 2% agarose gel. After completing the electrophoresis, the gel was stained with EtBr, and the picture thereof was taken under UV using DC120 zoom digital camera (Eastman Kodak, New Haven, Conn., USA). The degree of the expression was judged based on the GAPDH expression. The following Table 6 shows the primer sequences for the liver detoxifying enzyme genes.
(69) TABLE-US-00006 TABLE6 Primer Name Sequence GAPDH Forward:GGCATTGCTCTCAATGACAA (SEQIDNO:1) Reverse:TGTGAGGGAGATGCTCAGTG (SEQIDNO:2) NQO-1 Forward:TTCTCTGGCCGATTCAGAGT (SEQIDNO:3) Reverse:GGCTGCTTGGAGCAAAATAG (SEQIDNO:4) HO-1 Forward:GAGCCTGAATCGAGCAGAAC (SEQIDNO:5) Reverse:AGCCTTCTCTGGACACCTGA (SEQIDNO:6) GR Forward:ACCACGAGGAAGACGAAATG (SEQIDNO:7) Reverse:GGTGACCAGCTCCTCTGAAG (SEQIDNO:8) GSTP Forward:GGATGGAGACCTCACCCTTT (SEQIDNO:9) Reverse:CAGGGCCTTCACGTAGTCAT (SEQIDNO:10)
(70) As a result of RT-PCR shown in
(71) According to the results of Examples 1 to 5, it was confirmed that the chlorella extract improved the activity of the quinone reductase as a detoxifying enzyme in the liver cancer cell, hepa1c1c7; and the liver injury protecting effect and the activities of the liver detoxifying enzyme and anti-oxidant enzyme in the liver-injured animal model. Therefore, it is expected that the extract may show excellent effect as a liver function improving agent, and a preventing agent and a treating agent for the liver disease in the future.
(72) The composition comprising the chlorella extract according to the present invention may be used to a medicine and a health supplementary food and the like, and may show the liver-injury inhibiting effect in the liver-injured model. Therefore, the chlorella extract of the present invention may be usefully used as a composition for preventing and treating the liver injury.
(73) While certain embodiments have been described, these embodiments have been presented by way of example only, and are not intended to limit the scope of the disclosures. Further, it will be apparent to those skilled in the art that modifications and variations not exemplified above can be made in the scope not departing from essential properties. For example, each component shown in detail in the embodiments may be modified and implemented. In addition, it should be understood that difference associated with the modification and application are included in the scope of the present invention defined in the appended claims.