Method for the preparation of 2,4-dihydroxybutyrate

10570422 · 2020-02-25

Assignee

Inventors

Cpc classification

International classification

Abstract

A method for the preparation of 2,4-dihydroxybutyric acid from homoserine includes a first step of conversion of the primary amino group of homoserine to a carbonyl group to obtain 2-oxo-4-hydroxybutyrate, and a second step of reduction of the obtained 2-oxo-4-hydroxybutyrate (OHB) to 2,4-dihydroxybutyrate.

Claims

1. A method for the preparation of 2,4-dihydroxybutyrate from homoserine comprising: deaminating homoserine to form 2-oxo-4-hydroxybutyrate (OHB), where the deamination of homoserine is catalyzed by an enzyme having homoserine transaminase activity, wherein the enzyme having homoserine transaminase activity either is encoded by the sequence set forth in SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67 or SEQ ID NO: 69, or is selected from SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68 or SEQ ID NO: 70 or is selected from any sequence sharing a sequence identity of at least 90% with SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68 or SEQ ID NO: 70, and the enzyme having homoserine transaminase activity is produced via a transformed host microorganism that comprises a first chimeric gene including a first nucleic acid sequence encoding the enzyme having homoserine transaminase activity for converting the primary amino acid group of homoserine to a carbonyl group to obtain OHB; and reducing the OHB to form 2,4-dihydroxybutyrate (2,4-DHB), where the reduction of OHB is catalyzed by an enzyme having OHB reductase activity, wherein the enzyme having OHB reductase activity is an OHB reductase that is selected from the group consisting of (D)-lactate dehydrogenase from Escherichia coli (SEQ ID NO: 4), (L)-lactate dehydrogenase from Lactococcus lactis (SEQ ID NO: 6), the two isoforms of (L)-lactate dehydrogenase from Oryctalagus cuniculus (SEQ ID NO: 12 and SEQ ID NO: 14), (L)-lactate dehydrogenase from Geobacillus stearothermophilus (SEQ ID NO: 10), (L)-lactate dehydrogenase from Bacillus subtilis (SEQ ID NO: 8), (L)-malate dehydrogenase from Escherichia coli (SEQ ID NO: 2), branched chain (D)-2-hydroxyacid dehydrogenase from Lactococcus lactis, and dehydrogenases having an amino acid sequence sharing a sequence identity of at least 90% with at least one of said sequences, and the enzyme having OHB reductase activity being produced via the transformed host microorganism, which further comprises a second chimeric gene including a second nucleic acid sequence encoding the enzyme having OHB reductase activity for reducing OHB to 2,4-DHB.

2. The method of claim 1 wherein the OHB reductase is a lactate dehydrogenase comprising at least one mutation in position V17, Q85, E89, I1226, or A222, said positions being defined by reference to the L-Lactis LdhA (SEQ ID NO: 6); or a malate dehydrogenase comprising at least one mutation in position A112, R81, M85, D86, V93, G179, T211, or M227, said positions being defined by reference to the E. coli Mdh (SEQ ID NO: 2).

3. A method for the preparation of 2,4-dihydroxybutyrate from homoserine comprising: deaminating homoserine to form 2-oxo-4-hydroxybutyrate (OHB), where the deamination of homoserine is catalyzed by an enzyme having homoserine transaminase activity, wherein the enzyme having homoserine transaminase activity either is encoded by the sequence set forth in SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67 or SEQ ID NO: 69, or is selected from SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68 or SEQ ID NO: 70 or is selected from any sequence sharing a sequence identity of at least 90% with SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68 or SEQ ID NO: 70, and the enzyme having homoserine transaminase activity is produced via a transformed host microorganism that comprises a first chimeric gene including a first nucleic acid sequence encoding the enzyme having homoserine transaminase activity for converting the primary amino acid group of homoserine to a carbonyl group to obtain OHB; and reducing the OHB to form 2,4-dihydroxybutyrate (2,4-DHB), where the reduction of OHB is catalyzed by an enzyme having OHB reductase activity, wherein the enzyme having OHB reductase activity is an OHB reductase that either is selected from SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 288, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116 or SEQ ID NO: 118 or is selected from any sequence sharing a sequence identity of at least 90% with SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 288, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 102, SEQ ID NO: 104, SEQ ID NO: 106, SEQ ID NO: 108, SEQ ID NO: 110, SEQ ID NO: 112, SEQ ID NO: 114, SEQ ID NO: 116 or SEQ ID NO: 118, or is encoded by a nucleic acid sequence selected from SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 287, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 101, SEQ ID NO: 103, SEQ ID NO: 105, SEQ ID NO: 107, SEQ ID NO: 109, SEQ ID NO: 111, SEQ ID NO: 113, SEQ ID NO: 115 or SEQ ID NO: 117.

4. A modified microorganism for the preparation of 2,4-DHB (2,4-dihydroxybutyrate) from homoserine via a two-step pathway comprising: deaminating homoserine to form 2-oxo-4-hydroxybutyrate (OHB), where the deamination of homoserine is catalyzed by an enzyme having homoserine transaminase activity, wherein the enzyme having homoserine transaminase activity either is encoded by the sequence set forth in SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67 or SEQ ID NO: 69, or is selected from SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68 or SEQ ID NO: 70 or is selected from any sequence sharing a sequence identity of at least 90% with SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68 or SEQ ID NO: 70, and reducing the OHB to form 2,4-DHB, where the reduction of OHB is catalyzed by an enzyme having OHB reductase activity, wherein the enzyme having OHB reductase activity is an OHB reductase that is selected from the group consisting of (D)-lactate dehydrogenase from Escherichia coli (SEQ ID NO: 4), (L)-lactate dehydrogenase from Lactococcus lactis (SEQ ID NO: 6), the two isoforms of (L)-lactate dehydrogenase from Oryctalagus cuniculus (SEQ ID NO: 12 and SEQ ID NO: 14), (L)-lactate dehydrogenase from Geobacillus stearothermophilus (SEQ ID NO: 10), (L)-lactate dehydrogenase from Bacillus subtilis (SEQ ID NO: 8), (L)-malate dehydrogenase from Escherichia coli (SEQ ID NO: 2), branched chain (D)-2-hydroxyacid dehydrogenase from Lactococcus lactis, and dehydrogenases having an amino acid sequence sharing a sequence identity of at least 90% with at least one of said sequences; wherein the modified microorganism is a host microorganism that has been transformed to enhance production of 2,4-DHB compared to a non-transformed host microorganism, the transformed microorganism comprising: a first chimeric gene including a first nucleic acid sequence encoding the enzyme having homoserine transaminase activity for converting the primary amino acid group of homoserine to a carbonyl group to obtain OHB, and a second chimeric gene including a second nucleic acid sequence encoding the enzyme having OHB reductase activity for reducing OHB to 2,4-DHB.

5. The modified microorganism according to claim 4 wherein transformed host microorganism has been further transformed to enhance production of homoserine compared to the non-transformed host microorganism.

6. The modified microorganism according to claim 5, wherein the enhanced production of homoserine comprises overexpressing one or more additional enzymes selected from the group consisting of aspartate kinase, aspartate semialdehyde dehydrogenase and homoserine dehydrogenase, wherein the overexpression of said one or more enzymes being realized by expressing the enzymes from a multicopy plasmid.

7. The modified microorganism of claim 4, wherein the modified microorganism is a bacterium, a yeast, or a fungus.

8. The modified microorganism of claim 4 wherein the expression of at least of one the enzymatic activities chosen among phosphoenolpyruvate carboxylase, phosphoenolpyruvate carboxykinase, isocitrate lyase, pyruvate carboxylase, and hexose symporter permease is increased, or at least one of the enzymatic activities chosen among lactate dehydrogenase, alcohol dehydrogenase, acetate kinase, phosphate acetyltransferase, pyruvate oxidase, isocitrate lyase, fumarase, 2-oxoglutarate dehydrogenase, pyruvate kinase, malic enzyme, phosphoglucose isomerase, phosphoenolpyruvate carboxylase, phosphoenolpyruvate carboxykinase, pyruvate-formate lyase, succinic semialdehyde dehydrogenase, sugar-transporting phosphotransferase, ketohydroxyglutarate aldolase, homoserine-O-succinyl transferase, homoserine kinase, homoserine efflux transporter, diaminopimelate decarboxylase, and/or methylglyoxal synthase is decreased.

9. The modified microorganism according to claim 7, the modified microorganism being Escherichia coli, which overexpresses at least one of the genes chosen among ppc (phosphoenol pyruvate carboxylase), pck, aceA, galP, asd, thrA, metL, lysC all E coli; pycA from L lactis, and/or has at least one of the genes deleted chosen among IdhA, adhE, ackA, pta, poxB, focA, pfIB, sad, gabABC, sfcA, maeB, ppc, pykA, pykF, mgsA, sucAB, ptsl, ptsG, pgi, fumABCaldA, HdD, icIR, metA, thrB, lysA, eda, rthA, rthB, and rthC.

10. A method of production of 2,4-DHB comprising the steps of culturing the modified microorganism of claim 4 in an appropriate culture medium, recovering 2,4-DHB from the culture medium.

11. The method of claim 10 wherein the 2,4-DHB is further purified.

12. The method of claim 1, wherein the enzyme having homoserine transaminase activity either is encoded by the sequence set forth in SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67 or SEQ ID NO: 69, or is selected from SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68 or SEQ ID NO: 70 or is selected from any sequence sharing a sequence identity of at least 95% with SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68 or SEQ ID NO: 70, and the enzyme having OHB reductase activity is selected from the group consisting of (D)-lactate dehydrogenase from Escherichia coli (SEQ ID NO: 4), (L)-lactate dehydrogenase from Lactococcus lactis (SEQ ID NO: 6), the two isoforms of (L)-lactate dehydrogenase from Oryctalagus cuniculus (SEQ ID NO: 12 and SEQ ID NO: 14), (L)-lactate dehydrogenase from Geobacillus stearothermophilus (SEQ ID NO: 10), (L)-lactate dehydrogenase from Bacillus subtilis (SEQ ID NO: 8), (L)-malate dehydrogenase from Escherichia coli (SEQ ID NO: 2), branched chain (D)-2-hydroxyacid dehydrogenase from Lactococcus lactis, and dehydrogenases having an amino acid sequence sharing a sequence identity of at least 95% with at least one of said sequences.

13. The method of claim 12, wherein any amino acid substitutions are conservative amino acid substitutions in which each substituted amino acid is replaced by another biologically similar amino acid.

14. The method of claim 1, wherein the enzyme having homoserine transaminase activity is selected from SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68 or SEQ ID NO: 70 or is selected from any sequence sharing a sequence identity of at least 98% with SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68 or SEQ ID NO: 70, and the enzyme having OHB reductase activity is selected from the group consisting of (D)-lactate dehydrogenase from Escherichia coli (SEQ ID NO: 4), (L)-lactate dehydrogenase from Lactococcus lactis (SEQ ID NO: 6), the two isoforms of (L)-lactate dehydrogenase from Oryctalagus cuniculus (SEQ ID NO: 12 and SEQ ID NO: 14), (L)-lactate dehydrogenase from Geobacillus stearothermophilus (SEQ ID NO: 10), (L)-lactate dehydrogenase from Bacillus subtilis (SEQ ID NO: 8), (L)-malate dehydrogenase from Escherichia coli (SEQ ID NO: 2), branched chain (D)-2-hydroxyacid dehydrogenase from Lactococcus lactis, dehydrogenases having an amino acid sequence sharing a sequence identity of at least 98% with at least one of said sequences.

15. The method of claim 14, wherein any amino acid substitutions are conservative amino acid substitutions in which each substituted amino acid is replaced by another biologically similar amino acid.

16. The method of claim 1, wherein the enzyme having homoserine transaminase activity either is encoded by the sequence set forth in SEQ ID NO: 59, SEQ ID NO: 61, SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67 or SEQ ID NO: 69, or is selected from SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68 or SEQ ID NO: 70, and the enzyme having OHB reductase activity is selected from the group consisting of (D)-lactate dehydrogenase from Escherichia coli (SEQ ID NO: 4), (L)-lactate dehydrogenase from Lactococcus lactis (SEQ ID NO: 6), the two isoforms of (L)-lactate dehydrogenase from Oryctalagus cuniculus (SEQ ID NO: 12 and SEQ ID NO: 14), (L)-lactate dehydrogenase from Geobacillus stearothermophilus (SEQ ID NO: 10), (L)-lactate dehydrogenase from Bacillus subtilis (SEQ ID NO: 8), and (L)-malate dehydrogenase from Escherichia coli (SEQ ID NO: 2).

17. The method of claim 1, wherein the enzyme having homoserine transaminase activity is selected from the group consisting of SEQ ID NO: 60, SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68 or SEQ ID NO: 70, and the enzyme having OHB reductase activity is selected from the group consisting of (D)-lactate dehydrogenase from Escherichia coli (SEQ ID NO: 4), (L)-lactate dehydrogenase from Lactococcus lactis (SEQ ID NO: 6), the two isoforms of (L)-lactate dehydrogenase from Oryctalagus cuniculus (SEQ ID NO: 12 and SEQ ID NO: 14), (L)-lactate dehydrogenase from Geobacillus stearothermophilus (SEQ ID NO: 10), (L)-lactate dehydrogenase from Bacillus subtilis (SEQ ID NO: 8), and (L)-malate dehydrogenase from Escherichia coli (SEQ ID NO: 2).

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) FIG. 1: Method of preparation of 2,4-DHB from homoserine comprising a two step pathway which employs a first step of conversion of the primary amino group of homoserine to a carbonyl group to obtain OHB, and a second step of reduction of the obtained OHB to 2,4-DHB.

(2) FIG. 2: Specific activities of purified L. lactis lactate dehydrogenase mutated in position Q85. (A) specific activities on OHB, (B) specific activities on pyruvate, (C) Substrate specificity expressed as ratio of Vmax values on OHB and pyruvate. Values higher than 1 in graph C indicate preference for OHB (no saturation of enzymatic activity was obtained on either substrate for mutated enzymes between 0 and 50 mM OHB or pyruvate). Activities were measured at a substrate concentration of 20 mM.

(3) FIG. 3: Specific activities of purified E. coli malate dehydrogenase mutated in position R81. (A) specific activities on OHB, (B) specific activities on oxaloacetate. Activities were measured at a substrate concentration of 20 mM OHB or 0.5 mM oxaloacetate.

(4) The following non limiting examples illustrate the invention.

EXAMPLES

Example 1: Demonstration of OHB Reductase Activity

(5) Construction of Plasmids Containing Wild-Type Genes Coding for Lactate Dehydrogenase or Malate Dehydrogenase:

(6) The genes coding for (L)-malate dehydrogenase in Escherichia coli, Ec-mdh (SEQ ID No. 1), (D)-lactate dehydrogenase in E. coli, Ec-ldhA (SEQ ID No. 3), (L)-lactate dehydrogenase of Lactococcus lactis, Ll-ldhA (SEQ ID No. 5), (L)-lactate dehydrogenase of Bacillus subtilis, Bs-ldh (SEQ ID No. 7), (L)-lactate dehydrogenase of Geobacillus stearothermophilus, Gs-ldh (SEQ ID No. 9), the two isoforms of the (L)-lactate dehydrogenase of Oryctalagus cuniculus, Oc-ldhA (SEQ ID No. 11 and SEQ ID No. 13), were amplified by PCR using the high-fidelity polymerase Phusion (Fermentas) and the primers listed in Table 1. Genomic DNAs of E. coli MG1655, L. Lactis IL1403, and B. subtilis strain 168 were used as the template. The genes Oc-ldhA, and Gs-ldh were codon-optimized for expression in E. coli and synthesized by MWG Eurofins. The primers introduced restriction sites (Table 1) upstream of the start codon and downstream of the stop codon, respectively, facilitating the ligation of the digested PCR products into the corresponding sites of the pET28a+ (Novagen) expression vector using T4 DNA ligase (Fermentas). Ligation products were transformed into E. coli DH5 cells (NEB). The resulting pET28-Ec-mdh, pET28-Ec-ldhA, pET28-Ll-ldhA, pET28-Bs-ldh, pET28-Gs-ldh, and pET28-Oc-ldhA plasmids were isolated and shown by DNA sequencing to contain the correct full-length sequence of the E. coli mdh, E. coli ldhA, L. lactis ldhA, B. subtilis ldh, G. stearothermophilus ldh, and O. cuniculus ldhA genes, respectively. The corresponding protein sequences are represented by SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12 and SEQ ID No. 14, respectively.

(7) TABLE-US-00001 TABLE1 Primersequencesandrestrictionsitesusedforamplificationand cloningofcandidateenzymes Forwardandreverseprimersequence Restriction Gene 5 -3 sites Ec-mdh TATAATCATATGAAAGTCGCAGTCCTC(SEQIDNo15). NdeI TATAATGGATCCTTACTTATTAACGAACTC(SEQIDNo.16) BamHI LI-IdhA TATAATCATATGGCTGATAAACAACGTAAAAAA NdeI (SEQIDNo.17) TATAATGGATCCTTAGTTTTTAACTGCAGAAGCAAA BamHI (SEQIDNo.18) Bs_Idh TATAATGCTAGCATGATGAACAAACATGTAAATAAAGT Ndel (SEQIDNo.19) BamHI TATAATGGATCCTTAGTTGACTTTTTGTTC(SEQIDNo.20) Gs-Idh GenewasdeliveredbyMWGEurofins inpET28a NdeI vector BamHI Oc-IdhA TATAATGCTAGCATGGCGGCGTTGAAAGAC(SEQIDNo.21) NheI ATTATAGAATTCTTAAAATTGCAGTTCTTT(SEQIDNo.22) EcoRI LI-panE TATAATCATATGAGAATTACAATTGCCGG(SEQIDNo.23) NdeI TATAATGGATCCTTATTTTGCTTTTAATAACTCTTCTTTGC BamHI (SEQIDNo.24) Ec-IdhA TATAATCATATGAAACTCGCCGTTTATAG(SEQIDNo.25) NdeI TATAATGGATCCTTAAACCAGTTCGTTCGG(SEQIDNo.26) BamHI

(8) Expression of Enzymes:

(9) E. coli BL21 (DE3) star cells were transformed with the appropriate plasmids using standard genetic protocols (Sambrook, Fritsch, & Maniatis, 1989). Enzymes with an N-terminal hexa-His tag were expressed in 50 mL LB cultures that were inoculated from an overnight culture at OD.sub.600 of 0.1 and grown to OD.sub.600 of 0.6 before protein expression was induced by addition of 1 mM isopropyl -D-1-thiogalactopyranoside (IPTG) to the culture medium. After 15 h of protein expression, cells were harvested by centrifugation at 4000 g at 4 C. for 10 min and discarding the supernatant. Cell pellets were stored at 20 C. until further analysis. Growth and protein expression were carried out at 25 C. Culture media contained 50 g/mL kanamycin.

(10) Purification of Enzymes:

(11) Frozen cell pellets of expression cultures were resuspended in 0.5 mL of breakage buffer (50 mM Hepes, 300 mM NaCl, pH 7.5) and broken open by four successive rounds of sonication (sonication interval: 20 s, power output: 30%, sonicator: Bioblock Scientific, VibraCell 72437). Cell debris was removed by centrifuging the crude extracts for 15 min at 4 C. at 4000 g and retaining the clear supernatant. RNA and DNA were removed from the extracts by adding 15 mg/mL streptomycin sulfate (Sigma), centrifuging the samples at 13000 g for 10 min at 4 C. and retaining the supernatant. Clear protein extract was incubated for 1 h at 4 C. with 0.75 mL (bed volume) of Talon Cobalt affinity resin (Clontech). The suspension was centrifuged at 700 g in a table top centrifuge and supernatant was removed. The resin was washed with 10 bed volumes of wash buffer (50 mM Hepes, 300 mM NaCl, 15 mM Imidazole, pH 7.5) before proteins were eluted with 0.5 mL of elution buffer (50 mM Hepes, 300 mM NaCl, 250 mM Imidazole, pH 7.5). Purity of eluted enzymes was verified by SDS-PAGE analysis. Protein concentrations were estimated with the method of Bradford (Bradford (1976, Anal. Biochem. 72: 248-54). To stabilize the lactate dehydrogenase enzymes, the elution buffer was systematically exchanged by 100 mM phosphate buffer adjusted to pH 7. The protein sample was transferred to an Amicon Ultra centrifugal filter (cut-off 10 kDa), and centrifuged during 8 min at 4000 g at 4 C. to remove the buffer. The protein was diluted into phosphate buffer and the procedure was repeated 4 times.

(12) Enzymatic Assays:

(13) The reaction mixture contained 60 mM Hepes (pH 7), 50 mM potassium chloride, 5 mM MgCl.sub.2, 0.25 mM NADH, (optionally 5 mM fructose-1,6-bisphosphate) (all products from Sigma), and appropriate amounts of purified malate or lactate dehydrogenase or cell extract. Reactions were started by adding appropriate amounts of 2-oxo-4-hydroxybutyrate (OHB), pyruvate, or oxaloacetate (OAA). Enzymatic assays were carried out at 37 C. in 96-well flat bottomed microtiter plates in a final volume of 250 L. The reactions were followed by the characteristic absorption of NADH at 340 nm (.sub.NADH=6.22 mM.sup.1 cm.sup.1) in a microplate reader (BioRad 680XR).

(14) OHB was synthesized by incubating 125 mM homoserine with snake venom (L)-amino acid oxidase (1.25 U/mL, Sigma) and catalase (4400 U/mL, Sigma) in 100 mM Tris buffer at pH 7.8 for 90 min at 37 C. Subsequently, the reaction mixture was purified on an Amicon Ultra centrifugal filter with a cut-off of 10 kDa to eliminate the enzymes (method adapted from Wellner & Lichtenberg, 1971).

(15) OHB was quantified by mixing 100 L of the tested solution with 1 mL of a solution containing 1 M sodium arsenate and 1 M boric acid at pH 6.5. The mixture was incubated at room temperature for 30 min and the absorbance at 325 nm was used to quantify OHB. The relation between absorbance and concentration of the ketone was calibrated using pyruvate solutions of known concentrations (method adapted from (Wellner & Lichtenberg, 1971)). The typical OHB yield of the method was 90%.

(16) Results:

(17) The kinetic parameters are listed in Table 2 for the tested enzymes on their natural substrates and OHB. Significant OHB reductase activity was found for all lactate dehydrogenases of different biological origin. Malate dehydrogenase, Mdh, of E. coli only had very minor activity on OHB. The branched chain 2-oxo-acid dehydrogenase, PanE, from L. lactis also had significant activity on OHB.

(18) TABLE-US-00002 TABLE 2 Summary of kinetic parameters of selected candidate enzymes on their natural substrate and OHB Max. specific activity Substrate affinity, Km [mol/(mg min)] [mM] Natural Natural Enzyme substrate.sup.a OHB.sup.b substrate.sup.a OHB Ec-Mdh 95.6 0.01 0.04 ns Ll-Ldh 184 18 2.7 ns Gs-Ldh 87.7 66.8 1.2 1.3 Bs-Ldh 170 15.7 nd ns Ll-PanE nd 2.58 nd ns Oc-LdhA 68.3 6.5 1.5 13 Ec-LdhA 265 0.56 1.8 4.8 .sup.aNatural substrates for Mdh and Ldh are oxaloacetate and pyruvate, respectively .sup.bWhen enzymes could not be saturated, maximum specific activity refers to the activity estimated at 20 mM substrate concentration nsnot saturated ndnot determined

Example 2: Construction of Lactate Dehydrogenase Enzymes with Improved OHB Reductase Activity

(19) Site-directed mutagenesis of the L. lactis ldhA gene was carried out using the pET28-Ll-ldhA plasmid as the template. Point mutations to change the amino acid sequence were introduced by PCR (Phusion 1 U, HF buffer 20% (v/v), dNTPs 0.2 mM, direct and reverse primers 0.04 M each, template plasmid 30-50 ng, water) using the oligonucleotide pairs listed in Table 3. The genes mutated by PCR contained a new restriction site listed in Table 3 (introduced using silent mutations) in addition to the functional mutation to facilitate identification of mutated clones. The PCR products were digested by DpnI at 37 C. for 1 h to remove template DNA, and transformed into competent E. coli DH5 (NEB) cells. The mutated plasmids were identified by restriction site analysis and were verified to carry the desired mutations by DNA sequencing.

(20) TABLE-US-00003 TABLE3 Oligonucleotidesusedtomutatelactatedehydrogenase IdhAfromL.lactis(nnkdenotesadegeneratedcodonwithk representingeitherthymineorcytosine) Restriction Protein Mutation Primersequences5 -3 site LI-LdhA Q85nnk GTCTTGACTTCTGGTGCTCCANNKAAACCAGGTG MluI AAACGCGTCTT(SEQIDNO.27) AAGACGCGTTTCACCTGGTTTMNNTGGAGCACCA GAAGTCAAGAC(SEQIDNO.28) LI-LdhA I226V CGTGATGCTGCTTACTCGATCGTCGCTAAAAAAG PvuI GTG(SEQIDNo.99) CACCTTTTTTAGCGACGATCGAGTAAGCAGCATC ACG(SEQIDNo.100)
Mutant enzymes were expressed, purified and tested for OHB and pyruvate reductase activity as described in Example 1. The activity measurements for both substrates are summarized in FIG. 2. The results demonstrate that the replacement of Gln85 by preferably alanine, cysteine, asparagine, or methionine yields an increase of the enzyme's specificity for OHB, and/or an increase in maximum specific OHB reductase activity.
The mutation Q85N in Ll-Ldh was combined with mutation I226V. It was demonstrated that this exchange had a major positive impact on substrate affinity for OHB.

(21) TABLE-US-00004 TABLE 4 Summary of kinetic parameters of L. lactis lactate dehydrogenase A, Ll-LdhA, mutants on pyruvate and OHB Max. specific activity Km Mutant [mol/(mg min)] [mM] Enzyme Seq ID Pyruvate OHB Pyruvate OHB Q85N SEQ ID No. 30 184 63.9 22.1 29.2 Q85NI226V SEQ ID No. 32 11.5 4.9 1.4 3.3

Example 3: Construction of Malate Dehydrogenase Enzymes with Improved OHB Reductase Activity

(22) Site-directed mutagenesis of the mdh gene from E. coli was carried out as described in Example 2 using the primers listed in Table 5. Plasmid pET28-Ec-mdh was used as the template.

(23) TABLE-US-00005 TABLE5 Oligonucleotidesusedtomutatemalatedehydrogenase mdhfromE.coli.(nnkdenotesadegeneratedcodon withkrepresentingeitherthymineocytosine) Restr. Protein Mutation Primersequences5 -3 site Ec-Mdh R81nnk TTATCTCTGCAGGCGTAGCGNNKAAACCCGGGATGGATCGTTC Sma1 (SEQIDNo.33) GAACGATCCATCCCGGGTTTMNNCGCTACGCCTGCAGAGATAA (SEQIDNo.34) Ec-Mdh R81AM85E TTATCTCTGCAGGCGTAGCGGCTAAACCGGGTGAGGATCGTTCC no GACCTG(SEQIDNO.35) Sma1 CAGGTCGGAACGATCCTCACCCGGTTTAGCCGCTACGCCTGCA GAGATAA(SEQIDNO.36) Ec-Mdh R81A TTATCTCTGCAGGCGTAGCGGCTAAACCGGGTCAGGATCGTTCC no M85Q GACCTG(SEQIDNO.37) Sma1 CAGGTCGGAACGATCCTGACCCGGTTTAGCCGCTACGCCTGCA GAGATAA(SEQIDNO.38) Ec-Mdh I12V GTCGCAGTCCTCGGCGCCGCTGGCGGTGTCGGCCAGGCGCTTG Nar1 CAC(SEQIDNO.39 GTGCAAGCGCCTGGCCGACACCGCCAGCGGCGCCGAGGACTG CGAC(SEQIDNO.40) Ec-Mdh G179D CCGGTTATTGGCGGCCACTCTGATGTTACCATT Eae1 CTGCCGCTGCTG(SEQIDNO.41) CAGCAGCGGCAGAATGGTAACATCAGAGTGGCCGCCAATAACC GG(SEQIDNO.42) Ec-Mdh R81AD86S GGCGTAGCGGCTAAACCGGGTATGTCTCGTTCCGACCTG no (SEQIDNO.43) Sma1 CAGGTCGGAACGAGACATACCCGGTTTAGCCGCTACGCC (SEQIDNO.44)
Mutant enzymes were expressed, purified and tested for OHB and oxaloacetate reductase activity as described in Example 1. The activity measurements on OHB and oxaloacetate are summarized in FIG. 3. The results demonstrate that replacement of Arg81 by alanine, cysteine, glycine, histidine, isoleucine, leucine, methionine, asparagine, glutamine, serine, threonine, or valine confer significant OHB reductase activity, and concomitant decrease of oxaloacetate reductase activity.
The mutation R81A in Ec-Mdh was combined with additional changes in the protein sequence. The results are listed in Table 6. It was demonstrated that the introduction of mutations M85Q, M85E, I12V, D86S or G179D result in an increased activity on OHB.

(24) TABLE-US-00006 TABLE 6 Summary of kinetic parameters of E. coli malate dehydrogenase mutants on oxaloacetate (OAA) and OHB Max. specific activity Km Mutant [mol/(mg min)] [mM] Enzyme Seq ID OAA.sup.a OHB.sup.b OAA OHB Wild-type SEQ ID No. 95 0.01 0.04 ns 2 R81A SEQ ID No. 1.16 1.8 ns ns 102 R81A SEQ ID No. 0.5 4.99 ns ns M85Q 104 R81A SEQ ID No. 1 3 ns ns M85E 106 R81A SEQ ID No. 1.84 18.9 ns 15 M85Q I12V 108 R81A SEQ ID No. 2.2 12.54 ns ns M85E I12V 110 R81A SEQ ID No. 0.37 4.16 ns ns G179D 112 R81A D86S SEQ ID No. 0.67 14.6 ns ns 1114 R81A I12V SEQ ID No. 0.5 4.9 ns ns 115 R81A SEQ ID No. 0.54 19 ns ns G179D 118 D86S .sup.aactivity was measured at 0.5 mM oxaloacetate .sup.bactivity was measured at 20 mM OHB nsnot saturated at concentrations of up to 50 mM of OHB and 0.5 mM of oxaloacetate

Example 4: Demonstration of Homoserine Transaminase Activity for Selected Transaminases

(25) The genes coding for different transaminases in E. coli, S. cerevisiae, and L. lactis were amplified by PCR using the high-fidelity polymerase Phusion (Finnzymes) and the primers listed in Table 7. Genomic DNA of E. coli MG1655, S. cerevisiae BY4741, and L. lactis IL1403 were used as the templates. The primers introduced restriction sites (Table 7) upstream of the start codon and downstream of the stop codon, respectively, facilitating the ligation of the digested PCR products into the corresponding sites of the pET28a+ (Novagen) expression vector using T4 DNA ligase (Biolabs). Ligation products were transformed into E. coli DH5 cells. The resulting plasmids were isolated and shown by DNA sequencing to contain the correct full-length sequence of the corresponding genes. The references to the corresponding protein sequences are listed in Table 7.

(26) TABLE-US-00007 TABLE7 Primersequencesandrestrictionsitesusedforamplificationand cloningofcandidateenzymes(Abbreviationsusedforsourceorganism:Ec E.coli,ScS.cerevisiae,LlL.lactis).Allthegeneswerecloned intopET28a+ (Novagen),addinganN-terminalHexa-HisTag. Forwardandreverseprimersequences Gene Protein Restriction Gene 5 -3 sequence sequence sites Ec-ilvE tataatgctagcatgaccacgaagaaagctgattaca SEQID SEQID NheI (SEQIDNo.47) No.59 No.60 BamHI tataatggatccttattgattaacttgatctaacc (SEQIDNo.48) Ec-tyrB Tataatgctagcgtgtttcaaaaagttgacg SEQID SEQID NheI (SEQIDNo.49) No.61 No.62 BamHI Tataatggatccttacatcaccgcagcaaac (SEQIDNo.50) Ec-aspC Tataatgctagcatgtttgagaacattaccgc SEQID SEQID NheI (SEQIDNo.51) No.63 No.64 BamHI Tataatggatccttacagcactgccacaatcg (SEQIDNo.52) Ll-araT Tataatgctagcatggatttattaaaaaaatttaaccct SEQID SEQID NheI aa(SEQIDNo.53) No.65 No.66 BamHI Tataatggatcctcagccacgttttttagtcacataa (SEQIDNo.54) Ll-bcaT Tataatgctagcatggcaattaatttagactg SEQID SEQID NheI (SEQIDNo.55) No.67 No.68 BamHI Tataatggatccttaatcaactttaactatcc (SEQIDNo.56) Sc-ARO8 Tataatcatatgatcatgactttacctgaatcaaaaga SEQID SEQID NheI (SEQIDNo.57) No.69 No.70 BamHI Tataatggatccctatttggaaataccaaattcttcg (SEQIDNo.58)
Enzymes were expressed and purified as described in Example 1, and tested for homoserine transaminase activity under the conditions described below.

(27) Enzymatic Assays:

(28) Transaminase activity of several candidate aminotransferases was quantified with 2-oxoglutarate as the amino group acceptor. Transaminase reactions were carried out using homoserine and the preferred amino acid of the enzymes. The reactions were followed by the amino acid-dependent oxidation of NADH in the coupled dehydrogenase reaction.

(29) Transaminase Assays (Reaction Scheme)

(30) Transaminase: Amino acid+2-oxoglutarate.fwdarw.2-oxo-acid+glutamate

(31) Dehydrogenase: 2-oxo-acid+NADH.fwdarw.2-hydroxy-acid+NAD.sup.+

(32) The reaction mixture contained 60 mM Hepes (pH 7), 50 mM potassium chloride, 5 mM MgCl.sub.2, 4 mM 2-oxoglutarate, 0.1 mM pyridoxal-5-phosphate (PLP), 0.25 mM NADH, (optionally 5 mM fructose-1,6-bisphosphate) (all products from Sigma), 4 Units/mL of auxiliary 2-hydroxyacid dehydrogenase, and appropriate amounts of purified aminotransferase or cell extract. The auxiliary dehydrogenase enzyme was purified PanE from L. lactis in case of the amino acids phenylalanine and leucine (Chambellon, Rijnen, Lorquet, Gitton, van HylckamaVlieg, Wouters, & Yvon, 2009), malate dehydrogenase (Sigma) in case of aspartate, and rabbit muscle (L)-lactate dehydrogenase (Sigma) when homoserine was used as the starting substrate. Reactions were started by adding 50 mM of the amino acid.

(33) Enzymatic assays were carried out at 37 C. in 96-well flat bottomed microtiter plates in a final volume of 250 L. The reactions were followed by the characteristic absorption of NAD(P)H at 340 nm (.sub.NADPH=6.22 mM.sup.1 cm.sup.1) in a microplate reader (BioRad 680XR).

(34) Results:

(35) The kinetic parameters of different aminotransferases are listed in Table 8. Significant homoserine transaminase activity was found for the listed transaminase enzymes.

(36) TABLE-US-00008 TABLE 8 Transaminase activities of tested candidate enzymes on homoserine and their preferred amino acid substrate (Abbreviations used for source organism: EcE. coli, ScS. cerevisiae, LlL. lactis). Max. specific activity on different substrates [mol/(min mg.sub.prot)] Enzyme Homoserine* Preferred amino acid Ec-IlvE 0.077 10.6.sup.(L) Ec-TyrB 0.057 9.03.sup.(P) Ec-AspC 0.082 74.031.sup.(A) Ll-AraT 0.109 11.72.sup.(P) Ll-BcaT 0.028 30.39.sup.(L) Sc-ARO8 0.076 20.5.sup.(P) *activity measured at 50 mM homoserine,

Example 5: Construction of Plasmids for Overexpression of the Homoserine Pathway Enzymes

(37) Construction of the Plasmids pTAC-op-HMS1 and pACT3-op-HMS1

(38) The plasmid pET28-LYSCwt was constructed by amplifying the lysC gene by PCR using high fidelity polymerase Phusion (Finnzymes) and the direct and reverse primers .sup.5CACGAGGTACATATGTCTGAAATTGTTGTCTCC.sup.3 (SEQ ID No. 71) and .sup.5CTTCCAGGGGATCCAGTATTTACTCAAAC.sup.3 (SEQ ID No. 72) that introduced a NdeI and BamHI restriction sites upstream of the start codon and downstream of the stop codon, respectively. Genomic DNA from E. coli MG1655 was used as the template. The PCR product was digested with NdeI and BamHI, ligated into the corresponding sites of the pET28a (Novagen) expression vector using T4 DNA ligase (Biolabs), and transformed into E. coli DH5 cells. The resulting pET28-LYSCwt plasmid was isolated and shown by DNA sequencing to contain the full-length lysC gene having the correct sequence (SEQ ID No. 73).

(39) Site-directed mutagenesis of lysC to alleviate inhibition by lysine was carried out using the pET28-LYSCwt plasmid as the template. A point mutation to change the amino acid sequence in position 250 from glutamate to lysine (E250K, SEQ ID No. 36) was introduced by PCR (Phusion 1 U, HF buffer 20% (v/v), dNTPs 0.2 mM, direct and reverse primers 0.04 M each, template plasmid 50 ng, water) using the oligonucleotides .sup.5GCGTTTGCCGAAGCGGCAAAGATGGCCACTTTTG.sup.3 (SEQ ID No. 74) and .sup.5CAAAAGTGGCCATCTTTGCCGCTTCGGCAAACGC.sup.3 (SEQ ID No. 75). The PCR product (SEQ ID No. 35) was digested by DpnI at 37 C. for 1 h to remove template DNA, and transformed into competent E. coli DH5 (NEB) cells. The mutated plasmid pET28-LYSC* was identified by restriction site analysis and verified to carry the desired mutations by DNA sequencing.

(40) The plasmid pET28-ASDwt was constructed by amplifying the asd gene of E. coli by PCR using high fidelity polymerase Phusion (Finnzymes) and the direct and reverse primers .sup.5TATAATGCTAGCATGAAAAATGTTGGTTTTATCGG.sup.3 (SEQ ID No. 76) and .sup.5TATAATGGA-TCCTTACGCCAGTTGACGAAGC.sup.3 (SEQ ID No. 77) that introduced a NheI and BamHI restriction site upstream of the start codon and downstream of the stop codon, respectively. Genomic DNA from E. coli DH5 was used as the template. The PCR product was digested with NheI and BamHI, ligated into the corresponding sites of the pET28a (Novagen) expression vector using T4 DNA ligase (Biolabs), and transformed into E. coli DH5 cells. The resulting pET28-ASDwt plasmid was isolated and shown by DNA sequencing to contain the full-length asd gene having the correct sequence (SEQ ID No. 98).

(41) The plasmid pET28-HOM6 wt was constructed by amplifying the HOM6 gene of S. cerevisiae by PCR using high fidelity polymerase Phusion (Finnzymes) and the direct and reverse primers .sup.5TATAATCATATGAGCACTAAAGTTGTTAATG.sup.3 (SEQ ID No. 78) and .sup.5TATAATGGATC-CCTAAAGTCTTTGAGCAATC.sup.3 (SEQ ID No. 79) that introduced a NdeI and BamHI restriction site upstream of the start codon and downstream of the stop codon, respectively. Genomic DNA from S. cerevisiae BY4741 was used as the template. The PCR product was digested with NdeI and BamHI, ligated into the corresponding sites of the pET28a (Novagen) expression vector using T4 ligase (Biolabs), and transformed into E. coli DH5 cells. The resulting pET28-HOM6 wt plasmid was isolated and shown by DNA sequencing to contain the full-length HOM6 gene having the correct sequence (SEQ ID No. 97).

(42) The plasmid pET28-LYSC* was used as the backbone for the construction of the pTAC-op-HMS plasmid that enabled the expression of lysine-insensitive aspartate kinase, aspartate semialdehyde dehydrogenase, and homoserine dehydrogenase from an inducible tac promoter.

(43) The asd gene was obtained by PCR from pET28-asdwt. The whole coding region and part of the upstream region comprising the pET28 ribosome binding site (rbs) and the in-frame N-terminal His-Tag were amplified by PCR using high fidelity polymerase Phusion (Finnzymes) and the direct and reverse primers .sup.5TATAAGGATCCGTTTAACTTTAAGAAGGAGATATACCATGGG.sup.3 (SEQ ID No. 80) and .sup.5TATAAGAATTCTTACGCCAGTTGACGAAG.sup.3 (SEQ ID No. 81) that introduced a BamHI and EcoRI restriction site upstream of the rbs and downstream of the stop codon, respectively. The PCR product was digested with BamHI and EcoRI, ligated into the corresponding sites of pET28-LYSC*, using T4 DNA ligase (Biolabs), and transformed into E. coli DH5 cells. The resulting pET28-LYSC*-ASD plasmid was isolated and shown by DNA sequencing to have the correct sequence.

(44) The HOM6 gene was obtained by PCR from pET28-HOM6 wt. The whole coding region and part of the upstream region comprising the pET28 ribosome binding site and the in-frame N-terminal His-Tag were amplified by PCR using high fidelity polymerase Phusion (Finnzymes), the direct primer .sup.5TATAAGCGGCCGCGTTTAACTTTAAGAAGGAGATAT.sup.3 (SEQ ID No. 82), and the reverse primer .sup.5TATAAACTCGAGCCTAAAGTCTTTGAGCAAT.sup.3 (SEQ ID No. 83) that introduced a NotI and a PspXI restriction site upstream of the rbs and downstream of the stop codon, respectively. The PCR product was digested with NotI and PspXI, ligated into the corresponding sites of pET28-LYSC*-ASD, using T4 DNA ligase (Biolabs), and transformed into E. coli DH5 cells. The resulting pET28-op-HMS1 plasmid was isolated and shown by DNA sequencing to have the correct sequence.

(45) The 5 upstream promoter region simultaneously regulating the expression of the three genes (i.e. the T7 promoter in pET28a+) can be replaced with any other promoter, inducible or constitutive, by digesting the plasmids with SphI and XbaI and cloning another promoter region with suitable restriction sites.

(46) In the present non-exclusive example, the T7 promoter of the pET28a+ backbone was replaced by the artificial IPTG-inducible tac promoter (de Boer et al., 1983). The tac promoter was obtained from plasmid pEXT20 (Dykxhoorn et al., 1996) by digesting this plasmid with SphI and XbaI. The DNA fragment containing the promoter was purified and cloned into SphI and XbaI digested pET28-op-HMS1 obtaining pTAC-op-HMS1. The resulting pTAC-op-HMS plasmid was isolated and shown by DNA sequencing to have the correct sequence.

(47) The operon containing the coding sequences of lysC*, asd, and HOM6 was PCR amplified from the plasmid pTAC-op-HMS1 using the primers 5-TATAAAGATCTTAGAAATAATTTTGTTTA-3 (SEQ ID No. 84) and 5-TATAATCTAGACTAAAGTCTTTGAGCAAT-3 (SEQ ID No. 85) which introduced a BglII and a XbaI restriction site at the 5 and the 3 end, respectively, of the PCR fragment. The fragment was purified, digested with BglII and XbaI and cloned into the corresponding sites of pACT3 (Dykxhoorn et al., 1996) to obtain the vector pACT3-op-HMS1. The resulting pACT3-op-HMS1 plasmid was isolated and shown by DNA sequencing to have the correct sequence.

(48) Construction of the Plasmids pEXT20-op-HMS2 and pACT3-op-HMS2

(49) The plasmid pET28-thrAwt was constructed by amplifying the E. coli thrA gene encoding bifunctional enzyme aspartate kinase/homoserine dehydrogenase I by PCR using high fidelity polymerase Phusion (Finnzymes) and the direct and reverse primers 5-TATAATCATATGCGAGTGTTGAAGTTCG-3 (SEQ ID No. 86) and 5-TATAATGGATCCTCAGACTCCTAACTTCCA-3 (SEQ ID No. 87) that introduced a NdeI and BamHI restriction sites upstream of the start codon and downstream of the stop codon, respectively. Genomic DNA from E. coli MG1655 was used as the template. The PCR product was digested with NdeI and BamHI, ligated into the corresponding sites of the pET28a+ (Novagen) expression vector using T4 DNA ligase (Biolabs), and transformed into NEB 5-alpha competent E. coli cells (NEB). The resulting pET28-thrAwt plasmid was isolated and shown by DNA sequencing to contain the full-length thrA gene having the correct sequence (SEQ ID No. 88). The corresponding protein is represented by SEQ ID No. 89.

(50) An aspartate kinase/homoserine dehydrogenase with strongly decreased sensitivity for inhibition by threonine was constructed by site directed mutagenesis, replacing serine in position 345 with phenylalanine (S345F). Site-directed mutagenesis was carried out using the direct and reverse primers 5-TGTCTCGAGCCCGTATTTTCGTGGTGCTG-3 (SEQ ID No. 90) and 5-CAGCACCACGAAAATACGGGCTCGAGACA-3 (SEQ ID No. 91) and the pET28-thrAwt plasmid as the template. A single point mutation to change the amino acid sequence was introduced by PCR (Phusion 1 U, HF buffer 20% (v/v), dNTPs 0.2 mM, direct and reverse primers 0.04 M each, template plasmid 30-50 ng, water). Plasmids created by PCR contained a new restriction site for XhoI (underlined) introduced by silent mutation in addition to the functional mutation to facilitate identification of mutated clones. The PCR products were digested by DpnI at 37 C. for 1 h to remove template DNA, and transformed into DH5 competent E. coli cells (NEB). The mutated plasmid pET_Ec_thrA_S345F was identified by restriction site analysis and verified to carry the desired mutation by DNA sequencing.

(51) The thrAS345F coding region of the bifunctional E. coli aspartate kinase/homoserine dehydrogenase was obtained by PCR using the plasmid pET_Ec_thrA_S345F as the template (SEQ ID No. 92). The whole coding region was amplified by PCR using high fidelity polymerase Phusion (Finnzymes) and the direct and reverse primers 5-TATAATGAGCTCGTTTAACTTTAAGAAGGAGATATACCATGCGAGTGTTGA AGTTCGGCG-3 (SEQ ID No. 93) and 5-TATAATCCCGGGTCAGACTCCTAACTTCCA-3 (SEQ ID No. 94) that introduced a SacI and XmaI restriction site (underlined) upstream of the start codon and downstream of the stop codon, respectively. The direct primer includes the ribosome binding site (bold face) sequence of pET28. The PCR product was digested with SacI and XmaI, ligated into the corresponding sites of either pEXT20 or pACT3 (Dykxhoorn, St Pierre, & Linn, 1996), using T4 DNA ligase (Biolabs), and transformed into E. coli DH5 cells. The resulting pEXT20-op-HMS2_step1 and pACT3-op-HMS2_step1 plasmids were isolated and shown by DNA sequencing to have the correct sequence.

(52) Escherichia coli aspartate semialdehyde dehydrogenase asd was amplified by PCR using high fidelity polymerase Phusion (Finnzymes) and the direct and reverse primers 5-TATAATCCCGGGGTTTAACTTTAAGAAGGAGATATACCATGAAAAATGTTG GTTTTATCGGC-3 (SEQ ID No. 95) and 5-TATAATGGATCCTTACGCCAGTTGACGAAG-3 (SEQ ID No. 96) that introduced a XmaI and BamHI restriction site upstream of the start codon and downstream of the stop codon, respectively (SEQ ID No. 98). The direct primer includes the ribosome binding site sequence of pET28. Genomic DNA of E coli MG1655 was used as the template. The PCR product was digested with XmaI and BamHI, ligated into the corresponding sites of pEXT20-op-HMS2_step1 and pACT3-op-HMS2_step1, directly downstream the E. coli thrA gene, using T4 DNA ligase (Biolabs), and transformed into E. coli DH5 cells. The resulting pEXT20-op-HMS2 and pACT3-op-HMS2 plasmids were isolated and shown by DNA sequencing to have the correct sequence.

Example 6: Construction of Plasmids for Overexpression of Phosphoenolpyruvate (PEP) Carboxykinase, PEP Carboxylase, Pyruvate Kinase, Pyruvate Carboxylase, Isocitrate Lyase Enzymes and the Galactose Symporter Permease

(53) The plasmid pACT3-pck harbouring the PEP carboxykinase encoding pck gene of E. coli was constructed by amplifying the pck coding sequence using genomic DNA from E. coli MG1655 as the template and the forward and reverse primers, respectively, .sup.5TATAATCCCGGGATGCGCGTTAACAATGGTTTGACC.sup.3 (SEQ ID No. 119) and .sup.5TATAATTCTAGATTACAGTTTCGGACCAGCCG.sup.3 (SEQ ID No. 120). The DNA fragment was digested with XmaI and XbaI, ligated into the corresponding sites of the pACT3 expression vector (Dykxhoorn et al., 1996) using T4 DNA ligase (Biolabs), and transformed into E. coli DH5 cells. The transformants were selected on solid LB medium containing chloramphenicol (25 g/mL). The resulting plasmid was isolated and correct insertion of the pck gene was verified by sequencing. Plasmids pACT3-aceA, pACT3-ppc, pACT3-galP, pACT3-pck and pACT3-pycA harbouring, respectively, aceA, ppc, galP, or pck (all E. coli) or pycA from Lactococcus lactis were constructed analogously using the primers listed in Table 9.

(54) TABLE-US-00009 TABLE9 Primersusedforconstructionofplasmidsforgeneoverexpression. RestrictionsitesusedforcloningintopACT3areunderlined Gene Primer Linker Sequence Ec_pck Ec_pck_clon_for XmaI tataatcccgggatgcgcgttaacaatggtttgacc (SEQIDNo.121) Ec_pck_clon_rev XbaI tataattctagattacagtttcggaccagccg (SEQIDNo.122) Ec_ppc Ec_ppc_clon_for XmaI tataatcccgggatgaacgaacaatattcc (SEQIDNo.123) Ec_ppc_clon_rev XbaI tataattctagattagccggtattacgcat (SEQIDNo.124) Ec_aceA Ec_aceA_clon_for XmaI tataatcccgggatgaaaacccgtacacaacaaatt (SEQIDNo.125) Ec_aceA_clon_rev XbaI tataattctagattagaactgcgattcttcag (SEQIDNo.126) LI_pycA LI_pycA_clon_for XmaI tataatcccgggatgaaaaaactactcgtcgccaat (SEQIDNo.127) Ll_pycA_clon_rev XbaI tataattctagattaattaatttcgattaaca (SEQIDNo.128) Ec_galP Ec_galP_clon_for XmaI tataatcccgggatgcctgacgctaaaaaacaggggcggt (SEQIDNo.129) Ec_galP_clon_rev XbaI tataattctagattaatcgtgagcgcctatttc (SEQIDNo.130)

Example 7: Construction of the Plasmid for Overexpression of the Homoserine Transaminase and the OHB Reductase

(55) The coding sequence of the branched chain amino transferase, IlvE, from E. coli was PCR amplified using the forward and reverse primers 5-ACAATTTCACACAGGAAACAGAATTCGAGCTCGGTACCGTTTAACTTTAAG AAGGAGATATACCATGACCACGAAGAAAGCTGATTAC-3 (SEQ ID No. 131) and 5-GGATAACTTTTTTACGTTGTTTATCAGCCATGGTATATCTCCTTCTTAAAGT TAAACGGATCCTTATTGATTAACTTG-3 (SEQ ID No. 132), respectively, and plasmid pET28-Ec-ilvE (Example 4) as the template. The coding sequence of lactate dehydrogenase, LdhA, from L. lactis was PCR amplified using the forward and reverse primers 5-TAATATGGATCCGTTTAACTTTAAGAAGGAGATATACCATGGCTGATAAAC AACGTAAAAAAGTTATCC-3 (SEQ ID No. 133) and 5-CAATGCGGAATATTGTTCGTTCATGGTATATCTCCTTCTTAAAGTTAAACTC TAGATTAGTTTTTAACTGCAGAAGCAAATTC-3 (SEQ ID No. 134), respectively, and plasmid pET28-Ll-ldhA (Example 1) as the template. The amplified PCR fragments were fused in an overlap extension PCR by adding 150 ng of each fragment to 50 L of the reaction mix and running a PCR using primers 5-ACAATTTCACACAGGAAACAGAATTCGAGCTCGGTACCGTTTAACTTTAAG AAGGAGATATACCATGACCACGAAGAAAGCTGATTAC-3 (SEQ ID No. 135) and 5-CAATGCGGAATATTGTTCGTTCATGGTATATCTCCTTCTTAAAGTTAAACTC TAGATTAGTTTTTAACTGCAGAAGCAAATTC-3 (SEQ ID No. 136). The resulting PCR fragment was purified, digested with KpnI and XbaI, and ligated into the corresponding sites of pEXT20 (Dykxhoorn, St Pierre, & Linn, 1996) using T4 DNA ligase (Fermentas). The ligation product was transformed into E. coli DH5. The resulting plasmid pEXT20-DHB was isolated and shown by DNA sequencing to contain the correct full-length coding sequences of Ec-ilvE and Ll-ldhA. The plasmid was then transformed into E. coli MG1655-derived mutant strains and tested regarding DHB production.

Example 8: Construction of Optimized Strains for DHB Production

(56) Several genes were disrupted in E. coli strain MG1655 in order to optimise carbon flux repartitioning and cofactor supply for DHB production. Gene deletions were carried out using phage transduction method, or the lambda red recombinase method according to Datsenko et al. (Datsenko & Wanner, 2000).

(57) Protocol for Introduction of Gene Deletions Using the Phage Transduction Method:

(58) Strains carrying the desired single deletions were obtained from the Keio collection (Baba et al., 2006). Phage lysates of single deletion mutants were prepared by inoculating 10 mL of LB medium containing 50 g/mL kanamycin, 2 g/L glucose, and 5 mM CaCl.sub.2 with 100 L of overnight precultures. Following an incubation of 1 h at 37 C., 200 L of phage lysate prepared from the wild-type MG1655 strain were added, and cultures were incubated for another 2-3 h until cell lysis had completed. After addition of 200 L chloroform, cell preparations were first vigorously vortexted and then centrifuged for 10 min at 4500g. The clear lysate was recovered and stored at 4 C.

(59) The receptor strain was prepared for phage transduction by an overnight cultivation at 37 C. in LB medium. A volume of 1.5 mL of the preculture was centrifuged at 1500g for 10 min. The supernatant was discarded and the cell pellet was resuspended in 600 l of a solution containing 10 mM MgSO.sub.4 and 5 mM CaCl.sub.2. The transduction was carried out by mixing 100 L of the solution containing the receptor strain with 100 L of lysate and incubating this mixture at 30 C. for 30 min. Thereafter, 100 L of a 1M sodium citrate solution were added followed by vigorous vortexing. After addition of 1 mL LB medium, the cell suspension was incubated at 37 C. for 1 h before spreading the cells on LB agar dishes containing 50 g/mL kanamycin. Clones able to grow in presence of the antibiotic were confirmed by colony PCR to contain the desired deletion using the primers listed in Table 11. After the introduction of each gene deletion, the antibiotic marker was removed as described above following the method of (Cherepanov & Wackernagel, 1995). The deletions ldhA, adhE, metA, thrB, rhtB, and lldD were successively introduced by the described method.

(60) Protocol for Introduction of Gene Deletions Using the Lambda-Red Recombinase Method:

(61) The deletion cassettes were prepared by PCR using high fidelity polymerase Phusion (Finnzymes), and the FRT-flanked kanamycin resistance gene (kan) of plasmid pKD4 as the template (Datsenko & Wanner, 2000). Sense primers contained sequences corresponding to the 5 end of each targeted gene (underlined) followed by 20 bp corresponding to the FRT-kan-FRT cassette of pKD4. Anti-sense primers contained sequences corresponding to the 3 end region of each targeted gene (underlined) followed by 20 bp corresponding to the cassette. The primers are described in Table 10. PCR products were digested with DpnI and purified prior to transformation.

(62) E. coli MG1655 strain was rendered electro-competent by growing the cells to an OD.sub.600 of 0.6 in LB liquid medium at 37 C., concentrating the cells 100-fold, and washing them twice with ice-cold 10% glycerol. The cells were transformed with plasmid pKD46 (Datsenko & Wanner, 2000) by electroporation (2.5 kV, 200 , 25 F, in 2 mm gap cuvettes). Transformants were selected at 30 C. on ampicillin (100 g/mL) LB solid medium.

(63) Disruption cassettes were transformed into electro-competent E. coli strains harbouring the lambda Red recombinase-expressing plasmid pKD46. The cells were grown at 30 C. in liquid SOB medium containing ampicillin (100 g/mL). The lambda red recombinase system was induced by adding 10 mM arabinose when OD.sub.600 of the cultures reached 0.1. Cells were further grown to an OD.sub.600 of 0.6 before they were harvested by centrifugation, washed twice with ice-cold 10% glycerol, and transformed with the disruption cassette by electroporation. After an overnight phenotypic expression at 30 C. in LB liquid medium, cells were plated on solid LB medium containing 25 g/mL kanamycin. Transformants were selected after cultivation at 30 C.

(64) The gene replacement was verified by colony PCR using Crimson Taq polymerase (NEB). A first reaction was carried out with the flanking locus-specific primers (see Table 11) to verify simultaneous loss of the parental fragment and gain of the new mutant specific fragment. Two additional reactions were done by using one locus-specific primer together with one of the corresponding primers k1rev, or k2 for (see Table 11) that align within the FRT-kanamycin resistance cassette (sense locus primer/k1rev and k2for/reverse locus primer).

(65) The resistance gene (FRT-kan-FRT) was subsequently excised from the chromosome using the FLP recombinase-harbouring plasmid pCP20 (Cherepanov & Wackernagel, 1995) leaving a scar region containing one FRT site. pCP20 is an ampicillin and CmR plasmid that shows temperature-sensitive replication and thermal induction of FLP recombinase synthesis. Kanamycin resistant mutants were transformed with pCP20, and ampicillin-resistant transformants were selected at 30 C. Transformants were then grown on solid LB medium at 37 C. and tested for loss of all antibiotic resistances. Excision of the FRT-kanamycin cassette was analysed by colony PCR using crimson taq polymerase and the flanking locus-specific primers (Table 11). Multiple deletions were obtained by repeating the above described steps.

(66) TABLE-US-00010 TABLE10 Primersusedforgenedisruptions.Sequenceshomologoustotarget genesareunderlined Gene Primer Sequence ldhA _ldhA_for gaaggttgcgcctacactaagcatagttgttgatgagtgtaggctggagctgcttc (SEQIDNo.137) _ldhA_rev ttaaaccagttcgttcgggcaggtttcgcctttttcatgggaattagccatggtcc SEQIDNo.138) adhE _adhE_for atggctgttactaatgtcgctgaacttaacgcactcgtagagcgtgtgtaggctggagctgcttc (SEQIDNo.139) _adhE_rev ttaagcggattttttcgcttttttctcagctttagccggagcagccatatgaatatcctccttag (SEQIDNo.140) ackA _ackA_for atgtcgagtaagttagtactggttctgaactgcggtagttcttcagtgtaggctggagctgcttc (SEQIDNo.141 _ackA_rev tcaggcagtcaggcggctcgcgtcttgcgcgataaccagttcttccatatgaatatcctccttag (SEQIDNo.142) focA- _focA- ttactccgtatttgcataaaaaccatgcgagttacgggcctataagtgtaggctggagctgcttc pflB pflB_for (SEQIDNo.143) _focA- atagattgagtgaaggtacgagtaataacgtcctgctgctgttctcatatgaatatcctccttag pflBrev (SEQIDNo.144) pta _pta_for gtgtcccgtattattatgctgatccctaccggaaccagcgtcggtgtgtaggctggagctgcttc (SEQIDNo.145) _pta_rev ttactgctgctgtgcagactgaatcgcagtcagcgcgatggtgtacatatgaatatcctccttag (SEQIDNo.146) poxB _poxB_for atgaaacaaacggttgcagcttatatcgccaaaacactcgaatcggtgtaggctggagctgcttc (SEQIDNo.147) _poxB_rev ttaccttagccagtttgttttcgccagttcgatcacttcatcacccatatgaatatcctccttag (SEQIDNo.148) sad _sad_for atgaccattactccggcaactcatgcaatttcgataaatcctgccgtgtaggctggagctgcttc (SEQIDNo.149) _sad_rev tcagatccggtctttccacaccgtctggatattacagaattcgtgcatatgaatatcctccttag (SEQIDNo.150) gabD _gabD_for atgaaacttaacgacagtaacttattccgccagcaggcgttgattgtgtaggctggagctgcttc (SEQIDNo.151) _gabD_rev ttaaagaccgatgcacatatatttgatttctaagtaatcttcgatcatatgaatatcctccttag (SEQIDNo.152) gadA _gadA_for atggaccagaagctgttaacggatttccgctcagaactactcgatgtgtaggctggagctgcttc (SEQIDNo.153) _gadA_rev tcaggtgtgtttaaagctgttctgctgggcaataccctgcagtttcatatgaatatcctccttag (SEQIDNo.154) gadB _gadB_for atggataagaagcaagtaacggatttaaggtcggaactactcgatgtgtaggctggagctgcttc (SEQIDNo.155) _gadB_rev tcaggtatgtttaaagctgttctgttgggcaataccctgcagtttcatatgaatatcctccttag (SEQIDNo.156) gadC _gadC_for atggctacatcagtacagacaggtaaagctaagcagctcacattagtgtaggctggagctgcttc (SEQIDNo.157) _gadC_rev ttagtgtttcttgtcattcatcacaatatagtgtggtgaacgtgccatatgaatatcctccttag (SEQIDNo.158) sfcA _sfcA_for atggaaccaaaaacaaaaaaacagcgttcgctttatatcccttacgtgtaggctggagctgcttc (SEQIDNo.159) _sfcA_rev ttagatggaggtacggcggtagtcgcggtattcggcttgccagaacatatgaatatcctccttag (SEQIDNo.160) maeB _maeB_for atggatgaccagttaaaacaaagtgcacttgatttccatgaatttgtgtaggctggagctgcttc (SEQIDNo.161) _maeB_rev ttacagcggttgggtttgcgcttctaccacggccagcgccaccatcatatgaatatcctccttag (SEQIDNo.162) ppc _ppc_for atgaacgaacaatattccgcattgcgtagtaatgtcagtatgctcgtgtaggctggagctgcttc (SEQIDNo.163) _ppc_rev ttagccggtattacgcatacctgccgcaatcccggcaatagtgaccatatgaatatcctccttag (SEQIDNo.164) pykA _pykA_for atgtccagaaggcttcgcagaacaaaaatcgttaccacgttaggcgtgtaggctggagctgcttc (SEQIDNo.165) _pykA_rev ttactctaccgttaaaatacgcgtggtattagtagaacccacggtcatatgaatatcctccttag (SEQIDNo.166) pykF _pykF_for atgaaaaagaccaaaattgtttgcaccatcggaccgaaaaccgaagtgtaggctggagctgcttc (SEQIDNo.167) _pykF_rev ttacaggacgtgaacagatgcggtgttagtagtgccgctcggtaccatatgaatatcctccttag (SEQIDNo.168) mgsA _mgsA_for atggaactgacgactcgcactttacctgcgcggaaacatattgcggtgtaggctggagctgcttc (SEQIDNo.169) _mgsA_rev ttacttcagacggtccgcgagataacgctgataatcggggatcagcatatgaatatcctccttag (SEQIDNo.170) iclR _iclR_for atggtcgcacccattcccgcgaaacgcggcagaaaacccgccgttgtgtaggctggagctgcttc (SEQIDNo.171) _iclR_rev tcagcgcattccaccgtacgccagcgtcacttccttcgccgctttcatatgaatatcctccttag (SEQIDNo.172) icd icd_for atggaaagtaaagtagttgttccggcacaaggcaagaagatcaccgtgtaggctggagctgcttc (SEQIDNo.173) icd_rev ttacatgttttcgatgatcgcgtcaccaaactctgaacatttcagcatatgaatatcctccttag (SEQIDNo.174) sucA _sucA_for atgcagaacagcgctttgaaagcctggttggactcttcttacctcgtgtaggctggagctgcttc (SEQIDNo.175) _sucA_rev ttattcgacgttcagcgcgtcattaaccagatcttgttgctgtttcatatgaatatcctccttag (SEQIDNo.176) sucB _sucB_for atgagtagcgtagatattctggtccctgacctgcctgaatccgtagtgtaggctggagctgcttc (SEQIDNo.177) _sucB_rev ctacacgtccagcagcagacgcgtcggatcttccagcaactctttcatatgaatatcctccttag (SEQIDNo.178) frdA _frdA_for gtgcaaacctttcaagccgatcttgccattgtaggcgccggtggcgtgtaggctggagctgcttc (SEQIDNo.179) _frdA_rev tcagccattcgccttctccttcttattggctgcttccgccttatccatatgaatatcctccttag (SEQIDNo.180) frdB _frdB_for atggctgagatgaaaaacctgaaaattgaggtggtgcgctataacgtgtaggctggagctgcttc (SEQIDNo.181) _frdB_rev ttagcgtggtttcagggtcgcgataagaaagtctttcgaactttccatatgaatatcctccttag (SEQIDNo.182) frdC _frdC_for atgacgactaaacgtaaaccgtatgtacggccaatgacgtccaccgtgtaggctggagctgcttc (SEQIDNo.183) _frdC_rev ttaccagtacagggcaacaaacaggattacgatggtggcaaccaccatatgaatatcctccttag (SEQIDNo.184) frdD _frdD_for atgattaatccaaatccaaagcgttctgacgaaccggtattctgggtgtaggctggagctgcttc (SEQIDNo.185) _frdD_rev ttagattgtaacgacaccaatcagcgtgacaactgtcaggatagccatatgaatatcctccttag (SEQIDNo.186) ptsI _ptsI_for atgatttcaggcattttagcatccccgggtatcgctttcggtaaagtgtaggctggagctgcttc (SEQIDNo.187) _ptsI_rev ttagcagattgttttttcttcaatgaacttgttaaccagcgtcatcatatgaatatcctccttag (SEQIDNo.188) ptsG _ptsG_for atgtttaagaatgcatttgctaacctgcaaaaggtcggtaaatcggtgtaggctggagctgcttc (SEQIDNo.189) _ptsG_rev ttagtggttacggatgtactcatccatctcggttttcaggttatccatatgaatatcctccttag (SEQIDNo.190) lacI _lacI_for gtgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtcgtgtaggctggagctgcttc (SEQIDNo.191) _lacI_rev tcactgcccgctttccagtcgggaaacctgtcgtgccagctgcatcatatgaatatcctccttag (SEQIDNo.192) lldD _lIdD_for atgattatttccgcagccagcgattatcgcgccgcagcgcaacgcgtgtaggctggagctgcttc (SEQIDNo.193) _IldD_rev ctatgccgcattccctttcgccatgggagccagtgccgcaggcaacatatgaatatcctccttag (SEQIDNo.194) pgi _pgi_for atgaaaaacatcaatccaacgcagaccgctgcctggcaggcactagtgtaggctggagctgcttc (SEQIDNo.195) _pgi_rev ttaaccgcgccacgctttatagcggttaatcagaccattggtcgacatatgaatatcctccttag (SEQIDNo.196) metA _metA_for atgccgattcgtgtgccggacgagctacccgccgtcaatttcttggtgtaggctggagctgcttc (SEQIDNo.197) _metA_rev ttaatccagcgttggattcatgtgccgtagatcgtatggcgtgatcatatgaatatcctccttag (SEQIDNo.198) thrB _thrB_for atggttaaagtttatgccccggcttccagtgccaatatgagcgtcgtgtaggctggagctgcttc (SEQIDNo.199) _thrB_rev ttagttttccagtactcgtgcgcccgccgtatccagccggcaaatcatatgaatatcctccttag (SEQIDNo.200) lysA _lysA_for atgccacattcactgttcagcaccgataccgatctcaccgccgaagtgtaggctggagctgcttc (SEQIDNo.201) _lysA_rev ttaaagcaattccagcgccagtaattcttcgatggtctggcgacgcatatgaatatcctccttag (SEQIDNo.202) eda _eda_for atgaaaaactggaaaacaagtgcagaatcaatcctgaccaccggcgtgtaggctggagctgcttc (SEQIDNo.203) _eda_rev ctcgatcgggcattttgacttttacagcttagcgccttctacagccatatgaatatcctccttag (SEQIDNo.204) recA _recA_for atggctatcgacgaaaacaaacagaaagcgttggcggcagcactggtgtaggctggagctgcttc (SEQIDNo.205) _recA_rev ttaaaaatcttcgttagtttctgctacgccttcgctatcatctaccatatgaatatcctccttag (SEQIDNo.206) asd _asd_for atgaaaaatgttggttttatcggctggcgcggtatggtcggctccgtgtaggctggagctgcttc (SEQIDNo.207) _asd_rev ttacgccagttgacgaagcatccgacgcagcggctccgcggcccccatatgaatatcctccttag (SEQIDNo.208)

(67) TABLE-US-00011 TABLE11 Primerpairsusedforverificationofgenedisruptions Deleted Sequence(5 -3) gene Forwardprimer Reverseprimer K2for/k1 cggtgccctgaatgaactgc cagtcatagccgaatagcct rev (SEQIDNo.209) (SEQIDNo.210) ldhA atacgtgtcccgagcggtag tacacatcccgccatcagca (SEQIDNo.211) (SEQIDNo.212) adhE Gaagtaaacgggaaaatcaa Agaagtggcataagaaaacg (SEQIDNo.213) (SEQIDNo.214) ackA ccattggctgaaaattacgc gttccattgcacggatcacg (SEQIDNo.215) (SEQIDNo.216) focA_pflB atgccgtagaagccgccagt tgttggtgcgcagctcgaag (SEQIDNo.217) (SEQIDNo.218) pta gcaaatctggtttcatcaac tcccttgcacaaaacaaagt (SEQIDNo.219) (SEQIDNo.220) poxB ggatttggttctcgcataat agcattaacggtagggtcgt (SEQIDNo.221) (SEQIDNo.222) sad gctgattctcgcgaataaac aaaaacgttcttgcgcgtct (SEQIDNo.223) (SEQIDNo.224) gabD tctgtttgtcaccaccccgc Aagccagcacctggaagcag (SEQIDNo.225) (SEQIDNo.226) gadA aagagctgccgcaggaggat gccgccctcttaagtcaaat (SEQIDNo.227) (SEQIDNo.228) gadB ggattttagcaatattcgct cctaatagcaggaagaagac (SEQIDNo.229) (SEQIDNo.230) gadC gctgaactgttgctggaaga ggcgtgcttttacaactaca (SEQIDNo.231) (SEQIDNo.232) sfcA tagtaaataacccaaccggc tcagtgagcgcagtgtttta (SEQIDNo.233) (SEQIDNo.234) maeB attaatggtgagagtttgga tgcttttttttattattcgc (SEQIDNo.235) (SEQIDNo.236) ppc gctttataaaagacgacgaa gtaacgacaattccttaagg (SEQIDNo.237) (SEQIDNo.238) pykA tttatatgcccatggtttct atctgttagaggcggatgat (SEQIDNo.239) (SEQIDNo.240) pykF ctggaacgttaaatctttga ccagtttagtagctttcatt (SEQIDNo.241) (SEQIDNo.242) iclR gatttgttcaacattaactcatcgg tgcgattaacagacaccctt (SEQIDNo.243) (SEQIDNo.244) mgsA tctcaggtgctcacagaaca tatggaagaggcgctactgc (SEQIDNo.245) (SEQIDNo.246) icd cgacctgctgcataaacacc tgaacgctaaggtgattgca (SEQIDNo.247) (SEQIDNo.248) sucA acgtagacaagagctcgcaa catcacgtacgactgcgtcg (SEQIDNo.249) (SEQIDNo.250) sucB tgcaactttgtgctgagcaa tatcgcttccgggcattgtc (SEQIDNo.251) (SEQIDNo.252) frdA Aaatcgatctcgtcaaatttcagac aggaaccacaaatcgccata (SEQIDNo.253) (SEQIDNo.254) frdB gacgtgaagattactacgct agttcaatgctgaaccacac (SEQIDNo.255) (SEQIDNo.256) frdC tagccgcgaccacggtaagaaggag cagcgcatcacccggaaaca (SEQIDNo.257) (SEQIDNo.258) frdD atcgtgatcattaacctgat ttaccctgataaattaccgc (SEQIDNo.259) (SEQIDNo.260) ptsG ccatccgttgaatgagtttt tggtgttaactggcaaaatc (SEQIDNo.261) (SEQIDNo.262) ptsI gtgacttccaacggcaaaag ccgttggtttgatagcaata (SEQIDNo.263) (SEQIDNo.264) lacI Gaatctggtgtatatggcga Tcttcgctattacgccagct (SEQIDNo.265) (SEQIDNo.266) lldD Cgtcagcggatgtatctggt Gcggaatttctggttcgtaa (SEQIDNo.267) (SEQIDNo.268) pgi Ttgtcaacgatggggtcatg Aaaaatgccgacataacgtc (SEQIDNo.269) (SEQIDNo.270) lysA Tctcaaagcgcgcaagttcg Ggtattgatgtaccgggtgagatt (SEQIDNo.271) (SEQIDNo.272) metA Tcgacagaacgacaccaaat Cactgtgaacgaaggatcgt (SEQIDNo.273) (SEQIDNo.274) thrB Tgttggcaatattgatgaag Gacatcgctttcaacattgg (SEQIDNo.275) (SEQIDNo.276) eda Gacagacaggcgaactgacg Gcgcagatttgcagattcgt (SEQIDNo.277) (SEQIDNo.278) recA Tggcggcagtgaagagaagc Gcaataacgcgctcgtaatc (SEQIDNo.279) (SEQIDNo.280) asd Acaaagcaggataagtcgca Gacttcaggtaaggctgtga (SEQIDNo.281) (SEQIDNo.282) rhtA CAGAGAACTGCGTAAGTATTACGCA TAGTGGTAACAAGCGTGAAAAACAA (SEQIDNo.283) (SEQIDNo.284) rhtB ATGAAGACTCCGTAAACGTTTCCCC CAAAAATAGACACACCGGGAGTTCA (SEQIDNo.285) (SEQIDNo.286)

(68) The plasmid co-expressing aspartate kinase, aspartate semialdehyde dehydrogenase, and homoserine dehydrogenase (pACT3-op-HMS1) was transformed together with the plasmid expressing the homoserine transaminase and the OHB reductase (pEXT20-DHB) into the optimized host strains. Transformants were selected on solid LB medium containing chloramphenicol (25 g/mL) and ampicillin (100 g/mL). Non-exclusive examples of constructed strains are listed in Table 12.

(69) TABLE-US-00012 TABLE 12 Examples of strains constructed for DHB production Strain Relevant Genotype MG1655 Wild-type ECE73 ldhA adhE metA thrB ECE74 ldhA adhE metA thrB pACT3-op-HMS1 ECE75 ldhA adhE metA thrB pEXT20-DHB ECE76 ldhA adhE metA thrB pACT3-op-HMS1 pEXT20-DHB ECE77 ldhA adhE metA thrB lldD pACT3-op-HMS1 pEXT20-DHB ECE78 ldhA adhE metA thrB rhtB pACT3-op-HMS1 pEXT20-DHB

(70) It is understood that removal of the lacI gene from the backbone of the above described plasmids along with the genomic deletion of lacI in the host strain may render protein expression from above described plasmids constitutive.

Example 9: Demonstration of the Zymotic Production of DHB Via the Homoserine-OHB Pathway

(71) Strains and Cultivation Conditions:

(72) Experiments were carried out with strains listed in Table 12. All cultivations were carried out at 37 C. on an Infors rotary shaker running at 170 rpm. Overnight cultures (3 mL medium in test tube) were inoculated from glycerol stocks and used to adjust an initial OD.sub.600 of 0.05 in 100 mL growth cultures cultivated in 500 mL shake flasks. IPTG was added at a concentration of 1 mmol/L when OD.sub.600 in the growth cultures reached 0.8. One liter culture medium contained, 20 g glucose, 18 g Na.sub.2HPO.sub.4*12 H.sub.2O, 3 g KH.sub.2PO.sub.4, 0.5 g NaCl, 2 g NH.sub.4Cl, 0.5 g MgSO.sub.4*7 H.sub.2O, 0.015 CaCl.sub.2*2 H.sub.2O, 1 mL of 0.06 mol/L FeCl.sub.3 stock solution prepared in 100 times diluted concentrated HCl, 2 mL of 10 mM thiamine HCl stock solution, 20 g MOPS and 1 mL of trace element solution (containing per liter: 0.04 g Na.sub.2EDTA*2H.sub.2O, 0.18 g CoCl.sub.2*6 H.sub.2O, ZnSO4*7 H.sub.2O, 0.04 g Na.sub.2MoO4*2 H.sub.2O, 0.01 g H.sub.3BO.sub.3, 0.12 g MnSO.sub.4*H.sub.2O, 0.12 g CuCl.sub.2*H2O.). Medium pH was adjusted to 7 and medium was filter-sterilized. The antibiotics kanamycin sulphate, ampicillin, and chloramphenicol were added at concentrations of 50 mg/L, 100 mg/L, and 25 mg/L, respectively, when necessary.

(73) Estimation of DHB Concentration by LC-MS Analyses:

(74) Liquid anion exchange chromatography was performed on an ICS-3000 system from Dionex (Sunnyvale, USA) equipped with an automatic eluent (KOH) generator system (RFIC, Dionex), and an autosampler (AS50, Dionex) holding the samples at 4 C. Analytes were separated on an IonPac AS11 HC (2502 mm, Dionex) column protected by an AG11 HC (502 mm, Dionex) pre-column. Column temperature was held at 25 C., flow rate was fixed at 0.25 mL/min, and analytes were eluted applying the KOH gradient described earlier (Groussac E, Ortiz M & Francois J (2000): Improved protocols for quantitative determination of metabolites from biological samples using high performance ionic-exchange chromatography with conductimetric and pulsed amperometric detection. Enzyme. Microb. Technol. 26, 715-723). Injected sample volume was 15 L. For background reduction, an ASRS ultra II (2 mm, external water mode, 75 mA) anion suppressor was used. Analytes were quantified using a mass-sensitive detector (MSQ Plus, Thermo) running in ESI mode (split was , nitrogen pressure was 90 psi, capillary voltage was 3.5 kV, probe temperature was 450 C.).

(75) Results:

(76) After 24 h cultivation, the DHB concentration in the supernatant of different strains was quantified by LC-MS analyses. The strains ECE73, ECE74, ECE75, and ECE76 had produced 0 mg/L, 3.7 mg/L, 0.67 mg/L, and 11.9 mg/L of DHB, respectively.

REFERENCES

(77) Chambellon, E., Rijnen, L., Lorquet, F., Gitton, C., van Hylckama Vlieg, J. E. T., Wouters, J. A. & Yvon, M. (2009). The D-2-hydroxyacid dehydrogenase incorrectly annotated PanE is the sole reduction system for branched-chain 2-keto acids in Lactococcus lactis. J. Bacteriol 191, 873-881. Cherepanov, P. P. & Wackernagel, W. (1995). Gene disruption in Escherichia coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant. Gene 158, 9-14. Datsenko, K. A. & Wanner, B. L. (2000). One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S.A. 97, 6640-6645. Dykxhoorn, D. M., St Pierre, R. & Linn, T. (1996). A set of compatible tac promoter expression vectors. Gene 177, 133-136. Hdicke, O. & Klamt, S. (2010). CASOP: a computational approach for strain optimization aiming at high productivity. J. Biotechnol 147, 88-101. Klamt, S., Saez-Rodriguez, J. & Gilles, E. D. (2007). Structural and functional analysis of cellular networks with CellNetAnalyzer. BMC Syst Biol 1, 2. Rothman, S. C. & Kirsch, J. F. (2003). How does an enzyme evolved in vitro compare to naturally occurring homologs possessing the targeted function? Tyrosine aminotransferase from aspartate aminotransferase. J. Mol. Biol 327, 593-608. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2 d. Cold Spring Harbor: Cold Spring Harbor Laboratory Press. Schuster, S., Dandekar, T. & Fell, D. A. (1999). Detection of elementary flux modes in biochemical networks: a promising tool for pathway analysis and metabolic engineering. Trends Biotechnol 17, 53-60. Wellner, D. & Lichtenberg, L. A. (1971). Assay of amino acid oxidase. Methods in Enzymology 17, Part B, 593-596.