Peptide having hair growth-promoting activity and use thereof
10568828 ยท 2020-02-25
Assignee
Inventors
- Yong Ji CHUNG (Yongin-si, KR)
- Eun Mi KIM (Yongin-si, KR)
- Eung-ji LEE (Anyang-si, KR)
- Min Woong Kim (Anyang-si, KR)
Cpc classification
A61K8/64
HUMAN NECESSITIES
International classification
C07K7/00
CHEMISTRY; METALLURGY
C07K5/00
CHEMISTRY; METALLURGY
C07K17/00
CHEMISTRY; METALLURGY
A61K8/64
HUMAN NECESSITIES
C07K16/00
CHEMISTRY; METALLURGY
Abstract
The present invention provides a peptide which shows a hair growth-promoting activity. The peptide of the present invention promotes the growth of follicular cells and increases the expression of a hair growth-related growth factor and hair growth-related factors, thereby showing an excellent effect in hair growth. The peptide of the present invention can be used for preventing and alleviating hair loss, promoting hair growth, and improving hair growth. In addition, the superior activity and stability of the peptide of the present invention allows the peptide to be very favorably applied to quasi drugs and cosmetics.
Claims
1. A peptide having an activity to stimulate hair production, the peptide consisting of the amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3 optionally wherein (i) the C-terminal end of the peptide is modified by the presence of an amino group or an azide group, or (ii) the N-terminal end of the peptide comprises a protecting group.
2. The peptide of claim 1, wherein the peptide stimulates the growth of hair follicle cells.
3. The peptide of claim 1, wherein the peptide increases the expression of -catenin.
4. A method for preventing or improving hair loss comprising: administering a composition comprising at least one peptide selected from the peptide consisting of the amino acid of SEQ ID NO: 1, peptide consisting of the amino acid of SEQ ID NO: 2 and peptide consisting of the amino acid of SEQ ID NO: 3, as an active ingredient, optionally wherein (i) the C-terminal end of the peptide is modified by the presence of an amino group or an azide group, or (ii) the N-terminal end of the peptide comprises a protecting group.
5. A method for stimulating hair production or hair growth comprising: administering a composition comprising at least one peptide selected from the peptide consisting of the amino acid of SEQ ID NO: 1, peptide consisting of the amino acid of SEQ ID NO: 2 and peptide consisting of the amino acid of SEQ ID NO: 3, as an active ingredient, optionally wherein (i) the C-terminal end of the peptide is modified by the presence of an amino group or an azide group, or (ii) the N-terminal end of the peptide comprises a protecting group.
6. The peptide of claim 1, wherein the C-terminal end of the peptide is modified by the presence of an amino group or an azide group.
7. The peptide of claim 1, wherein the N-terminal end of the peptide comprises a protecting group.
8. The peptide of claim 7, wherein the protecting group is selected from the group consisting of an acetyl group, a fluorenyl methoxy carbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, and polyethylene glycol (PEG).
9. The method of claim 4, wherein the C-terminal end of the peptide is modified by the presence of an amino group or an azide group.
10. The method of claim 4, wherein the N-terminal end of the peptide comprises a protecting group.
11. The method of claim 10, wherein the protecting group is selected from the group consisting of an acetyl group, a fluorenyl methoxy carbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, and polyethylene glycol (PEG).
12. The method of claim 5, wherein the C-terminal end of the peptide is modified by the presence of an amino group or an azide group.
13. The method of claim 5, wherein the N-terminal end of the peptide comprises a protecting group.
14. The method of claim 13, wherein the protecting group is selected from the group consisting of an acetyl group, a fluorenyl methoxy carbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, and polyethylene glycol (PEG).
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
BEST MODE FOR CARRYING OUT THE INVENTION
(20) The present invention relates to a peptide having an activity to stimulate hair production, the peptide consisting of the amino acid sequence selected from SEQ ID NO: 1 to SEQ ID NO: 3.
MODE FOR CARRYING OUT THE INVENTION
(21) Hereinafter, the present invention will be described in detail with reference to examples. These examples are only for illustrating the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.
EXAMPLES
Synthetic Example 1
Peptide Synthesis
(22) 700 mg of chlorotrityl chloride resin (CTL resin, Nova Biochem Cat No. 01-64-0021) was added into a reaction container, and 10 ml of methylene chloride (MC) was added, followed by stirring for 3 minutes. After the solution was removed, 10 ml of dimethyl form amide (DMF) was added, followed by stirring for 3 minutes, and then the solvent was again removed.
(23) 10 ml of a dichloromethane solution was added to a reactor, and 200 mmole Fmoc-Ile-OH (Bachem, Swiss) and 400 mmole diisopropyl ethylamine (DIEA) were added. Thereafter, the mixture was well dissolved with stirring, and then the reaction was conducted with stirring for 1 hour.
(24) After the reaction, washing was conducted, and then methanol and DIEA (2:1) were dissolved in dichloromethane (DCM), followed by reaction for 10 minutes, and then the resulting material was washed with excess DCM/DMF (1:1). After the solution was removed, 10 ml of dimethyl form amide (DMF) was added, followed by stirring for 3 minutes, and then the solvent was again removed.
(25) 10 ml of a deprotection solution (20% piperidine/DMF) was added to a reaction container, followed by stirring at room temperature for 10 minutes, and then the solution was removed. An equal amount of a deprotection solution was added, and then the reaction was again maintained for 10 minutes, and thereafter, the solution was removed, followed by washing twice with DMF, once with MC, and once with DMF, for 3 minutes each, thereby preparing Ile-CTL Resin.
(26) 10 ml of a DMF solution was added to a new reactor, and 200 mmol Fmoc-Lys(Boc)-OH (Bachem, Swiss), 200 mmol HoBt, and 200 mmole Bop were added, and the mixture was well dissolved with stirring. 400 mmole DIEA was added to a reactor in two divided portions, and then stirring was conducted for at least 5 minutes until all solids were dissolved.
(27) The dissolved amino acid mixed solution was added to the reaction container containing the deprotected resin, and the reaction was conducted with stirring at room temperature for 1 hour. After the reaction solution was removed, the stirring was conducted using a DMF solution three times for 5 minutes each, followed by removal.
(28) A small amount of the reaction resin was taken to check the extent of reaction using the Kaiser test (Ninhydrin test). The deprotection reaction was twice conducted using a deprotection solution in the same manner as described above, thereby preparing Lys(Boc)-Ile-CTL Resin.
(29) After sufficient washing with DMF and MC, the Kaiser test was again conducted, and then the following amino acid attachment test was conducted in the same manner as described above.
(30) A chain reaction was conducted in the order of Fmoc-Arg(Pbf)-OH and Fmoc-Arg(Pbf)-OH on the basis of the selected amino acid sequence. The Fmoc-protecting group was removed by reaction twice with the deprotection solution for 10 minutes for each and then favorable washing.
(31) Acetic anhydride, DIEA, and HoBt were added to conduct acetylation for 1 hour, and then the prepared peptidyl resin was washed with DMF, MC, and methanol three times for each, dried under the flow of nitrogen gas, and completely dried by decompression under vacuum in P.sub.2O.sub.5.
(32) Thereafter, 30 ml of a leaving solution [95% trifluoroacetic acid (TFA), 5% distilled water 2, and 5% thioanisole 2] was added, and the reaction was maintained for 2 hours while the mixture was intermittently stirred at room temperature.
(33) The resin was obtained through filtration, washed with a small amount of a TFA solution, and then mixed with the stock solution. The distillation was conducted under reduced pressure to reduce the total volume by half, and then 50 ml of cold ether was added to induce precipitation.
(34) Thereafter, the precipitates were collected by centrifugation, followed by washing twice with cold ether. The stock solution was removed, followed by sufficient drying under nitrogen atmosphere, thereby synthesizing 0.7 g of unpurified peptide 1, Arg-Arg-Lys-Ile (yield: 90.0%).
(35) The molecular weight was determined as 571.7 (theoretical value: 571.72) by using a molecular weight analysis system.
(36) The other peptides, peptide 2 composed of the amino acid sequence of SEQ ID NO: 2 and peptide 3 composed of the amino acid sequence of SEQ ID NO: 3 were also synthesized by the same method as described above.
(37) TABLE-US-00001 TABLE1 Molecularweightanalysis SEQ value(Massspectromter) ID Analytic Theoretical NO Sequence(5-3) value value 1 Arg-Arg-Lys-Ile 571.7 571.72 2 Ile-Tyr-Phe-Tyr 604 604.7 3 Lys-Lys-Phe-Ile-Gln- 1350.6 1350.65 Gln-Val-Tyr-Leu-Ala- Ile
(38) In order to secure peptides showing hair growth stimulating efficacy, screening was conducted for the peptide libraries of the applicant through cell proliferation experiments, and thus three types of peptides were selected. Thereafter, the hair growth stimulating efficacy of the three types of peptides was observed through the expression changes of various genes and proteins, and the excellent efficacy thereof was investigated.
Example 1
DPC Proliferation Assay
(39) Human hair follicle dermal papilla cells were seeded at a density of 210.sup.3 cells/well on 96-well plates, followed by incubation overnight. After changing into serum-free medium, the cells were treated with the peptides, followed by incubation for 3 days, and then the wells were treated with 4 mg/ml MTT solution, followed by reaction for 4 hours. The resulting formazan was solubilized with DNSO, and then the absorbance was measured at 550 nm using a microplate reader. The results are shown in
(40) As can be confirmed from
Example 2
-Catenin Activation Test
(41) Human hair follicle dermal papilla cells were seeded at a density of 410.sup.5 cells/well on 6-well plates, followed by incubation overnight. After changing into serum-free medium, the cells were treated with the peptides, followed by incubation for 15 and 30 minutes, and then the wells were harvested to isolate nuclear and cytoplasmic proteins. Western blotting was performed using -catenin (Santa Cruz Biotechnology, USA) to compare -catenin expression patterns in nuclei. The results are shown in
(42) As can be confirmed from
Example 3
KGF, bFGF, VEGF RT-PCR
(43) Human hair follicle dermal papilla cells were seeded at a density of 410.sup.5 cells/well on 6-well plates, followed by incubation overnight. After changing into serum-free medium, the cells were treated with the peptides, followed by incubation for 24 hours, and then the wells were harvested to isolate RNA. After RNA quantification, cDNA synthesis was conducted using the cDNA synthesis kit (Intron, Korea), followed by PCR using PCR premix (Intron, Korea) and respective KGF, bFGF, and VEGF primers, and then electrophoresis was performed on 5% agarose gel to compare the mRNA expression levels of the growth factors for each sample treatment conditions. The results are shown in
(44) TABLE-US-00002 TABLE2 SEQID Primer NO nomenclature Sequence(5-3) 4 KGF_F TCTGTCGAACACAGTGGTACCT 5 KGF_R GTGTGTCCATTTAGCTGATGCAT 6 bFGF_F TGCTGGTGATGGGAGTTGTA 7 bFGF_R CCTCCAAGTAGCAGCCAAAG 8 VEGF_F CCATGAACTTTCTGCTGTCTT 9 VEGF_R TCGATCGTTCTGTATCAGTCT
(45) As can be confirmed from
(46) As can be confirmed from
Example 4
PI3K & p-ERK WB
(47) Human hair follicle dermal papilla cells were seeded at a density of 410.sup.5 cells/well on 6-well plates, followed by incubation overnight. After changing into serum-free medium, the cells were treated with the peptides, followed by incubation for 15 and 30 minutes, and then the wells were harvested to prepare cell lysates. Western blotting was performed using PI3K antibodies (Santa Cruz Biotechnology, USA) and phospho-ERK antibody (Cell Signaling Technology, USA) to compare protein expression patterns. The results are shown in
(48) As can be confirmed from
Example 5
MSX2 RT-PCR
(49) Human hair follicle dermal papilla cells were seeded at a density of 410.sup.5 cells/well on 6-well plates, followed by incubation overnight. After changing into serum-free medium, the cells were treated with the peptides, followed by incubation for 24 hours, and then the wells were harvested to isolate RNA. After RNA quantification, cDNA synthesis was conducted using the cDNA synthesis kit (Intron, Korea), followed by PCR using PCR premix (Intron, Korea) and MSX2 primers, and then electrophoresis was performed on 5% agarose gel to compare the mRNA expression levels for each sample treatment conditions. The results are shown in
(50) TABLE-US-00003 TABLE3 SEQID Primer NO nomenclature Sequence(5-3) 10 MSX2_F AACACAAGACCAACCGGAAG 11 MSX2_R GCAGCCATTTTCAGCTTTTC
(51) As can be seen from
Example 6
TGF-1 RT-PCR
(52) Human hair follicle dermal papilla cells were seeded at a density of 410.sup.5 cells/well on 6-well plates, followed by incubation overnight. After changing into serum-free medium, the cells were treated with the peptides, followed by incubation for 24 hours, and then the wells were harvested to separate RNA. After RNA quantification, cDNA synthesis was conducted using the cDNA synthesis kit (Intron, Korea), followed by PCR using PCR premix (Intron, Korea) and TGF-1 primers, and then electrophoresis was performed on 5% agarose gel to compare the mRNA expression levels for each sample treatment conditions. The results are shown in
(53) TABLE-US-00004 TABLE4 SEQID primer NO nomenclature Sequence(5-3) 12 TGF-1_F GCCCTGGATACCAACTATTGC 13 TGF-1_R TCAGCACTTGCAGGAGTAGCG
(54) As can be seen from
Example 7
Bcl-2/Bax WB
(55) Human hair follicle dermal papilla cells were seeded at a density of 410.sup.5 cells/well on 6-well plate, followed by incubation overnight. After changing into serum-free medium, the cells were treated with the peptides, followed by incubation for 24 hours, and then the wells were harvested to prepare cell lysates. Western blotting was performed using Bcl-2 and Bax antibodies (Santa Cruz Biotechnology, USA) to compare protein expression patterns. The results are shown in
(56) As can be confirmed from
Example 8
Keratin-14 RT-PCR
(57) Human hair follicle dermal papilla cells were seeded at a density of 510.sup.5 cells/well on 6-well plates, followed by incubation overnight. After changing into serum-free medium, the cells were treated with the peptides, followed by incubation for 24 hours, and then the wells were harvested to isolate RNA. After RNA quantification, cDNA synthesis was conducted using the cDNA synthesis kit (Intron, Korea), followed by PCR using PCR premix (Intron, Korea) and keratin primers, and then electrophoresis was performed on 5% agarose gel to compare the mRNA expression levels for respective sample treatment conditions. The results are shown in
(58) TABLE-US-00005 TABLE5 SEQID primer NO nomenclature Sequence(5-3) 14 Keratin-14_F CCACCTTTCATCTTCCCAATTCTC 15 Keratin-14_R GTGCGGATCTGGCGGTTG
(59) As can be confirmed from
INDUSTRIAL APPLICABILITY
(60) The present invention relates to a peptide having an activity to stimulate hair production and/or growth, a composition containing the peptide as an active ingredient for stimulating hair production, and a use of the peptide for stimulating hair production.