Enzyme compositions and uses thereof

10570433 ยท 2020-02-25

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to enzyme compositions and processes of producing and using the compositions for the saccharification of lignocellulosic material.

Claims

1. A process for degrading a cellulosic or hemicellulosic material, comprising: treating the cellulosic or hemicellulosic material with an enzyme composition comprising: a cellobiohydrolase I, a cellobiohydrolase II, a beta-glucosidase variant comprising one or more substitutions selected from the group consisting of F100D, S283G, N456E, and F512Y of SEQ ID NO: 6 or the mature polypeptide thereof, an AA9 polypeptide having cellulolytic enhancing activity, a GH10 xylanase, and a beta-xylosidase; wherein the cellobiohydrolase I is selected from the group consisting of: (i) a cellobiohydrolase I comprising or consisting of the mature polypeptide of SEQ ID NO: 2; (ii) a cellobiohydrolase I comprising or consisting of an amino acid sequence having at least 95% sequence identity to the mature polypeptide of SEQ ID NO: 2; (iii) a cellobiohydrolase I encoded by a polynucleotide comprising or consisting of the mature polypeptide coding sequence of SEQ ID NO: 1; and (iv) a cellobiohydrolase I encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 95% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 1; wherein the cellobiohydrolase II is selected from the group consisting of: (i) a cellobiohydrolase II comprising or consisting of the mature polypeptide of SEQ ID NO: 4; (ii) a cellobiohydrolase II comprising or consisting of an amino acid sequence having at least 95% sequence identity to the mature polypeptide of SEQ ID NO: 4; (iii) a cellobiohydrolase II encoded by a polynucleotide comprising or consisting of the mature polypeptide coding sequence of SEQ ID NO: 3; and (iv) a cellobiohydrolase II encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 95% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 3; wherein the xylanase is selected from the group consisting of: (i) a xylanase comprising or consisting of the mature polypeptide of SEQ ID NO: 10 or the mature polypeptide of SEQ ID NO: 12; (ii) a xylanase comprising or consisting of an amino acid sequence having at least 95% sequence identity to the mature polypeptide of SEQ ID NO: 10 or the mature polypeptide of SEQ ID NO: 12; (iii) a xylanase encoded by a polynucleotide comprising or consisting of the mature polypeptide coding sequence of SEQ ID NO: 9 or the mature polypeptide coding sequence of SEQ ID NO: 11; and (iv) a xylanase encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 95% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 9 or the mature polypeptide coding sequence of SEQ ID NO: 11; and wherein the beta-xylosidase is selected from the group consisting of: (i) a beta-xylosidase comprising or consisting of the mature polypeptide of SEQ ID NO: 14; (ii) a beta-xylosidase comprising or consisting of an amino acid sequence having at least 95% sequence identity to the mature polypeptide of SEQ ID NO: 14; (iii) a beta-xylosidase encoded by a polynucleotide comprising or consisting of the mature polypeptide coding sequence of SEQ ID NO: 13; and (iv) a beta-xylosidase encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 95% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 13.

2. The process of claim 1, wherein the AA9 polypeptide having cellulolytic enhancing activity is selected from the group consisting of: (i) an AA9 polypeptide having cellulolytic enhancing activity comprising or consisting of the mature polypeptide of SEQ ID NO: 8; (ii) an AA9 polypeptide having cellulolytic enhancing activity comprising or consisting of an amino acid sequence having at least 95% sequence identity to the mature polypeptide of SEQ ID NO: 8; (iii) an AA9 polypeptide having cellulolytic enhancing activity encoded by a polynucleotide comprising or consisting of the mature polypeptide coding sequence of SEQ ID NO: 7; and (iv) an AA9 polypeptide having cellulolytic enhancing activity encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 95% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 7.

3. The process of claim 1, wherein the beta-glucosidase variant comprises the substitutions F100D, S283G, N456E, and F512Y of SEQ ID NO: 6 or the mature polypeptide thereof.

4. The process of claim 3, wherein the variant comprises or consists of SEQ ID NO: 36 or the mature polypeptide thereof.

5. The process of claim 1, wherein the enzyme composition further comprises one or more enzymes selected from the group consisting of an endoglucanase I, endoglucanase II, a cellobiohydrolase I, a cellobiohydrolase II, a cellobiohydrolase III, a beta-glucosidase, an AA9 polypeptide having cellulolytic enhancing activity, a cellulose inducible protein, an acetylxylan esterase, a feruloyl esterase, an arabinofuranosidase, a xylanase, a xylosidase, a glucuronidase, an esterase, an expansin, a laccase, a ligninolytic enzyme, a pectinase, a catalase, a peroxidase, a protease, and a swollenin.

6. The process of claim 5, wherein the endoglucanase I is selected from the group consisting of: (i) an endoglucanase I comprising or consisting of the mature polypeptide of SEQ ID NO: 16; (ii) an endoglucanase I comprising or consisting of an amino acid sequence having at least 95% sequence identity to the mature polypeptide of SEQ ID NO: 16; (iii) an endoglucanase I encoded by a polynucleotide comprising or consisting of the mature polypeptide coding sequence of SEQ ID NO: 15; and (iv) an endoglucanase I encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 95% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 15; and wherein the endoglucanase II is selected from the group consisting of: (i) an endoglucanase II comprising or consisting of the mature polypeptide of SEQ ID NO: 18; (ii) an endoglucanase II comprising or consisting of an amino acid sequence having at least 95% sequence identity to the mature polypeptide of SEQ ID NO: 18; (iii) an endoglucanase II encoded by a polynucleotide comprising or consisting of the mature polypeptide coding sequence of SEQ ID NO: 17; and (iv) an endoglucanase II encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 95% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 17; or wherein the endoglucanase II is selected from the group consisting of: (i) an endoglucanase II comprising or consisting of the mature polypeptide of SEQ ID NO: 106; (ii) an endoglucanase II comprising or consisting of an amino acid sequence having at least 95% sequence identity to the mature polypeptide of SEQ ID NO: 106; (iii) an endoglucanase II encoded by a polynucleotide comprising or consisting the mature polypeptide coding sequence of SEQ ID NO: 105; and (iv) an endoglucanase II encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 95% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 105.

7. The process of claim 5, wherein the catalase is selected from the group consisting of: (i) a catalase comprising or consisting of the mature polypeptide of SEQ ID NO: 34; (ii) a catalase comprising or consisting of an amino acid sequence having at least 95% sequence identity to the mature polypeptide of SEQ ID NO: 34; and (iii) a catalase encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 95% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 33.

8. The process of claim 1, wherein the enzyme composition further comprises a Trichoderma whole broth preparation; a Myceliophthora whole broth preparation; a Talaromyces emersonii whole broth preparation; or a combination thereof.

9. The process of claim 1, wherein the enzyme composition is a fermentation broth formulation or a cell composition.

10. A process for producing a fermentation product, comprising: (a) saccharifying a cellulosic or hemicellulosic material with an enzyme composition comprising: a cellobiohydrolase I, a cellobiohydrolase II, a beta-glucosidase variant comprising one or more substitutions selected from the group consisting of F100D, S283G, N456E, and F512Y of SEQ ID NO: 6 or the mature polypeptide thereof, an AA9 polypeptide having cellulolytic enhancing activity, a GH10 xylanase, and a beta-xylosidase; wherein the cellobiohydrolase I is selected from the group consisting of: (i) a cellobiohydrolase I comprising or consisting of the mature polypeptide of SEQ ID NO: 2; (ii) a cellobiohydrolase I comprising or consisting of an amino acid sequence having at least 95% sequence identity to the mature polypeptide of SEQ ID NO: 2; (iii) a cellobiohydrolase I encoded by a polynucleotide comprising or consisting of the mature polypeptide coding sequence of SEQ ID NO: 1; and (iv) a cellobiohydrolase I encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 95% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 1; wherein the cellobiohydrolase II is selected from the group consisting of: (i) a cellobiohydrolase II comprising or consisting of the mature polypeptide of SEQ ID NO: 4; (ii) a cellobiohydrolase II comprising or consisting of an amino acid sequence having at least 95% sequence identity to the mature polypeptide of SEQ ID NO: 4; (iii) a cellobiohydrolase II encoded by a polynucleotide comprising or consisting of the mature polypeptide coding sequence of SEQ ID NO: 3; and (iv) a cellobiohydrolase II encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 95% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 3; wherein the xylanase is selected from the group consisting of: (i) a xylanase comprising or consisting of the mature polypeptide of SEQ ID NO: 10 or the mature polypeptide of SEQ ID NO: 12; (ii) a xylanase comprising or consisting of an amino acid sequence having at least 95% sequence identity to the mature polypeptide of SEQ ID NO: 10 or the mature polypeptide of SEQ ID NO: 12; (iii) a xylanase encoded by a polynucleotide comprising or consisting of the mature polypeptide coding sequence of SEQ ID NO: 9 or the mature polypeptide coding sequence of SEQ ID NO: 11; and (iv) a xylanase encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 95% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 9 or the mature polypeptide coding sequence of SEQ ID NO: 11; and wherein the beta-xylosidase is selected from the group consisting of: (i) a beta-xylosidase comprising or consisting of the mature polypeptide of SEQ ID NO: 14; (ii) a beta-xylosidase comprising or consisting of an amino acid sequence having at least 95% sequence identity to the mature polypeptide of SEQ ID NO: 14; (iii) a beta-xylosidase encoded by a polynucleotide comprising or consisting of the mature polypeptide coding sequence of SEQ ID NO: 13; and (iv) a beta-xylosidase encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 95% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 13; (b) fermenting the saccharified cellulosic or hemicellulosic material with one or more fermenting microorganisms to produce the fermentation product; and (c) recovering the fermentation product from the fermentation.

11. The process of claim 10, wherein the AA9 polypeptide having cellulolytic enhancing activity is selected from the group consisting of: (i) an AA9 polypeptide having cellulolytic enhancing activity comprising or consisting of the mature polypeptide of SEQ ID NO: 8; (ii) an AA9 polypeptide having cellulolytic enhancing activity comprising or consisting of an amino acid sequence having at least 95% sequence identity to the mature polypeptide of SEQ ID NO: 8; (iii) an AA9 polypeptide having cellulolytic enhancing activity encoded by a polynucleotide comprising or consisting of the mature polypeptide coding sequence of SEQ ID NO: 7; and (iv) an AA9 polypeptide having cellulolytic enhancing activity encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 95% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 7.

12. The process of claim 10, wherein the beta-glucosidase variant comprises the substitutions F100D, S283G, N456E, and F512Y of SEQ ID NO: 6 or the mature polypeptide thereof.

13. The process of claim 12, wherein the variant comprises or consists of SEQ ID NO: 36 or the mature polypeptide thereof.

14. The process of claim 10, wherein the enzyme composition further comprises one or more enzymes selected from the group consisting of an endoglucanase I, endoglucanase II, a cellobiohydrolase I, a cellobiohydrolase II, a cellobiohydrolase III, a beta-glucosidase, an AA9 polypeptide having cellulolytic enhancing activity, a cellulose inducible protein, an acetylxylan esterase, a feruloyl esterase, an arabinofuranosidase, a xylanase, a xylosidase, a glucuronidase, an esterase, an expansin, a laccase, a ligninolytic enzyme, a pectinase, a catalase, a peroxidase, a protease, and a swollenin.

15. The process of claim 14, wherein the endoglucanase I is selected from the group consisting of: (i) an endoglucanase I comprising or consisting of the mature polypeptide of SEQ ID NO: 16; (ii) an endoglucanase I comprising or consisting of an amino acid sequence having at least 95% sequence identity to the mature polypeptide of SEQ ID NO: 16; (iii) an endoglucanase I encoded by a polynucleotide comprising or consisting of the mature polypeptide coding sequence of SEQ ID NO: 15; and (iv) an endoglucanase I encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 95% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 15; and wherein the endoglucanase II is selected from the group consisting of: (i) an endoglucanase II comprising or consisting of the mature polypeptide of SEQ ID NO: 18; (ii) an endoglucanase II comprising or consisting of an amino acid sequence having at least 95% sequence identity to the mature polypeptide of SEQ ID NO: 18; (iii) an endoglucanase II encoded by a polynucleotide comprising or consisting of the mature polypeptide coding sequence of SEQ ID NO: 17; and (iv) an endoglucanase II encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 95% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 17; or wherein the endoglucanase II is selected from the group consisting of: (i) an endoglucanase II comprising or consisting of the mature polypeptide of SEQ ID NO: 106; (ii) an endoglucanase II comprising or consisting of an amino acid sequence having at least 95% sequence identity to the mature polypeptide of SEQ ID NO: 106; (iii) an endoglucanase II encoded by a polynucleotide comprising or consisting the mature polypeptide coding sequence of SEQ ID NO: 105; and (iv) an endoglucanase II encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 95% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 105.

16. The process of claim 14, wherein the catalase is selected from the group consisting of: (i) a catalase comprising or consisting of the mature polypeptide of SEQ ID NO: 34; (ii) a catalase comprising or consisting of an amino acid sequence having at least 95% sequence identity to the mature polypeptide of SEQ ID NO: 34; and (iii) a catalase encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 95% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 33.

17. The process of claim 10, wherein the enzyme composition further comprises a Trichoderma whole broth preparation; a Myceliophthora whole broth preparation; a Talaromyces emersonii whole broth preparation; or a combination thereof.

18. The process of claim 10, wherein the enzyme composition is a fermentation broth formulation or a cell composition.

19. A process of fermenting a cellulosic or hemicellulosic material, comprising: fermenting the cellulosic or hemicellulosic material with one or more fermenting microorganisms comprising a Trichoderma whole broth preparation; a Myceliophthora whole broth preparation; a Talaromyces emersonii whole broth preparation; or a combination thereof, wherein the cellulosic or hemicellulosic material is saccharified with an enzyme composition comprising: a cellobiohydrolase I, a cellobiohydrolase II, a beta-glucosidase variant comprising one or more substitutions selected from the group consisting of F100D, S283G, N456E, and F512Y of SEQ ID NO: 6 or the mature polypeptide thereof, an AA9 polypeptide having cellulolytic enhancing activity, a GH10 xylanase, and a beta-xylosidase; wherein the cellobiohydrolase I is selected from the group consisting of: (i) a cellobiohydrolase I comprising or consisting of the mature polypeptide of SEQ ID NO: 2; (ii) a cellobiohydrolase I comprising or consisting of an amino acid sequence having at least 95% sequence identity to the mature polypeptide of SEQ ID NO: 2; (iii) a cellobiohydrolase I encoded by a polynucleotide comprising or consisting of the mature polypeptide coding sequence of SEQ ID NO: 1; and (iv) a cellobiohydrolase I encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 95% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 1; wherein the cellobiohydrolase II is selected from the group consisting of: (i) a cellobiohydrolase II comprising or consisting of the mature polypeptide of SEQ ID NO: 4; (ii) a cellobiohydrolase II comprising or consisting of an amino acid sequence having at least 95% sequence identity to the mature polypeptide of SEQ ID NO: 4; (iii) a cellobiohydrolase II encoded by a polynucleotide comprising or consisting of the mature polypeptide coding sequence of SEQ ID NO: 3; and (iv) a cellobiohydrolase II encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 95% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 3; wherein the xylanase is selected from the group consisting of: (i) a xylanase comprising or consisting of the mature polypeptide of SEQ ID NO: 10 or the mature polypeptide of SEQ ID NO: 12; (ii) a xylanase comprising or consisting of an amino acid sequence having at least 95% sequence identity to the mature polypeptide of SEQ ID NO: 10 or the mature polypeptide of SEQ ID NO: 12; (iii) a xylanase encoded by a polynucleotide comprising or consisting of the mature polypeptide coding sequence of SEQ ID NO: 9 or the mature polypeptide coding sequence of SEQ ID NO: 11; and (iv) a xylanase encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 95% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 9 or the mature polypeptide coding sequence of SEQ ID NO: 11; and wherein the beta-xylosidase is selected from the group consisting of: (i) a beta-xylosidase comprising or consisting of the mature polypeptide of SEQ ID NO: 14; (ii) a beta-xylosidase comprising or consisting of an amino acid sequence having at least 95% sequence identity to the mature polypeptide of SEQ ID NO: 14; (iii) a beta-xylosidase encoded by a polynucleotide comprising or consisting of the mature polypeptide coding sequence of SEQ ID NO: 13; and (iv) a beta-xylosidase encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 95% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 13.

20. The process of claim 19, wherein the fermenting of the cellulosic or hemicellulosic material produces a fermentation product and optionally comprising recovering the fermentation product from the fermentation.

21. The process of claim 19, wherein the AA9 polypeptide having cellulolytic enhancing activity is selected from the group consisting of: (i) an AA9 polypeptide having cellulolytic enhancing activity comprising or consisting of the mature polypeptide of SEQ ID NO: 8; (ii) an AA9 polypeptide having cellulolytic enhancing activity comprising or consisting of an amino acid sequence having at least 95% sequence identity to the mature polypeptide of SEQ ID NO: 8; (iii) an AA9 polypeptide having cellulolytic enhancing activity encoded by a polynucleotide comprising or consisting of the mature polypeptide coding sequence of SEQ ID NO: 7; and (iv) an AA9 polypeptide having cellulolytic enhancing activity encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 95% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 7.

22. The process of claim 19, wherein the beta-glucosidase variant comprises the substitutions F100D, S283G, N456E, and F512Y of SEQ ID NO: 6 or the mature polypeptide thereof.

23. The process of claim 22, wherein the variant comprises or consists of SEQ ID NO: 36 or the mature polypeptide thereof.

24. The process of claim 19, wherein the enzyme composition further comprises one or more enzymes selected from the group consisting of an endoglucanase I, endoglucanase II, a cellobiohydrolase I, a cellobiohydrolase II, a cellobiohydrolase III, a beta-glucosidase, an AA9 polypeptide having cellulolytic enhancing activity, a cellulose inducible protein, an acetylxylan esterase, a feruloyl esterase, an arabinofuranosidase, a xylanase, a xylosidase, a glucuronidase, an esterase, an expansin, a laccase, a ligninolytic enzyme, a pectinase, a catalase, a peroxidase, a protease, and a swollenin.

25. The process of claim 24, wherein the endoglucanase I is selected from the group consisting of: (i) an endoglucanase I comprising or consisting of the mature polypeptide of SEQ ID NO: 16; (ii) an endoglucanase I comprising or consisting of an amino acid sequence having at least 95% sequence identity to the mature polypeptide of SEQ ID NO: 16; (iii) an endoglucanase I encoded by a polynucleotide comprising or consisting of the mature polypeptide coding sequence of SEQ ID NO: 15; and (iv) an endoglucanase I encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 95% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 15; and wherein the endoglucanase II is selected from the group consisting of: (i) an endoglucanase II comprising or consisting of the mature polypeptide of SEQ ID NO: 18; (ii) an endoglucanase II comprising or consisting of an amino acid sequence having at least 95% sequence identity to the mature polypeptide of SEQ ID NO: 18; (iii) an endoglucanase II encoded by a polynucleotide comprising or consisting of the mature polypeptide coding sequence of SEQ ID NO: 17; and (iv) an endoglucanase II encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 95% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 17; or wherein the endoglucanase II is selected from the group consisting of: (i) an endoglucanase II comprising or consisting of the mature polypeptide of SEQ ID NO: 106; (ii) an endoglucanase II comprising or consisting of an amino acid sequence having at least 95% sequence identity to the mature polypeptide of SEQ ID NO: 106; (iii) an endoglucanase II encoded by a polynucleotide comprising or consisting the mature polypeptide coding sequence of SEQ ID NO: 105; and (iv) an endoglucanase II encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 95% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 105.

26. The process of claim 24, wherein the catalase is selected from the group consisting of: (i) a catalase comprising or consisting of the mature polypeptide of SEQ ID NO: 34; (ii) a catalase comprising or consisting of an amino acid sequence having at least 95% sequence identity to the mature polypeptide of SEQ ID NO: 34; and (iii) a catalase encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 95% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 33.

27. The process of claim 19, wherein the enzyme composition further comprises a Trichoderma whole broth preparation; a Myceliophthora whole broth preparation; a Talaromyces emersonii whole broth preparation; or a combination thereof.

28. The process of claim 19, wherein the enzyme composition is a fermentation broth formulation or a cell composition.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) FIG. 1 shows a restriction map of plasmid pJfyS159.

(2) FIG. 2 shows a restriction map of plasmid pGMEr169.

(3) FIG. 3 shows a restriction map of plasmid pJfyS157.

(4) FIG. 4 shows a restriction map of plasmid pAyGm10.

(5) FIG. 5 shows a restriction map of plasmid pQM35.

(6) FIG. 6 shows a restriction map of plasmid pSMai139.

(7) FIG. 7 shows a restriction map of plasmid pSMai143.

(8) FIG. 8 shows a restriction map of plasmid pAG122.

(9) FIG. 9 shows a restriction map of plasmid pAgJg131.

(10) FIG. 10 shows a restriction map of plasmid pLAQ564.

(11) FIG. 11 shows a restriction map of plasmid pSaMe-TaCat.

(12) FIG. 12 shows a comparison of percent conversion of glucan (pretreated corn stover) by Cellic CTec2 to an enzyme composition comprising a cellobiohydrolase I of SEQ ID NO: 2, a cellobiohydrolase II of SEQ ID NO: 4, an endoglucanase of SEQ ID NO: 16, an endoglucanase of SEQ ID NO: 18, a beta-glucosidase variant of SEQ ID NO: 36, an AA9 (GH61) polypeptide having cellulolytic enhancing activity of SEQ ID NO: 8, a catalase of SEQ ID NO: 34, a GH10 xylanase of SEQ ID NO: 10, and a beta-xylosidase of SEQ ID NO: 14 (enzyme mix 1) at 50 C. and pH 5.0 for 5 days.

(13) FIG. 13 shows a comparison of percent conversion of glucan (pretreated corn stover) by Cellic CTec2 to an enzyme composition comprising a cellobiohydrolase I of SEQ ID NO: 2, a cellobiohydrolase II of SEQ ID NO: 4, an endoglucanase of SEQ ID NO: 16, an endoglucanase of SEQ ID NO: 18, a beta-glucosidase variant of SEQ ID NO: 36, an AA9 (GH61) polypeptide having cellulolytic enhancing activity of SEQ ID NO: 8, a GH10 xylanase of SEQ ID NO: 10, and a beta-xylosidase of SEQ ID NO: 14 (enzyme mix 2) at 50 C. and pH 5.0 for 5 days.

DEFINITIONS

(14) Acetylxylan esterase: The term acetylxylan esterase means a carboxylesterase (EC 3.1.1.72) that catalyzes the hydrolysis of acetyl groups from polymeric xylan, acetylated xylose, acetylated glucose, alpha-napthyl acetate, and p-nitrophenyl acetate. Acetylxylan esterase activity can be determined using 0.5 mM p-nitrophenylacetate as substrate in 50 mM sodium acetate pH 5.0 containing 0.01% TWEEN 20 (polyoxyethylene sorbitan monolaurate). One unit of acetylxylan esterase is defined as the amount of enzyme capable of releasing 1 mole of p-nitrophenolate anion per minute at pH 5, 25 C.

(15) Allelic variant: The term allelic variant means any of two or more (e.g., several) alternative forms of a gene occupying the same chromosomal locus. Allelic variation arises naturally through mutation, and may result in polymorphism within populations. Gene mutations can be silent (no change in the encoded polypeptide) or may encode polypeptides having altered amino acid sequences. An allelic variant of a polypeptide is a polypeptide encoded by an allelic variant of a gene.

(16) Alpha-L-arabinofuranosidase: The term alpha-L-arabinofuranosidase means an alpha-L-arabinofuranoside arabinofuranohydrolase (EC 3.2.1.55) that catalyzes the hydrolysis of terminal non-reducing alpha-L-arabinofuranoside residues in alpha-L-arabinosides. The enzyme acts on alpha-L-arabinofuranosides, alpha-L-arabinans containing (1,3)- and/or (1,5)-linkages, arabinoxylans, and arabinogalactans. Alpha-L-arabinofuranosidase is also known as arabinosidase, alpha-arabinosidase, alpha-L-arabinosidase, alpha-arabinofuranosidase, polysaccharide alpha-L-arabinofuranosidase, alpha-L-arabinofuranoside hydrolase, L-arabinosidase, or alpha-L-arabinanase. Alpha-L-arabinofuranosidase activity can be determined using 5 mg of medium viscosity wheat arabinoxylan (Megazyme International Ireland, Ltd., Bray, Co. Wicklow, Ireland) per ml of 100 mM sodium acetate pH 5 in a total volume of 200 l for 30 minutes at 40 C. followed by arabinose analysis by AMINEX HPX-87H column chromatography (Bio-Rad Laboratories, Inc., Hercules, Calif., USA).

(17) Alpha-glucuronidase: The term alpha-glucuronidase means an alpha-D-glucosiduronate glucuronohydrolase (EC 3.2.1.139) that catalyzes the hydrolysis of an alpha-D-glucuronoside to D-glucuronate and an alcohol. Alpha-glucuronidase activity can be determined according to de Vries, 1998, J. Bacteriol. 180: 243-249. One unit of alpha-glucuronidase equals the amount of enzyme capable of releasing 1 mole of glucuronic or 4-O-methylglucuronic acid per minute at pH 5, 40 C.

(18) Auxiliary Activity 9 polypeptide: The term Auxiliary Activity 9 polypeptide or AA9 polypeptide means a polypeptide classified as a lytic polysaccharide monooxygenase (Quinlan et al., 2011, Proc. Natl. Acad. Sci. USA 208: 15079-15084; Phillips et al., 2011, ACS Chem. Biol. 6: 1399-1406; Lin et al., 2012, Structure 20: 1051-1061). AA9 polypeptides were formerly classified into the glycoside hydrolase Family 61 (GH61) according to Henrissat, 1991, Biochem. J. 280: 309-316, and Henrissat and Bairoch, 1996, Biochem. J. 316: 695-696.

(19) AA9 polypeptides enhance the hydrolysis of a cellulosic material by an enzyme having cellulolytic activity, e.g., cellulase composition. Cellulolytic enhancing activity can be determined by measuring the increase in reducing sugars or the increase of the total of cellobiose and glucose from the hydrolysis of the cellulosic material by the cellulolytic enzyme under the following conditions: 1-50 mg of total protein/g of cellulose in pretreated corn stover (PCS), wherein total protein is comprised of 50-99.5% w/w cellulolytic enzyme protein and 0.5-50% w/w protein of an AA9 polypeptide for 1-7 days at a suitable temperature, such as 40 C.-80 C., e.g., 40 C., 45 C., 50 C., 55 C., 60 C., 65 C., 70 C., 75 C., or 80 C., and a suitable pH, such as 4-9, e.g., 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, or 9.0, compared to a control hydrolysis with equal total protein loading without cellulolytic enhancing activity (1-50 mg of cellulolytic protein/g of cellulose in PCS).

(20) AA9 polypeptide enhancing activity can be determined using a mixture of CELLUCLAST 1.5 L (Novozymes A/S, Bagsrd, Denmark) and beta-glucosidase as the source of the cellulolytic activity, wherein the beta-glucosidase is present at a weight of at least 2-5% protein of the cellulase protein loading. In one aspect, the beta-glucosidase is an Aspergillus oryzae beta-glucosidase (e.g., recombinantly produced in Aspergillus oryzae according to WO 02/095014). In another aspect, the beta-glucosidase is an Aspergillus fumigatus beta-glucosidase (e.g., recombinantly produced in Aspergillus oryzae as described in WO 02/095014).

(21) AA9 polypeptide enhancing activity can also be determined by incubating an AA9 polypeptide with 0.5% phosphoric acid swollen cellulose (PASC), 100 mM sodium acetate pH 5, 1 mM MnSO.sub.4, 0.1% gallic acid, 0.025 mg/ml of Aspergillus fumigatus beta-glucosidase, and 0.01% TRITON X-100 (4-(1,1,3,3-tetramethylbutyl)phenyl-polyethylene glycol) for 24-96 hours at 40 C. followed by determination of the glucose released from the PASC.

(22) AA9 polypeptide enhancing activity can also be determined according to WO 2013/028928 for high temperature compositions.

(23) AA9 polypeptides enhance the hydrolysis of a cellulosic material catalyzed by enzyme having cellulolytic activity by reducing the amount of cellulolytic enzyme required to reach the same degree of hydrolysis preferably at least 1.01-fold, e.g., at least 1.05-fold, at least 1.10-fold, at least 1.25-fold, at least 1.5-fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 10-fold, or at least 20-fold.

(24) The AA9 polypeptide can also be used in the presence of a soluble activating divalent metal cation according to WO 2008/151043 or WO 2012/122518, e.g., manganese or copper.

(25) The AA9 polypeptide can also be used in the presence of a dioxy compound, a bicyclic compound, a heterocyclic compound, a nitrogen-containing compound, a quinone compound, a sulfur-containing compound, or a liquor obtained from a pretreated cellulosic or hemicellulosic material such as pretreated corn stover (WO 2012/021394, WO 2012/021395, WO 2012/021396, WO 2012/021399, WO 2012/021400, WO 2012/021401, WO 2012/021408, and WO 2012/021410).

(26) Aspartic protease: The term aspartic protease means a protease that involves an aspartate residue(s) for catalyzing the hydrolysis of peptide bonds in peptides and proteins. Aspartic proteases are a family of protease enzymes that generally have two highly-conserved aspartates in the active site and are optimally active at acidic pH (Szecsi, 1992, Scand. J. Clin. Lab. In vest. Suppl. 210: 5-22). Aspartic protease activity can be determined according to the procedure described by Aikawa et al., 2001, J. Biochem. 129: 791-794.

(27) Beta-glucosidase: The term beta-glucosidase means a beta-D-glucoside glucohydrolase (E.C. 3.2.1.21) that catalyzes the hydrolysis of terminal non-reducing beta-D-glucose residues with the release of beta-D-glucose. Beta-glucosidase activity can be determined using p-nitrophenyl-beta-D-glucopyranoside as substrate according to the procedure of Venturi et al., 2002, J. Basic Microbiol. 42: 55-66. One unit of beta-glucosidase is defined as 1.0 mole of p-nitrophenolate anion produced per minute at 25 C., pH 4.8 from 1 mM p-nitrophenyl-beta-D-glucopyranoside as substrate in 50 mM sodium citrate containing 0.01% TWEEN 20.

(28) Beta-xylosidase: The term beta-xylosidase means a beta-D-xyloside xylohydrolase (E.C. 3.2.1.37) that catalyzes the exo-hydrolysis of short beta (1.fwdarw.4)-xylooligosaccharides to remove successive D-xylose residues from non-reducing termini. Beta-xylosidase activity can be determined using 1 mM p-nitrophenyl-beta-D-xyloside as substrate in 100 mM sodium citrate containing 0.01% TWEEN 20 at pH 5, 40 C. One unit of beta-xylosidase is defined as 1.0 mole of p-nitrophenolate anion produced per minute at 40 C., pH 5 from 1 mM p-nitrophenyl-beta-D-xyloside in 100 mM sodium citrate containing 0.01% TWEEN 20.

(29) Catalase: The term catalase means a hydrogen-peroxide:hydrogen-peroxide oxidoreductase (EC 1.11.1.6) that catalyzes the conversion of 2H.sub.2O.sub.2 to O.sub.2+2 H.sub.2O. For purposes of the present invention, catalase activity is determined according to U.S. Pat. No. 5,646,025. One unit of catalase activity equals the amount of enzyme that catalyzes the oxidation of 1 mole of hydrogen peroxide under the assay conditions.

(30) cDNA: The term cDNA means a DNA molecule that can be prepared by reverse transcription from a mature, spliced, mRNA molecule obtained from a eukaryotic or prokaryotic cell. cDNA lacks intron sequences that may be present in the corresponding genomic DNA. The initial, primary RNA transcript is a precursor to mRNA that is processed through a series of steps, including splicing, before appearing as mature spliced mRNA.

(31) Cellobiohydrolase: The term cellobiohydrolase means a 1,4-beta-D-glucan cellobiohydrolase (E.C. 3.2.1.91 and E.C. 3.2.1.176) that catalyzes the hydrolysis of 1,4-beta-D-glucosidic linkages in cellulose, cellooligosaccharides, or any beta-1,4-linked glucose containing polymer, releasing cellobiose from the reducing end (cellobiohydrolase I) or non-reducing end (cellobiohydrolase II) of the chain (Teeri, 1997, Trends in Biotechnology 15: 160-167; Teeri et al., 1998, Biochem. Soc. Trans. 26: 173-178). Cellobiohydrolase activity can be determined according to the procedures described by Lever et al., 1972, Anal. Biochem. 47: 273-279; van Tilbeurgh et al., 1982, FEBS Letters 149: 152-156; van Tilbeurgh and Claeyssens, 1985, FEBS Letters 187: 283-288; and Tomme et al., 1988, Eur. J. Biochem. 170: 575-581.

(32) Cellulolytic enzyme or cellulase: The term cellulolytic enzyme or cellulase means one or more (e.g., several) enzymes that hydrolyze a cellulosic material. Such enzymes include endoglucanase(s), cellobiohydrolase(s), beta-glucosidase(s), or combinations thereof. The two basic approaches for measuring cellulolytic enzyme activity include: (1) measuring the total cellulolytic enzyme activity, and (2) measuring the individual cellulolytic enzyme activities (endoglucanases, cellobiohydrolases, and beta-glucosidases) as reviewed in Zhang et al., 2006, Biotechnology Advances 24: 452-481. Total cellulolytic enzyme activity can be measured using insoluble substrates, including Whatman N21 filter paper, microcrystalline cellulose, bacterial cellulose, algal cellulose, cotton, pretreated lignocellulose, etc. The most common total cellulolytic activity assay is the filter paper assay using Whatman N21 filter paper as the substrate. The assay was established by the International Union of Pure and Applied Chemistry (IUPAC) (Ghose, 1987, Pure Appl. Chem. 59: 257-68).

(33) Cellulolytic enzyme activity can be determined by measuring the increase in production/release of sugars during hydrolysis of a cellulosic material by cellulolytic enzyme(s) under the following conditions: 1-50 mg of cellulolytic enzyme protein/g of cellulose in pretreated corn stover (PCS) (or other pretreated cellulosic material) for 3-7 days at a suitable temperature such as 40 C.-80 C., e.g., 40 C., 45 C., 50 C., 55 C., 60 C., 65 C., 70 C., 75 C., or 80 C., and a suitable pH, such as 4-9, e.g., 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, or 9.0, compared to a control hydrolysis without addition of cellulolytic enzyme protein. Typical conditions are 1 ml reactions, washed or unwashed PCS, 5% insoluble solids (dry weight), 50 mM sodium acetate pH 5, 1 mM MnSO.sub.4, 50 C., 55 C., or 60 C., 72 hours, sugar analysis by AMINEX HPX-87H column chromatography (Bio-Rad Laboratories, Inc., Hercules, Calif., USA).

(34) Cellulosic material: The term cellulosic material means any material containing cellulose. The predominant polysaccharide in the primary cell wall of biomass is cellulose, the second most abundant is hemicellulose, and the third is pectin. The secondary cell wall, produced after the cell has stopped growing, also contains polysaccharides and is strengthened by polymeric lignin covalently cross-linked to hemicellulose. Cellulose is a homopolymer of anhydrocellobiose and thus a linear beta-(1-4)-D-glucan, while hemicelluloses include a variety of compounds, such as xylans, xyloglucans, arabinoxylans, and mannans in complex branched structures with a spectrum of substituents. Although generally polymorphous, cellulose is found in plant tissue primarily as an insoluble crystalline matrix of parallel glucan chains. Hemicelluloses usually hydrogen bond to cellulose, as well as to other hemicelluloses, which help stabilize the cell wall matrix.

(35) Cellulose is generally found, for example, in the stems, leaves, hulls, husks, and cobs of plants or leaves, branches, and wood of trees. The cellulosic material can be, but is not limited to, agricultural residue, herbaceous material (including energy crops), municipal solid waste, pulp and paper mill residue, waste paper, and wood (including forestry residue) (see, for example, Wiselogel et al., 1995, in Handbook on Bioethanol (Charles E. Wyman, editor), pp. 105-118, Taylor & Francis, Washington D.C.; Wyman, 1994, Bioresource Technology 50: 3-16; Lynd, 1990, Applied Biochemistry and Biotechnology 24/25: 695-719; Mosier et al., 1999, Recent Progress in Bioconversion of Lignocellulosics, in Advances in Biochemical Engineering/Biotechnology, T. Scheper, managing editor, Volume 65, pp. 23-40, Springer-Verlag, New York). It is understood herein that the cellulose may be in the form of lignocellulose, a plant cell wall material containing lignin, cellulose, and hemicellulose in a mixed matrix. In one aspect, the cellulosic material is any biomass material. In another aspect, the cellulosic material is lignocellulose, which comprises cellulose, hemicelluloses, and lignin.

(36) In an embodiment, the cellulosic material is agricultural residue, herbaceous material (including energy crops), municipal solid waste, pulp and paper mill residue, waste paper, or wood (including forestry residue).

(37) In another embodiment, the cellulosic material is arundo, bagasse, bamboo, corn cob, corn fiber, corn stover, miscanthus, rice straw, sugar cane straw, switchgrass, or wheat straw.

(38) In another embodiment, the cellulosic material is aspen, eucalyptus, fir, pine, poplar, spruce, or willow.

(39) In another embodiment, the cellulosic material is algal cellulose, bacterial cellulose, cotton linter, filter paper, microcrystalline cellulose (e.g., AVICEL), or phosphoric-acid treated cellulose.

(40) In another embodiment, the cellulosic material is an aquatic biomass. As used herein the term aquatic biomass means biomass produced in an aquatic environment by a photosynthesis process. The aquatic biomass can be algae, emergent plants, floating-leaf plants, or submerged plants.

(41) The cellulosic material may be used as is or may be subjected to pretreatment, using conventional methods known in the art, as described herein. In a preferred aspect, the cellulosic material is pretreated.

(42) Coding sequence: The term coding sequence means a polynucleotide, which directly specifies the amino acid sequence of a polypeptide. The boundaries of the coding sequence are generally determined by an open reading frame, which begins with a start codon such as ATG, GTG, or TTG and ends with a stop codon such as TAA, TAG, or TGA. The coding sequence may be a genomic DNA, cDNA, synthetic DNA, or a combination thereof.

(43) Control sequences: The term control sequences means nucleic acid sequences necessary for expression of a polynucleotide encoding a mature polypeptide of the present invention. Each control sequence may be native (i.e., from the same gene) or foreign (i.e., from a different gene) to the polynucleotide encoding the polypeptide or native or foreign to each other. Such control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator. At a minimum, the control sequences include a promoter, and transcriptional and translational stop signals. The control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the polynucleotide encoding a polypeptide.

(44) Endoglucanase: The term endoglucanase means a 4-(1,3;1,4)-beta-D-glucan 4-glucanohydrolase (E.C. 3.2.1.4) that catalyzes endohydrolysis of 1,4-beta-D-glycosidic linkages in cellulose, cellulose derivatives (such as carboxymethyl cellulose and hydroxyethyl cellulose), lichenin, beta-1,4 bonds in mixed beta-1,3-1,4 glucans such as cereal beta-D-glucans or xyloglucans, and other plant material containing cellulosic components. Endoglucanase activity can be determined by measuring reduction in substrate viscosity or increase in reducing ends determined by a reducing sugar assay (Zhang et al., 2006, Biotechnology Advances 24: 452-481). Endoglucanase activity can also be determined using carboxymethyl cellulose (CMC) as substrate according to the procedure of Ghose, 1987, Pure and Appl. Chem. 59: 257-268, at pH 5, 40 C.

(45) Expression: The term expression includes any step involved in the production of a polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

(46) Expression vector: The term expression vector means a linear or circular DNA molecule that comprises a polynucleotide encoding a polypeptide and is operably linked to control sequences that provide for its expression.

(47) Feruloyl esterase: The term feruloyl esterase means a 4-hydroxy-3-methoxycinnamoyl-sugar hydrolase (EC 3.1.1.73) that catalyzes the hydrolysis of 4-hydroxy-3-methoxycinnamoyl (feruloyl) groups from esterified sugar, which is usually arabinose in natural biomass substrates, to produce ferulate (4-hydroxy-3-methoxycinnamate). Feruloyl esterase (FAE) is also known as ferulic acid esterase, hydroxycinnamoyl esterase, FAE-III, cinnamoyl ester hydrolase, FAEA, cinnAE, FAE-I, or FAE-II. Feruloyl esterase activity can be determined using 0.5 mM p-nitrophenylferulate as substrate in 50 mM sodium acetate pH 5.0. One unit of feruloyl esterase equals the amount of enzyme capable of releasing 1 mole of p-nitrophenolate anion per minute at pH 5, 25 C.

(48) Fragment: The term fragment means a polypeptide having one or more (e.g., several) amino acids absent from the amino and/or carboxyl terminus of a mature polypeptide, wherein the fragment has enzyme activity. In one aspect, a fragment contains at least 85%, e.g., at least 90% or at least 95% of the amino acid residues of the mature polypeptide of an enzyme.

(49) Hemicellulolytic enzyme or hemicellulase: The term hemicellulolytic enzyme or hemicellulase means one or more (e.g., several) enzymes that hydrolyze a hemicellulosic material. See, for example, Shallom and Shoham, 2003, Current Opinion In Microbiology 6(3): 219-228). Hemicellulases are key components in the degradation of plant biomass. Examples of hemicellulases include, but are not limited to, an acetylmannan esterase, an acetylxylan esterase, an arabinanase, an arabinofuranosidase, a coumaric acid esterase, a feruloyl esterase, a galactosidase, a glucuronidase, a glucuronoyl esterase, a mannanase, a mannosidase, a xylanase, and a xylosidase. The substrates for these enzymes, hemicelluloses, are a heterogeneous group of branched and linear polysaccharides that are bound via hydrogen bonds to the cellulose microfibrils in the plant cell wall, crosslinking them into a robust network. Hemicelluloses are also covalently attached to lignin, forming together with cellulose a highly complex structure. The variable structure and organization of hemicelluloses require the concerted action of many enzymes for its complete degradation. The catalytic modules of hemicellulases are either glycoside hydrolases (GHs) that hydrolyze glycosidic bonds, or carbohydrate esterases (CEs), which hydrolyze ester linkages of acetate or ferulic acid side groups. These catalytic modules, based on homology of their primary sequence, can be assigned into GH and CE families. Some families, with an overall similar fold, can be further grouped into clans, marked alphabetically (e.g., GH-A). A most informative and updated classification of these and other carbohydrate active enzymes is available in the Carbohydrate-Active Enzymes (CAZy) database. Hemicellulolytic enzyme activities can be measured according to Ghose and Bisaria, 1987, Pure & Appl. Chem. 59: 1739-1752, at a suitable temperature such as 40 C.-80 C., e.g., 40 C., 45 C., 50 C., 55 C., 60 C., 65 C., 70 C., 75 C., or 80 C., and a suitable pH such as 4-9, e.g., 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, or 9.0.

(50) Hemicellulosic material: The term hemicellulosic material means any material comprising hemicelluloses. Hemicelluloses include xylan, glucuronoxylan, arabinoxylan, glucomannan, and xyloglucan. These polysaccharides contain many different sugar monomers. Sugar monomers in hemicellulose can include xylose, mannose, galactose, rhamnose, and arabinose. Hemicelluloses contain most of the D-pentose sugars. Xylose is in most cases the sugar monomer present in the largest amount, although in softwoods mannose can be the most abundant sugar. Xylan contains a backbone of beta-(1-4)-linked xylose residues. Xylans of terrestrial plants are heteropolymers possessing a beta-(1-4)-D-xylopyranose backbone, which is branched by short carbohydrate chains. They comprise D-glucuronic acid or its 4-O-methyl ether, L-arabinose, and/or various oligosaccharides, composed of D-xylose, L-arabinose, D- or L-galactose, and D-glucose. Xylan-type polysaccharides can be divided into homoxylans and heteroxylans, which include glucuronoxylans, (arabino)glucuronoxylans, (glucurono)arabinoxylans, arabinoxylans, and complex heteroxylans. See, for example, Ebringerova et al., 2005, Adv. Polym. Sci. 186: 1-67. Hemicellulosic material is also known herein as xylan-containing material.

(51) Sources for hemicellulosic material are essentially the same as those for cellulosic material described herein.

(52) In the processes of the present invention, any material containing hemicellulose may be used. In a preferred aspect, the hemicellulosic material is lignocellulose.

(53) Host cell: The term host cell means any cell type that is susceptible to transformation, transfection, transduction, or the like with a nucleic acid construct or expression vector comprising a polynucleotide encoding a polypeptide. The term host cell encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication.

(54) Isolated: The term isolated means a substance in a form or environment that does not occur in nature. Non-limiting examples of isolated substances include (1) any non-naturally occurring substance, (2) any substance including, but not limited to, any enzyme, variant, nucleic acid, protein, peptide or cofactor, that is at least partially removed from one or more or all of the naturally occurring constituents with which it is associated in nature; (3) any substance modified by the hand of man relative to that substance found in nature; or (4) any substance modified by increasing the amount of the substance relative to other components with which it is naturally associated (e.g., recombinant production in a host cell; multiple copies of a gene encoding the substance; and use of a stronger promoter than the promoter naturally associated with the gene encoding the substance).

(55) Mature polypeptide: The term mature polypeptide means a polypeptide in its final form following translation and any post-translational modifications, such as N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, etc. In one aspect, the mature polypeptide of a cellobiohydrolase I is amino acids 26 to 532 of SEQ ID NO: 2 based on the SignalP 3.0 program (Bendtsen et al., 2004, J. Mol. Biol. 340: 783-795) that predicts amino acids 1 to 25 of SEQ ID NO: 2 are a signal peptide. In another aspect, the mature polypeptide of a cellobiohydrolase II is amino acids 19 to 464 of SEQ ID NO: 4 based on the SignalP 3.0 program that predicts amino acids 1 to 18 of SEQ ID NO: 4 are a signal peptide. In another aspect, the mature polypeptide of a beta-glucosidase is amino acids 20 to 863 of SEQ ID NO: 6 based on the SignalP 3.0 program that predicts amino acids 1 to 19 of SEQ ID NO: 6 are a signal peptide. In another aspect, the mature polypeptide of a beta-glucosidase variant is amino acids 20 to 863 of SEQ ID NO: 36 based on the SignalP 3.0 program that predicts amino acids 1 to 19 of SEQ ID NO: 36 are a signal peptide. In another aspect, the mature polypeptide of an AA9 polypeptide is amino acids 26 to 253 of SEQ ID NO: 8 based on the SignalP 3.0 program that predicts amino acids 1 to 25 of SEQ ID NO: 8 are a signal peptide. In another aspect, the mature polypeptide of a GH10 xylanase is amino acids 21 to 405 of SEQ ID NO: 10 based on the SignalP 3.0 program that predicts amino acids 1 to 20 of SEQ ID NO: 10 are a signal peptide. In another aspect, the mature polypeptide of a GH10 xylanase is amino acids 20 to 398 of SEQ ID NO: 12 based on the SignalP 3.0 program that predicts amino acids 1 to 19 of SEQ ID NO: 12 are a signal peptide. In another aspect, the mature polypeptide of a beta-xylosidase is amino acids 22 to 796 of SEQ ID NO: 14 based on the SignalP 3.0 program that predicts amino acids 1 to 21 of SEQ ID NO: 14 are a signal peptide. In another aspect, the mature polypeptide of an endoglucanase I is amino acids 23 to 459 of SEQ ID NO: 16 based on the SignalP 3.0 program that predicts amino acids 1 to 22 of SEQ ID NO: 16 are a signal peptide. In another aspect, the mature polypeptide of an endoglucanase II is amino acids 22 to 418 of SEQ ID NO: 18 based on the SignalP 3.0 program that predicts amino acids 1 to 21 of SEQ ID NO: 18 are a signal peptide. In another aspect, the mature polypeptide of a Trichoderma reesei cellobiohydrolase I is amino acids 18 to 514 of SEQ ID NO: 20 based on the SignalP 3.0 program that predicts amino acids 1 to 17 of SEQ ID NO: 20 are a signal peptide. In another aspect, the mature polypeptide of a Trichoderma reesei cellobiohydrolase II is amino acids 19 to 471 of SEQ ID NO: 22 based on the SignalP 3.0 program that predicts amino acids 1 to 18 of SEQ ID NO: 22 are a signal peptide. In another aspect, the mature polypeptide of a Trichoderma reesei beta-glucosidase is amino acids 20 to 744 of SEQ ID NO: 24 based on the SignalP 3.0 program that predicts amino acids 1 to 19 of SEQ ID NO: 24 are a signal peptide. In another aspect, the mature polypeptide of a Trichoderma reesei xylanase I is amino acids 20 to 229 of SEQ ID NO: 26 based on the SignalP 3.0 program that predicts amino acids 1 to 19 of SEQ ID NO: 26 are a signal peptide. In another aspect, the mature polypeptide of a Trichoderma reesei xylanase II is amino acids 20 to 223 of SEQ ID NO: 28 based on the SignalP 3.0 program that predicts amino acids 1 to 19 of SEQ ID NO: 28 are a signal peptide. In another aspect, the mature polypeptide of a Trichoderma reesei xylanase III is amino acids 17 to 347 of SEQ ID NO: 30 based on the SignalP 3.0 program that predicts amino acids 1 to 16 of SEQ ID NO: 30 are a signal peptide. In another aspect, the mature polypeptide of a Trichoderma reesei beta-xylosidase is amino acids 21 to 796 of SEQ ID NO: 32 based on the SignalP 3.0 program that predicts amino acids 1 to 20 of SEQ ID NO: 32 are a signal peptide. In another aspect, the mature polypeptide of a catalase is amino acids 17 to 740 of SEQ ID NO: 34 based on the SignalP 3.0 program that predicts amino acids 1 to 16 of SEQ ID NO: 34 are a signal peptide. In another aspect, the mature polypeptide of an endoglucanase II is amino acids 19 to 335 of SEQ ID NO: 106 based on the SignalP 3.0 program that predicts amino acids 1 to 18 of SEQ ID NO: 106 are a signal peptide. It is known in the art that a host cell may produce a mixture of two of more different mature polypeptides (i.e., with a different C-terminal and/or N-terminal amino acid) expressed by the same polynucleotide.

(56) Mature polypeptide coding sequence: The term mature polypeptide coding sequence means a polynucleotide that encodes a mature polypeptide having enzyme activity. In one aspect, the mature polypeptide coding sequence of a cellobiohydrolase I is nucleotides 76 to 1727 of SEQ ID NO: 1 or the cDNA sequence thereof based on the SignalP 3.0 program that predicts nucleotides 1 to 75 of SEQ ID NO: 1 encode a signal peptide. In another aspect, the mature polypeptide coding sequence of a cellobiohydrolase II is nucleotides 55 to 1895 of SEQ ID NO: 3 or the cDNA sequence thereof based on the SignalP 3.0 program that predicts nucleotides 1 to 54 of SEQ ID NO: 3 encode a signal peptide. In another aspect, the mature polypeptide coding sequence of a beta-glucosidase is nucleotides 58 to 3057 of SEQ ID NO: 5 or the cDNA sequence thereof based on the SignalP 3.0 program that predicts nucleotides 1 to 57 of SEQ ID NO: 5 encode a signal peptide. In another aspect, the mature polypeptide coding sequence of a beta-glucosidase variant is nucleotides 58 to 3057 of SEQ ID NO: 35 or the cDNA sequence thereof based on the SignalP 3.0 program that predicts nucleotides 1 to 57 of SEQ ID NO: 35 encode a signal peptide. In another aspect, the mature polypeptide coding sequence of an AA9 polypeptide is nucleotides 76 to 832 of SEQ ID NO: 7 or the cDNA sequence thereof based on the SignalP 3.0 program that predicts nucleotides 1 to 75 of SEQ ID NO: 7 encode a signal peptide. In another aspect, the mature polypeptide coding sequence of a GH10 xylanase is nucleotides 124 to 1517 of SEQ ID NO: 9 or the cDNA sequence thereof based on the SignalP 3.0 program that predicts nucleotides 1 to 123 of SEQ ID NO: 9 encode a signal peptide. In another aspect, the mature polypeptide coding sequence of a GH10 xylanase is nucleotides 58 to 1194 of SEQ ID NO: 11 based on the SignalP 3.0 program that predicts nucleotides 1 to 57 of SEQ ID NO: 11 encode a signal peptide. In another aspect, the mature polypeptide coding sequence of a beta-xylosidase is nucleotides 64 to 2388 of SEQ ID NO: 13 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 13 encode a signal peptide. In another aspect, the mature polypeptide coding sequence of an endoglucanase I is nucleotides 67 to 1504 of SEQ ID NO: 15 or the cDNA sequence thereof based on the SignalP 3.0 program that predicts nucleotides 1 to 66 of SEQ ID NO: 15 encode a signal peptide. In another aspect, the mature polypeptide coding sequence of an endoglucanase II is nucleotides 64 to 1504 of SEQ ID NO: 17 based on the SignalP 3.0 program that predicts nucleotides 1 to 63 of SEQ ID NO: 17 encode a signal peptide. In another aspect, the mature polypeptide coding sequence of a Trichoderma reesei cellobiohydrolase I is nucleotides 52 to 1545 of SEQ ID NO: 19 or the cDNA sequence thereof based on the SignalP 3.0 program that predicts nucleotides 1 to 51 of SEQ ID NO: 19 encode a signal peptide. In another aspect, the mature polypeptide coding sequence of a Trichoderma reesei cellobiohydrolase II is nucleotides 55 to 1608 of SEQ ID NO: 21 or the cDNA sequence thereof based on the SignalP 3.0 program that predicts nucleotides 1 to 54 of SEQ ID NO: 21 encode a signal peptide. In another aspect, the mature polypeptide coding sequence of a Trichoderma reesei beta-glucosidase is nucleotides 58 to 2612 of SEQ ID NO: 23 or the cDNA sequence thereof based on the SignalP 3.0 program that predicts nucleotides 1 to 57 of SEQ ID NO: 23 encode a signal peptide. In another aspect, the mature polypeptide coding sequence of a Trichoderma reesei xylanase I is nucleotides 58 to 749 of SEQ ID NO: 25 or the cDNA sequence thereof based on the SignalP 3.0 program that predicts nucleotides 1 to 57 of SEQ ID NO: 25 encode a signal peptide. In another aspect, the mature polypeptide coding sequence of a Trichoderma reesei xylanase II is nucleotides 58 to 778 of SEQ ID NO: 27 or the cDNA sequence thereof based on the SignalP 3.0 program that predicts nucleotides 1 to 57 of SEQ ID NO: 27 encode a signal peptide. In another aspect, the mature polypeptide coding sequence of a Trichoderma reesei xylanase III is nucleotides 49 to 1349 of SEQ ID NO: 29 or the cDNA sequence thereof based on the SignalP 3.0 program that predicts nucleotides 1 to 48 of SEQ ID NO: 29 encode a signal peptide. In another aspect, the mature polypeptide coding sequence of a Trichoderma reesei beta-xylosidase is nucleotides 61 to 2391 of SEQ ID NO: 31 or the cDNA sequence thereof based on the SignalP 3.0 program that predicts nucleotides 1 to 60 of SEQ ID NO: 31 encode a signal peptide. In another aspect, the mature polypeptide coding sequence of a catalase is nucleotides 49 to 2499 of SEQ ID NO: 33 or the cDNA sequence thereof based on the SignalP 3.0 program that predicts nucleotides 1 to 48 of SEQ ID NO: 33 encode a signal peptide. In another aspect, the mature polypeptide coding sequence of an endoglucanase II is nucleotides 55 to 1005 of SEQ ID NO: 105 or the genomic DNA sequence thereof based on the SignalP 3.0 program that predicts nucleotides 1 to 54 of SEQ ID NO: 105 encode a signal peptide.

(57) Nucleic acid construct: The term nucleic acid construct means a nucleic acid molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or is modified to contain segments of nucleic acids in a manner that would not otherwise exist in nature or which is synthetic, which comprises one or more control sequences.

(58) Operably linked: The term operably linked means a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of a polynucleotide such that the control sequence directs expression of the coding sequence.

(59) Pretreated cellulosic or hemicellulosic material: The term pretreated cellulosic or hemicellulosic material means a cellulosic or hemicellulosic material derived from biomass by treatment with heat and dilute sulfuric acid, alkaline pretreatment, neutral pretreatment, or any pretreatment known in the art.

(60) Pretreated corn stover: The term Pretreated Corn Stover or PCS means a cellulosic material derived from corn stover by treatment with heat and dilute sulfuric acid, alkaline pretreatment, neutral pretreatment, or any pretreatment known in the art.

(61) Sequence identity: The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter sequence identity.

(62) For purposes of the present invention, the sequence identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), preferably version 5.0.0 or later. The parameters used are a gap open penalty of 10, a gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. The output of Needle labeled longest identity (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:
(Identical Residues100)/(Length of AlignmentTotal Number of Gaps in Alignment)

(63) For purposes of the present invention, the sequence identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably version 5.0.0 or later. The parameters used are a gap open penalty of 10, a gap extension penalty of 0.5, and the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. The output of Needle labeled longest identity (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:
(Identical Deoxyribonucleotides100)/(Length of AlignmentTotal Number of Gaps in Alignment)

(64) Stringency Conditions: The term very low stringency conditions means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42 C. in 5SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 25% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 0.2SSC, 0.2% SDS at 45 C.

(65) The term low stringency conditions means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42 C. in 5SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 25% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 0.2SSC, 0.2% SDS at 50 C.

(66) The term medium stringency conditions means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42 C. in 5SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 35% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 0.2SSC, 0.2% SDS at 55 C.

(67) The term medium-high stringency conditions means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42 C. in 5SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 35% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 0.2SSC, 0.2% SDS at 60 C.

(68) The term high stringency conditions means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42 C. in 5SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 50% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 0.2SSC, 0.2% SDS at 65 C.

(69) The term very high stringency conditions means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42 C. in 5SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 50% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 0.2SSC, 0.2% SDS at 70 C.

(70) Subsequence: The term subsequence means a polynucleotide having one or more (e.g., several) nucleotides absent from the 5 and/or 3 end of a mature polypeptide coding sequence, wherein the subsequence encodes a fragment having enzyme activity. In one aspect, a subsequence contains at least 85%, e.g., at least 90% or at least 95% of the nucleotides of the mature polypeptide coding sequence of an enzyme.

(71) Subtilisin-like serine protease: The term subtilisin-like serine protease means a protease with a substrate specificity similar to subtilisin that involves a serine residue for catalyzing the hydrolysis of peptide bonds in peptides and proteins. Subtilisin-like proteases (subtilases) are serine proteases characterized by a catalytic triad of the three amino acids aspartate, histidine, and serine. The arrangement of these catalytic residues is shared with the prototypical subtilisin from Bacillus licheniformis (Siezen and Leunissen, 1997, Protein Science 6: 501-523). Subtilisin-like serine protease activity can be determined using a synthetic substrate, N-succinyl-L-Ala-L-Ala-L-Pro-L-Phe-p-nitroanilide (AAPF) (Bachem AG, Bubendorf, Switzerland) in 100 mM NaCl-100 mM MOPS pH 7.0 at 50 C. for 3 hours and then the absorbance at 405 nm is measured.

(72) Transformant: The term transformant means a cell which has taken up extracellular DNA (foreign, artificial or modified) and expresses the gene(s) contained therein.

(73) Transformation: The term transformation means the introduction of extracellular DNA into a cell, i.e., the genetic alteration of a cell resulting from the direct uptake, incorporation and expression of exogenous genetic material (exogenous DNA) from its surroundings and taken up through the cell membrane(s).

(74) Trypsin-like serine protease: The term trypsin-like serine protease means a protease with a substrate specificity similar to trypsin that involves a serine residue for catalyzing the hydrolysis of peptide bonds in peptides and proteins. For purposes of the present invention, trypsin-like serine protease activity is determined according to the procedure described by Dienes et al., 2007, Enzyme and Microbial Technology 40: 1087-1094.

(75) Variant: The term variant means a polypeptide having enzyme activity comprising an alteration, i.e., a substitution, insertion, and/or deletion, at one or more (e.g., several) positions. A substitution means replacement of the amino acid occupying a position with a different amino acid; a deletion means removal of the amino acid occupying a position; and an insertion means adding an amino acid adjacent to and immediately following the amino acid occupying a position.

(76) Whole broth preparation: The term whole broth preparation means a composition produced by a naturally-occurring source, i.e., a naturally-occurring microorganism that is unmodified with respect to the cellulolytic and/or hemicellulolytic enzymes produced by the naturally-occurring microorganism, or a non-naturally-occurring source, i.e., a non-naturally-occurring microorganism, e.g., mutant, that is unmodified with respect to the cellulolytic and/or hemicellulolytic enzymes produced by the non-naturally-occurring microorganism.

(77) Xylan degrading activity or xylanolytic activity: The term xylan degrading activity or xylanolytic activity means a biological activity that hydrolyzes xylan-containing material. The two basic approaches for measuring xylanolytic activity include: (1) measuring the total xylanolytic activity, and (2) measuring the individual xylanolytic activities (e.g., endoxylanases, beta-xylosidases, arabinofuranosidases, alpha-glucuronidases, acetylxylan esterases, feruloyl esterases, and alpha-glucuronyl esterases). Recent progress in assays of xylanolytic enzymes was summarized in several publications including Biely and Puchard, 2006, Journal of the Science of Food and Agriculture 86(11): 1636-1647; Spanikova and Biely, 2006, FEBS Letters 580(19): 4597-4601; Herrmann et al., 1997, Biochemical Journal 321: 375-381.

(78) Total xylan degrading activity can be measured by determining the reducing sugars formed from various types of xylan, including, for example, oat spelt, beechwood, and larchwood xylans, or by photometric determination of dyed xylan fragments released from various covalently dyed xylans. A common total xylanolytic activity assay is based on production of reducing sugars from polymeric 4-O-methyl glucuronoxylan as described in Bailey et al., 1992, Interlaboratory testing of methods for assay of xylanase activity, Journal of Biotechnology 23(3): 257-270.

(79) Xylan degrading activity can also be determined by measuring the increase in hydrolysis of birchwood xylan (Sigma Chemical Co., Inc., St. Louis, Mo., USA) by xylan-degrading enzyme(s) under the following typical conditions: 1 ml reactions, 5 mg/ml substrate (total solids), 5 mg of xylanolytic protein/g of substrate, 50 mM sodium acetate pH 5, 50 C., 24 hours, sugar analysis using p-hydroxybenzoic acid hydrazide (PHBAH) assay as described by Lever, 1972, Anal. Biochem. 47: 273-279.

(80) Xylanase: The term xylanase means a 1,4-beta-D-xylan-xylohydrolase (E.C. 3.2.1.8) that catalyzes the endohydrolysis of 1,4-beta-D-xylosidic linkages in xylans. Xylanase activity can be determined with 0.2% AZCL-arabinoxylan as substrate in 0.01% TRITON X-100 and 200 mM sodium phosphate pH 6 at 37 C. One unit of xylanase activity is defined as 1.0 mole of azurine produced per minute at 37 C., pH 6 from 0.2% AZCL-arabinoxylan as substrate in 200 mM sodium phosphate pH 6.

DETAILED DESCRIPTION OF THE INVENTION

(81) Enzyme Compositions

(82) The present invention relates to enzyme compositions, comprising: (A) (i) a cellobiohydrolase I, (ii) a cellobiohydrolase II, and (iii) at least one enzyme selected from the group consisting of a beta-glucosidase or a variant thereof, an AA9 polypeptide having cellulolytic enhancing activity, a GH10 xylanase, and a beta-xylosidase; (B) (i) a GH10 xylanase and (ii) a beta-xylosidase; or (C) (i) a cellobiohydrolase I, (ii) a cellobiohydrolase II, (iii) a GH10 xylanase, and (iv) a beta-xylosidase;

(83) wherein the cellobiohydrolase I is selected from the group consisting of: (i) a cellobiohydrolase I comprising or consisting of the mature polypeptide of SEQ ID NO: 2; (ii) a cellobiohydrolase I comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 2; (iii) a cellobiohydrolase I encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 1; and (iv) a cellobiohydrolase I encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 1 or the full-length complement thereof;

(84) wherein the cellobiohydrolase II is selected from the group consisting of: (i) a cellobiohydrolase II comprising or consisting of the mature polypeptide of SEQ ID NO: 4; (ii) a cellobiohydrolase II comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 4; (iii) a cellobiohydrolase II encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 3; and (iv) a cellobiohydrolase II encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 3 or the full-length complement thereof;

(85) wherein the beta-glucosidase is selected from the group consisting of: (i) a beta-glucosidase comprising or consisting of the mature polypeptide of SEQ ID NO: 6; (ii) a beta-glucosidase comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 6; (iii) a beta-glucosidase encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 5; and (iv) a beta-glucosidase encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 5 or the full-length complement thereof;

(86) wherein the xylanase is selected from the group consisting of: (i) a xylanase comprising or consisting of the mature polypeptide of SEQ ID NO: 10 or the mature polypeptide of SEQ ID NO: 12; (ii) a xylanase comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 10 or the mature polypeptide of SEQ ID NO: 12; (iii) a xylanase encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 9 or the mature polypeptide coding sequence of SEQ ID NO: 11; and (iv) a xylanase encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 9 or the mature polypeptide coding sequence of SEQ ID NO: 11; or the full-length complement thereof; and

(87) wherein the beta-xylosidase is selected from the group consisting of: (i) a beta-xylosidase comprising or consisting of the mature polypeptide of SEQ ID NO: 14; (ii) a beta-xylosidase comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 14; (iii) a beta-xylosidase encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 13; and (iv) a beta-xylosidase encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 13 or the full-length complement thereof.

(88) In one aspect, the AA9 (GH61) polypeptide is any AA9 polypeptide having cellulolytic enhancing activity. Examples of AA9 polypeptides include, but are not limited to, AA9 polypeptides from Thielavia terrestris (WO 2005/074647, WO 2008/148131, and WO 2011/035027), Thermoascus aurantiacus (WO 2005/074656 and WO 2010/065830), Trichoderma reesei (WO 2007/089290 and WO 2012/149344), Myceliophthora thermophila (WO 2009/085935, WO 2009/085859, WO 2009/085864, WO 2009/085868, WO 2009/033071, WO 2012/027374, and WO 2012/068236), Aspergillus fumigatus (WO 2010/138754), Penicillium pinophilum (WO 2011/005867), Thermoascus sp. (WO 2011/039319), Penicillium sp. (emersonii) (WO 2011/041397 and WO 2012/000892), Thermoascus crustaceous (WO 2011/041504), Aspergillus aculeatus (WO 2012/125925), Thermomyces lanuginosus (WO 2012/113340, WO 2012/129699, WO 2012/130964, and WO 2012/129699), Aurantiporus alborubescens (WO 2012/122477), Trichophaea saccata (WO 2012/122477), Penicillium thomii (WO 2012/122477), Talaromyces stipitatus (WO 2012/135659), Humicola insolens (WO 2012/146171), Malbranchea cinnamomea (WO 2012/101206), Talaromyces leycettanus (WO 2012/101206), and Chaetomium thermophilum (WO 2012/101206), Talaromyces emersonii (WO 2012/000892), Trametes versicolor (WO 2012/092676 and WO 2012/093149), and Talaromyces thermophilus (WO 2012/129697 and WO 2012/130950); which are incorporated herein by reference in their entireties.

(89) In another aspect, the AA9 polypeptide having cellulolytic enhancing activity is selected from the group consisting of: (i) an AA9 polypeptide having cellulolytic enhancing activity comprising or consisting of the mature polypeptide of SEQ ID NO: 8; (ii) an AA9 polypeptide having cellulolytic enhancing activity comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 8; (iii) an AA9 polypeptide having cellulolytic enhancing activity encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 7; and (iv) an AA9 polypeptide having cellulolytic enhancing activity encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 7 or the full-length complement thereof.

(90) In one embodiment, the enzyme composition comprises the cellobiohydrolase I, the cellobiohydrolase II, and the beta-glucosidase or a variant thereof, described above.

(91) In another embodiment, the enzyme composition comprises the cellobiohydrolase I, the cellobiohydrolase II, and the AA9 polypeptide having cellulolytic enhancing activity, described above.

(92) In another embodiment, the enzyme composition comprises the cellobiohydrolase I, the cellobiohydrolase II, and the GH10 xylanase, described above.

(93) In another embodiment, the enzyme composition comprises the cellobiohydrolase I, the cellobiohydrolase II, and the beta-xylosidase, described above.

(94) In another embodiment, the enzyme composition comprises the cellobiohydrolase I, the cellobiohydrolase II, the beta-glucosidase or a variant thereof, and the AA9 polypeptide having cellulolytic enhancing activity, described above.

(95) In another embodiment, the enzyme composition comprises the cellobiohydrolase I, the cellobiohydrolase II, the beta-glucosidase or a variant thereof, and the GH10 xylanase, described above.

(96) In another embodiment, the enzyme composition comprises the cellobiohydrolase I, the cellobiohydrolase II, the beta-glucosidase or a variant thereof, and the beta-xylosidase, described above.

(97) In another embodiment, the enzyme composition comprises the cellobiohydrolase I, the cellobiohydrolase II, the AA9 polypeptide having cellulolytic enhancing activity, and the GH10 xylanase, described above.

(98) In another embodiment, the enzyme composition comprises the cellobiohydrolase I, the cellobiohydrolase II, the AA9 polypeptide having cellulolytic enhancing activity, and the beta-xylosidase, described above.

(99) In another embodiment, the enzyme composition comprises the cellobiohydrolase I, the cellobiohydrolase II, the GH10 xylanase, and the beta-xylosidase, described above.

(100) In another embodiment, the enzyme composition comprises the cellobiohydrolase I, the cellobiohydrolase II, the beta-glucosidase or a variant thereof, the AA9 polypeptide having cellulolytic enhancing activity, and the GH10 xylanase, described above.

(101) In another embodiment, the enzyme composition comprises the cellobiohydrolase I, the cellobiohydrolase II, the beta-glucosidase or a variant thereof, the AA9 polypeptide having cellulolytic enhancing activity, and the beta-xylosidase, described above.

(102) In another embodiment, the enzyme composition comprises the cellobiohydrolase I, the cellobiohydrolase II, the beta-glucosidase or a variant thereof, the GH10 xylanase, and the beta-xylosidase, described above.

(103) In another embodiment, the enzyme composition comprises the cellobiohydrolase I, the cellobiohydrolase II, the AA9 polypeptide having cellulolytic enhancing activity, the GH10 xylanase, and the beta-xylosidase, described above.

(104) In another embodiment, the enzyme composition comprises the cellobiohydrolase I, the cellobiohydrolase II, the beta-glucosidase or a variant thereof, the AA9 polypeptide having cellulolytic enhancing activity, the GH10 xylanase, and the beta-xylosidase, described above.

(105) Each of the enzyme compositions described above may further or even further comprise an endoglucanase I, an endoglucanase II, or an endoglucanase I and an endoglucanase II. In one embodiment, the enzyme compositions described above may further or even further comprise an endoglucanase I. In another embodiment, the enzyme compositions described above may further or even further comprise an endoglucanase II. In another embodiment, the enzyme compositions described above may further or even further comprise an endoglucanase I and an endoglucanase II.

(106) In one aspect, the endoglucanase I is selected from the group consisting of: (i) an endoglucanase I comprising or consisting of the mature polypeptide of SEQ ID NO: 16; (ii) an endoglucanase I comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 16; (iii) an endoglucanase I encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 15; and (iv) an endoglucanase I encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 15 or the full-length complement thereof.

(107) In another aspect, the endoglucanase II is selected from the group consisting of: (i) an endoglucanase II comprising or consisting of the mature polypeptide of SEQ ID NO: 18; (ii) an endoglucanase II comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 18; (iii) an endoglucanase II encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 17; and (iv) an endoglucanase II encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 17 or the full-length complement thereof.

(108) In another aspect, the endoglucanase II is selected from the group consisting of: (i) an endoglucanase II comprising or consisting of the mature polypeptide of SEQ ID NO: 106; (ii) an endoglucanase II comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 106; (iii) an endoglucanase II encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 105; and (iv) an endoglucanase II encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions with the mature polypeptide coding sequence of SEQ ID NO: 105 or the full-length complement thereof.

(109) In another aspect, the enzyme composition further or even further comprises a Trichoderma endoglucanase I or a homolog thereof. In another aspect, the enzyme composition further comprises a Trichoderma reesei endoglucanase I or a homolog thereof. In another aspect, the enzyme composition further comprises a Trichoderma reesei Cel7B endoglucanase I (GENBANK accession no. M15665) or homolog thereof. In another aspect, the Trichoderma reesei endoglucanase I or a homolog thereof is native to the host cell.

(110) In another aspect, the enzyme composition further or even further comprises a Trichoderma endoglucanase II or a homolog thereof. In another aspect, the enzyme composition further comprises a Trichoderma reesei endoglucanase II or a homolog thereof. In another aspect, the enzyme composition further comprises a Trichoderma reesei Cel5A endoglucanase II (GENBANK accession no. M19373) or a homolog thereof. In another aspect, the Trichoderma reesei endoglucanase II or a homolog thereof is native to the host cell.

(111) Each of the enzyme compositions described above may further or even further comprise a catalase.

(112) In one aspect, the catalase is selected from the group consisting of: (i) a catalase comprising or consisting of the mature polypeptide of SEQ ID NO: 34; (ii) a catalase comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 34; (iii) a catalase encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 33; and (iv) a catalase encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 33 or the full-length complement thereof.

(113) The polynucleotides of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 33, and 105, or subsequences thereof, as well as the polypeptides of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 34, and 106, or fragments thereof, may be used to design nucleic acid probes to identify and clone DNA encoding enzymes according to methods well known in the art. In particular, such probes can be used for hybridization with the genomic DNA or cDNA of a cell of interest, following standard Southern blotting procedures, in order to identify and isolate the corresponding gene therein. Such probes can be considerably shorter than the entire sequence, but should be at least 15, e.g., at least 25, at least 35, or at least 70 nucleotides in length. Preferably, the nucleic acid probe is at least 100 nucleotides in length, e.g., at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at least 800 nucleotides, or at least 900 nucleotides in length. Both DNA and RNA probes can be used. The probes are typically labeled for detecting the corresponding gene (for example, with .sup.32P, .sup.3H, .sup.355, biotin, or avidin). Such probes are encompassed by the present invention.

(114) A genomic DNA or cDNA library may be screened for DNA that hybridizes with the probes described above and encodes an enzyme. Genomic or other DNA may be separated by agarose or polyacrylamide gel electrophoresis, or other separation techniques. DNA from the libraries or the separated DNA may be transferred to and immobilized on nitrocellulose or other suitable carrier material. In order to identify a clone or DNA that hybridizes with SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 33, or 105, or a subsequence thereof, the carrier material is used in a Southern blot.

(115) For purposes of the present invention, hybridization indicates that the polynucleotide hybridizes to a labeled nucleic acid probe corresponding to (i) SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 33, or 105; (ii) the mature polypeptide coding sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 33, or 105; (iii) the genomic DNA or cDNA sequence thereof, as appropriate; (iv) the full-length complement thereof; or (v) a subsequence thereof; under very low to very high stringency conditions. Molecules to which the nucleic acid probe hybridizes under these conditions can be detected using, for example, X-ray film or any other detection means known in the art.

(116) In one aspect, the nucleic acid probe is SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 33, or 105, or the mature polypeptide coding sequence thereof. In another aspect, the nucleic acid probe is a polynucleotide that encodes the polypeptide of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 34, or 106; the mature polypeptide thereof; or a fragment thereof.

(117) The techniques used to isolate or clone a polynucleotide are known in the art and include isolation from genomic DNA or cDNA, or a combination thereof. The cloning of the polynucleotides from genomic DNA can be effected, e.g., by using the well-known polymerase chain reaction (PCR) or antibody screening of expression libraries to detect cloned DNA fragments with shared structural features. See, e.g., Innis et al., 1990, PCR: A Guide to Methods and Application, Academic Press, New York. Other nucleic acid amplification procedures such as ligase chain reaction (LCR), ligation activated transcription (LAT) and polynucleotide-based amplification (NASBA) may be used. The polynucleotides may be an allelic or species variant of the polypeptide encoding region of the polynucleotide.

(118) A protein engineered variant of an enzyme above (or protein) may also be used.

(119) In one aspect, the variant is a beta-glucosidase variant. In another aspect, the variant is an Aspergillus fumigatus beta-glucosidase variant. In another aspect, the A. fumigatus beta-glucosidase variant comprises a substitution at one or more (e.g., several) positions corresponding to positions 100, 283, 456, and 512 of SEQ ID NO: 6, wherein the variant has beta-glucosidase activity.

(120) In an embodiment, the variant has a sequence identity of at least 80%, e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, but less than 100%, to the amino acid sequence of the parent beta-glucosidase.

(121) In another embodiment, the variant has at least 80%, e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, but less than 100%, sequence identity to the mature polypeptide of SEQ ID NO: 6.

(122) For purposes of the present invention, the full-length polypeptide disclosed in SEQ ID NO: 6 is used to determine the corresponding amino acid residue in another beta-glucosidase where methionine is position 1 or the mature polypeptide thereof where the N-terminus is position 20 (Gln). The amino acid sequence of another beta-glucosidase is aligned with the full-length polypeptide disclosed in SEQ ID NO: 6 or the mature polypeptide thereof, and based on the alignment, the amino acid position number corresponding to any amino acid residue in the full-length polypeptide disclosed in SEQ ID NO: 6 or the mature polypeptide thereof is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), preferably version 5.0.0 or later. The parameters used are a gap open penalty of 10, a gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix.

(123) Identification of the corresponding amino acid residue in another beta-glucosidase can be determined by alignment of multiple polypeptide sequences using several computer programs including, but not limited to, MUSCLE (multiple sequence comparison by log-expectation; version 3.5 or later; Edgar, 2004, Nucleic Acids Research 32: 1792-2797), MAFTT (version 6.857 or later; Katoh and Kuma, 2002, Nucleic Acids Research 30: 3059-3066; Katoh et al., 2005, Nucleic Acids Research 33: 511-518; Katoh and Toh, 2007, Bioinformatics 23: 372-374; Katoh et al., 2009, Methods in Molecular Biology 537: 39-64; Katoh and Toh, 2010, Bioinformatics 26: 1899-1900), and EMBOSS EMMA employing ClustalW (1.83 or later; Thompson et al., 1994, Nucleic Acids Research 22: 4673-4680), using their respective default parameters.

(124) For an amino acid substitution, the following nomenclature is used: Original amino acid, position, substituted amino acid. Accordingly, the substitution of threonine at position 226 with alanine is designated as Thr226Ala or T226A. Multiple mutations are separated by addition marks (+), e.g., Gly205Arg+Ser411Phe or G205R+S411F, representing substitutions at positions 205 and 411 of glycine (G) with arginine (R) and serine (S) with phenylalanine (F), respectively.

(125) In one aspect, a variant comprises a substitution at one or more (e.g., several) positions corresponding to positions 100, 283, 456, and 512. In another aspect, a variant comprises a substitution at two positions corresponding to any of positions 100, 283, 456, and 512. In another aspect, a variant comprises a substitution at three positions corresponding to any of positions 100, 283, 456, and 512. In another aspect, a variant comprises a substitution at each position corresponding to positions 100, 283, 456, and 512.

(126) In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 100. In another aspect, the amino acid at a position corresponding to position 100 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Asp. In another aspect, the variant comprises or consists of the substitution F100D of the full-length polypeptide of SEQ ID NO: 6 or the mature polypeptide thereof.

(127) In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 283. In another aspect, the amino acid at a position corresponding to position 283 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Gly In another aspect, the variant comprises or consists of the substitution S283G of the full-length polypeptide of SEQ ID NO: 6 or the mature polypeptide thereof.

(128) In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 456. In another aspect, the amino acid at a position corresponding to position 456 is substituted with Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Glu. In another aspect, the variant comprises or consists of the substitution N456E of the full-length polypeptide of SEQ ID NO: 6 or the mature polypeptide thereof.

(129) In another aspect, the variant comprises or consists of a substitution at a position corresponding to position 512. In another aspect, the amino acid at a position corresponding to position 512 is substituted with Ala, Arg, Asn, Asp, Cys, Gin, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, or Val, preferably with Tyr. In another aspect, the variant comprises or consists of the substitution F512Y of the full-length polypeptide of SEQ ID NO: 6 or the mature polypeptide thereof.

(130) In another aspect, the variant comprises or consists of a substitution at positions corresponding to positions 100 and 283, such as those described above.

(131) In another aspect, the variant comprises or consists of substitutions at positions corresponding to positions 100 and 456, such as those described above.

(132) In another aspect, the variant comprises or consists of substitutions at positions corresponding to positions 100 and 512, such as those described above.

(133) In another aspect, the variant comprises or consists of substitutions at positions corresponding to positions 283 and 456, such as those described above.

(134) In another aspect, the variant comprises or consists of substitutions at positions corresponding to positions 283 and 512, such as those described above.

(135) In another aspect, the variant comprises or consists of substitutions at positions corresponding to positions 456 and 512, such as those described above.

(136) In another aspect, the variant comprises or consists of substitutions at positions corresponding to positions 100, 283, and 456, such as those described above.

(137) In another aspect, the variant comprises or consists of substitutions at positions corresponding to positions 100, 283, and 512, such as those described above.

(138) In another aspect, the variant comprises or consists of substitutions at positions corresponding to positions 100, 456, and 512, such as those described above.

(139) In another aspect, the variant comprises or consists of substitutions at positions corresponding to positions 283, 456, and 512, such as those described above.

(140) In another aspect, the variant comprises or consists of substitutions at positions corresponding to positions 100, 283, 456, and 512, such as those described above.

(141) In another aspect, the variant comprises or consists of one or more (e.g., several) substitutions selected from the group consisting of F100D, S283G, N456E, and F512Y.

(142) In another aspect, the variant comprises or consists of the substitutions F100D+S283G of the full-length polypeptide of SEQ ID NO: 6 or the mature polypeptide thereof.

(143) In another aspect, the variant comprises or consists of the substitutions F100D+N456E of the full-length polypeptide of SEQ ID NO: 6 or the mature polypeptide thereof. In another aspect, the variant comprises or consists of the substitutions F100D+F512Y of the full-length polypeptide of SEQ ID NO: 6 or the mature polypeptide thereof.

(144) In another aspect, the variant comprises or consists of the substitutions S283G+N456E of the full-length polypeptide of SEQ ID NO: 6 or the mature polypeptide thereof.

(145) In another aspect, the variant comprises or consists of the substitutions S283G+F512Y of the full-length polypeptide of SEQ ID NO: 6 or the mature polypeptide thereof.

(146) In another aspect, the variant comprises or consists of the substitutions N456E+F512Y of the full-length polypeptide of SEQ ID NO: 6 or the mature polypeptide thereof.

(147) In another aspect, the variant comprises or consists of the substitutions F100D+S283G+N456E of the full-length polypeptide of SEQ ID NO: 6 or the mature polypeptide thereof.

(148) In another aspect, the variant comprises or consists of the substitutions F100D+S283G+F512Y of the full-length polypeptide of SEQ ID NO: 6 or the mature polypeptide thereof.

(149) In another aspect, the variant comprises or consists of the substitutions F100D+N456E+F512Y of the full-length polypeptide of SEQ ID NO: 6 or the mature polypeptide thereof.

(150) In another aspect, the variant comprises or consists of the substitutions S283G+N456E+F512Y of the full-length polypeptide of SEQ ID NO: 6 or the mature polypeptide thereof.

(151) In another aspect, the variant comprises or consists of the substitutions F100D+S283G+N456E+F512Y of the full-length polypeptide of SEQ ID NO: 6 or the mature polypeptide thereof.

(152) The variants may consist of 720 to 863 amino acids, e.g., 720 to 739, 740 to 759, 760 to 779, 780 to 799, 800 to 819, 820 to 839, and 840 to 863 amino acids.

(153) In one aspect, a variant beta-glucosidase comprises or consists of the mature polypeptide of SEQ ID NO: 36.

(154) The variants may further comprise an alteration at one or more (e.g., several) other positions.

(155) In one embodiment, the amount of cellobiohydrolase I in an enzyme composition of the present invention is 5% to 60% of the total protein of the enzyme composition, e.g., 7.5% to 55%, 10% to 50%, 12.5% to 45%, 15% to 40%, 17.5% to 35%, and 20% to 30% of the total protein of the enzyme composition.

(156) In another embodiment, the amount of cellobiohydrolase II in an enzyme composition of the present invention is 2.0-40% of the total protein of the enzyme composition, e.g., 3.0% to 35%, 4.0% to 30%, 5% to 25%, 6% to 20%, 7% to 15%, 7.5% to 12%, 10% to 20%, and 11 to 17% of the total protein of the enzyme composition.

(157) In another embodiment, the amount of beta-glucosidase in an enzyme composition of the present invention is 0% to 30% of the total protein of the enzyme composition, e.g., 1% to 27.5%, 1.5% to 25%, 2% to 22.5%, 3% to 20%, 4% to 19%, % 4.5 to 18%, 5% to 17%, and 6% to 16% of the total protein of the enzyme composition.

(158) In another embodiment, the amount of AA9 polypeptide in an enzyme composition of the present invention is 0% to 50% of the total protein of the enzyme composition, e.g., 2.5% to 45%, 5% to 40%, 7.5% to 35%, 10% to 30%, 10% to 25%, 12.5% to 25%, and 15% to 25% of the total protein of the enzyme composition.

(159) In another embodiment, the amount of xylanase in an enzyme composition of the present invention is 0% to 30% of the total protein of the enzyme composition, e.g., 0.125% to 30%, 0.25% to 25%, 0.5% to 30%, 1.0% to 27.5%, 1.5% to 25%, 2% to 22.5%, 0.5% to 20%, 2.5% to 20%, 3% to 19%, 3.5% to 18%, 4% to 17%, 0.75% to 15%, and 1% to 10% of the total protein of the enzyme composition.

(160) In another embodiment, the amount of beta-xylosidase in an enzyme composition of the present invention is 0% to 50% of the total protein of the enzyme composition, e.g., 0.125% to 30%, 0.25% to 25%, 0.75% to 17.5%, 0.5% to 30%, 1.0% to 27.5%, 1.5% to 25%, 2% to 22.5%, 0.5% to 20%, 2.5% to 20%, 3% to 19%, 3.5% to 18%, 4% to 17%, and 1% to 15% of the total protein of the enzyme composition.

(161) In another embodiment, the amount of endoglucanase I in an enzyme composition of the present invention is 0.5% to 30% of the total protein of the enzyme composition, e.g., 1.0% to 25%, 2% to 20%, 4% to 25%, 5% to 20%, 16% to 15%, and 7% to 12% of the total protein of the enzyme composition.

(162) In another embodiment, the amount of endoglucanase II in an enzyme composition of the present invention is 0.5% to 30% of the total protein of the enzyme composition, e.g., 1.0% to 25%, 2% to 20%, 4% to 25%, 5% to 20%, 16% to 15%, and 7% to 12% of the total protein of the enzyme composition.

(163) In another embodiment, the amount of catalase in an enzyme composition of the present invention is 0% to 25% of the total protein of the enzyme composition, e.g., 0.25% to 20%, 0.5% to 15%, 0.75% to 10%, 1% to 9.5%, 1.25% to 9%, 1.5% to 8%, 1.75% to 8%, 1.75% to 7%, and 1.75% to 6% of the total protein of the enzyme composition.

(164) The amount of protein can be determined as described in Example 17.

(165) The enzyme composition may further or even further comprise one or more (e.g., several) enzymes selected from the group consisting of a cellulase, an AA9 polypeptide having cellulolytic enhancing activity, a cellulose inducible protein (GENESEQP:ADW12302), a hemicellulase, an esterase, an expansin, a laccase, a ligninolytic enzyme, a pectinase, a catalase, a peroxidase, a protease, and a swollenin (GENESEQP:BBA42745). In another aspect, the cellulase is preferably one or more (e.g., several) enzymes selected from the group consisting of an endoglucanase, a cellobiohydrolase, and a beta-glucosidase. In another aspect, the hemicellulase is preferably one or more (e.g., several) enzymes selected from the group consisting of an acetylmannan esterase, an acetylxylan esterase, an arabinanase, an arabinofuranosidase, a beta-glucanase, a coumaric acid esterase, a feruloyl esterase, a galactosidase, a glucuronidase, a glucuronoyl esterase, a mannanase, a mannosidase, a xylanase, and a xylosidase. The sources for the above enzymes may be fungal or bacterial, and may be present as single domain enzymes or polypeptides comprising multiple catalytic domains.

(166) One or more (e.g., several) of the enzymes in the enzyme composition may be wild-type proteins expressed by the host strain, recombinant proteins, or a combination of wild-type proteins expressed by the host strain and recombinant proteins. For example, one or more (e.g., several) enzymes may be native proteins of a cell, which is used as a host cell to express recombinantly the enzyme composition.

(167) In another aspect, the enzyme compositions can further comprise a whole broth preparation of a Trichoderma strain. In another aspect, the enzyme compositions can further comprise a whole broth preparation of a Trichoderma reesei strain.

(168) In another aspect, the enzyme compositions can further comprise a whole broth preparation of a Talaromyces emersonii strain.

(169) In another aspect, the enzyme compositions can further comprise a whole broth preparation of a Myceliophthora strain. In another aspect, the enzyme compositions can further comprise a whole broth preparation of a Myceliophthora thermophila strain.

(170) In another aspect, the enzyme compositions can further comprise a combination of two or more of a Trichoderma whole broth preparation (e.g., a Trichoderma reesei whole broth preparation); a Myceliophthora whole broth preparation (e.g., a Myceliophthora thermophila whole broth preparation); and a Talaromyces emersonii whole broth preparation.

(171) The enzyme compositions may be prepared in accordance with methods known in the art and may be in the form of a liquid or a dry composition. The compositions may be stabilized in accordance with methods known in the art.

(172) The enzyme compositions may result from a single fermentation or may be a blend of two or more fermentations, e.g., three, four, five, six, seven, etc. fermentations. For example, one fermentation may produce cellulases (e.g., endoglucanases, cellobiohydrolases, beta-glucosidase) and a second fermentation may produce hemicellulases (e.g., xylanase and beta-xylosidase), which are then blended in a specific ratio, e.g., 10/90 v/v, 25/75 v/v, 50:50 v/v, 75:25 v/v, or 90/10 v/v, respectively, to produce an enzyme composition. In another example, one fermentation may produce cellulases (e.g., endoglucanases, cellobiohydrolases, beta-glucosidase), a second fermentation may produce hemicellulases (e.g., xylanase and beta-xylosidase), and a third fermentation may produce an AA9 (GH61) polypeptide, which are then blended in a specific ratio, e.g., 10:80:20 v/v/v, 20:60:20 v/v/v, 40:40:20 v/v/v, 40:20:40 v/v/v, or 50:10:40 v/v/v, respectively, to produce an enzyme composition.

(173) The enzyme compositions may be in any form suitable for use, such as, for example, a crude fermentation broth with or without cells removed, a cell lysate with or without cellular debris, a semi-purified or purified enzyme preparation, or a host cell (e.g., T. reesei, T. emersonii, or M. thermophila) as a source of the enzymes. The enzyme composition may be a dry powder or granulate, a non-dusting granulate, a liquid, a stabilized liquid, or a stabilized protected enzyme. Liquid enzyme preparations may, for instance, be stabilized by adding stabilizers such as a sugar, a sugar alcohol or another polyol, and/or lactic acid or another organic acid according to established processes.

(174) The enzyme compositions may also be a fermentation broth formulation or a cell composition. The fermentation broth product further comprises additional ingredients used in the fermentation process, such as, for example, cells (including, the host cells containing the gene encoding the polypeptide of the present invention which are used to produce the polypeptide), cell debris, biomass, fermentation media and/or fermentation products. In some embodiments, the composition is a cell-killed whole broth containing organic acid(s), killed cells and/or cell debris, and culture medium.

(175) The term fermentation broth refers to a preparation produced by cellular fermentation that undergoes no or minimal recovery and/or purification. For example, fermentation broths are produced when microbial cultures are grown to saturation, incubated under carbon-limiting conditions to allow protein synthesis (e.g., expression of enzymes by host cells) and secretion into cell culture medium. The fermentation broth can contain unfractionated or fractionated contents of the fermentation materials derived at the end of the fermentation. Typically, the fermentation broth is unfractionated and comprises the spent culture medium and cell debris present after the microbial cells (e.g., filamentous fungal cells) are removed, e.g., by centrifugation. In some embodiments, the fermentation broth contains spent cell culture medium, extracellular enzymes, and viable and/or nonviable microbial cells.

(176) In an embodiment, the fermentation broth formulation and cell compositions comprise a first organic acid component comprising at least one 1-5 carbon organic acid and/or a salt thereof and a second organic acid component comprising at least one 6 or more carbon organic acid and/or a salt thereof. In a specific embodiment, the first organic acid component is acetic acid, formic acid, propionic acid, a salt thereof, or a mixture of two or more of the foregoing and the second organic acid component is benzoic acid, cyclohexanecarboxylic acid, 4-methylvaleric acid, phenylacetic acid, a salt thereof, or a mixture of two or more of the foregoing.

(177) In one aspect, the composition contains an organic acid(s), and optionally further contains live cells, killed cells and/or cell debris. In one embodiment, the composition comprises live cells. In another embodiment, killed cells, and/or cell debris are removed from a cell-killed whole broth to provide a composition that is free of these components.

(178) The fermentation broth formulations or cell compositions may further comprise a preservative and/or anti-microbial (e.g., bacteriostatic) agent, including, but not limited to, sorbitol, sodium chloride, potassium sorbate, and others known in the art.

(179) The cell-killed whole broth or composition may contain the unfractionated contents of the fermentation materials derived at the end of the fermentation. Typically, the cell-killed whole broth or composition contains the spent culture medium and cell debris present after the microbial cells (e.g., filamentous fungal cells) are grown to saturation, incubated under carbon-limiting conditions to allow protein synthesis (e.g., expression of cellulase and/or glucosidase enzyme(s)). In some embodiments, the cell-killed whole broth or composition contains the spent cell culture medium, extracellular enzymes, and killed filamentous fungal cells. In some embodiments, the microbial cells present in the cell-killed whole broth or composition can be permeabilized and/or lysed using methods known in the art.

(180) A whole broth or cell composition as described herein is typically a liquid slurry, but may contain insoluble components, such as killed cells, cell debris, culture media components, and/or insoluble enzyme(s). In some embodiments, insoluble components may be removed to provide a clarified liquid composition.

(181) The whole broth formulations and cell compositions of the present invention may be produced by the method described in WO 90/15861 or WO 2010/096673.

(182) The effective amount of an enzyme composition of the present invention in deconstructing a cellulosic or hemicellulosic material depends on several factors including, but not limited to, the cellulosic or hemicellulosic material, the concentration of cellulosic or hemicellulosic material, the pretreatment(s) of the cellulosic or hemicellulosic material, temperature, time, pH, and inclusion of fermenting organism (e.g., yeast for Simultaneous Saccharification and Fermentation).

(183) In one aspect, an effective amount of an enzyme composition of the present invention to the cellulosic or hemicellulosic material is about 0.01 to about 50.0 mg, e.g., about 0.01 to about 40 mg, about 0.01 to about 30 mg, about 0.01 to about 20 mg, about 0.01 to about 10 mg, about 0.01 to about 5 mg, about 0.025 to about 1.5 mg, about 0.05 to about 1.25 mg, about 0.075 to about 1.25 mg, about 0.1 to about 1.25 mg, about 0.15 to about 1.25 mg, or about 0.25 to about 1.0 mg protein per g of the cellulosic or hemicellulosic material.

(184) The enzyme compositions of the present invention are more efficient at high temperatures in the deconstruction of cellulosic or hemicellulosic material. The enzyme compositions of the present invention enable efficient conversion of cellulosic or hemicellulosic material at significantly lower dosages relative to a commercial benchmark cocktail. For example, 75% conversion of glucan was achieved at 5 mg enzyme protein per g cellulose while equivalent conversion with the benchmark cocktail required approximately 14 mg enzyme protein per g cellulose (see FIG. 12).

(185) Nucleic Acid Constructs

(186) Nucleic acid constructs comprising a polynucleotide encoding an enzyme or protein can be constructed by operably linking one or more (e.g., several) control sequences to the polynucleotide to direct the expression of the coding sequence in a fungal host cell under conditions compatible with the control sequences. Manipulation of the polynucleotide prior to its insertion into a vector may be desirable or necessary depending on the expression vector. The techniques for modifying polynucleotides utilizing recombinant DNA methods are well known in the art. The nucleic acid constructs may comprise one or more polynucleotides encoding an enzyme component or enzyme components of the compositions.

(187) The control sequence may be a promoter, a polynucleotide that is recognized by a fungal host cell for expression of a polynucleotide encoding an enzyme or protein. The promoter contains transcriptional control sequences that mediate the expression of the polypeptide. The promoter may be any polynucleotide that shows transcriptional activity in the host cell including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.

(188) Examples of suitable promoters for directing transcription of the nucleic acid constructs in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus nidulans acetamidase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA), Aspergillus oryzae TAKA amylase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Fusarium oxysporum trypsin-like protease (WO 96/00787), Fusarium venenatum amyloglucosidase (WO 00/56900), Fusarium venenatum Daria (WO 00/56900), Fusarium venenatum Quinn (WO 00/56900), Rhizomucor miehei lipase, Rhizomucor miehei aspartic proteinase, Trichoderma reesei beta-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei xylanase III, Trichoderma reesei beta-xylosidase, and Trichoderma reesei translation elongation factor, as well as the NA2-tpi promoter (a modified promoter from an Aspergillus neutral alpha-amylase gene in which the untranslated leader has been replaced by an untranslated leader from an Aspergillus triose phosphate isomerase gene; non-limiting examples include modified promoters from an Aspergillus niger neutral alpha-amylase gene in which the untranslated leader has been replaced by an untranslated leader from an Aspergillus nidulans or Aspergillus oryzae triose phosphate isomerase gene); and mutant, truncated, and hybrid promoters thereof. Other promoters are described in U.S. Pat. No. 6,011,147, which is incorporated herein in its entirety.

(189) In a yeast host, useful promoters are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH1, ADH2/GAP), Saccharomyces cerevisiae triose phosphate isomerase (TPI), Saccharomyces cerevisiae metallothionein (CUP1), and Saccharomyces cerevisiae 3-phosphoglycerate kinase. Other useful promoters for yeast host cells are described by Romanos et al., 1992, Yeast 8: 423-488.

(190) The control sequence may also be a transcription terminator, which is recognized by a fungal host cell to terminate transcription. The terminator is operably linked to the 3-terminus of the polynucleotide encoding the polypeptide. Any terminator that is functional in the host cell may be used in the present invention.

(191) Preferred terminators for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase, Aspergillus oryzae TAKA amylase, Fusarium oxysporum trypsin-like protease, Trichoderma reesei beta-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei xylanase III, Trichoderma reesei beta-xylosidase, and Trichoderma reesei translation elongation factor.

(192) Preferred terminators for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C (CYC1), and Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase. Other useful terminators for yeast host cells are described by Romanos et al., 1992, supra.

(193) The control sequence may also be a leader, a nontranslated region of an mRNA that is important for translation by a fungal host cell. The leader is operably linked to the 5-terminus of the polynucleotide encoding the polypeptide. Any leader that is functional in the host cell may be used.

(194) Preferred leaders for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.

(195) Suitable leaders for yeast host cells are obtained from the genes for Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae alpha-factor, and Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase (ADH2/GAP).

(196) The control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3-terminus of the polynucleotide and, when transcribed, is recognized by a fungal host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence that is functional in the host cell may be used.

(197) Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans anthranilate synthase, Aspergillus nigerglucoamylase, Aspergillus niger alpha-glucosidase Aspergillus oryzae TAKA amylase, Fusarium oxysporum trypsin-like protease, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, and Trichoderma reesei endoglucanase V.

(198) Useful polyadenylation sequences for yeast host cells are described by Guo and Sherman, 1995, Mol. Cellular Biol. 15: 5983-5990.

(199) The control sequence may also be a signal peptide coding region that encodes a signal peptide linked to the N-terminus of a polypeptide and directs the polypeptide into the cell's secretory pathway. The 5-end of the coding sequence of the polynucleotide may inherently contain a signal peptide coding sequence naturally linked in translation reading frame with the segment of the coding sequence that encodes the polypeptide. Alternatively, the 5-end of the coding sequence may contain a signal peptide coding sequence that is foreign to the coding sequence. A foreign signal peptide coding sequence may be required where the coding sequence does not naturally contain a signal peptide coding sequence. Alternatively, a foreign signal peptide coding sequence may simply replace the natural signal peptide coding sequence in order to enhance secretion of the polypeptide. However, any signal peptide coding sequence that directs the expressed polypeptide into the secretory pathway of a host cell may be used.

(200) Effective signal peptide coding sequences for filamentous fungal host cells are the signal peptide coding sequences obtained from the genes for Aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Aspergillus oryzae TAKA amylase, Humicola insolens cellulase, Humicola insolens endoglucanase V, Humicola lanuginosa lipase, Rhizomucor miehei aspartic proteinase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, and Trichoderma reesei endoglucanase V.

(201) Useful signal peptides for yeast host cells are obtained from the genes for Saccharomyces cerevisiae alpha-factor and Saccharomyces cerevisiae invertase. Other useful signal peptide coding sequences are described by Romanos et al., 1992, supra.

(202) The control sequence may also be a propeptide coding sequence that encodes a propeptide positioned at the N-terminus of a polypeptide. The resultant polypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases). A propolypeptide is generally inactive and can be converted to an active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide. The propeptide coding sequence may be obtained from the genes for Bacillus subtilis alkaline protease (aprE), Bacillus subtilis neutral protease (nprT), Myceliophthora thermophila laccase (WO 95/33836), Rhizomucor miehei aspartic proteinase, and Saccharomyces cerevisiae alpha-factor.

(203) Where both signal peptide and propeptide sequences are present, the propeptide sequence is positioned next to the N-terminus of a polypeptide and the signal peptide sequence is positioned next to the N-terminus of the propeptide sequence.

(204) It may also be desirable to add regulatory sequences that regulate expression of the polypeptide relative to the growth of a fungal host cell. Examples of regulatory sequences are those that cause expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. In yeast, the ADH2 system or GAL1 system may be used. In filamentous fungi, the Aspergillus nigerglucoamylase promoter, Aspergillus oryzae TAKA alpha-amylase promoter, Aspergillus oryzae glucoamylase promoter, Trichoderma reesei cellobiohydrolase I promoter, and Trichoderma reesei cellobiohydrolase II promoter may be used. Other examples of regulatory sequences are those that allow for gene amplification. In eukaryotic systems, these regulatory sequences include the dihydrofolate reductase gene that is amplified in the presence of methotrexate, and the metallothionein genes that are amplified with heavy metals. In these cases, the polynucleotide encoding the polypeptide would be operably linked to the regulatory sequence.

(205) Expression Vectors

(206) Recombinant expression vectors can be constructed comprising a polynucleotide encoding an enzyme, a promoter, a terminator, and transcriptional and translational stop signals. The various nucleotide and control sequences may be joined together to produce a recombinant expression vector that may include one or more convenient restriction sites to allow for insertion or substitution of the polynucleotide encoding the polypeptide at such sites. Alternatively, the polynucleotide may be expressed by inserting the polynucleotide or a nucleic acid construct comprising the polynucleotide into an appropriate vector for expression. In creating the expression vector, the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression. The recombinant expression vectors may comprise one or more polynucleotides encoding an enzyme component or enzyme components of the compositions.

(207) The recombinant expression vector may be any vector (e.g., a plasmid or virus) that can be conveniently subjected to recombinant DNA procedures and can bring about expression of the polynucleotide. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector may be a linear or closed circular plasmid.

(208) The vector may be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any means for assuring self-replication. Alternatively, the vector may be one that, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated. Furthermore, a single vector or plasmid or two or more vectors or plasmids that together contain the total DNA to be introduced into the genome of the host cell, or a transposon, may be used.

(209) The vector preferably contains one or more selectable markers that permit easy selection of transformed, transfected, transduced, or the like cells. A selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like.

(210) Examples of selectable markers for use in a filamentous fungal host cell include, but are not limited to, adeA (phosphoribosylaminoim idazole-succinocarboxam ide synthase), adeB (phosphoribosylaminoimidazole synthase), amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hpt (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5-phosphate decarboxylase), sC (sulfate adenyltransferase), and trpC (anthranilate synthase), as well as equivalents thereof. Preferred for use in an Aspergillus cell are Aspergillus nidulans or Aspergillus oryzae amdS and pyrG genes and a Streptomyces hygroscopicus bar gene. Preferred for use in a Trichoderma cell are the adeA, adeB, amdS, hpt, and pyrG genes. Suitable markers for yeast host cells include, but are not limited to, ADE2, HIS3, LEU2, LYS2, MET3, TRP1, and URA3.

(211) The selectable marker may be a dual selectable marker system as described in WO 2010/039889, which is incorporated herein by reference in its entirety. In one aspect, the dual selectable marker is an hpt-tk dual selectable marker system.

(212) The vector preferably contains an element(s) that permits integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome.

(213) For integration into the host cell genome, the vector may rely on the polynucleotide's sequence encoding the polypeptide or any other element of the vector for integration into the genome by homologous or non-homologous recombination. Alternatively, the vector may contain additional polynucleotides for directing integration by homologous recombination into the genome of the host cell at a precise location(s) in the chromosome(s). To increase the likelihood of integration at a precise location, the integrational elements should contain a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, 400 to 10,000 base pairs, and 800 to 10,000 base pairs, which have a high degree of sequence identity to the corresponding target sequence to enhance the probability of homologous recombination. The integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell. Furthermore, the integrational elements may be non-encoding or encoding polynucleotides. On the other hand, the vector may be integrated into the genome of the host cell by non-homologous recombination.

(214) For autonomous replication, the vector may further comprise an origin of replication enabling the vector to replicate autonomously in a fungal host cell. The origin of replication may be any plasmid replicator mediating autonomous replication that functions in a cell. The term origin of replication or plasmid replicator means a polynucleotide that enables a plasmid or vector to replicate in vivo.

(215) Examples of origins of replication useful in a filamentous fungal host cell are AMA1 and ANSI (Gems et al., 1991, Gene 98: 61-67; Cullen et al., 1987, Nucleic Acids Res. 15: 9163-9175; WO 00/24883). Isolation of the AMA1 gene and construction of plasmids or vectors comprising the gene can be accomplished according to the methods disclosed in WO 00/24883.

(216) Examples of origins of replication for use in a yeast host cell are the 2 micron origin of replication, ARS1, ARS4, the combination of ARS1 and CEN3, and the combination of ARS4 and CEN6.

(217) More than one copy of a polynucleotide may be inserted into a fungal host cell to increase production of a polypeptide. An increase in the copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the polynucleotide where cells containing amplified copies of the selectable marker gene, and thereby additional copies of the polynucleotide, can be selected for by cultivating the cells in the presence of the appropriate selectable agent.

(218) The procedures used to ligate the elements described above to construct the recombinant expression vectors are well known to one skilled in the art (see, e.g., Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, New York).

(219) Host Cells

(220) The present invention also relates to recombinant fungal host cells, comprising polynucleotides encoding an enzyme composition comprising: (A) (i) a cellobiohydrolase I, (ii) a cellobiohydrolase II, and (iii) at least one enzyme selected from the group consisting of a beta-glucosidase or a variant thereof, an AA9 polypeptide having cellulolytic enhancing activity, a GH10 xylanase, and a beta-xylosidase; (B) (i) a GH10 xylanase and (ii) a beta-xylosidase; or (C) (i) a cellobiohydrolase I, (ii) a cellobiohydrolase II, (iii) a GH10 xylanase, and (iv) a beta-xylosidase, as described herein. The recombinant fungal host cells may further or even further comprise one or more polynucleotides encoding an endoglucanase I, an endoglucanase II, or an endoglucanase I and an endoglucanase II, as described herein. The recombinant fungal host cells may further or even further comprise a polynucleotide encoding a catalase, as described herein.

(221) The recombinant fungal host cells can further comprise one or more polynucleotides encoding enzymes selected from the group consisting of a cellulase, an AA9 polypeptide having cellulolytic enhancing activity, a cellulose inducible protein, a hemicellulase, an esterase, an expansin, a laccase, a ligninolytic enzyme, a pectinase, a catalase, a peroxidase, a protease, and a swollenin, as described herein. One or more (e.g., several) of the enzymes may be wild-type proteins, recombinant proteins, or a combination of wild-type proteins and recombinant proteins.

(222) The host cell may be any fungal cell useful in the recombinant production of an enzyme or protein. The term host cell encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication.

(223) Fungi as used herein includes the phyla Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota as well as the Oomycota and all mitosporic fungi (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK).

(224) The fungal host cell may be a yeast cell. Yeast as used herein includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeast belonging to the Fungi Imperfecti (Blastomycetes). Since the classification of yeast may change in the future, for the purposes of this invention, yeast shall be defined as described in Biology and Activities of Yeast (Skinner, Passmore, and Davenport, editors, Soc. App. Bacteriol. Symposium Series No. 9, 1980).

(225) The yeast host cell may be a Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia cell, such as a Kluyveromyces lactis, Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis, Saccharomyces oviformis, or Yarrowia lipolytica cell.

(226) The fungal host cell may be a filamentous fungal cell. Filamentous fungi include all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., 1995, supra). The filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic. In contrast, vegetative growth by yeasts such as Saccharomyces cerevisiae is by budding of a unicellular thallus and carbon catabolism may be fermentative.

(227) The filamentous fungal host cell may be an Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phiebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma cell.

(228) For example, the filamentous fungal host cell may be an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium zonatum, Coprinus cinereus, Coriolus hirsutus, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium suiphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Talaromyces emersonii, Thielavia terrestris, Trametes villosa, Trametes versicolor, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride cell.

(229) Fungal cells may be transformed with one or more constructs and/or vectors described herein by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se. Suitable procedures for transformation of Aspergillus and Trichoderma host cells are described in EP 238023, Yelton et al., 1984, Proc. Natl. Acad. Sci. USA 81: 1470-1474, and Christensen et al., 1988, Bio/Technology 6: 1419-1422. Suitable methods for transforming Fusarium species are described by Malardier et al., 1989, Gene 78: 147-156, and WO 96/00787. Suitable procedures for transformation of Myceliophthora thermophila are described in WO 2000/020555. Suitable procedures for transformation of Talaromyces emersonii are described in WO 2011/054899 and Jain et al., 1992, Mol. Gen. Genet. 234: 489. Yeast may be transformed using the procedures described by Becker and Guarente, In Abelson, J. N. and Simon, M. I., editors, Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume 194, pp 182-187, Academic Press, Inc., New York; Ito et al., 1983, J. Bacteriol. 153: 163; and Hinnen et al., 1978, Proc. Natl. Acad. Sci. USA 75: 1920.

(230) In one aspect, the filamentous fungal cell is any Trichoderma cell useful in the recombinant production of an enzyme or protein. For example, the Trichoderma cell may be a Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride cell. In another aspect, the Trichoderma cell is a Trichoderma harzianum cell. In another aspect, the Trichoderma cell is a Trichoderma koningii cell. In another aspect, the Trichoderma cell is a Trichoderma longibrachiatum cell. In another aspect, the Trichoderma cell is a Trichoderma reesei cell. In another aspect, the Trichoderma cell is a Trichoderma viride cell.

(231) In another aspect, the Trichoderma reesei cell is Trichoderma reesei RutC30. In another aspect, the Trichoderma reesei cell is Trichoderma reesei TV10. In another aspect, the Trichoderma reesei cell is a mutant of Trichoderma reesei RutC30. In another aspect, the Trichoderma reesei cell is mutant of Trichoderma reesei TV10. In another aspect, the Trichoderma reesei cell is a morphological mutant of Trichoderma reesei. See, for example, WO 97/26330, which is incorporated herein by reference in its entirety.

(232) In another aspect, the filamentous fungal cell is any Aspergillus oryzae cell useful in the recombinant production of an enzyme or protein.

(233) In another aspect, the filamentous fungal cell is any Aspergillus niger cell useful in the recombinant production of an enzyme or protein.

(234) In another aspect, the filamentous fungal cell is any Myceliophthora thermophila cell useful in the recombinant production of an enzyme or protein.

(235) In another aspect, the filamentous fungal cell is any Talaromyces emersonii cell useful in the recombinant production of an enzyme or protein.

(236) One or more (e.g., several) native cellulase and/or hemicellulase genes may be inactivated in the filamentous fungal host cell (e.g., Trichoderma) by disrupting or deleting the genes, or a portion thereof, which results in the mutant cell producing less or none of the cellulase and/or hemicellulase than the parent cell when cultivated under the same conditions. In one aspect, the one or more (e.g., several) cellulase genes encode enzymes selected from the group consisting of cellobiohydrolase I, cellobiohydrolase II, endoglucanase I, endoglucanase II, beta-glucosidase, and swollenin. In another aspect, the one or more (e.g., several) hemicellulase genes encode enzymes selected from the group consisting of xylanase I, xylanase II, xylanase III, and beta-xylosidase. In another aspect, the one or more (e.g., several) hemicellulase genes encode enzymes selected from the group consisting of an acetylmannan esterase, an acetylxylan esterase, an arabinanase, an arabinofuranosidase, a coumaric acid esterase, a feruloyl esterase, a galactosidase, a glucuronidase, a glucuronoyl esterase, a mannanase, and a mannosidase.

(237) The mutant cell may be constructed by reducing or eliminating expression of a polynucleotide encoding a cellulase or hemicellulase using methods well known in the art, for example, insertions, disruptions, replacements, or deletions. In a preferred aspect, the polynucleotide is inactivated. The polynucleotide to be modified or inactivated may be, for example, the coding region or a part thereof essential for activity, or a regulatory element required for expression of the coding region. An example of such a regulatory or control sequence may be a promoter sequence or a functional part thereof, i.e., a part that is sufficient for affecting expression of the polynucleotide. Other control sequences for possible modification include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, signal peptide sequence, transcription terminator, and transcriptional activator.

(238) Modification or inactivation of the polynucleotide may be performed by subjecting the parent cell to mutagenesis and selecting for mutant cells in which expression of the polynucleotide has been reduced or eliminated. The mutagenesis, which may be specific or random, may be performed, for example, by use of a suitable physical or chemical mutagenizing agent, by use of a suitable oligonucleotide, or by subjecting the DNA sequence to PCR generated mutagenesis. Furthermore, the mutagenesis may be performed by use of any combination of these mutagenizing agents.

(239) Examples of a physical or chemical mutagenizing agent suitable for the present purpose include ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N-nitro-N-nitrosoguanidine (MNNG), O-methyl hydroxylamine, nitrous acid, ethyl methane sulphonate (EMS), sodium bisulphite, formic acid, and nucleotide analogues.

(240) When such agents are used, the mutagenesis is typically performed by incubating the parent cell to be mutagenized in the presence of the mutagenizing agent of choice under suitable conditions, and screening and/or selecting for mutant cells exhibiting reduced or no expression of the gene.

(241) Modification or inactivation of the polynucleotide may also be accomplished by insertion, substitution, or deletion of one or more (e.g., several) nucleotides in the gene or a regulatory element required for transcription or translation thereof. For example, nucleotides may be inserted or removed so as to result in the introduction of a stop codon, the removal of the start codon, or a change in the open reading frame. Such modification or inactivation may be accomplished by site-directed mutagenesis or PCR generated mutagenesis in accordance with methods known in the art. Although, in principle, the modification may be performed in vivo, i.e., directly on the cell expressing the polynucleotide to be modified, it is preferred that the modification be performed in vitro as exemplified below.

(242) An example of a convenient way to eliminate or reduce expression of a polynucleotide is based on techniques of gene replacement, gene deletion, or gene disruption. For example, in the gene disruption method, a nucleic acid sequence corresponding to the endogenous polynucleotide is mutagenized in vitro to produce a defective nucleic acid sequence that is then transformed into the parent cell to produce a defective gene. By homologous recombination, the defective nucleic acid sequence replaces the endogenous polynucleotide. It may be desirable that the defective polynucleotide also encodes a marker that may be used for selection of transformants in which the polynucleotide has been modified or destroyed. In an aspect, the polynucleotide is disrupted with a selectable marker such as those described herein.

(243) Modification or inactivation of the polynucleotide may also be accomplished by inhibiting expression of an enzyme encoded by the polynucleotide in a cell by administering to the cell or expressing in the cell a double-stranded RNA (dsRNA) molecule, wherein the dsRNA comprises a subsequence of a polynucleotide encoding the enzyme. In a preferred aspect, the dsRNA is about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more duplex nucleotides in length.

(244) The dsRNA is preferably a small interfering RNA (siRNA) or a micro RNA (miRNA). In a preferred aspect, the dsRNA is small interfering RNA for inhibiting transcription. In another preferred aspect, the dsRNA is micro RNA for inhibiting translation. In another aspect, the double-stranded RNA (dsRNA) molecules comprise a portion of the mature polypeptide coding sequence of SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, and/or SEQ ID NO: 31 for inhibiting expression of the polypeptide in a cell. While the present invention is not limited by any particular mechanism of action, the dsRNA can enter a cell and cause the degradation of a single-stranded RNA (ssRNA) of similar or identical sequences, including endogenous mRNAs. When a cell is exposed to dsRNA, mRNA from the homologous gene is selectively degraded by a process called RNA interference (RNAi).

(245) The dsRNAs can be used in gene-silencing to selectively degrade RNA using a dsRNAi of the present invention. The process may be practiced in vitro, ex vivo or in vivo. In one aspect, the dsRNA molecules can be used to generate a loss-of-function mutation in a cell, an organ or an animal. Methods for making and using dsRNA molecules to selectively degrade RNA are well known in the art; see, for example, U.S. Pat. Nos. 6,489,127; 6,506,559; 6,511,824; and 6,515,109.

(246) In one aspect, a gene encoding a cellobiohydrolase I is inactivated. In another aspect, a gene encoding a Trichoderma cellobiohydrolase I is inactivated. In another aspect, a gene encoding a Trichoderma reesei cellobiohydrolase I is inactivated. In another aspect, the cellobiohydrolase I is selected from the group consisting of: (i) a cellobiohydrolase I comprising or consisting of the mature polypeptide of SEQ ID NO: 20; (ii) a cellobiohydrolase I comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 20; (iii) a cellobiohydrolase I encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 19; and (iv) a cellobiohydrolase I encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 19 or the full-length complement thereof.

(247) In another aspect, a gene encoding a cellobiohydrolase II is inactivated. In another aspect, a gene encoding a Trichoderma cellobiohydrolase II is inactivated. In another aspect, a gene encoding a Trichoderma reesei cellobiohydrolase II is inactivated. In another aspect, the cellobiohydrolase II is selected from the group consisting of: (i) a cellobiohydrolase II comprising or consisting of the mature polypeptide of SEQ ID NO: 22; (ii) a cellobiohydrolase II comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 22; (iii) a cellobiohydrolase II encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 21; and (iv) a cellobiohydrolase II encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 21 or the full-length complement thereof.

(248) In another aspect, a gene encoding a beta-glucosidase is inactivated. In another aspect, a gene encoding a Trichoderma beta-glucosidase is inactivated. In another aspect, a gene encoding a Trichoderma reesei beta-glucosidase is inactivated. In another aspect, the beta-glucosidase is selected from the group consisting of: (i) a beta-glucosidase comprising or consisting of the mature polypeptide of SEQ ID NO: 24; (ii) a beta-glucosidase comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 24; (iii) a beta-glucosidase encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 23; and (iv) a beta-glucosidase encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 23 or the full-length complement thereof.

(249) In another aspect, a gene encoding a xylanase is inactivated. In another aspect, a gene encoding a Trichoderma xylanase is inactivated. In another aspect, a gene encoding a Trichoderma reesei xylanase is inactivated. In another aspect, the xylanase is selected from the group consisting of: (i) a xylanase comprising or consisting of the mature polypeptide of SEQ ID NO: 26, SEQ ID NO: 28, or SEQ ID NO: 30; (ii) a xylanase comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 26, SEQ ID NO: 28, or SEQ ID NO: 30; (iii) a xylanase encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 25, SEQ ID NO: 27, or SEQ ID NO: 29; and (iv) a xylanase encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 25, SEQ ID NO: 27, or SEQ ID NO: 29; or the full-length complement thereof.

(250) In another aspect, a gene encoding a beta-xylosidase is inactivated. In another aspect, a gene encoding a Trichoderma beta-xylosidase is inactivated. In another aspect, a gene encoding a Trichoderma reesei beta-xylosidase is inactivated. In another aspect, the beta-xylosidase is selected from the group consisting of: (i) a beta-xylosidase comprising or consisting of the mature polypeptide of SEQ ID NO: 32; (ii) a beta-xylosidase comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 32; (iii) a beta-xylosidase encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 31; and (iv) a beta-xylosidase encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 31 or the full-length complement thereof.

(251) In another aspect, a cellobiohydrolase I gene is inactivated. In another aspect, a Trichoderma cellobiohydrolase I gene is inactivated. In another aspect, a Trichoderma reesei cellobiohydrolase I gene is inactivated. In another aspect, a Trichoderma cellobiohydrolase II gene is inactivated. In another aspect, a Trichoderma reesei cellobiohydrolase II gene is inactivated. In another aspect, a Trichoderma beta-glucosidase gene is inactivated. In another aspect, a Trichoderma reesei beta-glucosidase gene is inactivated. In another aspect, a Trichoderma xylanase gene is inactivated. In another aspect, a Trichoderma reesei xylanase gene is inactivated. In another aspect, a Trichoderma beta-xylosidase gene is inactivated. In another aspect, a Trichoderma reesei beta-xylosidase gene is inactivated.

(252) In another aspect, a Trichoderma cellobiohydrolase I gene and a Trichoderma cellobiohydrolase II gene are inactivated. In another aspect, a Trichoderma reesei cellobiohydrolase I gene and a Trichoderma reesei cellobiohydrolase II gene are inactivated.

(253) In another aspect, two or more (e.g., several) genes selected from the group consisting of cellobiohydrolase I, cellobiohydrolase II, beta-glucosidase, xylanase I, xylanase II, xylanase III, and beta-xylosidase are inactivated. In another aspect, three or more (e.g., several) genes selected from the group consisting of cellobiohydrolase I, cellobiohydrolase II, beta-glucosidase, xylanase I, xylanase II, xylanase III, and beta-xylosidase genes are inactivated. In another aspect, four or more (e.g., several) genes selected from the group consisting of cellobiohydrolase I, cellobiohydrolase II, beta-glucosidase, xylanase I, xylanase II, xylanase III, and beta-xylosidase genes are inactivated. In another aspect, five or more (e.g., several) genes selected from the group consisting of cellobiohydrolase I, cellobiohydrolase II, beta-glucosidase, xylanase I, xylanase II, xylanase III, and beta-xylosidase genes are inactivated. In another aspect, six or more (e.g., several) genes selected from the group consisting of cellobiohydrolase I, cellobiohydrolase II, beta-glucosidase, xylanase I, xylanase II, xylanase III, and beta-xylosidase genes are inactivated.

(254) In another aspect, the cellobiohydrolase I, cellobiohydrolase II, beta-glucosidase, xylanase I, xylanase II, xylanase III, and beta-xylosidase genes are inactivated.

(255) In another aspect, one or more (e.g., several) protease genes are inactivated. In another aspect, the one or more (e.g., several) protease genes are subtilisin-like serine protease, aspartic protease, and trypsin-like serine protease genes as described in WO 2011/075677, which is incorporated herein by reference in its entirety.

(256) Processes of Production

(257) The present invention also relates to processes of producing an enzyme composition of the present invention described herein, comprising: (a) cultivating one or more (e.g., several) fungal host cells of the present invention under conditions conducive for production of the enzyme composition; and optionally (b) recovering the enzyme composition.

(258) The fungal host cells are cultivated in a nutrient medium suitable for production of the enzyme composition using methods known in the art. For example, the cell may be cultivated by shake flask cultivation, or small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors in a suitable medium and under conditions allowing the enzymes to be expressed and/or isolated. The cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Culture Collection).

(259) The activity of the enzyme compositions may be determined using methods known in the art. These methods include, but are not limited to, use of specific antibodies, formation of an enzyme product, or disappearance of an enzyme substrate.

(260) The enzyme compositions may be recovered using methods known in the art. For example, the enzyme may be recovered from the nutrient medium by conventional procedures including, but not limited to, collection, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation. In one aspect, the whole fermentation broth is recovered.

(261) Uses

(262) The present invention is also directed to the following processes for using the enzyme compositions of the present invention.

(263) The present invention also relates to processes for degrading a cellulosic or hemicellulosic material, comprising: treating the cellulosic or hemicellulosic material with an enzyme composition of the present invention. In one aspect, the processes further comprise recovering the degraded cellulosic or hemicellulosic material. Soluble products from the degradation of the cellulosic or hemicellulosic material can be separated from insoluble cellulosic or hemicellulosic material using methods known in the art such as, for example, centrifugation, filtration, or gravity settling.

(264) The present invention also relates to processes of producing a fermentation product, comprising: (a) saccharifying a cellulosic or hemicellulosic material with an enzyme composition of the present invention; (b) fermenting the saccharified cellulosic or hemicellulosic material with one or more (e.g., several) fermenting microorganisms to produce the fermentation product; and (c) recovering the fermentation product from the fermentation.

(265) The present invention also relates to processes of fermenting a cellulosic or hemicellulosic material, comprising: fermenting the cellulosic or hemicellulosic material with one or more (e.g., several) fermenting microorganisms, wherein the cellulosic or hemicellulosic material is saccharified with an enzyme composition of the present invention. In one aspect, the fermenting of the cellulosic or hemicellulosic material produces a fermentation product. In another aspect, the processes further comprise recovering the fermentation product from the fermentation.

(266) The processes of the present invention can be used to saccharify the cellulosic or hemicellulosic material to fermentable sugars and to convert the fermentable sugars to many useful fermentation products, e.g., fuel (ethanol, n-butanol, isobutanol, biodiesel, jet fuel) and/or platform chemicals (e.g., acids, alcohols, ketones, gases, oils, and the like). The production of a desired fermentation product from the cellulosic or hemicellulosic material typically involves pretreatment, enzymatic hydrolysis (saccharification), and fermentation.

(267) The processing of the cellulosic or hemicellulosic material according to the present invention can be accomplished using methods conventional in the art. Moreover, the processes of the present invention can be implemented using any conventional biomass processing apparatus configured to operate in accordance with the invention.

(268) Hydrolysis (saccharification) and fermentation, separate or simultaneous, include, but are not limited to, separate hydrolysis and fermentation (SHF); simultaneous saccharification and fermentation (SSF); simultaneous saccharification and co-fermentation (SSCF); hybrid hydrolysis and fermentation (HHF); separate hydrolysis and co-fermentation (SHCF); hybrid hydrolysis and co-fermentation (HHCF); and direct microbial conversion (DMC), also sometimes called consolidated bioprocessing (CBP). SHF uses separate process steps to first enzymatically hydrolyze the cellulosic or hemicellulosic material to fermentable sugars, e.g., glucose, cellobiose, and pentose monomers, and then ferment the fermentable sugars to ethanol. In SSF, the enzymatic hydrolysis of the cellulosic or hemicellulosic material and the fermentation of sugars to ethanol are combined in one step (Philippidis, G. P., 1996, Cellulose bioconversion technology, in Handbook on Bioethanol: Production and Utilization, Wyman, C. E., ed., Taylor & Francis, Washington, D.C., 179-212). SSCF involves the co-fermentation of multiple sugars (Sheehan and Himmel, 1999, Biotechnol. Prog. 15: 817-827). HHF involves a separate hydrolysis step, and in addition a simultaneous saccharification and hydrolysis step, which can be carried out in the same reactor. The steps in an HHF process can be carried out at different temperatures, i.e., high temperature enzymatic saccharification followed by SSF at a lower temperature that the fermentation strain can tolerate. DMC combines all three processes (enzyme production, hydrolysis, and fermentation) in one or more (e.g., several) steps where the same organism is used to produce the enzymes for conversion of the cellulosic or hemicellulosic material to fermentable sugars and to convert the fermentable sugars into a final product (Lynd et al., 2002, Microbiol. Mol. Biol. Reviews 66: 506-577). It is understood herein that any method known in the art comprising pretreatment, enzymatic hydrolysis (saccharification), fermentation, or a combination thereof, can be used in the practicing the processes of the present invention.

(269) A conventional apparatus can include a fed-batch stirred reactor, a batch stirred reactor, a continuous flow stirred reactor with ultrafiltration, and/or a continuous plug-flow column reactor (de Castilhos Corazza et al., 2003, Acta Scientiarum. Technology 25: 33-38; Gusakov and Sinitsyn, 1985, Enz. Microb. Technol. 7: 346-352), an attrition reactor (Ryu and Lee, 1983, Biotechnol. Bioeng. 25: 53-65). Additional reactor types include fluidized bed, upflow blanket, immobilized, and extruder type reactors for hydrolysis and/or fermentation.

(270) Pretreatment.

(271) In practicing the processes of the present invention, any pretreatment process known in the art can be used to disrupt plant cell wall components of the cellulosic or hemicellulosic material (Chandra et al., 2007, Adv. Biochem. Engin./Biotechnol. 108: 67-93; Galbe and Zacchi, 2007, Adv. Biochem. Engin./Biotechnol. 108: 41-65; Hendriks and Zeeman, 2009, Bioresource Technology 100: 10-18; Mosier et al., 2005, Bioresource Technology 96: 673-686; Taherzadeh and Karimi, 2008, Int. J. Mol. Sci. 9: 1621-1651; Yang and Wyman, 2008, Biofuels Bioproducts and Biorefining-Biofpr. 2: 26-40).

(272) The cellulosic or hemicellulosic material can also be subjected to particle size reduction, sieving, pre-soaking, wetting, washing, and/or conditioning prior to pretreatment using methods known in the art.

(273) Conventional pretreatments include, but are not limited to, steam pretreatment (with or without explosion), dilute acid pretreatment, hot water pretreatment, alkaline pretreatment, lime pretreatment, wet oxidation, wet explosion, ammonia fiber explosion, organosolv pretreatment, and biological pretreatment. Additional pretreatments include ammonia percolation, ultrasound, electroporation, microwave, supercritical CO.sub.2, supercritical H.sub.2O, ozone, ionic liquid, and gamma irradiation pretreatments.

(274) The cellulosic or hemicellulosic material can be pretreated before hydrolysis and/or fermentation. Pretreatment is preferably performed prior to the hydrolysis. Alternatively, the pretreatment can be carried out simultaneously with enzyme hydrolysis to release fermentable sugars, such as glucose, xylose, and/or cellobiose. In most cases the pretreatment step itself results in some conversion of biomass to fermentable sugars (even in absence of enzymes).

(275) Steam Pretreatment. In steam pretreatment, the cellulosic or hemicellulosic material is heated to disrupt the plant cell wall components, including lignin, hemicellulose, and cellulose to make the cellulose and other fractions, e.g., hemicellulose, accessible to enzymes. The cellulosic or hemicellulosic material is passed to or through a reaction vessel where steam is injected to increase the temperature to the required temperature and pressure and is retained therein for the desired reaction time. Steam pretreatment is preferably performed at 140-250 C., e.g., 160-200 C. or 170-190 C., where the optimal temperature range depends on optional addition of a chemical catalyst. Residence time for the steam pretreatment is preferably 1-60 minutes, e.g., 1-30 minutes, 1-20 minutes, 3-12 minutes, or 4-10 minutes, where the optimal residence time depends on the temperature and optional addition of a chemical catalyst. Steam pretreatment allows for relatively high solids loadings, so that the cellulosic or hemicellulosic material is generally only moist during the pretreatment. The steam pretreatment is often combined with an explosive discharge of the material after the pretreatment, which is known as steam explosion, that is, rapid flashing to atmospheric pressure and turbulent flow of the material to increase the accessible surface area by fragmentation (Duff and Murray, 1996, Bioresource Technology 855: 1-33; Galbe and Zacchi, 2002, Appl. Microbiol. Biotechnol. 59: 618-628; U.S. Patent Application No. 2002/0164730). During steam pretreatment, hemicellulose acetyl groups are cleaved and the resulting acid autocatalyzes partial hydrolysis of the hemicellulose to monosaccharides and oligosaccharides. Lignin is removed to only a limited extent.

(276) Chemical Pretreatment: The term chemical treatment refers to any chemical pretreatment that promotes the separation and/or release of cellulose, hemicellulose, and/or lignin. Such a pretreatment can convert crystalline cellulose to amorphous cellulose. Examples of suitable chemical pretreatment processes include, for example, dilute acid pretreatment, lime pretreatment, wet oxidation, ammonia fiber/freeze expansion (AFEX), ammonia percolation (APR), ionic liquid, and organosolv pretreatments.

(277) A chemical catalyst such as H.sub.2SO.sub.4 or SO.sub.2 (typically 0.3 to 5% w/w) is sometimes added prior to steam pretreatment, which decreases the time and temperature, increases the recovery, and improves enzymatic hydrolysis (Ballesteros et al., 2006, Appl. Biochem. Biotechnol. 129-132: 496-508; Varga et al., 2004, Appl. Biochem. Biotechnol. 113-116: 509-523; Sassner et al., 2006, Enzyme Microb. Technol. 39: 756-762). In dilute acid pretreatment, the cellulosic or hemicellulosic material is mixed with dilute acid, typically H.sub.2SO.sub.4, and water to form a slurry, heated by steam to the desired temperature, and after a residence time flashed to atmospheric pressure. The dilute acid pretreatment can be performed with a number of reactor designs, e.g., plug-flow reactors, counter-current reactors, or continuous counter-current shrinking bed reactors (Duff and Murray, 1996, Bioresource Technology 855: 1-33; Schell et al., 2004, Bioresource Technology 91: 179-188; Lee et al., 1999, Adv. Biochem. Eng. Biotechnol. 65: 93-115).

(278) Several methods of pretreatment under alkaline conditions can also be used. These alkaline pretreatments include, but are not limited to, sodium hydroxide, lime, wet oxidation, ammonia percolation (APR), and ammonia fiber/freeze expansion (AFEX) pretreatment.

(279) Lime pretreatment is performed with calcium oxide or calcium hydroxide at temperatures of 85-150 C. and residence times from 1 hour to several days (Wyman et al., 2005, Bioresource Technology 96: 1959-1966; Mosier et al., 2005, Bioresource Technology 96: 673-686). WO 2006/110891, WO 2006/110899, WO 2006/110900, and WO 2006/110901 disclose pretreatment methods using ammonia.

(280) Wet oxidation is a thermal pretreatment performed typically at 180-200 C. for 5-15 minutes with addition of an oxidative agent such as hydrogen peroxide or over-pressure of oxygen (Schmidt and Thomsen, 1998, Bioresource Technology 64: 139-151; Palonen et al., 2004, Appl. Biochem. Biotechnol. 117: 1-17; Varga et al., 2004, Biotechnol. Bioeng. 88: 567-574; Martin et al., 2006, J. Chem. Technol. Biotechnol. 81: 1669-1677). The pretreatment is performed preferably at 1-40% dry matter, e.g., 2-30% dry matter or 5-20% dry matter, and often the initial pH is increased by the addition of alkali such as sodium carbonate.

(281) A modification of the wet oxidation pretreatment method, known as wet explosion (combination of wet oxidation and steam explosion) can handle dry matter up to 30%. In wet explosion, the oxidizing agent is introduced during pretreatment after a certain residence time. The pretreatment is then ended by flashing to atmospheric pressure (WO 2006/032282).

(282) Ammonia fiber expansion (AFEX) involves treating the cellulosic or hemicellulosic material with liquid or gaseous ammonia at moderate temperatures such as 90-150 C. and high pressure such as 17-20 bar for 5-10 minutes, where the dry matter content can be as high as 60% (Gollapalli et al., 2002, Appl. Biochem. Biotechnol. 98: 23-35; Chundawat et al., 2007, Biotechnol. Bioeng. 96: 219-231; Alizadeh et al., 2005, Appl. Biochem. Biotechnol. 121: 1133-1141; Teymouri et al., 2005, Bioresource Technology 96: 2014-2018). During AFEX pretreatment cellulose and hemicelluloses remain relatively intact. Lignin-carbohydrate complexes are cleaved.

(283) Organosolv pretreatment delignifies the cellulosic or hemicellulosic material by extraction using aqueous ethanol (40-60% ethanol) at 160-200 C. for 30-60 minutes (Pan et al., 2005, Biotechnol. Bioeng. 90: 473-481; Pan et al., 2006, Biotechnol. Bioeng. 94: 851-861; Kurabi et al., 2005, Appl. Biochem. Biotechnol. 121: 219-230). Sulphuric acid is usually added as a catalyst. In organosolv pretreatment, the majority of hemicellulose and lignin is removed.

(284) Other examples of suitable pretreatment methods are described by Schell et al., 2003, Appl. Biochem. Biotechnol. 105-108: 69-85, and Mosier et al., 2005, Bioresource Technology 96: 673-686, and U.S. Published Application 2002/0164730.

(285) In one aspect, the chemical pretreatment is preferably carried out as a dilute acid treatment, and more preferably as a continuous dilute acid treatment. The acid is typically sulfuric acid, but other acids can also be used, such as acetic acid, citric acid, nitric acid, phosphoric acid, tartaric acid, succinic acid, hydrogen chloride, or mixtures thereof. Mild acid treatment is conducted in the pH range of preferably 1-5, e.g., 1-4 or 1-2.5. In one aspect, the acid concentration is in the range from preferably 0.01 to 10 wt. % acid, e.g., 0.05 to 5 wt. % acid or 0.1 to 2 wt. % acid. The acid is contacted with the cellulosic or hemicellulosic material and held at a temperature in the range of preferably 140-200 C., e.g., 165-190 C., for periods ranging from 1 to 60 minutes.

(286) In another aspect, pretreatment takes place in an aqueous slurry. In preferred aspects, the cellulosic or hemicellulosic material is present during pretreatment in amounts preferably between 10-80 wt. %, e.g., 20-70 wt. % or 30-60 wt. %, such as around 40 wt. %. The pretreated cellulosic or hemicellulosic material can be unwashed or washed using any method known in the art, e.g., washed with water.

(287) Mechanical Pretreatment or Physical Pretreatment: The term mechanical pretreatment or physical pretreatment refers to any pretreatment that promotes size reduction of particles. For example, such pretreatment can involve various types of grinding or milling (e.g., dry milling, wet milling, or vibratory ball milling).

(288) The cellulosic or hemicellulosic material can be pretreated both physically (mechanically) and chemically. Mechanical or physical pretreatment can be coupled with steaming/steam explosion, hydrothermolysis, dilute or mild acid treatment, high temperature, high pressure treatment, irradiation (e.g., microwave irradiation), or combinations thereof. In one aspect, high pressure means pressure in the range of preferably about 100 to about 400 psi, e.g., about 150 to about 250 psi. In another aspect, high temperature means temperature in the range of about 100 to about 300 C., e.g., about 140 to about 200 C. In a preferred aspect, mechanical or physical pretreatment is performed in a batch-process using a steam gun hydrolyzer system that uses high pressure and high temperature as defined above, e.g., a Sunds Hydrolyzer available from Sunds Defibrator AB, Sweden. The physical and chemical pretreatments can be carried out sequentially or simultaneously, as desired.

(289) Accordingly, in a preferred aspect, the cellulosic or hemicellulosic material is subjected to physical (mechanical) or chemical pretreatment, or any combination thereof, to promote the separation and/or release of cellulose, hemicellulose, and/or lignin.

(290) Biological Pretreatment: The term biological pretreatment refers to any biological pretreatment that promotes the separation and/or release of cellulose, hemicellulose, and/or lignin from the cellulosic or hemicellulosic material. Biological pretreatment techniques can involve applying lignin-solubilizing microorganisms and/or enzymes (see, for example, Hsu, T.-A., 1996, Pretreatment of biomass, in Handbook on Bioethanol: Production and Utilization, Wyman, C. E., ed., Taylor & Francis, Washington, D.C., 179-212; Ghosh and Singh, 1993, Adv. Appl. Microbiol. 39: 295-333; McMillan, J. D., 1994, Pretreating lignocellulosic biomass: a review, in Enzymatic Conversion of Biomass for Fuels Production, Himmel, M. E., Baker, J. O., and Overend, R. P., eds., ACS Symposium Series 566, American Chemical Society, Washington, D.C., chapter 15; Gong, C. S., Cao, N. J., Du, J., and Tsao, G. T., 1999, Ethanol production from renewable resources, in Advances in Biochemical Engineering/Biotechnology, Scheper, T., ed., Springer-Verlag Berlin Heidelberg, Germany, 65: 207-241; Olsson and Hahn-Hagerdal, 1996, Enz. Microb. Tech. 18: 312-331; and Vallander and Eriksson, 1990, Adv. Biochem. Eng./Biotechnol. 42: 63-95).

(291) Saccharification.

(292) In the hydrolysis step, also known as saccharification, the cellulosic or hemicellulosic material, e.g., pretreated, is hydrolyzed to break down cellulose and/or hemicellulose to fermentable sugars, such as glucose, cellobiose, xylose, xylulose, arabinose, mannose, galactose, and/or soluble oligosaccharides. The hydrolysis is performed enzymatically by one or more enzyme compositions of the present invention in one or more stages. The hydrolysis can be carried out as a batch process or series of batch processes. The hydrolysis can be carried out as a fed batch or continuous process, or series of fed batch or continuous processes, where the cellulosic or hemicellulosic material is fed gradually to, for example, an enzyme containing hydrolysis solution.

(293) Enzymatic hydrolysis is preferably carried out in a suitable aqueous environment under conditions that can be readily determined by one skilled in the art. In one aspect, hydrolysis is performed under conditions suitable for the activity of the enzymes(s), i.e., optimal for the enzyme(s).

(294) The saccharification is generally performed in stirred-tank reactors or fermentors under controlled pH, temperature, and mixing conditions. Suitable process time, temperature and pH conditions can readily be determined by one skilled in the art. For example, the total saccharification time can last up to 200 hours, but is typically performed for preferably about 4 to about 120 hours, e.g., about 12 to about 96 hours or about 24 to about 72 hours. The temperature is in the range of preferably about 25 C. to about 80 C., e.g., about 30 C. to about 70 C., about 40 C. to about 60 C., or about 50 C. to about 55 C. The pH is in the range of preferably about 3 to about 9, e.g., about 3.5 to about 8, about 4 to about 7, about 4.2 to about 6, or about 4.3 to about 5.5.

(295) The dry solids content is in the range of preferably about 5 to about 50 wt. %, e.g., about 10 to about 40 wt. % or about 20 to about 30 wt. %.

(296) In one aspect, the saccharification is performed in the presence of dissolved oxygen at a concentration of at least 0.5% of the saturation level.

(297) In an embodiment of the invention, the dissolved oxygen concentration during saccharification is in the range of at least 0.5% up to 30% of the saturation level, such as at least 1% up to 25%, at least 1% up to 20%, at least 1% up to 15%, at least 1% up to 10%, at least 1% up to 5%, and at least 1% up to 3% of the saturation level. In a preferred embodiment, the dissolved oxygen concentration is maintained at a concentration of at least 0.5% up to 30% of the saturation level, such as at least 1% up to 25%, at least 1% up to 20%, at least 1% up to 15%, at least 1% up to 10%, at least 1% up to 5%, and at least 1% up to 3% of the saturation level during at least 25% of the saccharification period, such as at least 50% or at least 75% of the saccharification period. When the enzyme composition comprises an oxidoreductase the dissolved oxygen concentration may be higher up to 70% of the saturation level.

(298) Oxygen is added to the vessel in order to achieve the desired concentration of dissolved oxygen during saccharification. Maintaining the dissolved oxygen level within a desired range can be accomplished by aeration of the vessel, tank or the like by adding compressed air through a diffuser or sparger, or by other known methods of aeration. The aeration rate can be controlled on the basis of feedback from a dissolved oxygen sensor placed in the vessel/tank, or the system can run at a constant rate without feedback control. In the case of a hydrolysis train consisting of a plurality of vessels/tanks connected in series, aeration can be implemented in one or more or all of the vessels/tanks. Oxygen aeration systems are well known in the art. According to the invention any suitable aeration system may be used. Commercial aeration systems are designed by, e.g., Chemineer, Derby, England, and build by, e.g., Paul Mueller Company, MO, USA.

(299) In the processes of the present invention, an enzyme composition of the present invention can be added prior to or during fermentation, e.g., during saccharification or during or after propagation of the fermenting microorganism(s).

(300) Fermentation.

(301) The fermentable sugars obtained from the hydrolyzed cellulosic or hemicellulosic material can be fermented by one or more (e.g., several) fermenting microorganisms capable of fermenting the sugars directly or indirectly into a desired fermentation product. Fermentation or fermentation process refers to any fermentation process or any process comprising a fermentation step. Fermentation processes also include fermentation processes used in the consumable alcohol industry (e.g., beer and wine), dairy industry (e.g., fermented dairy products), leather industry, and tobacco industry. The fermentation conditions depend on the desired fermentation product and fermenting organism and can easily be determined by one skilled in the art.

(302) In the fermentation step, sugars, released from the cellulosic or hemicellulosic material as a result of the pretreatment and enzymatic hydrolysis steps, are fermented to a product, e.g., ethanol, by a fermenting organism, such as yeast. Hydrolysis (saccharification) and fermentation can be separate or simultaneous.

(303) Any suitable hydrolyzed cellulosic or hemicellulosic material can be used in the fermentation step in practicing the present invention. The material is generally selected based on economics, i.e., costs per equivalent sugar potential, and recalcitrance to enzymatic conversion.

(304) The term fermentation medium is understood herein to refer to a medium before the fermenting microorganism(s) is(are) added, such as, a medium resulting from a saccharification process, as well as a medium used in a simultaneous saccharification and fermentation process (SSF).

(305) Fermenting microorganism refers to any microorganism, including bacterial and fungal organisms, suitable for use in a desired fermentation process to produce a fermentation product. The fermenting organism can be hexose and/or pentose fermenting organisms, or a combination thereof. Both hexose and pentose fermenting organisms are well known in the art. Suitable fermenting microorganisms are able to ferment, i.e., convert, sugars, such as glucose, xylose, xylulose, arabinose, maltose, mannose, galactose, and/or oligosaccharides, directly or indirectly into the desired fermentation product. Examples of bacterial and fungal fermenting organisms producing ethanol are described by Lin et al., 2006, Appl. Microbiol. Biotechnol. 69: 627-642.

(306) Examples of fermenting microorganisms that can ferment hexose sugars include bacterial and fungal organisms, such as yeast. Yeast include strains of Candida, Kluyveromyces, and Saccharomyces, e.g., Candida sonorensis, Kluyveromyces marxianus, and Saccharomyces cerevisiae.

(307) Examples of fermenting organisms that can ferment pentose sugars in their native state include bacterial and fungal organisms, such as some yeast. Xylose fermenting yeast include strains of Candida, preferably C. sheatae or C. sonorensis; and strains of Pichia, e.g., P. stipitis, such as P. stipitis CBS 5773. Pentose fermenting yeast include strains of Pachysolen, preferably P. tannophilus. Organisms not capable of fermenting pentose sugars, such as xylose and arabinose, may be genetically modified to do so by methods known in the art.

(308) Examples of bacteria that can efficiently ferment hexose and pentose to ethanol include, for example, Bacillus coagulans, Clostridium acetobutylicum, Clostridium thermocellum, Clostridium phytofermentans, Geobacillus sp., Thermoanaerobacter saccharolyticum, and Zymomonas mobilis (Philippidis, G. P., 1996, Cellulose bioconversion technology, in Handbook on Bioethanol: Production and Utilization, Wyman, C. E., ed., Taylor & Francis, Washington, D.C., 179-212).

(309) Other fermenting organisms include strains of Bacillus, such as Bacillus coagulans; Candida, such as C. sonorensis, C. methanosorbosa, C. diddensiae, C. parapsilosis, C. naedodendra, C. blankii, C. entomophilia, C. brassicae, C. pseudotropicalis, C. boidinii, C. utilis, and C. scehatae; Clostridium, such as C. acetobutylicum, C. thermocellum, and C. phytofermentans; E. coli, especially E. coli strains that have been genetically modified to improve the yield of ethanol; Geobacillus sp.; Hansenula, such as Hansenula anomala; Klebsiella, such as K. oxytoca; Kluyveromyces, such as K. marxianus, K. lactis, K. thermotolerans, and K. fragilis; Schizosaccharomyces, such as S. pombe; Thermoanaerobacter, such as Thermoanaerobacter saccharolyticum; and Zymomonas, such as Zymomonas mobilis.

(310) Commercially available yeast suitable for ethanol production include, e.g., BIO-FERM AFT and XR (Lallemand Specialities, Inc., USA), ETHANOL REDO yeast (Lesaffre et Compagnie, France), FALI (AB Mauri Food Inc., USA), FERMIOL (Rymco International AG, Denmark), GERT STRAND (Gert Strand AB, Sweden), and SUPERSTART and THERMOSACC fresh yeast (Lallemand Specialities, Inc., USA).

(311) In an aspect, the fermenting microorganism has been genetically modified to provide the ability to ferment pentose sugars, such as xylose utilizing, arabinose utilizing, and xylose and arabinose co-utilizing microorganisms.

(312) The cloning of heterologous genes into various fermenting microorganisms has led to the construction of organisms capable of converting hexoses and pentoses to ethanol (co-fermentation) (Chen and Ho, 1993, Appl. Biochem. Biotechnol. 39-40: 135-147; Ho et al., 1998, Appl. Environ. Microbiol. 64: 1852-1859; Kotter and Ciriacy, 1993, Appl. Microbiol. Biotechnol. 38: 776-783; Walfridsson et al., 1995, Appl. Environ. Microbiol. 61: 4184-4190; Kuyper et al., 2004, FEMS Yeast Research 4: 655-664; Beall et al., 1991, Biotech. Bioeng. 38: 296-303; Ingram et al., 1998, Biotechnol. Bioeng. 58: 204-214; Zhang et al., 1995, Science 267: 240-243; Deanda et al., 1996, Appl. Environ. Microbiol. 62: 4465-4470; WO 03/062430).

(313) In one aspect, the fermenting organism comprises one or more polynucleotides encoding one or more cellulolytic enzymes, hemicellulolytic enzymes, and accessory enzymes.

(314) It is well known in the art that the organisms described above can also be used to produce other substances, as described herein.

(315) The fermenting microorganism is typically added to the degraded cellulosic or hemicellulosic material or hydrolysate and the fermentation is performed for about 8 to about 96 hours, e.g., about 24 to about 60 hours. The temperature is typically between about 26 C. to about 60 C., e.g., about 32 C. or 50 C., and about pH 3 to about pH 8, e.g., pH 4-5, 6, or 7.

(316) In one aspect, the yeast and/or another microorganism are applied to the degraded cellulosic or hemicellulosic material and the fermentation is performed for about 12 to about 96 hours, such as typically 24-60 hours. In another aspect, the temperature is preferably between about 20 C. to about 60 C., e.g., about 25 C. to about 50 C., about 32 C. to about 50 C., or about 32 C. to about 50 C., and the pH is generally from about pH 3 to about pH 7, e.g., about pH 4 to about pH 7. However, some fermenting organisms, e.g., bacteria, have higher fermentation temperature optima. Yeast or another microorganism is preferably applied in amounts of approximately 10.sup.5 to 10.sup.12, preferably from approximately 10.sup.7 to 10.sup.10, especially approximately 210.sup.8 viable cell count per ml of fermentation broth. Further guidance in respect of using yeast for fermentation can be found in, e.g., The Alcohol Textbook (Editors K. Jacques, T. P. Lyons and D. R. Kelsall, Nottingham University Press, United Kingdom 1999), which is hereby incorporated by reference.

(317) A fermentation stimulator can be used in combination with any of the processes described herein to further improve the fermentation process, and in particular, the performance of the fermenting microorganism, such as, rate enhancement and ethanol yield. A fermentation stimulator refers to stimulators for growth of the fermenting microorganisms, in particular, yeast. Preferred fermentation stimulators for growth include vitamins and minerals. Examples of vitamins include multivitamins, biotin, pantothenate, nicotinic acid, meso-inositol, thiamine, pyridoxine, para-aminobenzoic acid, folic acid, riboflavin, and Vitamins A, B, C, D, and E. See, for example, Alfenore et al., Improving ethanol production and viability of Saccharomyces cerevisiae by a vitamin feeding strategy during fed-batch process, Springer-Verlag (2002), which is hereby incorporated by reference. Examples of minerals include minerals and mineral salts that can supply nutrients comprising P, K, Mg, S, Ca, Fe, Zn, Mn, and Cu.

(318) Fermentation Products:

(319) A fermentation product can be any substance derived from the fermentation. The fermentation product can be, without limitation, an alcohol (e.g., arabinitol, n-butanol, isobutanol, ethanol, glycerol, methanol, ethylene glycol, 1,3-propanediol [propylene glycol], butanediol, glycerin, sorbitol, and xylitol); an alkane (e.g., pentane, hexane, heptane, octane, nonane, decane, undecane, and dodecane); a cycloalkane (e.g., cyclopentane, cyclohexane, cycloheptane, and cyclooctane); an alkene (e.g., pentene, hexene, heptene, and octene); an amino acid (e.g., aspartic acid, glutamic acid, glycine, lysine, serine, and threonine); a gas (e.g., methane, hydrogen (H.sub.2), carbon dioxide (CO.sub.2), and carbon monoxide (CO)); isoprene; a ketone (e.g., acetone); an organic acid (e.g., acetic acid, acetonic acid, adipic acid, ascorbic acid, citric acid, 2,5-diketo-D-gluconic acid, formic acid, fumaric acid, glucaric acid, gluconic acid, glucuronic acid, glutaric acid, 3-hydroxypropionic acid, itaconic acid, lactic acid, malic acid, malonic acid, oxalic acid, oxaloacetic acid, propionic acid, succinic acid, and xylonic acid); and polyketide.

(320) In one aspect, the fermentation product is an alcohol. The term alcohol encompasses a substance that contains one or more hydroxyl moieties. The alcohol can be, but is not limited to, n-butanol, isobutanol, ethanol, methanol, arabinitol, butanediol, ethylene glycol, glycerin, glycerol, 1,3-propanediol, sorbitol, or xylitol. See, for example, Gong et al., 1999, Ethanol production from renewable resources, in Advances in Biochemical Engineering/Biotechnology, Scheper, T., ed., Springer-Verlag Berlin Heidelberg, Germany, 65: 207-241; Silveira and Jonas, 2002, Appl. Microbiol. Biotechnol. 59: 400-408; Nigam and Singh, 1995, Process Biochemistry 30(2): 117-124; Ezeji et al., 2003, World Journal of Microbiology and Biotechnology 19(6): 595-603.

(321) In another aspect, the fermentation product is an alkane. The alkane may be an unbranched or a branched alkane. The alkane can be, but is not limited to, pentane, hexane, heptane, octane, nonane, decane, undecane, or dodecane.

(322) In another aspect, the fermentation product is a cycloalkane. The cycloalkane can be, but is not limited to, cyclopentane, cyclohexane, cycloheptane, or cyclooctane.

(323) In another aspect, the fermentation product is an alkene. The alkene may be an unbranched or a branched alkene. The alkene can be, but is not limited to, pentene, hexene, heptene, or octene.

(324) In another aspect, the fermentation product is an amino acid. The organic acid can be, but is not limited to, aspartic acid, glutamic acid, glycine, lysine, serine, or threonine. See, for example, Richard and Margaritis, 2004, Biotechnology and Bioengineering 87(4): 501-515.

(325) In another aspect, the fermentation product is a gas. The gas can be, but is not limited to, methane, H.sub.2, CO.sub.2, or CO. See, for example, Kataoka et al., 1997, Water Science and Technology 36(6-7): 41-47; and Gunaseelan, 1997, Biomass and Bioenergy 13(1-2): 83-114.

(326) In another aspect, the fermentation product is isoprene.

(327) In another aspect, the fermentation product is a ketone. The term ketone encompasses a substance that contains one or more ketone moieties. The ketone can be, but is not limited to, acetone.

(328) In another aspect, the fermentation product is an organic acid. The organic acid can be, but is not limited to, acetic acid, acetonic acid, adipic acid, ascorbic acid, citric acid, 2,5-diketo-D-gluconic acid, formic acid, fumaric acid, glucaric acid, gluconic acid, glucuronic acid, glutaric acid, 3-hydroxypropionic acid, itaconic acid, lactic acid, malic acid, malonic acid, oxalic acid, propionic acid, succinic acid, or xylonic acid. See, for example, Chen and Lee, 1997, Appl. Biochem. Biotechnol. 63-65: 435-448.

(329) In another aspect, the fermentation product is polyketide.

(330) Recovery.

(331) The fermentation product(s) can be optionally recovered from the fermentation medium using any method known in the art including, but not limited to, chromatography, electrophoretic procedures, differential solubility, distillation, or extraction. For example, alcohol is separated from the fermented cellulosic or hemicellulosic material and purified by conventional methods of distillation. Ethanol with a purity of up to about 96 vol. % can be obtained, which can be used as, for example, fuel ethanol, drinking ethanol, i.e., potable neutral spirits, or industrial ethanol.

(332) The present invention is further described by the following examples that should not be construed as limiting the scope of the invention.

EXAMPLES

(333) Strains

(334) Trichoderma reesei RutC30 is a mutagenized T. reesei strain of original isolate QM6A (Montenecourt and Eveleigh, 1979, Adv. Chem. Ser. 181: 289-301).

(335) T. reesei strain 981-08-D4 is a mutagenized strain of T. reesei RutC30.

(336) T. reesei AgJg115-104-7B1 is strain T. reesei 981-08-D4 strain containing a disruption of ku70 rendering it deficient in non-homologous end joining of DNA (WO 2011/075677).

(337) Media and Buffer Solutions

(338) Cellulase inducing medium (CIM) was composed of 20 g of Arbocel-natural cellulose fibers (J. Rettenmaier USA LP), 10 g of corn steep solids, 1.45 g of (NH.sub.4).sub.2SO.sub.4, 2.08 g of KH.sub.2PO.sub.4, 0.28 g of CaCl.sub.2, 0.42 g of MgSO.sub.4.7H.sub.2O, 0.42 ml of T. reesei trace metals solution, 2 drops of anti-foam, and deionized water to 1 liter; pH 6.0.

(339) COVE plates were composed of 342.3 g of sucrose, 20 ml of COVE salt solution, 10 ml of 1 M acetamide, 10 ml of 1.5 M CsCl, 25 g of Noble agar (Difco), and deionized water to 1 liter.

(340) COVE salt solution was composed of 26 g of KCl, 26 g of MgSO.sub.4.7H.sub.2O, 76 g of KH.sub.2PO.sub.4, 50 ml of COVE trace metals solution, and deionized water to 1 liter.

(341) COVE trace metals solution was composed of 0.04 g of NaB.sub.4O.sub.7.10H.sub.2O, 0.4 g of CuSO.sub.4.5H.sub.2O, 1.2 g of FeSO.sub.4.7H.sub.2O, 0.7 g or 1 g of MnSO.sub.4.H.sub.2O, 0.8 g of Na.sub.2MoO.sub.2.2H.sub.2O, 10 g of ZnSO.sub.4.7H.sub.2O, and deionized water to 1 liter.

(342) LB+Amp medium was composed of 10 g of tryptone, 5 g of yeast extract, 5 g of NaCl, and deionized water to 1 liter. After autoclaving 1 ml of a 100 mg/ml solution of ampicillin in water was added.

(343) Overlay PDA medium was composed of 39 g of Potato Dextrose Agar (Difco) and deionized water to 1 liter.

(344) PDA plates were composed of 39 g of Potato Dextrose Agar (Difco) and deionized water to 1 liter.

(345) PEG buffer was composed of 500 g of PEG 4000, 10 mM CaCl.sub.2, 10 mM Tris-HCl pH 7.5, and deionized water to 1 liter; filter sterilized.

(346) SOC medium was composed of 20 g of tryptone, 5 g of yeast extract, 0.5 g of NaCl, 10 ml of 250 mM KCl, and deionized water to 1 liter.

(347) STC was composed of 0.8 M or 1 M sorbitol, 10 mM or 25 mM CaCl.sub.2, and 10 mM Tris-HCl, pH 7.5; filter sterilized.

(348) TAE buffer was composed of 4.84 g of Tris Base, 1.14 ml of Glacial acetic acid, 2 ml of 0.5 M EDTA pH 8, and deionized water to 1 liter.

(349) TBE buffer was composed of 10.8 g of Tris Base, 5 g of boric acid, 4 ml of 0.5 M EDTA pH 8, and deionized water to 1 liter.

(350) TE buffer was composed of 1 M Tris pH 8.0 and 0.5 M EDTA pH 8.0 in deionized water.

(351) TrMM-G plates were composed of 20 ml of COVE salt solution, 6 g of (NH.sub.4).sub.2SO.sub.4, 0.6 g of CaCl.sub.2, 25 g of Nobel Agar (Difco), 20 g of glucose, and deionized water to 1 liter.

(352) T. reesei trace metals solution was composed of 216 g of FeCl.sub.3.6H.sub.2O, 58 g of ZnSO.sub.4.7H.sub.2O, 27 g of MnSO.sub.4.H.sub.2O, 10 g of CuSO.sub.4.5H.sub.2O, 2.4 g of H.sub.3BO.sub.4, 336 g of citric acid, and deionized water to 1 liter.

(353) 2XYT+Amp plates were composed of 10 g of tryptone, 5 g of yeast extract, 5 g of sodium chloride, 15 g of Bacto Agar, and deionized water to 1 liter, followed by 2 ml of a filter-sterilized solution of 50 mg/ml ampicillin after autoclaving.

(354) YP medium was composed of 10 g of yeast extract, 20 g of Bacto peptone, and deionized water to 1 liter.

Example 1: Protoplast Generation and Transformation of Trichoderma reesei Strain AgJg115-104-7B1 to Delete the T. reesei 42 kDa Aspartic Protease

(355) Protoplast preparation and transformation were performed using a modified protocol of Penttila et al., 1987, Gene 61: 155-164. Briefly, Trichoderma reesei strain AgJg115-104-7B1 was cultivated in 25 ml of YP medium supplemented with 2% (w/v) glucose and 10 mM uridine at 27 C. for 17 hours with gentle agitation at 90 rpm. Mycelia were collected by filtration using a Millipore Vacuum Driven Disposable Filtration System (Millipore, Bedford, Mass., USA) and washed twice with deionized water and twice with 1.2 M sorbitol. Protoplasts were generated by suspending the washed mycelia in 20 ml of 1.2 M sorbitol containing 15 mg of GLUCANEX 200 G (Novozymes A/S, Bagsvaerd, Denmark) per ml and 0.36 units of chitinase (Sigma Chemical Co., St. Louis, Mo., USA) per ml for 15-25 minutes at 34 C. with gentle shaking at 90 rpm. Protoplasts were collected by centrifuging for 7 minutes at 400g and washed twice with cold 1.2 M sorbitol. The protoplasts were counted using a hemocytometer and re-suspended to a final concentration of 110.sup.8 protoplasts/ml in STC. Excess protoplasts were stored in cryotubes and frozen in a Cryo 1 C. Freezing Container (Nalgene, Rochester, N.Y., USA) at 80 C.

(356) A deletion construct pAgJg118 (WO 2011/075677) contains the E. coli hygromycin phosphotransferase (hpt) gene and the Herpes simplex virus thymidine kinase (tk) gene flanked by direct repeats. The direct repeats were inserted to facilitate the excision of the hpt and tk selectable markers and generate a clean deletion of a 42 kDa aspartic protease gene. Ninety-six g of the transforming plasmid, pAgJg118, were digested with Pme I. The digestion reaction was purified by 1% agarose gel electrophoresis using TAE buffer where a 7.9 kb DNA band was excised from the gel, and extracted using a QIAQUICK Gel Extraction Kit (QIAGEN Inc., Valencia, Calif., USA). Briefly 3 volumes of Kit-supplied buffer QG were added to the gel slice and dissolved at 50 C. for approximately 10 minutes. The dissolved gel slice was applied to a Kit-supplied spin column by transferring to the column and centrifuging at 13,000 rpm for 1 minute. The column was washed with 750 l of Kit-supplied buffer PE and the centrifugation was repeated. DNA was eluted with 25 l of Kit-supplied buffer EB. Approximately 1 g of the resulting purified DNA fragment was added to 100 l of the protoplast solution and mixed gently. PEG buffer (250 l) was added, mixed, and incubated at 34 C. for 30 minutes. STC (3 ml) was then added, mixed, and spread onto PDA plates supplemented with 1 M sucrose. After incubation at 28 C. for 16 hours, 20 ml of overlay PDA medium supplemented with 35 g of hygromycin B per ml were added to each plate. The plates were incubated at 28 C. for 4-7 days. Seven transformants were sub-cultured onto PDA plates to generate spores.

(357) Transformants of T. reesei strain AgJg115-104-7B1 containing the pAgJg118 deletion vector at the 42 kDa aspartic protease locus were screened by Fungal Colony PCR. A small amount of spores from each transformant was suspended in 20 l of Dilution buffer (PHIRE Plant Direct PCR Kit, Thermo Fisher Scientific, Waltham, Mass., USA). The spore suspension was used as a template in a PCR reaction to screen for the aspartic protease deletion. The reaction was composed of 0.5 l of the spore suspension, 50 pmol of primer 069134 (shown below), 50 pmol of primer 067947 (shown below), 10 l of 2 PHIRE Plant PCR Buffer (PHIRE Plant Direct PCR Kit, Thermo Fisher Scientific), and 0.4 l of PHIRE Hot Start II DNA Polymerase (PHIRE Plant Direct PCR Kit, Thermo Fisher Scientific) in a 20 l reaction. The reaction was incubated in an EPPENDORF MASTERCYCLER (Eppendorf Scientific, Inc., Westbury, N.Y., USA) programmed for 1 cycle at 98 C. for 5 minutes; 40 cycles each at 98 C. for 5 seconds, 58 C. for 5 seconds, and 72 C. for 2 minutes 20 seconds; 1 cycle at 72 C. for 2 minutes; and a 10 C. hold. Primer 069134 is located upstream of the 5 flanking region and primer 067947 is located at the beginning of the E. coli hygromycin phosphotransferase (hpt) gene coding region. If the deletion vector was integrated into the aspartic protease locus, the amplified PCR fragment should be 2.4 kb in length. One transformant designated T. reesei AgJg115-118-1 was identified as having the aspartic protease gene deleted.

(358) TABLE-US-00001 Forwardprimer: (SEQIDNO:37) 5-CGCAATCTATCGAATAGCAG-3 Reverseprimer: (SEQIDNO:38) 5-CTACATCGAAGCTGAAAGCACGAGA-3

(359) Spores from T. reesei AgJg115-118-1 were spread onto TrMM-G plates supplemented with 1 M 5-fluoro-2-deoxyuridine (FdU) and incubated at 28 C. for 6 days. Nine isolates were sub-cultured onto PDA plates and incubated at 28 C. for 6 days. The isolates were then screened for the absence of the hpt and tk markers by Fungal Colony PCR in a similar manner described above. The PCR screen was composed of 0.5 l of each spore suspension, 50 pmol of forward and reverse primers listed below, 10 l of 2 PHIRE Plant PCR Buffer, and 0.4 l of PHIRE Hot Start II DNA Polymerase in a 20 l reaction.

(360) TABLE-US-00002 Forwardprimer: (SEQIDNO:39) 5-CGCAATCTATCGAATAGCAG-3 Reverseprimer: (SEQIDNO:40) 5-GACGTGCAACTTCCTTCAAAC-3

(361) The reactions were incubated in an EPPENDORF MASTERCYCLER programmed for 1 cycle at 98 C. for 5 minutes; 40 cycles each at 98 C. for 5 seconds, 58 C. for 5 seconds, and 72 C. for 1 minute 45 seconds; 1 cycle at 72 C. for 1 minute; and a 10 C. hold. The forward primer location is upstream of the 5 flanking region and the reverse primer location is downstream of the 3 flanking region. If the aspartic protease coding sequence has been deleted and the hpt and tk markers have been looped out, the amplified PCR fragments should be 3.6 kb in length.

(362) Genomic DNA from the isolates was prepared as described below and analyzed by Southern blot analysis to confirm the deletion of the 42 kDa aspartic protease coding sequence.

(363) The T. reesei AgJg115-118-1 isolates were grown in 50 ml of YP medium supplemented with 2% glucose (w/v) in a 250 ml baffled shake flask at 28 C. for 2 days with agitation at 200 rpm. Mycelia were harvested by filtration using MIRACLOTH (Calbiochem, La Jolla, Calif., USA), washed twice in deionized water, and frozen under liquid nitrogen. Frozen mycelia were ground, by mortar and pestle, to a fine powder, and total DNA was isolated using a DNEASY Plant Maxi Kit (QIAGEN Inc., Valencia, Calif., USA) according to the manufacturer's protocol with the exception that the lytic incubation was extended to 2 hours. Briefly 5 ml of Kit-supplied buffer AP1 were added to 1 g of tissue in a 15 ml conical bottom tube and incubated for 2 hours at 65 C. Then 1.8 ml of Kit-supplied buffer AP2 were added. The tube was incubated on ice for 5 minutes and centrifuged at 3300 rpm for 5 minutes using a LEGEND RT swinging bucket centrifuge (Thermo Fisher Scientific Inc., Waltham, Mass., USA). The supernatant was transferred to a QIAShredder column (QIAGEN Inc., Valencia, Calif., USA) and the centrifugation was repeated. Supernatant was transferred to a new 50 ml conical tube to which 1.5 volumes of Kit-supplied buffer AP3/E were added and transferred to a Kit-supplied DNA spin column and the centrifugation was repeated. The column was washed with 12 ml of Kit-supplied buffer AW and the centrifugation was repeated. The column was dried by repeating the centrifugation without any addition. The DNA was eluted by adding 1 ml of Kit-supplied buffer AE and the centrifugation was repeated.

(364) For Southern blot analysis, 2 g of genomic DNA were digested with 10 units of Nco I in a 30 l reaction volume and subjected to 0.7% agarose electrophoresis using TAE buffer. The DNA in the gel was depurinated, denatured, neutralized, and transferred to a NYTRAN SuPerCharge nylon membrane (Whatman, Kent UK) using a TURBOBLOTTER (Whatman, Kent UK). The DNA was UV cross-linked to the membrane using a UV STRATALINKER (Stratagene, La Jolla, Calif., USA) and prehybridized for 1 hour at 42 C. in 20 ml of DIG Easy Hyb (Roche Diagnostics Corporation, Indianapolis, Ind., USA).

(365) The membrane was hybridized with a 500 bp digoxigenin-labeled Trichoderma reesei 42 kDa aspartic protease gene probe, which was synthesized by incorporation of digoxigenin-11-dUTP by PCR using the forward and reverse primers shown below.

(366) TABLE-US-00003 ForwardPrimer: (SEQIDNO:41) 5-CTTCTATCTTGGGATGCTTCACGATACGTGA-3 ReversePrimer: (SEQIDNO:42) 5-CGCGCCCTTGAATATCGGAGAAGGT-3

(367) The amplification reaction was composed of 5 l of 10 Taq Buffer (New England Biolabs, Ipswich, Mass., USA), 2.5 l of PCR DIG Labeling Mix, 5 ng of pAgJg118, 10 pmol each primer, 2.5 l of 10 mM dNTPs, 5 units of Taq DNA polymerase (New England Biolabs, Ipswich, Mass., USA), and 36.5 l of water. The reaction was incubated in an EPPENDORF MASTERCYCLER programmed for 1 cycle at 95 C. for 2 minutes; 30 cycles each at 95 C. for 30 seconds, 56 C. for 30 seconds, and 72 C. for 40 seconds; 1 cycle at 72 C. for 15 minutes; and a 4 C. hold. The probe was purified by 1% agarose gel electrophoresis using TAE buffer, excised from the gel, and extracted using a QIAQUICK Gel Extraction Kit. Briefly 3 volumes of Kit-supplied buffer QG were added to the gel slice and dissolved at 50 C. for approximately 10 minutes. The dissolved gel slice was transferred to a spin column and centrifuged at 13,000 rpm for 1 minute. The column was washed with 750 l of Kit-supplied buffer PE and then the centrifugation was repeated. DNA was eluted with 25 l of Kit-supplied buffer EB.

(368) The probe was boiled for 5 minutes, chilled on ice for 2 minutes, and added to 10 ml of DIG Easy Hyb to produce the hybridization solution. Hybridization was performed at 42 C. for 15-17 hours. The membrane was then washed twice under low stringency conditions in 2SSC plus 0.1% SDS for 5 minutes at room temperature followed by two high stringency washes in 0.5SSC plus 0.1% SDS for 15 minutes each at 65 C. The probe-target hybrids were detected by chemiluminescent assay (Roche Diagnostics, Indianapolis, Ind., USA) according to the manufacturer's instructions. Southern blot analysis identified primary transformant T. reesei AgJg115-118-1H1 as containing the replacement and being void of the hpt/tk markers.

Example 2: Construction of a Cbh2 Replacement Vector pGMER169

(369) A cbh2 coding sequence (SEQ ID NO: 3 [DNA sequence] and SEQ ID NO: 4 [amino acid sequence]) was PCR amplified from pP23YSW (WO 2012/103288) as template with the primers shown below. The underlined portions are overhang to match the pMJ09 vector (US 20080233613).

(370) TABLE-US-00004 ForwardPrimer: (SEQIDNO:43) 5-ATAGTCAACCGCGGACTGCGCACCATGCGGTCTCTCCTGGCTCTTGC CCC-3 ReversePrimer: (SEQIDNO:44) 5-TCAGGCTTTCGCCACGGAGCTTAATTAATTAGAAAGAGGGGTTGGCG TTG-3

(371) The amplification reaction was composed of 10 ng of pP23YSYW, 200 M dNTP's, 0.5 M primers, 1 PHUSION Reaction Buffer (New England Biolabs, Ipswich, Mass., USA), and 1 unit of PHUSION High Fidelity DNA polymerase (New England Biolabs, Ipswich, Mass., USA) in a final volume of 50 l. The amplification reaction was incubated in an EPPENDORF MASTERCYCLER programmed for 1 cycle at 98 C. for 30 seconds; 30 cycles each at 98 C. for 10 seconds, 59 C. for 30 seconds, and 72 C. for 1 minute; and 1 cycle at 72 C. for 10 minutes.

(372) The PCR product was separated by 1% agarose electrophoresis using TAE buffer where a 1.9 kb band was excised from the gel and the DNA was extracted using a QIAQUICK Gel Extraction Kit (Example 1). The fragment was inserted into Nco I/Pac I-digested pMJ09 using a GENEART Seamless Cloning and Assembly Kit (LifeTechnologies, Carlsbad, Calif., USA). The reaction was composed of 4 l of Kit-supplied 5 Enzyme Buffer, 100 ng of pMJ09, 54 ng of PCR product, and 2 l of Kit-supplied Enzyme Mix in a 20 l reaction volume. The reaction was incubated for 30 minutes at room temperature and then placed on ice. Then 8 l were used to transform ONE SHOT TOP10 E. coli chemically competent cells (Invitrogen, Carlsbad, Calif., USA) by addition to a single use tube containing the competent cells and incubating the cells on ice for 20 minutes. The tube was incubated at 42 C. for 30 seconds after which 250 l of SOC medium were added. The tube was then incubated at 37 C. for 1 hour with mixing at 200 rpm and 200 l were transferred to a 150 mm 2XYT+Amp plate and incubated overnight at 37 C. E. coli colonies were inoculated into 3 ml of LB+Amp medium in a 14 ml Falcon round-bottom polypropylene tube and incubated at 37 C. overnight with mixing at 200 rpm. Plasmid DNA was isolated from the resulting transformants using a BIOROBOT 9600 (QIAGEN Inc., Valencia, Calif., USA). The resulting transformants were screened by restriction digestion analysis with Sca I to determine the presence and orientation of the insert. Positive clones were DNA sequenced using an Applied Biosystems 377 XL Automated DNA Sequencer (Applied Biosystems Inc., Foster City, Calif., USA) and dye-terminator chemistry (Giesecke et al., 1992, J. Virol. Methods 38: 47-60). The resulting plasmid was designated pAyGm8.

(373) Expression plasmid pGMEr169 contains the cbh2 coding sequence of SEQ ID NO: 3 under control of the Trichoderma reesei cbh2 promoter and terminator. Plasmid pGMEr169 was constructed by first PCR amplifying the cbh2 coding sequence from plasmid pAYGm8 using the forward and reverse primers shown below.

(374) TABLE-US-00005 Forwardprimer: (SEQIDNO:45) 5-AGATCACCCTCTGTGTATTGCACCATGCGGTCTCTCCTGGCTCTTGC CCCT-3 Reverseprimer: (SEQIDNO:46) 5-CCGGTCACGAAAGCCTTAATTAACTATTAGAAAGAGGGGTTGGCGTT GGTAAG-3
The reverse primer added a Pac I restriction site at the 3 end of the fragment indicated by the underlined portion.

(375) The amplification reaction (50 l) was composed of 50 ng of plasmid pAYGm8 DNA, 1 PHUSION HF buffer (New England Biolabs, Inc., Ipswich, Mass., USA), 50 pmol of each primer, 200 M each dNTP, 3% DMSO (New England Biolabs, Inc., Ipswich, Mass., USA), and 1 unit of PHUSION High Fidelity DNA polymerase. The reaction was performed in an EPPENDORF MASTERCYCLER programmed for 1 cycle at 98 C. for 5 minutes; 35 cycles each at 98 C. for 30 seconds, 60 C. for 30 seconds, and 72 C. for 2 minutes; and a final extension cycle at 72 C. for 7 minutes. The completed PCR was submitted to 0.8% agarose gel electrophoresis using TBE buffer where an approximately 1948 bp PCR product was excised from the gel and purified using a NUCLEOSPIN Gel and PCR Clean-Up Kit (Macherey Nagel., Bethlehem, Pa., USA).

(376) A second PCR reaction was performed to create a Trichoderma reesei cbh2 promoter fragment containing 3 homology to the PCR product above and including an Afl II restriction site at its 5 end. This fragment was PCR amplified from plasmid pJfyS159 (FIG. 1) using the following forward and reverse primers:

(377) TABLE-US-00006 Forwardprimer: (SEQIDNO:47) 5-GCTTAGGCCCTTAAGCTTAGGCCGGCTTGCTTACT-3 Reverseprimer: (SEQIDNO:48) 5-AGGGGCAAGAGCCAGGAGAGACCGCATGGTGCAATACACAGAGGGTG ATCTTACAAGC-3

(378) The forward primer added an Afl II restriction site at the 5 end of the fragment while the reverse primer added, at its 3 end, a region of homology to the cbh2 coding sequence described above (sequence in Italics).

(379) The PCR (50 l) was composed of about 50 ng of plasmid pJfyS159 DNA, 1 PHUSION HF buffer, 50 pmol of each primer above, 200 M each of dNTP, 3% DMSO, and 1 unit of PHUSION High Fidelity DNA polymerase. The reaction was performed in an EPPENDORF MASTERCYCLER programmed for 1 cycle at 98 C. for 5 minutes; 35 cycles each at 98 C. for 30 seconds, 60 C. for 30 seconds, and 72 C. for 1.5 minutes; and a final extension cycle at 72 C. for 7 minutes. The completed PCR was submitted to 0.8% agarose gel electrophoresis using TBE buffer where an approximately 1340 bp PCR product was excised from the gel and purified using a NUCLEOSPIN Gel and PCR Clean-Up Kit.

(380) The 1948 bp and 1340 bp fragments were fused together by splicing by overlap extension (SOE) PCR using the forward primer directly above and reverse primer from the cbh2 PCR above, resulting in a 3237 bp fragment in which the Trichoderma reesei cbh2 promoter fragment was added upstream of the cbh2 coding sequence.

(381) The PCR (50 l) was composed of about 120 ng of each of the fragments for a total amount of template DNA of about 240 ng, 1 PHUSION HF buffer, 50 pmol of primer 1201537, 50 pmol of primer 1201280, 200 M each of dATP, dCTP, dGTP, and dTTP, 1.5 l of 100% DMSO, and 1 unit of PHUSION High Fidelity DNA polymerase. The reaction was performed in an EPPENDORF MASTERCYCLER programmed for 1 cycle at 98 C. for 3 minutes; 35 cycles each at 98 C. for 30 seconds, 60 C. for 30 seconds, and 72 C. for 2.5 minutes; and a final extension cycle at 72 C. for 7 minutes. The completed PCR was submitted to 0.8% agarose gel electrophoresis using TBE buffer where an approximately 3237 bp PCR product was excised from the gel and purified using a NUCLEOSPIN Gel and PCR Clean-Up Kit. Briefly, 2 volumes of Buffer NT were added to the gel slice and the sample was heated 10 minutes at 50 C. The entire solution was transferred to a Kit-supplied centrifugal column. The column was centrifuged at 13,000 rpm for 1 minute and washed with Kit-supplied wash buffer NT3 and re-centrifuged. DNA was eluted with 20 l of Kit-supplied elution buffer and centrifuged at 13,000 rpm for 1 minute.

(382) The resulting 3237 bp fragment was digested with Afl II and Pac I and ligated to the 9044 bp Afl II/Pac I fragment from plasmid pJfyS159. About 20 g of plasmid pJfyS159 were digested with Afl II and Pac I at 37 C. overnight. Before stopping the digestion reaction, 1 l of calf intestinal alkaline phosphatase (New England Biolabs, Ipswich, Mass., USA) was added to the pJfyS159-Afl II/Pac I digestion in order to de-phosphorylate the plasmid ends. The reaction was incubated again at 37 C. for 1 hour. The resulting reaction was submitted to 0.8% agarose gel electrophoresis using TBE buffer where a 9044 bp vector fragment was excised from the gel and purified using a NUCLEOSPIN Gel and PCR Clean-up Kit. The 3237 bp PCR product comprising the T. reesei cbh2 promoter and the cbh2 coding sequence was digested with restriction enzymes Afl II and Pac I at 37 C. for 3 hours. The resulting digested 3209 bp fragment was cleaned up using a NUCLEOSPIN Gel and PCR Clean-up Kit.

(383) The ligation reaction was performed using a QUICK LIGATION Kit (New England Biolabs, Inc., Ipswich, Mass., USA). The ligation reaction was composed of 3 l of vector fragment, 3 l of the T. reesei cbh2 promoter/cbh2 coding sequence insert fragment, 4 l of sterile deionized water, 10 l of 2 Quick Ligation Buffer (New England Biolabs, Ipswich, Mass., USA), and 1 l of Quick T4 Ligase (New England Biolabs, Ipswich, Mass., USA). The ligation reaction was incubated for 1 hour at room temperature. A 5 l aliquot of the ligation reaction was transformed into ONE SHOT TOP10 E. coli chemically competent cells. Briefly, 5 l of the ligation reaction were added to one tube containing the competent cells and the mixture was incubated on ice for 30 minutes. The tube was then incubated at 42 C. for 30 seconds after which 250 l of SOC medium were added. The tube was then incubated at 37 C. for 1 hour with mixing at 200 rpm and 250 l were transferred to a 150 mm 2XYT+Amp plate and incubated overnight at 37 C. Several of the resulting transformants were screened for proper insertion of the desired insert by Hind III restriction digestion. E. coli transformant colonies were inoculated into 3 ml of LB+Amp medium in a 14 ml Falcon round-bottom polypropylene tube and incubated at 37 C. overnight with mixing at 200 rpm. Plasmid DNA was isolated using a BIOROBOTO 9600. Plasmid DNA was extracted and purified using a Plasmid Mini Kit (QIAGEN Inc., Valencia, Calif., USA). Four transformants yielding the desired Hind III bands of 9168 bp, 2764 bp, 208 bp, and 113 bp were submitted to sequencing analysis for final insert confirmation. DNA sequencing was performed using an Applied Biosystems 377 XL Automated DNA Sequencer and dye-terminator chemistry (Giesecke et al., 1992, supra). The resulting plasmid was designated pGMER169 (FIG. 2), which comprises the cbh2 coding sequence of SEQ ID NO: 3 under transcriptional control of the Trichoderma reesei cbh2 gene promoter and terminator.

Example 3: Replacement of the Native Cbh2 Gene in Trichoderma reesei Strain AgJg115-118-1H1

(384) Approximately 200 g of plasmid pGMEr169 (Example 2) were digested with Pme I. The digestion reaction was purified by 1% agarose gel electrophoresis using TAE buffer. A 9.6 kb DNA band was excised from the gel and extracted using a QIAQUICK Gel Extraction Kit (Example 1). T. reesei strain AgJg115-118-1H1 (Example 1) was transformed with Pme I digested pGMer169 DNA selecting for hygromycin resistance (hpt) as described in Example 1. Thirty-five transformants were obtained and each one was transferred to a PDA plate and incubated for 2-4 days at 28 C. A spore PCR using a PHIRE Plant Direct PCR Kit was utilized to identify transformants which had integrated the pGMer169 Pme I fragment at the cbh2 locus. Briefly, spores from each transformant were collected with a sterile 1 l inoculation loop and transferred to 15 l of Kit-supplied dilution buffer in 0.2 ml PCR strip tubes and incubated for 5 minutes at room temperature. Each spore suspension was centrifuged briefly in a strip-fuge mini centrifuge (Sigma Aldrich, St Louis, Mo., USA) and 1 l of each supernatant was used in the spore PCR reaction. The Spore PCR reaction (20 l) was composed of 1 PHIRE Plant Direct PCR buffer (contains dNTPs and Mg), 10 pmol of gene specific forward and reverse primers shown below, and 0.4 l of PHIRE II Hot Start DNA Polymerase.

(385) TABLE-US-00007 Forwardprimer(homologousto5 flankofcbh2 ofSEQIDNO:3): (SEQIDNO:49) 5-CTCTATAGAGGAATCAGCGT-3 Reverseprimer1(homologoustocbh2ofSEQID NO:3): (SEQIDNO:50) 5-TACACCTCGGACGAGTATTC-3 Reverseprimer2(homologoustoT.reeseicbh2 codingsequence): (SEQIDNO:51) 5-TCTAGAGGCACACTAGCTGC-3

(386) The amplification reactions were incubated in an EPPENDORF MASTERCYCLER programmed for 1 cycle at 98 C. for 5 minutes; 40 cycles each at 98 C. for 5 seconds, 57 C. for 5 seconds, and 72 C. for 45 seconds; and 1 cycle at 72 C. for 1 minute.

(387) The completed PCRs were subjected to 0.8% agarose gel electrophoresis using TBE buffer. Transformants with the correct replacement of the native T. reesei cbh2 gene with the cbh2 coding sequence of SEQ ID NO: 3 produced a 2.1 kb fragment, whereas transformants with the intact native cbh2 gene produced a 1.7 kb fragment.

(388) Two transformants produced the correct replacement fragment and were chosen for spore isolation. Spores from a 6 day old PDA plate were collected in 4 ml of 0.01% TWEEN 20 and the spore concentration was determined using a hemocytometer. Spores were diluted appropriately to a concentration of 10.sup.3 spores per ml using sterile water and 100 spores were spread onto PDA plates. Plates were incubated for 2 days at 30 C. Isolated colonies from each transformant were picked with a sterile 10 l inoculation loop and transferred to a new 50 mm PDA plate and incubated at 30 C. Spore PCR using a PHIRE Plant Direct PCR Kit (protocol and primers described above) was utilized to identify spore isolates with the correct gene replacement. Correct spore isolates were chosen and the hpt/tk markers were looped out using 5-fluorodeoxyuridine (FdU) counter-selection. Spores from the PDA plate were collected in 4 ml of 0.01% TWEEN 20 and approximately 30 l of the spore suspension were added to the middle of a 50 mm TrMM-G plate supplemented with 1 M FdU. The FdU plates were incubated for 6 days at 30 C. A chunk of mycelia was cut from the outer edge of the growth area and transferred to a PDA plate and the plate was incubated at 30 C. Spore PCR using a PHIRE Plant Direct PCR Kit (as described above) was utilized to identify isolates with the correct loop out of the hpt/tk markers.

(389) Screen for hpt Marker

(390) TABLE-US-00008 Forwardprimer(homologoustohptmarker): (SEQIDNO:52) 5-GGCATGACCTTTTGATGATCG-3 Reverseprimer(homologousto3 flankofT. reeseicbh2locus): (SEQIDNO:53) 5-TTACAACGTACCTACCTAGT-3
Screen for tk Marker:

(391) TABLE-US-00009 Forwardprimer(homologousto5 flankofT. reeseicbh2locus): (SEQIDNO:54) 5-CTCTATAGAGGAATCAGCGT-3 Reverseprimer(homologoustotkmarker): (SEQIDNO:55) 5-CGTGTCCCCGATATGGGGTCGTGGG-3

(392) The amplification reactions were incubated in an EPPENDORF MASTERCYCLER programmed for 1 cycle at 98 C. for 5 minutes; 40 cycles each at 98 C. for 7 seconds, 57 C. for 7 seconds, and 72 C. for 2 minutes; and 1 cycle at 72 C. for 2 minutes.

(393) The completed PCRs were subjected to 0.8% agarose gel electrophoresis using TAE buffer. Isolates that still contained the hpt marker produced a 1.8 kb fragment and isolates that still contained the tk marker produced a 5.5 kb fragment. Isolates that were void of the hpt and tk markers were carried forward.

(394) Spores from a 6 day old PDA plate were transferred to 1 ml of 0.01% TWEEN 20 using an inoculation loop and the spore concentration was determined using a hemocytometer. Spores were diluted appropriately to a concentration of 10.sup.3 spores per ml and 100 spores were spread onto PDA plates. Plates were incubated at 30 C. for 2 days. Colonies were picked with a sterile 10 l inoculation loop and transferred to new 50 mm PDA plates and incubated for 5 days at 28 C. The final Isolates were checked again for the absence of the hpt marker by spore PCR as described above.

(395) Genomic DNA from the final isolates was prepared as described below and analyzed by Southern blot analysis.

(396) The Trichoderma reesei isolates were each grown in 25 ml of YP medium supplemented with 2% glucose (w/v) in a 125 ml baffled shake flask at 28 C. for 2 days with agitation at 200 rpm. Mycelia were harvested from each culture by vacuum filtration through Whatman 1 filter paper in a Buchner funnel. The mycelia preparations were each washed twice in deionized water, dried under vacuum, and then transferred to a 2 ml microfuge tube. The mycelia preparations were dried approximately 16 hours in a Savant ISS110 SpeedVac concentrator (Thermo Fisher Scientific, Waltham, Mass., USA). The dried mycelia preparations were ground to a fine powder and total DNA was isolated using a MasterPure Yeast DNA Purification Kit (Epicentre, Madison, Wis., USA). Ground mycelia equivalent to approximately a 50 l volume were each transferred to a 2 ml microfuge tube. Yeast Cell Lysis Solution (300 l; Epicentre, Madison, Wis., USA) was added to each mycelia sample and each sample was vortexed. Each sample was incubated at 65 C. for 20 minutes. The samples were placed on ice for 5 minutes. MPC Protein Precipitation Reagent (150 l; Epicentre, Madison, Wis., USA) was added to each sample and the samples were vortexed for 10 seconds. The samples were centrifuged in a microcentrifuge for 10 minutes at 10,000 rpm. The supernatants were each transferred to a clean 1.7 ml microcentrifuge tube and 500 l of isopropanol were added. The samples were mixed thoroughly by inversion. The DNAs were pelleted by centrifugation in a microcentrifuge for 10 minutes at 10,000 rpm. The supernatants were discarded. The pellets containing the DNA were washed with 0.5 ml of 70% ethanol. The samples were centrifuged in a microcentrifuge for 4 minutes at 10,000 rpm. The ethanol was removed with a pipette and the pellets were air dried for 7 minutes at room temperature. The DNA pellets were resuspended in 60 l of TE. A 1.5 l aliquot of 5 g/l RNase A was added to each tube and the samples were incubated 30 minutes at 37 C.

(397) For Southern blot analysis approximately 1 g of genomic DNA was digested with 20 units of Hind III and subjected to 0.8% agarose electrophoresis using TAE buffer. The DNA in the gel was depurinated, denatured, neutralized, and transferred to a NYTRAN SuPerCharge nylon membrane using a TURBOBLOTTER. The DNA was UV cross-linked to the membrane using a UV STRATALINKER and prehybridized for 1 hour at 42 C. in 20 ml of DIG Easy Hyb.

(398) A template for a probe hybridizing to the 3 flanking region of the T. reesei cbh2 gene was generated using PHUSION High-Fidelity Hot Start DNA Polymerase (New England Biolabs, Ipswich, Mass., USA) and gene-specific forward and reverse primers shown below.

(399) TABLE-US-00010 Forwardprimer: (SEQIDNO:56) 5-TCTTGAGCCGCATCGCATAGA-3 Reverseprimer: (SEQIDNO:57) 5-TACGGTCAGCGCTCATGCGAA-3

(400) Fifty picomoles of each of the primers were used in a PCR composed of 100 ng of T. reesei RutC30 genomic DNA, 1 PHUSION High-Fidelity Hot Start DNA Polymerase buffer (New England Biolabs, Ipswich, Mass., USA), 1 l of a 10 mM blend of dATP, dTTP, dGTP, and dCTP, and 1 unit of PHUSION High-Fidelity Hot Start DNA Polymerase in a final volume of 50 l. The amplification was performed using an EPPENDORF MASTERCYCLER 5333 epgradient S (Eppendorf Scientific, Inc., Westbury, N.Y., USA) programmed for 1 cycle at 98 C. for 2 minutes; 34 cycles each at 98 C. for 15 seconds, 60 C. for 30 seconds, and 72 C. for 1 minute 30 seconds, and 1 cycle at 72 C. for 10 minutes. The completed PCR was purified by 0.8% agarose gel electrophoresis using TAE buffer where a 0.46 kb DNA band was excised from the gel and the DNA was extracted using a NUCLEOSPIN Extract II Kit. Briefly, 3 volumes of Buffer NT were added to the gel slice and the sample was heated 10 minutes at 50 C. The entire solution was transferred to a Kit-supplied centrifugal column. The column was centrifuged at 13,000 rpm for 1 minute and washed with Kit-supplied wash buffer NT3 and re-centrifuged. DNA was eluted with 30 l of Kit-supplied elution buffer and centrifuged at 13,000 rpm for 1 minute.

(401) A probe hybridizing to the 3 flanking region of the T. reesei cbh2 gene was generated using a PCR Dig Probe Synthesis Kit (Roche Diagnostics Corporation, Indianapolis, Ind., USA) with the forward and reverse primers shown directly above.

(402) The 50 l PCR reaction was composed of 1PCR DIG Probe Synthesis mix, 50 pmol of each primer, 1 PCR buffer with MgCl.sub.2, 24 ng purified probe template (described above), and 2.6 units of EXPAND High Fidelity DNA polymerase (Roche Applied Science, Penzberg, Germany). The cycling parameters were as follows: 1 cycle at 95 C. for 2 minute; 30 cycles each at 95 C. for 30 seconds, 59 C. for 30 seconds, and 72 C. for 45 seconds; and 1 cycle at 72 C. for 7 minutes.

(403) The probe was boiled for 5 minutes, chilled on ice for 2 minutes, and added to 10 ml of DIG Easy Hyb to produce the hybridization solution. Hybridization was performed at 42 C. for 15-17 hours. The membrane was then washed under low stringency conditions in 2SSC plus 0.1% SDS for 5 minutes at room temperature followed by two high stringency washes in 0.5SSC plus 0.1% SDS for 15 minutes each at 65 C. The probe-target hybrids were detected by chemiluminescent assay (Roche Diagnostics, Indianapolis, Ind., USA) according to the manufacturer's instructions. Southern blot analysis identified final spore isolates that contained the cbh2 replacement (3.3 kb hybridizing fragment) and did not contain the hpt/tk markers. The native T. reesei cbh2 locus produces a 4.7 kb hybridizing fragment. One spore isolate was chosen as the final strain and designated T. reesei KM1000-34.

Example 4: Generation of Cbh1 Replacement Vector pAyGm10

(404) To construct plasmid pAyGm7, a cbh1 coding sequence (SEQ ID NO: 1 [DNA sequence] and SEQ ID NO: 2 [amino acid sequence]) was amplified by PCR from plasmid pP23YSY (WO 2012/103293) as template with the primers shown below. The underlined portions are overhangs to match the site of insertion into plasmid pMJ09 (WO 2005/056772).

(405) TABLE-US-00011 ForwardPrimer (SEQIDNO:58) 5-ATAGTCAACCGCGGACTGCGCACCATGGCCAGCCTCTTCTCTTTCAA GATG-3 ReversePrimer (SEQIDNO:59) 5-CAGGCTTTCGCCACGGAGCTTAATTAATTACAGGCACTGGTAGTAGT AGGGGTTC-3

(406) The amplification reaction was composed of 15 ng of pP23YSY, 200 M dNTP's, 0.5 M primers, 1 PHUSION HF Reaction Buffer, and 1 unit of PHUSION High Fidelity DNA polymerase in a final volume of 50 l. The reaction was incubated in an EPPENDORF MASTERCYCLER programmed for 1 cycle at 98 C. for 30 seconds; 30 cycles each at 98 C. for 10 seconds, 62 C. for 30 seconds, and 72 C. for 1 minute; and 1 cycle at 72 C. for 10 minutes.

(407) The fragment was inserted directly into Nco I/Pac I-digested pMJ09 following PCR using a GENEART Seamless Cloning and Assembly Kit. The reaction was composed of 4 l of Kit-supplied 5 Enzyme Buffer, 100 ng of pMJ09, 45.8 ng of PCR product, and 2 l of Kit-supplied Enzyme Mix in a 20 l reaction volume. The reaction was incubated at room temperature for 30 minutes and then placed on ice. Then 1.3 l were used to transform ONE SHOT TOP10 E. coli chemically competent cells by addition to a single use tube containing the competent cells and incubating the cells on ice for 20 minutes. The tube was incubated at 42 C. for 30 seconds after which 250 l of SOC medium were added. The tube was then incubated at 37 C. with mixing at 200 rpm for 1 hour and 200 l were transferred to a 150 mm 2XYT+Amp plate and incubated overnight at 37 C. E. coli transformant colonies were each inoculated into 3 ml of LB+Amp medium in a 14 ml Falcon round-bottom polypropylene tube and incubated at 37 C. overnight with agitation at 200 rpm. Plasmid DNA was isolated from the resulting transformants using a BIOROBOT 9600. The resulting transformants were screened by restriction digestion analysis with Sal I to determine the presence and orientation of the insert and positive clones were DNA sequenced using an Applied Biosystems 377 XL Automated DNA Sequencer and dye-terminator chemistry (Giesecke et al., 1992, supra). The resulting plasmid was designated pAyGm7.

(408) To generate plasmid pAyGm10, two individual PCRs were combined by SOE PCR. First, the individual fragments were amplified from either pJfyS157 (FIG. 3) or pAyGm7 using the forward and reverse primers shown below.

(409) TABLE-US-00012 pJfyS157: ForwardPrimer: (SEQIDNO:60) 5-CAGTTGGGTGCACGAGTGGGTTACATCGAACTGG-3 ReversePrimer: (SEQIDNO:61) 5-GAAAGAGAAGAGGCTGGCCATGGTGCGCAGTCCGCGGTTGACTATT G-3 pAyGm7: ForwardPrimer: (SEQIDNO:62) 5-CAATAGTCAACCGCGGACTGCGCACCATGGCCAGCCTCTTCTCTTT C-3 ReverseComplementPrimer: (SEQIDNO:63) 5-GCGTCAGGCTTTCGCCACGGAGC-3

(410) The amplification reactions were composed of 10 ng of the respective plasmid template, 200 M dNTP's, 0.5 M primers, 1 PHUSION HF Reaction Buffer, and 1 unit of PHUSION High Fidelity DNA polymerase in a final volume of 50 l. Both PCR reactions were incubated in an EPPENDORF MASTERCYCLER. Cycling conditions for pJfyS157 were 1 cycle at 98 C. for 30 seconds; 30 cycles each at 98 C. for 10 seconds, 70 C. for 30 seconds, and 72 C. for 1 minute and 30 seconds; and 1 cycle at 72 C. for 10 minutes. Cycling conditions for pAyGm7 were 1 cycle at 98 C. for 30 seconds; 30 cycles each at 98 C. for 10 seconds, 67 C. for 30 seconds, and 72 C. for 1 minute; and 1 cycle at 72 C. for 10 minutes.

(411) The PCR products were separated by 1% agarose electrophoresis using TAE buffer where a 1.6 kb band for the pAyGm10 fragment and a 2.8 kb band for the pJFYS157 fragment were excised from the gels and extracted using a QIAQUICK Gel Extraction Kit (Example 1). The two fragments were then spliced together using SOE PCR with the forward and reverse primers of SEQ ID NO: 60 and SEQ ID NO: 63, respectively.

(412) The amplification reaction was composed of 125 ng of the pJFYS157 fragment and 218 ng of the pAyGm7 fragment, 200 M dNTP's, 0.5 M primers, 1 PHUSION HF Reaction Buffer, and 1 unit of PHUSION High Fidelity DNA polymerase in a final volume of 50 l. The reaction was incubated in an EPPENDORF MASTERCYCLER programmed for 1 cycle at 98 C. for 30 seconds; 30 cycles each at 98 C. for 10 seconds, 67 C. for 30 seconds, and 72 C. for 2 minute 30 seconds; and 1 cycle at 72 C. for 10 minutes.

(413) The PCR fragment was then digested with Pac I and Xmn I and subjected to a QIAQUICK PCR Purification Kit (QIAGEN Inc., Valencia, Calif., USA). Briefly, 5 volumes of Kit-supplied buffer PB1 were added to the PCR reaction and subsequently added to a Kit-supplied spin column by transferring to the column and centrifuging at 13,000 rpm for 1 minute. The column was washed with 750 l of Kit-supplied buffer PE and the centrifugation was repeated. DNA was eluted with 25 l of Kit-supplied buffer EB. The 4.4 kb Pac I and Xmn I digested PCR fragment was ligated to Pac I and Xmn I digested pJfyS157 using T4 DNA ligase (Roche, Indianapolis, Ind., USA). The ligation reaction was composed of 50 ng of the Pac I and Xmn I digested pJfyS157, 140 ng of the Pac I and Xmn I digested 4.4 kb PCR fragment, 1 Ligase Buffer (Roche, Indianapolis, Ind., USA), and 2 units of T4 DNA ligase in a final volume of 20 l. The reaction was incubated at room temperature for 10 minutes and 5 l of the reaction were transformed into ONE SHOT TOP10 E. coli chemically competent cells by addition to a single use tube containing the competent cells and incubating the cells on ice for 20 minutes. The tube was incubated at 42 C. for 30 seconds after which 250 l of SOC medium were added. The tube was then incubated at 37 C. with mixing at 200 rpm for 1 hour and 200 l were transferred to a 150 mm 2XYT+Amp plate and incubated overnight at 37 C. E. coli transformant colonies were inoculated into 3 ml of LB+Amp medium in a 14 ml Falcon round-bottom polypropylene tube and incubated at 37 C. overnight with agitation at 200 rpm. Plasmid DNA was isolated from the resulting transformants using a BIOROBOT 9600. The resulting transformants were screened by restriction digestion analysis with Hind III to determine the presence and orientation of the insert and positive clones were DNA sequenced using an Applied Biosystems 377 XL Automated DNA Sequencer and dye-terminator chemistry (Giesecke et al., 1992, supra). The resulting plasmid was designated pAyGm10 (FIG. 4).

Example 5: Replacement of the Native Trichoderma reesei Cbh1

(414) Approximately 200 g of plasmid pAyGm10 (Example 4) were digested with Pme I. The digestion reaction was purified by 0.8% agarose gel electrophoresis using TAE buffer where an 8.6 kb DNA band was excised from the gel and extracted using a NUCLEOSPIN Extract II Kit. Three volumes of Kit-supplied NT buffer were added to the gel slice and the sample was heated 10 minutes at 50 C. The solution was transferred to 6 Kit-supplied centrifugal columns. The columns were centrifuged at 13,000 rpm for 1 minute and washed with Kit-supplied wash buffer NT3 and re-centrifuged. The DNA was eluted with 70 l of 65 C. Kit-supplied NE buffer per column. The 6 eluted DNA samples were combined. T. reesei strain KM1000-34 (Example 3) was transformed with Pme I-digested pAyGm10 DNA selecting for hygromycin resistance (hpt) as described in Example 1. Five transformants were obtained and each one was picked and transferred to a PDA plate and incubated for 2-4 days at 30 C. Spore PCR using a PHIRE Plant Direct PCR Kit was employed to identify transformants which had integrated the pAyGm10 Pme I fragment at the T. reesei cbh1 locus. Briefly, spores from the transformants were collected with a sterile 1 l inoculation loop and transferred to 15 l of Kit-supplied dilution buffer in 0.2 ml PCR strip tubes and incubated at room temperature for 5 minutes. The spore suspension was centrifuged briefly in a strip-fuge mini centrifuge (Sigma Aldrich, St Louis, Mo., USA) and 1 l of supernatant was used in the spore PCR. The 20 l spore PCR reaction was composed of 1 PHIRE Plant Direct PCR buffer (contains dNTPs and Mg), 10 pmol of gene specific forward and reverse primers shown below, and 0.4 l of PHIRE II Hot Start DNA Polymerase.

(415) Screening Primers for 5 End of T. reesei Cbh1 Locus

(416) TABLE-US-00013 Forwardprimer(homologousto5 flankofcbh1 locus): (SEQIDNO:64) 5-GTAATTTGCCTGCTTGACCG-3 Reverseprimer(homologoustocbh1codingsequence ofSEQIDNO:1): (SEQIDNO:65) 5-TGAAGATCTGGTAGGTTGTG-3
Screening Primers for 3 End of T. reesei Cbh1 Locus

(417) TABLE-US-00014 Forwardprimer(homologoustohptmarker): (SEQIDNO:66) 5-TCATTGACTGTCTGTCCTCT-3 Reverseprimer(homologousto3 flankofcbh1 locus): (SEQIDNO:67) 5-TACCATGACTGTCACGATAG-3

(418) The amplification reaction was incubated in an EPPENDORF MASTERCYCLER programmed for 1 cycle at 98 C. for 5 minutes; 40 cycles each at 98 C. for 5 seconds, 57 C. for 5 seconds, and 72 C. for 1 minute; and 1 cycle at 72 C. for 1 minute.

(419) The completed PCRs were subjected to 1% agarose gel electrophoresis using TAE buffer. Transformants having the correct replacement of the native cbh1 gene with the cbh1 coding sequence of SEQ ID NO: 1 produced a 1.46 kb fragment with the 5 end screening primers and a 1.64 kb fragment with the 3 end screening primers.

(420) Two transformants produced the correct replacement fragments and were chosen for spore isolation and loop out of the hpt/tk markers. Spores from a 6 day old PDA plate were collected in 5 ml of 0.01% TWEEN 20 and the spore concentration was determined using a hemocytometer. Spores were diluted appropriately to a concentration of 10.sup.3 spores per ml and 100 spores were spread onto PDA plates. The plates were incubated for 2 days at 30 C. Nine colonies from each transformant were picked with a sterile 10 l inoculation loop and transferred to a new 50 mm PDA plate and incubated for 2 days at 30 C. Spore PCR using a PHIRE Plant Direct PCR Kit was utilized as described above to identify spore isolates with the correct gene replacement.

(421) Screening Primers for 5 End of T. reesei Cbh1 Locus

(422) TABLE-US-00015 Forwardprimer(homologousto5 flankofcbh1 locus): (SEQIDNO:68) 5-GTAATTTGCCTGCTTGACCG-3 Reverseprimer1(homologoustocbh1coding sequenceofSEQIDNO:1): (SEQIDNO:69) 5-TGAAGATCTGGTAGGTTGTG-3 Reverseprimer2(homologoustoT.reeseicbh1 gene): (SEQIDNO:70) 5-CGAGATGACGGCCAACTTCC-3
Screening Primers for 3 End of T. reesei Cbh1 Locus

(423) TABLE-US-00016 Forwardprimer1(homologoustohptmarker): (SEQIDNO:71) 5-TCATTGACTGTCTGTCCTCT-3 Forwardprimer2(homologoustoT.reeseicbh1 gene): (SEQIDNO:72) 5-GGAAGTTGGCCGTCATCTCG-3 Reverseprimer(homologousto3 flankofT. reeseicbh1locus): (SEQIDNO:73) 5-TACCATGACTGTCACGATAG-3

(424) The amplification reactions were incubated in an EPPENDORF MASTERCYCLER programmed for 1 cycle at 98 C. for 5 minutes; 40 cycles each at 98 C. for 5 seconds, 57 C. for 5 seconds, and 72 C. for 1 minute; and 1 cycle at 72 C. for 1 minute.

(425) The completed PCRs were subjected to 0.8% agarose gel electrophoresis using TAE buffer. Transformants having the correct replacement of the native T. reesei cbh1 gene with the cbh1 coding sequence of SEQ ID NO: 1 produced a 1.46 kb fragment with the 5 end screening primers. The native T. reesei cbh1 locus produced a 1.1 kb fragment with the 5 end screening primers. Transformants having the correct replacement of the native T. reesei cbh1 gene with the cbh1 coding sequence of SEQ ID NO: 1 produced a 1.64 kb fragment with the 3 end screening primers. The native T. reesei cbh1 locus produced a 3.0 kb fragment with the 3 end screening primers.

(426) Correct spore isolates were chosen and the hpt/tk markers were looped out using 5-fluorodeoxyuridine (FdU) counter-selection. A small chunk of mycelia from each PDA plate was added to the middle of a 50 mm TrMM-G plate supplemented with 1 M FdU. The FdU plates were incubated at 30 C. for 7 days. A chunk of mycelia was cut from the outer edge of the growth area of each plate and transferred to PDA platea. The plates were incubated at 30 C. for 2-4 days. Spore PCR using a PHIRE Plant Direct PCR Kit (protocol described above) was utilized to identify isolates with the correct loop out of the hpt/tk markers.

(427) Screen for hpt/tk Marker Excision:

(428) TABLE-US-00017 Forwardprimer(homologoustocbh1codingsequence ofSEQIDNO:1): (SEQIDNO:74) 5-TTCCCCAACCACGACCACCT-3 Reverseprimer(homologousto3 flankofT. reeseicbh1): (SEQIDNO:75) 5-TACCATGACTGTCACGATAG-3
Screen for hpt Marker:

(429) TABLE-US-00018 Forwardprimer(homologoustohptmarker): (SEQIDNO:76) 5-GGCATGACCTTTTGATGATCG-3 Reverseprimer(homologousto3 flankofT. reeseicbh1): (SEQIDNO:77) 5-TACCATGACTGTCACGATAG-3

(430) The amplification reactions were incubated in an EPPENDORF MASTERCYCLER programmed for 1 cycle at 98 C. for 5 minutes; 40 cycles each at 98 C. for 5 seconds, 57 C. for 5 seconds, and 72 C. for 1 minute; and 1 cycle at 72 C. for 1 minute.

(431) The completed PCR reactions were subjected to 0.8% agarose gel electrophoresis using TAE buffer. Isolates that still contained the hpt marker produced a 1.5 kb fragment using the hpt screening primers. Isolates that were void of the hpt and tk markers produced a 1.5 kb fragment using the loop out screening primers. Isolates with the correct marker loop out were carried forward.

(432) Spores from a 6 day old PDA plate were collected in 5 ml of 0.01% TWEEN 20 and the spore concentration was determined using a hemocytometer. Spores were diluted appropriately to a concentration of 10.sup.3 spores per ml and 100 spores were spread onto PDA plates. The plates were incubated for 2 days at 30 C. Eight colonies from each transformant were picked with a sterile 10 l inoculation loop and transferred to new 50 mm PDA plates and incubated for 2 days at 30 C. Spore PCR using a PHIRE Plant Direct PCR Kit (protocol described above) was utilized to identify final spore isolates with the correct gene replacement and hpt/tk marker loop out. The PCR primers used for the hpt/tk marker loop out and the screen for the hpt marker are described above.

(433) Genomic DNA of final spore isolates was prepared (as described in Example 3) and analyzed by Southern blot analysis. For Southern blot analysis approximately 1 g of genomic DNA was digested with 20 units of Bgl II and 20 units of Bam HI and subjected to 0.8% agarose electrophoresis using TAE buffer. The DNA in the gel was depurinated, denatured, neutralized, and transferred to a NYTRAN SuPerCharge nylon membrane using a TURBOBLOTTER. The DNA was UV cross-linked to the membrane using a UV STRATALINKER and prehybridized for 1 hour at 42 C. in 20 ml of DIG Easy Hyb.

(434) A probe hybridizing to the 3 flanking region of the cbh1 gene was generated using a PCR Dig Probe Synthesis Kit with the forward and reverse primers shown below. The PCR reaction (50 l) was composed of 1 Taq DNA Polymerase Buffer (New England Biolabs, Ipswich, Mass., USA), 50 pmol each primer, 0.5PCR DIG Probe Synthesis mix, 0.5 dNTP stock solution (Roche Diagnostics, Indianapolis, Ind., USA), 100 ng T. reesei RutC30 genomic DNA, and 2.5 units of Taq DNA polymerase (New England Biolabs, Ipswich, Mass., USA). The amplification reaction was incubated in an EPPENDORF MASTERCYCLER programmed for 1 cycle at 95 C. for 2 minute; 30 cycles each at 95 C. for 30 seconds, 60 C. for 30 seconds, and 72 C. for 40 seconds; and 1 cycle at 72 C. for 15 minutes.

(435) TABLE-US-00019 Forwardprimer: (SEQIDNO:78) 5-AATGACCCATAGGGAGACAAACAGCATAAT-3 Reverseprimer: (SEQIDNO:79) 5-TGTTGGACGCAGGATTTTGGA-3

(436) The 0.56 kb probe was purified by 1% agarose gel electrophoresis using TAE buffer where a band corresponding to the probe was excised from the gel and extracted using a QIAQUICK Gel Extraction Kit (Example 1). The probe was boiled for 5 minutes and chilled on ice for 2 minutes, and then added to 10 ml of DIG Easy Hyb to produce the hybridization solution. Hybridization was performed at 42 C. for 15-17 hours. The membrane was then washed under low stringency conditions in 2SSC plus 0.1% SDS for 5 minutes at room temperature followed by two high stringency washes in 0.5SSC plus 0.1% SDS for 15 minutes each at 65 C. The probe-target hybrids were detected by chemiluminescent assay (Roche Diagnostics, Indianapolis, Ind., USA) according to the manufacturer's instructions. Southern blot analysis identified final spore isolates that contained the cbh1 replacement (2.5 kb hybridizing fragment) and did not contain the hpt/tk markers. The native T. reesei cbh1 locus produced a 1.9 kb hybridizing fragment. One spore isolate was chosen as the final strain and designated T. reesei DLM-TICBH-9.

Example 6: Repair of the ku70 Gene in Cbh1 and Cbh2 Replaced Strain Trichoderma reesei DLM-TICBH-9

(437) The native Trichoderma reesei ku70 gene was repaired in the Trichoderma reesei replacement strain DLM-TICBH-9 (Example 5) in order to facilitate strain manipulation steps requiring the function of the KU70 protein's role in in non-homologous end-joining of DNA. T. reesei DLM-TICBH-9 was transformed with 232 g of Pme I-linearized pTH239 (WO 2013/028928) according to the procedure described above in Example 1. Forty-six transformants were obtained and each one was separately transferred to a PDA plate and incubated for 3 days at 30 C.

(438) Spore PCR using a PHIRE Plant Direct PCR Kit was utilized to identify transformants which had integrated the pTH239 repair cassette at the ku70 locus. Briefly, spores from transformants were collected with a sterile 1 l inoculation loop and transferred to 20 l of Kit-supplied dilution buffer in 0.2 ml PCR strip tubes and incubated for 5 minutes at room temperature. The spore suspensions were centrifuged briefly in a strip-fuge mini centrifuge (Sigma Aldrich, St Louis, Mo., USA) and 1.5 l of each supernatant was used in the spore PCR. The Spore PCR was composed of 1 PHIRE Plant Direct PCR Buffer (contains dNTPs and Mg), 1.25 M gene specific forward and reverse primers listed below, and 0.4 l of PHIRE II Hot Start DNA Polymerase.

(439) TABLE-US-00020 Forwardprimer: (SEQIDNO:80) 5-CGCTGAAATGCGCCCGCCACCT-3 Reverseprimer: (SEQIDNO:81) 5-GGGCGGACAGACGGGGCAAA-3

(440) The amplification reactions were incubated in an EPPENDORF MASTERCYCLER programmed for 1 cycle at 98 C. for 5 minutes; 40 cycles each at 98 C. for 20 seconds, 61 C. for 20 seconds, and 72 C. for 1 minute; and 1 cycle at 72 C. for 1 minute.

(441) The completed PCRs were subjected to 1% agarose gel electrophoresis using TAE buffer and 40 of the 46 transformants obtained displayed the 1.4 kb band indicative of integration of pTH239 at the ku70 locus. Six transformants were arbitrarily chosen to loop out the hpt/tk markers using 5-fluorodeoxyuridine (FdU) counter-selection. Spores from a 6 day old plate were collected in 10 ml of 0.01% TWEEN 20 and the spore concentration was determined using a hemocytometer. Spores were diluted to a concentration of 10.sup.6 spores per ml and 10.sup.6, 10.sup.5, and 10.sup.4 spores were spread onto TrMM-G plates supplemented with 1 M FdU. Colonies were picked with a sterile 10 l inoculation loop and transferred to a 75 mm PDA plate and incubated for 3 days at 30 C.

(442) Spore PCR using a PHIRE Plant Direct PCR Kit was completed to determine if the resulting spore isolates had correctly excised the markers as described above with the forward and reverse primers below.

(443) TABLE-US-00021 Forwardprimer: (SEQIDNO:82) 5-CGCTGAAATGCGCCCGCCACCT-3 Reverseprimer: (SEQIDNO:83) 5-CGTTCTCGCCGGCGTTTGCC-3

(444) The composition of the PCRs was identical to those described above with the spore solution of the FdU-resistant spore isolates as template and the cycling parameters were as follows: 1 cycle at 98 C. for 5 minutes; 40 cycles each at 98 C. for 20 seconds, 61 C. for 20 seconds, and 72 C. for 3 minutes; and 1 cycle at 72 C. for 3 minutes.

(445) The completed PCRs were subjected to 1% agarose gel electrophoresis using TAE buffer and the results indicated that 25 of the 48 isolates had correctly excised the cassette. Three of the spore isolates were chosen for spore purification to ensure homogeneity. For each spore purification, a 1 l inoculation loop was lightly touched to an isolate on a PDA plate and transferred to 1 ml of 0.01% TWEEN 20 in 15 ml conical bottom tube. Each tube was vortexed and a 3 l aliquot was transferred to a new 150 mm PDA plate and incubated at 30 C. for 2 days. Isolates were picked with a sterile 10 l inoculation loop and transferred to a new PDA plate and incubated at 30 C. for 3 days. Spore PCR was repeated to ensure that the isolates picked contained the repaired ku70 locus and were homogeneous. One randomly selected isolate, designated JfyS99-19B4, was analyzed by Southern blot analysis to verify the results of the spore PCR suggesting strains were all homozygous for the deletion and had correctly excised the markers, Southern blot analysis was then used on the resulting spore progeny. Genomic DNA was generated as described above in Example 1, and 2 g were digested with Nco I. DNA was subjected to 1% agarose gel electrophoresis and transferred to a NYTRAN membrane as described in Example 1. A probe hybridizing to the 3 flank of the ku70 gene was generated as described in Example 1 with the following region-specific forward and reverse primers below.

(446) TABLE-US-00022 Forwardprimer: (SEQIDNO:84) 5-CAGAGAAAGGTAGCTGGAGAGC-3 Reverseprimer: (SEQIDNO:85) 5-GTCCATTTCGATTCCGCATAG-3

(447) The above probe was used for hybridization and subsequent detection of probe-DNA hybrids as described in Example 1. The results of the Southern blot analysis confirmed the results of the spore PCR above suggesting that the strains had correctly excised the markers, and that the ku70 gene sequence was no longer disrupted. One of the strains, designated Trichoderma reesei JfyS99-19B4, was arbitrarily selected for expression of different possible combinations of cellulases described herein.

Example 7: Construction of an AA9 (GH61A) Polypeptide Expression Vector pQM35

(448) Plasmid pQM35 was constructed to comprise an AA9 (GH61A) polypeptide expression cassette under control of the Trichoderma reesei cbh2 promoter and terminator. The AA9 polypeptide coding sequence (SEQ ID NO: 7 [DNA sequence] and SEQ ID NO: 8 [amino acid sequence]) was amplified from plasmid pDM286 (WO 2013/028912) using gene-specific forward and reverse primers (1205256 and 1205257) shown below. The Trichoderma reesei cbh2 terminator was amplified from Trichoderma reesei RutC30 genomic DNA using the gene specific forward and reverse primers (1205258 and 1205259) shown below.

(449) TABLE-US-00023 1205256(InF-PeGH61-F): (SEQIDNO:86) ATCACCCTCTGTGTATTGCACCATGCTGTCTTCGACGACTCGC 1205257(InF-PeGH61-R): (SEQIDNO:87) GCCCGGTCACGAAAGCCTTATCGACTTCTTCTAGAACGTCGGC 1205258(InF-TrCbh2Term-F): (SEQIDNO:88) GCCGACGTTCTAGAAGAAGTCGATAAGGCTTTCGTGACCGGGC 1205259(InF-TrCBh2Term-R): (SEQIDNO:89) CAGGTGTCAGTCACCTCTAGTTAATTAACTCGGAGTTGTTATACGCTACT CG

(450) The amplification reaction was composed of 100 ng of template, 1 l of 10 mM dNTP's, 50 pmol of each forward and reverse primer, 1 PHUSION GC Buffer (New England Biolabs, Ipswich, Mass., USA), and 1 unit of PHUSION High-Fidelity Hot Start DNA polymerase in a final volume of 50 l. The amplification reaction was incubated in an EPPENDORF MASTERCYCLER programmed for 1 cycle at 98 C. for 2 minutes; 35 cycles each at 98 C. for 15 seconds, 60 C. for 30 seconds, and 72 C. for 1 minute; and 1 cycle at 72 C. for 10 minutes. The PCR products were separated by 0.7% agarose gel electrophoresis using TAE buffer where a 1 kb AA9 polypeptide gene fragment and a 353 bp Trichoderma reesei cbh2 terminator fragment were excised from the gel and extracted using a NUCLEOSPIN Gel and PCR Clean-Up Kit. Briefly, 2 volumes of Buffer NT1 were added to the gel slice and dissolved for 10 minutes at 50 C. after which the entire solution was transferred to a Kit-supplied centrifugal column. The column was centrifuged at 13,000 rpm for 1 minute, and washed with wash buffer NT3 and recentrifuged. DNA was eluted with 20 l of Kit-supplied elution buffer and centrifuged at 13,000 rpm for 1 minute

(451) The purified AA9 polypeptide coding sequence and Trichoderma reesei cbh2 terminator were combined in a SOE PCR using primer 1205256 and 1205259. The SOE PCR was composed of 10 ng of the 887 bp purified AA9 polypeptide gene fragment amplified from pDM286, 10 ng of the 353 bp purified Trichoderma reesei cbh2 terminator fragment, 1 l of 10 mM dNTP's, 1 PHUSION HF Buffer, and 1 unit of PHUSION High-Fidelity Hot Start DNA Polymerase in a final volume of 45 l. The amplification reaction was incubated in an EPPENDORF MASTERCYCLER programmed for 1 cycle at 98 C. for 2 minutes; and 5 cycles each at 98 C. for 15 seconds, 60 C. for 30 seconds, and 72 C. for 1 minute and 30 seconds. A mixture containing 1 PHUSION H Buffer and 50 pmol of each forward and reverse primer in a total volume of 5 l was added to the SOE PCR and continued for 35 cycles each at 98 C. for 15 seconds, 60 C. for 30 seconds, and 72 C. for 1 minute and 30 seconds; and 1 cycle at 72 C. for 10 minutes. The SOE PCR product was purified using a NUCLEOSPIN Gel and PCR Clean-Up Kit.

(452) The purified SOE PCR product was inserted into Pac I and Nco I digested pAG121 (Example 10) using an IN-FUSION HD Cloning Kit (Clontech, Palo Alto, Calif., USA). The reaction (10 l) was composed of 1IN-FUSION HD enzyme mix, 150 ng of pAG121 digested with Nco I and Pac I, and 57 ng of the purified SOE PCR product. The reaction was incubated for 15 minutes at 50 C. Then 2.5 l of the cloning reaction were transformed into ONE SHOT TOP10 competent cells by addition to a single use tube containing the competent cells and incubating the cells on ice for 5 minutes. The tube was incubated at 42 C. for 30 seconds after which 250 l of SOC medium were added. The tube was then incubated at 37 C. with mixing at 200 rpm for 1 hour and 250 l were transferred to a 150 mm 2XYT+Amp plate and incubated overnight at 37 C. Plasmid DNA was isolated from the resulting transformants using a Plasmid Mini Kit. A plasmid containing the insert with no PCR errors confirmed by DNA sequencing using an Applied Biosystems 377 XL Automated DNA Sequencer and dye-terminator chemistry (Giesecke et al., 1992, supra) was designated pQM35 (FIG. 5).

Example 8: Construction of Plasmid pSMai139

(453) To construct pSMai139, the Humicola insolens endoglucanase V full-length coding region was PCR amplified from pMJ05 (US 2004/0248258) as template with the primers shown below. The underlined portions are a Sph I site and a Hind III site introduced by the Car-F2 sense primer. The bold portion is an Eco RI site introduced by the Car-R2 antisense primer.

(454) TABLE-US-00024 Car-F2senseprimer: (SEQIDNO:90) 5-TATAAGCTTAAGCATGCGTTCCTCCCCCCTC-3 Car-R2antisenseprimer: (SEQIDNO:91) 5-CTGCAGAATTCTACAGGCACTGATGGTACCAG-3

(455) The amplification reaction (50 l) was composed of 1 ThermoPol Reaction Buffer (New England Biolabs, Inc., Ipswich, Mass. USA), 0.3 mM dNTPs, 10 ng of pMJ05 DNA, 0.3 M Car-F2 sense primer, 0.3 M Car-R2 antisense primer, and 2.5 units of VENT DNA polymerase (New England Biolabs, Inc., Ipswich, Mass. USA). The reaction was incubated in an EPPENDORF MASTERCYCLER 5333 epgradient S programmed for 30 cycles each at 94 C. for 30 seconds, 55 C. for 30 seconds, and 72 C. for 60 seconds (15 minute final extension). The reaction product was isolated by 1.0% agarose gel electrophoresis using TAE buffer where a 900 bp product band was excised from the gel and purified using a QIAQUICK Gel Extraction Kit (Example 1). The 900 bp PCR fragment was then digested with Eco RI and Hind III and subjected to a QIAQUICK PCR Purification Kit (Example 4). Plasmid pMJ05 was digested with Eco RI and Hind III, isolated by 0.7% agarose gel electrophoresis using TAE buffer, excised from the gel, and extracted using a QIAQUICK Gel Extraction Kit (Example 1).

(456) The 900 bp Eco RI and Hind III digested PCR fragment were ligated into Eco RI and Hind III digested pMJ05 using T4 DNA ligase (Roche, Indianapolis, Ind., USA). The ligation reaction was composed of 50 ng of the Eco RI and Hind III digested pMJ05, 33 ng of the Eco RI and Hind III digested 0.9 kb PCR fragment, 1 Ligase Buffer (Roche, Indianapolis, Ind., USA), and 2 units of T4 DNA ligase in a final volume of 20 l. The reaction was incubated at 15 C. for 17 hours and 2 l of the reaction were transformed into ONE SHOT TOP10 competent cells by addition to a single use tube containing the competent cells and incubating the cells on ice for 5 minutes. The tube was incubated at 42 C. for 30 seconds after which 250 l of SOC medium were added. The tube was then incubated at 37 C. with mixing at 200 rpm for 1 hour and 250 l were transferred to a 150 mm 2XYT+Amp plate and incubated overnight at 37 C. The resulting transformants were screened by restriction digestion analysis with Sph I and Bam HI to determine the presence and orientation of the insert and positive clones were sequenced using an Applied Biosystems 377 XL Automated DNA Sequencer and dye-terminator chemistry (Giesecke et al., 1992, supra). A clone containing the Humicola insolens endoglucanase V coding region with no PCR errors was designated pSMai139 (FIG. 6).

Example 9: Construction of Plasmid pSMai143

(457) Plasmid pSMai143 was constructed by amplifying 620 bp of the Trichoderma reesei cellobiohydrolase Cel6A promoter from Trichoderma reesei RutC30 genomic DNA using primers 994148 and 994149 shown below. The underlined portion is a Sal I site introduced by primer 994148. The bold portion is a CAT sequence introduced by primer 994149.

(458) TABLE-US-00025 Primer994148: (SEQIDNO:92) 5-ACGCGTCGACGAATTCTAGGCTAGGTATGCGAGGCA-3 Primer994149: (SEQIDNO:93) 5-CATGGTGCAATACACAGAGGGTG-3

(459) The amplification reaction (50 l) was composed of 1 ThermoPol Reaction Buffer, 0.3 mM dNTPs, 100 ng of Trichoderma reesei RutC30 genomic DNA, 0.3 M 994148 sense primer, 0.3 M 994149 antisense primer, and 2.5 units of Vent DNA polymerase. The reactions were incubated in an EPPENDORF MASTERCYCLER 5333 epgradient S programmed for 30 cycles each at 94 C. for 60 seconds, 55 C. for 60 seconds, and 72 C. for 60 seconds (15 minute final extension). The reaction products were isolated by 1.0% agarose gel electrophoresis using TAE buffer where a 620 bp product band was excised from the gel and purified using a QIAQUICK Gel Extraction Kit (Example 1).

(460) Plasmid pSMai139 was digested with Sph I and the 3-protruding end was blunted with T4 DNA polymerase followed by digestion with Sal I. The digested DNA was isolated by 0.7% agarose gel electrophoresis using TAE buffer, excised from the gel, and extracted using a QIAQUICK Gel Extraction Kit (Example 1).

(461) The 620 bp Sal I digested PCR fragment was ligated into Sph I and Sal I digested pSMai139 using T4 DNA ligase. The ligation reaction was composed of 50 ng of the Sph I and Sal I digested pSMai139, 22 ng of the Sal I digested 0.62 kb PCR fragment, 1 Ligase Buffer, and 2 units of T4 DNA ligase in a final volume of 20 l. The reaction was incubated at 15 C. for 17 hours and 2 l of the reaction were transformed into ONE SHOT TOP10 competent cells by addition to a single use tube containing the competent cells and incubating the cells on ice for 5 minutes. The tube was incubated at 42 C. for 30 seconds after which 250 l of SOC medium were added. The tube was then incubated at 37 C. with mixing at 200 rpm for 1 hour and 250 l were transferred to a 150 mm 2XYT+Amp plate and incubated overnight at 37 C. The resulting transformants were screened by restriction digestion analysis with Eco RI to determine the presence and orientation of the insert and positive clones were sequenced. One clone containing the Trichoderma reesei cbh2 promoter with no PCR errors was designated pSMai143 (FIG. 7).

Example 10: Construction of Plasmid pAG121

(462) Expression vector pAG121 with an Nco I restriction site was constructed by performing site-directed mutagenesis on pSMai143 (Example 9) using a QUIKCHANGE Site-Directed Mutagenesis Kit (Stratagene, La Jolla, Calif., USA) using the primers shown below. The mutagenesis was performed according to manufacturer's recommendations using 20 ng of plasmid pAG121 and 12.5 M of the primers shown below in a final volume of 50 l.

(463) TABLE-US-00026 Smai143SDMFwd: (SEQIDNO:94) gtgtattgcaccatggcgttcctcccccctcc Smai143SDMRev: (SEQIDNO:95) ggaggggggaggaacgccatggtgcaataca

(464) The resulting variant plasmid pAG121 was prepared using a BIOROBOT 9600. The variant plasmid construct was sequenced using an Applied Biosystems 3130xl Genetic Analyzer to verify the changes.

(465) Plasmid pAG122 was constructed to comprise a beta-xylosidase coding sequence (SEQ ID NO: 13 [DNA sequence] and SEQ ID NO: 14 [amino acid sequence]) under the control of the T. reesei cbh2 gene promoter and T. reesei cbh1 gene terminator.

(466) Two synthetic oligonucleotide primers shown below were designed to PCR amplify the beta-xylosidase coding sequence (SEQ ID NO: 13) contained in plasmid pENI191. An IN-FUSION Advantage PCR Cloning Kit (Clontech Laboratories, Inc., Mountain View, Calif., USA) was used to clone the fragment directly into the expression vector pAG121. Bold letters represent coding sequence. The remaining sequence is homologous to the insertion sites of pAG121.

(467) TABLE-US-00027 Forwardprimer: (SEQIDNO:96) 5-CCCTCTGTGTATTGCACCATGATGACTCCCACGGCGAT-3 Reverseprimer: (SEQIDNO:97) 5-GATCTGCGGCCGCGAATTTTATTGCTGCAGCACCCCCG-3

(468) Fifty picomoles of each of the primers above were used in a PCR composed of 10 ng of pENI191, 1 EXPAND High Fidelity PCR buffer with MgCl.sub.2 (Roche Applied Science, Penzberg, Germany), 0.25 mM each of dATP, dTTP, dGTP, and dCTP, and 2.6 units of EXPAND High Fidelity Enzyme Mix (Roche Applied Science, Penzberg, Germany) in a final volume of 50 l. The amplification was performed using an EPPENDORF MASTERCYCLER 5333 epgradient S programmed for 1 cycle at 94 C. for 2 minutes; 30 cycles each at 94 C. for 15 seconds, 60.5 C. for 30 seconds, and 72 C. for 2 minutes; and a final elongation at 72 C. for 15 minutes. The heat block then went to a 4 C. soak cycle. The reaction products were isolated by 1% agarose gel electrophoresis using TAE buffer where an approximately 2.4 kb product band was observed on the gel. The PCR product was purified using a MINELUTE Gel Extraction Kit. Briefly, 3 volumes of Kit-supplied buffer QG were added to a gel slice and dissolved at 50 C. for approximately 10 minutes. The dissolved gel slice was applied to a Kit-supplied spin column and centrifuged at 13,000 rpm for 1 minute. The column was washed with 750 l of Kit-supplied buffer PE and then re-centrifuged. DNA was eluted with 10 l of Kit-supplied buffer EB. Plasmid pAG121 was digested with Nco I and Kpn I and isolated by 1.0% agarose gel electrophoresis using TAE buffer where a 6.6 kb band was excised from the gel and extracted using a QIAQUICK Gel Extraction Kit (Example 1).

(469) The 2.4 kb gene fragment and the 6.6 kb digested vector were ligated together using an IN-FUSION Advantage PCR Cloning Kit resulting in pAG122. The reaction (20 l) was composed of 1IN-FUSION Reaction Buffer (Clontech Laboratories, Inc., Mountain View, Calif., USA), 1BSA, 1 l of IN-FUSION enzyme (Clontech Laboratories, Inc., Mountain View, Calif., USA) (diluted 1:10), 100 ng of the gel-purified Nco I/Pac I digested pMJ09, and 42 ng of the purified 1.05 kb PCR product. The reaction was incubated at 37 C. for 15 minutes followed by 50 C. for 15 minutes. After diluting the reaction mix with 50 l of TE buffer, 2.5 l of the reaction was transformed into E. coli XL10 SOLOPACK Gold Supercompetent cells (Stratagene, La Jolla, Calif., USA). The E. coli transformation reactions were spread onto 2XYT plus ampicillin plates. Plasmid DNA was prepared using a BIOROBOT 9600. The beta-xylosidase coding sequence insert was confirmed in one plasmid by DNA sequencing using an Applied Biosystems 377 XL Automated DNA Sequencer and dye-terminator chemistry (Giesecke et al., 1992, supra). The plasmid was designated pAG122 (FIG. 8).

Example 11: Construction of a Xylanase Expression Vector pAgJg131

(470) Plasmid pAgJg131 was constructed to comprise the Trichoderma reesei cellobiohydrolase 1 gene promoter and terminator and a xylanase coding sequence (SEQ ID NO: 9 [DNA sequence] and SEQ ID NO: 10 [amino acid sequence]). Two synthetic oligonucleotide primers shown below were designed to PCR amplify the xylanase gene from plasmid P24F62 (WO 2013/019827) and introduce flanking regions for insertion into expression vector pMJ09 (WO 05/056772). Bold letters represent coding sequence and the remaining sequence is homologous to the insertion sites of plasmid pMJ09.

(471) TABLE-US-00028 ForwardPrimer: (SEQIDNO:98) 5-CCGCGGACTGCGCACCATGGTCCATCTTTCTTCCCT-3 ReversePrimer: (SEQIDNO:99) 5-TTCGCCACGGAGCTTATTACAGGCACTGGTAGTAGT-3

(472) The amplification reaction was composed of 64.2 ng of plasmid P24F62, 10 l of 10 mM dNTP's, 50 pmol of each forward and reverse primer, 1 PHUSION GC Buffer, and 2 units of PHUSION High-Fidelity Hot Start DNA polymerase in a final volume of 50 l. The amplification reaction was incubated in an EPPENDORF MASTERCYCLER programmed for 1 cycle at 98 C. for 30 seconds; 30 cycles each at 98 C. for 10 seconds, 61 C. for 10 seconds, and 72 C. for 45 seconds; and 1 cycle at 72 C. for 10 minutes. PCR products were separated by 1% agarose gel electrophoresis using TAE buffer where a 1.5 kb fragment was excised from the gel and extracted using a QIAQUICK Gel Extraction Kit (Example 1).

(473) The fragment was then cloned into pMJ09 using an IN-FUSION HD Cloning Kit. Plasmid pMJ09 was digested with Nco I and Pac I. The vector was isolated by 1% agarose gel electrophoresis using TAE buffer where a 7.2 kb fragment was excised from the gel and extracted using a QIAQUICK Gel Extraction Kit (Example 1). The 1.5 kb gene fragment and the digested vector were ligated together in a reaction resulting in the expression plasmid pAgJg131 in which transcription of the xylanase gene was under the control of the T. reesei cbh1 promoter. The ligation reaction (10 l) was composed of 1IN-FUSION HD enzyme mix (Clontech, Palo Alto, Calif., USA), 213 ng of pMJ09 digested with Nco I and Pac I, and 106 ng of the xylanase purified PCR product. The reaction was incubated for 15 minutes at 50 C. A 2.5 l volume of the cloning reaction was used to transform ONE SHOT TOP10 competent cells by addition to a single use tube containing the competent cells and incubating the cells on ice for 5 minutes. The tube was incubated at 42 C. for 30 seconds after which 250 l of SOC medium were added. The tube was then incubated at 37 C. with mixing at 200 rpm for 1 hour and 250 l were transferred to a 150 mm 2XYT+Amp plate and incubated overnight at 37 C. Plasmid DNA was isolated from the resulting transformants using a QIAprep Mini Prep Kit (QIAGEN Inc., Valencia, Calif., USA). The insert was confirmed by DNA sequencing using an Applied Biosystems 377 XL Automated DNA Sequencer and dye-terminator chemistry (Giesecke et al., 1992, supra). The resulting plasmid was designated pAgJg131 (FIG. 9).

Example 12: Construction of Catalase Expression Vector pLAQ564

(474) A DNA sequence was designed to encode the amino acid sequence of a catalase (SEQ ID NO: 33 [DNA sequence] and SEQ ID NO: 34 [amino acid sequence]). The gene was specifically designed for expression in Aspergillus oryzae and a restriction site was added at either end to ease cloning. The DNA was subsequently synthesized by a commercial provider.

(475) The synthetic gene (SEQ ID NO: 100) encoding the catalase was ligated into the multiple cloning site of plasmid pENI2516 (U.S. Pat. No. 7,871,800) as a Not I-Xho I fragment to generate construct pLAQ564 using T4 DNA ligase. The constructed plasmid was transformed into ONE SHOT TOP10 competent cells. Plasmid DNA was isolated using a QIAprep Mini Prep Kit. The insert was confirmed by DNA sequencing using an Applied Biosystems 377 XL Automated DNA Sequencer and dye-terminator chemistry (Giesecke et al., 1992, supra). The resulting plasmid was designated pLAQ564 (FIG. 10).

Example 13: Construction of Catalase Expression Vector pSaMe-TaCat

(476) Plasmid pSaMe-TaCat was constructed to comprise the catalase coding sequence of SEQ ID NO: 33 operably linked to the Trichoderma reesei cellobiohydrolase I gene promoter and terminator. Two synthetic oligonucleotide primers shown below were designed to PCR amplify the catalase gene from plasmid pLAQ564 and introduce flanking regions for insertion into expression vector pMJ09 (WO 05/056772). Bold letters represent coding sequence and the remaining sequence is homologous to the insertion sites of pMJ09.

(477) TABLE-US-00029 ForwardPrimer: (SEQIDNO:101) 5-CGGACTGCGCACCATGCGAGCAATCGGCTTGTT-3 ReversePrimer: (SEQIDNO:102) 5-TCGCCACGGAGCTTATCACTCGGCGTCTTCGTCGA-3

(478) The amplification reaction was composed of 50 ng of plasmid pLAQ564, 200 m dNTP's, 0.4 M primers, 1 PHUSION GC Buffer, and 2 units of PHUSION DNA polymerase in a final volume of 50 l. The reaction was incubated in an EPPENDORF MASTERCYCLER programmed for 1 cycle at 98 C. for 30 seconds; 30 cycles each at 98 C. for 15 seconds, 60 C. for 15 seconds, and 72 C. for 45 seconds; and 1 cycle at 72 C. for 7 minutes. PCR products were separated by 1% agarose gel electrophoresis using TAE buffer where a 2.2 kb fragment was excised from the gel and extracted using a NUCLEOSPIN Extract II Kit (Example 2).

(479) The fragment was then cloned into pMJ09 using an IN-FUSION HD Cloning Kit. The vector was digested with Nco I and Pac I and purified by agarose gel electrophoresis as described above. The 2.2 kb gene fragment and the digested vector were ligated together in a reaction resulting in the expression plasmid pSaMe-TaCat in which transcription of the catalase gene was under the control of the T. reesei cbh1 promoter. The ligation reaction (10 l) was composed of 1IN-FUSION HD enzyme mix, 200 ng of pMJ09 digested with Nco I and Pac I, and 122 ng of the catalase purified PCR product. The reaction was incubated for 15 minutes at 37 C. and 15 minutes at 50 C. To the reaction 40 l of TE were added. Two l were used to transform ONE SHOT TOP10 competent cells by addition to a single use tube containing the competent cells and incubating the cells on ice for 5 minutes. The tube was incubated at 42 C. for 30 seconds after which 250 l of SOC medium were added. The tube was then incubated at 37 C. with mixing at 200 rpm for 1 hour and 250 l were transferred to a 150 mm 2XYT+Amp plate and incubated overnight at 37 C. Plasmid DNA was isolated from the resulting transformants using a BIOROBOT 9600. The insert was confirmed by DNA sequencing using an Applied Biosystems 377 XL Automated DNA Sequencer and dye-terminator chemistry (Giesecke et al., 1992, supra). The resulting plasmid was designated pSaMe-TaCat (FIG. 11).

Example 14: Construction of Beta-Glucosidase Expression Vectors

(480) Plasmid pEJG107 is described in WO 05/047499 and comprises a beta-glucosidase coding sequence (SEQ ID NO: 5 [DNA sequence] and SEQ ID NO: 6 [amino acid sequence]) operably linked to the T. reesei cbh1 gene promoter and terminator. Plasmid pDFng133-3 is described in WO 2013028912 and comprises a beta-glucosidase variant coding sequence (SEQ ID NO: 35 [DNA sequence] and SEQ ID NO: 36 [amino acid sequence]) operably linked to the T. reesei cbh1 gene promoter and terminator.

Example 15: Construction of Plasmid pSaMe-TsGH10

(481) Plasmid pSaMe-TsGH10 was constructed to comprise a GH10 xylanase coding sequence (SEQ ID NO: 11 [DNA sequence] and SEQ ID NO: 12 [amino acid sequence]) under the control of the Trichoderma reesei cellobiohydrolase I gene promoter and terminator. Two synthetic oligonucleotide primers shown below were designed to PCR amplify the GH10 coding sequence from plasmid pDAU81#5 (WO 2011/057083) and introduce flanking regions for insertion into expression vector pMJ09 (WO 2005/056772). Bold letters represent coding sequence and the remaining sequence is homologous to the insertion sites of pMJ09.

(482) TABLE-US-00030 ForwardPrimer: (SEQIDNO:103) 5-CGGACTGCGCACCATGCGTACCTTCTCGTCTCTT-3 ReversePrimer: (SEQIDNO:104) 5-TCGCCACGGAGCTTATCAAGCCGCAAGAGCAGACG-3

(483) Cloning of the xylanase followed the overall expression cloning protocol described below:

(484) Fifty picomoles of each of the primers above were used in a PCR composed of 50 ng of plasmid DNA from pDAU81#5, 1 l of a 10 mM blend of dATP, dTTP, dGTP, and dCTP, 5 l of 10 PLATINUM Pfx DNA Polymerase Buffer (Invitrogen, Carlsbad, Calif., USA), and 1 unit of PLATINUM Pfx DNA Polymerase (Invitrogen, Carlsbad, Calif., USA) in a final volume of 50 l. An EPPENDORF MASTERCYCLER 5333 (Eppendorf Scientific, Inc., Westbury, N.Y., USA) was used to amplify the DNA fragment programmed for 1 cycle at 94 C. for 2 minutes; and 30 cycles each at 94 C. for 15 seconds, 55 C. for 30 seconds, and 68 C. for 1 minute. After the 30 cycles, the reaction was incubated at 72 C. for 10 minutes and then cooled to 4 C. until further processing.

(485) The reaction products were isolated by 1.0% agarose gel electrophoresis using TAE buffer where a 1.2 kb product band was excised from the gel and purified using a QIAQUICK Gel Extraction Kit.

(486) The 1.2 kb fragment was then cloned into pMJ09 using an IN-FUSION Advantage PCR Cloning Kit. The vector was digested with Nco I and Pac I and purified by agarose gel electrophoresis as described above. The gene fragment and the digested vector were ligated together in a reaction resulting in the expression plasmid pSaMe-TsGH10 in which transcription of the xylanase coding sequence of SEQ ID NO: 11 was under the control of the T. reesei cbh1 gene promoter and terminator. The ligation reaction (50 l) was composed of 1IN-FUSION Reaction Buffer, 1BSA, 1 l of IN-FUSION enzyme (diluted 1:10), 100 ng of pMJ09 digested with Nco I and Pac I, and 100 ng of the xylanase purified PCR product. The reaction was incubated at room temperature for 30 minutes. One l of the reaction was used to transform E. coli XL10 SOLOPACK Gold cells. Transformants were selected on LB+Amp plates. An E. coli transformant containing pSaMe-TsGH10 was detected by restriction enzyme digestion with Nco I and Kpn I and plasmid DNA was prepared using a BIOROBOT 9600. DNA sequencing of the xylanase coding sequence from pSaMe-TsGH10 was performed using an Applied Biosystems 3130xl Genetic Analyzer and dye-terminator chemistry (Giesecke et al., 1992, supra) to confirm the correct sequence and completion of construct pSaMe-TsGH10.

Example 16: Construction of Recombinant Filamentous Fungal Strains for Producing Enzyme Compositions

(487) Production strains for the enzyme compositions of the present invention are constructed by transforming one or more filamentous fungal host cells, e.g., Trichoderma reesei JfyS99-19B4 (Example 6), with one or more of the nucleic acid constructs and/or expression vectors described herein. Protoplast preparation and transformation are performed by any method known in the art such as one of the methods described herein involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall. Transformants are selected using a suitable selective medium, e.g., COVE plates for amdS selection. The transformants are then grown in a suitable enzyme production medium, e.g., CIM, and supernatants of the culture broths are assayed for enzyme activity and analyzed by SDS-PAGE using the methods described herein. The strains are then fermented in a suitable enzyme production medium to produce the enzyme compositions.

Example 17: Determination of the BCA-Equivalent Protein Composition of Monocomponents, Broths and Mixtures of Broths Achieved by BCA Assay and Stain Free Gel Quantitation

(488) Samples of protein broths, mixtures of protein broths, and monocomponent proteins were quantified by BCA protein assays and by gel electrophoresis. First, all samples were desalted to remove interfering salts and buffers. This was achieved by equilibration of ECONOPAC 10DG gravity flow desalt columns (Bio-Rad Laboratories, Inc., Hercules, Calif., USA) with 50 mM sodium acetate pH 5 as column buffer, followed by application of 3 ml of solution containing the protein of interest followed by capture of the desalted sample by elution with 4 ml of column buffer. Diluted samples were measured using a BCA Protein Assay Kit (Thermo Fischer Scientific, Waltham, Mass., USA) calibrated by protein standard dilutions of 2.0 mg/mL BSA (Thermo Fischer Scientific, Waltham, Mass., USA). The combined method of desalting and BCA assay is called desalt BCA.

(489) TGX Stain Free or CRITERION Stain Free 8-16% gels (Bio-Rad Laboratories, Inc., Hercules, Calif., USA) were loaded with, for example, 10 g desalted protein from fermentation broths. Additionally molecular weight standards (Bio-Rad Laboratories, Inc., Hercules, Calif., USA; unstained) and dilution series of purified monocomponent standard proteins, measured by desalt BCA, were loaded at between 5 to 0.3125 g per lane. To improve the gel banding resolution, some samples were first deglycosylated by the addition of 0.2 l of Endo Hf (New England Biolabs, Ipswich, Mass., USA) and incubation overnight at 37 C. For these samples 6.7 to 10 g of the broth protein was loaded onto gels. The gels were electrophoresed according to manufacturer's recommendations at 200V until the bromophenol blue dye front reached the bottom of the gel. Gels were rinsed 5 minutes with MilliQ water (Millipore, Billerica, Mass., USA) prior to activation (5 minutes) and scanning in an Image Lab Scanner (Bio-Rad Laboratories, Inc., Hercules, Calif., USA). Image Lab protein band densities were quantified using Image Lab 3.0 software (Bio-Rad Laboratories, Inc., Hercules, Calif., USA), creating a band volume for each identified protein which represented the total integrated Stain Free staining density of that band, and a lane volume which represented the total integrated Stain Free lane gel staining density for that lane. If used, the Stain Free compositional amount for any single protein band was represented by the fractional percentage of that band divided by the total staining in the lane (% Stain Free=band volume/lane volume). For samples where addition of Endo Hf enzyme was made, the band volume for that amount of Endo Hf was subtracted from the lane volume to make an adjusted lane volume that represented the composition without Endo Hf.

(490) Purified monocomponent proteins were used to create band volume vs. BCA protein load response curves where the proteins were added by g as measured by desalt BCA assay and detected as band volume by Stain Free quantitation. For most proteins the ratio of band volume per g protein was approximately 500,000. The response of most proteins required no adjustment as they had an equal ratio of band volume per g protein, within the error of these assays (5%). If a protein showed a significant deviation from this ratio, a calibration curve was made between the protein's band volume and the loaded g protein as measured by BCA. This allowed adjustment of the band volume relative to the lane volume.

(491) For example, if enzyme Q with band volume of 320,000 in a lane with volume 2,000,000 shows a ratio of band volume per g BCA loaded protein Q of 400,000 (ths the expected value of 500,000 seen in Stain Free for typical proteins), the band volume for enzyme Q in the quantitation should be multiplied by 5/4 to predict the correct BCA-equivalent amount (to an adjusted band volume of 400,000), and the lane volume should be increased by th of the band volume for enzyme Q (2,000,000+*320,000=2,080,000, the Adjusted Lane volume). This leads to an adjusted BCA-equivalent compositional content for protein Q of 400,000/2,080,000=19.2%.

(492) Similarly, if enzyme Z showed a ratio of band volume per g BCA protein of 600,000 (6/5ths the expected value), the band volume for enzyme Z should be multiplied by to predict the correct BCA equivalent amount, and the lane volume should be decreased by th of the band volume for enzyme Z.

(493) When the adjustments for BCA-equivalent band volume and lane volume were made for all proteins for which there were purified monocomponents, corrected estimates of BCA-equivalent compositions for all broths can be calculated.

Example 18: Pretreated Corn Stover Hydrolysis Assay

(494) Corn stover was pretreated at U.S. Department of Energy National Renewable Energy Laboratory (NREL) using 4% sulfuric acid (based on biomass) at 190 C. for 6 minutes. The water insoluble solids in the pretreated corn stover (PCS) were composed 60.9% of solids and contained 59.4% cellulose, 5.3% hemicellulose and 27.0% lignin. Cellulose and hemicellulose were determined by a two-stage sulfuric acid hydrolysis with subsequent analysis of sugars by high performance liquid chromatography using NREL Standard Analytical Procedure #002. Lignin was determined gravimetrically after hydrolyzing the cellulose and hemicellulose fractions with sulfuric acid using NREL Standard Analytical Procedure #003.

(495) Hydrolysis of PCS was conducted using 50 ml round-bottom centrifuge tubes (Nalgene, Rochester, N.Y., USA) in a total reaction mass of 19 g. The pH of unwashed PCS slurry was adjusted to either 4.75 or 5.0 with sodium hydroxide and 15.5 g of slurry was placed in centrifuge tubes. Enzyme compositions were prepared and added to the PCS slurry in the tubes along with water and buffer to give hydrolysis reaction conditions of 20% total solids, 50 mM sodium citrate, and various protein loadings (expressed as mg protein per gram of cellulose). All enzyme loadings were evaluated in duplicate. Tubes were capped and placed in a rotisserie incubator at a specific temperature for 5 days (120 hours).

(496) Following hydrolysis, samples were filtered using a 0.22 m MULTISCREEN 96-well filter plate (Millipore, Bedford, Mass., USA) and filtrates were frozen at 20 C. if not analyzed immediately. Filtrates were diluted 10-fold by volume in 5 mM H.sub.2SO.sub.4, and the sugar concentrations of the diluted filtrates were measured using an HPLC system (1100 Series LC System, Agilent Technologies Inc., Palo Alto, Calif.) equipped with a HyperREZ XP; Carbohydrate H+; particle size 8 m with 8% cross linkage (7.7300 mm) (Thermo Scientific, Waltham, Mass. USA), 0.2 mm in line filter, an automated well-plate sampler, a gradient pump and a refractive index detector. The mobile phase used was 5 mM sulfuric acid at a flow rate of 1.4 ml/min. Refractive index peaks corresponding to cellobiose, glucose, xylose, arabinose, xylitol, glycerol, and acetate were integrated and quantitated versus calibration standards at different concentrations.

(497) All HPLC data processing was performed using MICROSOFT EXCEL software (Microsoft, Richland, Wash., USA). For each hydrolysis sample, the measured glucose concentration was adjusted for the appropriate dilution factor, and the net concentration of enzymatically-produced glucose was determined by subtracting the background glucose concentration in unwashed PCS reactions at zero time points from the glucose concentration in samples after hydrolysis. The overall glucan conversions were calculated based on sugars released from enzymatic hydrolysis and biomass composition of the pretreated feedstock using a method published by Zhu et al. (Bioresource Technol. 102(3): 2897-2903). Duplicate data points were averaged and standard deviation was calculated.

Example 19: Comparison of Enzyme Mix 1 to Cellic CTec2 in the Hydrolysis of Pretreated Corn Stover

(498) An enzyme composition comprising a cellobiohydrolase I of SEQ ID NO: 2, a cellobiohydrolase II of SEQ ID NO: 4, an endoglucanase I of SEQ ID NO: 16, an endoglucanase II of SEQ ID NO: 18, a beta-glucosidase variant of SEQ ID NO: 36, an AA9 (GH61) polypeptide having cellulolytic enhancing activity of SEQ ID NO: 8, a catalase of SEQ ID NO: 34, a GH10 xylanase of SEQ ID NO: 10, and a beta-xylosidase of SEQ ID NO: 14 (designated enzyme mix 1) was compared to a commercial enzyme Cellic CTec2 (Novozymes A/S, Bagsvaerd, Denmark). The enzyme compositions were compared on unwashed PCS at 20% TS according to Example 18 with the optimal conditions for each blend. Enzyme mix 1 was hydrolyzed at 55 C. and pH 4.75 whereas Cellic CTec2 was hydrolyzed at 50 C. and pH 5.0 for 5 days. All compositions were used at 3, 6, 10 and 20 mg protein per g cellulose. The protein concentration of the enzyme compositions was determined using a Microplate BOA Protein Assay Kit (Thermo Fischer Scientific, Waltham, Mass., USA) in which bovine serum albumin was used as a protein standard.

(499) The results shown in FIG. 12 demonstrated that enzyme mix 1 had significantly higher hydrolysis than the commercial enzyme Cellic CTec2 at all enzyme loadings.

Example 20: Comparison of Enzyme Mix 2 to Cellic CTec2 in the Hydrolysis of Pretreated Corn Stover

(500) An enzyme composition comprising a cellobiohydrolase I of SEQ ID NO: 2, a cellobiohydrolase II of SEQ ID NO: 4, an endoglucanase I of SEQ ID NO: 16, an endoglucanase II of SEQ ID NO: 18, a beta-glucosidase variant of SEQ ID NO: 36, an AA9 (GH61) polypeptide having cellulolytic enhancing activity of SEQ ID NO: 8, a GH10 xylanase of SEQ ID NO: 10, and a beta-xylosidase of SEQ ID NO: 14 (designated enzyme mix 2) was compared to a commercial enzyme Cellic CTec2. The enzyme compositions were compared on unwashed PCS at 20% TS according to Example 18 with the optimal conditions for each blend. Enzyme mix 1 was hydrolyzed at 55 C. and pH 4.75 whereas Cellic CTec2 was hydrolyzed at 50 C. and pH 5.0 for 5 days. All compositions were used at 3, 6, 10 and 20 mg protein per g cellulose. The protein concentration of the enzyme compositions was determined using a Microplate BCA Protein Assay Kit in which bovine serum albumin was used as a protein standard.

(501) The results shown in FIG. 13 demonstrated that enzyme mix 2 had significantly higher hydrolysis than the commercial enzyme Cellic CTec2 at all enzyme loadings.

(502) The present invention is further described by the following numbered paragraphs:

(503) [1] An enzyme composition, comprising: (A) (i) a cellobiohydrolase I, (ii) a cellobiohydrolase II, and (iii) at least one enzyme selected from the group consisting of a beta-glucosidase or a variant thereof, an AA9 polypeptide having cellulolytic enhancing activity, a GH10 xylanase, and a beta-xylosidase; (B) (i) a GH10 xylanase and (ii) a beta-xylosidase; or (C) (i) a cellobiohydrolase I, (ii) a cellobiohydrolase II, (iii) a GH10 xylanase, and (iv) a beta-xylosidase;

(504) wherein the cellobiohydrolase I is selected from the group consisting of: (i) a cellobiohydrolase I comprising or consisting of the mature polypeptide of SEQ ID NO: 2; (ii) a cellobiohydrolase I comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 2; (iii) a cellobiohydrolase I encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 1; and (iv) a cellobiohydrolase I encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 1 or the full-length complement thereof;

(505) wherein the cellobiohydrolase II is selected from the group consisting of: (i) a cellobiohydrolase II comprising or consisting of the mature polypeptide of SEQ ID NO: 4; (ii) a cellobiohydrolase II comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 4; (iii) a cellobiohydrolase II encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 3; and (iv) a cellobiohydrolase II encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 3 or the full-length complement thereof;

(506) wherein the beta-glucosidase is selected from the group consisting of: (i) a beta-glucosidase comprising or consisting of the mature polypeptide of SEQ ID NO: 6; (ii) a beta-glucosidase comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 6; (iii) a beta-glucosidase encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 5; and (iv) a beta-glucosidase encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 5 or the full-length complement thereof;

(507) wherein the xylanase is selected from the group consisting of: (i) a xylanase comprising or consisting of the mature polypeptide of SEQ ID NO: 10 or the mature polypeptide of SEQ ID NO: 12; (ii) a xylanase comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 10 or the mature polypeptide of SEQ ID NO: 12; (iii) a xylanase encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 9 or the mature polypeptide coding sequence of SEQ ID NO: 11; and (iv) a xylanase encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 9 or the mature polypeptide coding sequence of SEQ ID NO: 11; or the full-length complement thereof; and

(508) wherein the beta-xylosidase is selected from the group consisting of: (i) a beta-xylosidase comprising or consisting of the mature polypeptide of SEQ ID NO: 14; (ii) a beta-xylosidase comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 14; (iii) a beta-xylosidase encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 13; and (iv) a beta-xylosidase encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 13 or the full-length complement thereof.

(509) [2] The enzyme composition of paragraph 1, wherein the AA9 polypeptide is any AA9 polypeptide having cellulolytic enhancing activity.

(510) [3] The enzyme composition of paragraph 1 or 2, wherein the AA9 polypeptide having cellulolytic enhancing activity is selected from the group consisting of: (i) an AA9 polypeptide having cellulolytic enhancing activity comprising or consisting of the mature polypeptide of SEQ ID NO: 8; (ii) an AA9 polypeptide having cellulolytic enhancing activity comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 8; (iii) an AA9 polypeptide having cellulolytic enhancing activity encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 7; and (iv) an AA9 polypeptide having cellulolytic enhancing activity encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 7 or the full-length complement thereof.

(511) [4] The enzyme composition of any of paragraphs 1-3, wherein the beta-glucosidase variant comprises a substitution at one or more positions corresponding to positions 100, 283, 456, and 512 of the full-length polypeptide of SEQ ID NO: 6 or the mature polypeptide thereof, wherein the variant has beta-glucosidase activity.

(512) [5] The enzyme composition of any of paragraphs 1-4, wherein the parent beta-glucosidase of the variant is (a) a polypeptide comprising or consisting of the mature polypeptide of SEQ ID NO: 6; (b) a polypeptide having at least 80% sequence identity to the mature polypeptide of SEQ ID NO: 6; (c) a polypeptide encoded by a polynucleotide that hybridizes under high or very high stringency conditions with (i) the mature polypeptide coding sequence of SEQ ID NO: 5, (ii) the cDNA sequence contained in the mature polypeptide coding sequence of SEQ ID NO: 5, or (iii) the full-length complementary strand of (i) or (ii); (d) a polypeptide encoded by a polynucleotide having at least 80% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 5 or the cDNA sequence thereof; or (e) a fragment of the mature polypeptide of SEQ ID NO: 6, which has beta-glucosidase activity.

(513) [6] The enzyme composition of any of paragraphs 1-5, wherein the variant has at least 80%, e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, but less than 100%, sequence identity to the amino acid sequence of the parent beta-glucosidase.

(514) [7] The enzyme composition of any of paragraphs 1-6, wherein the variant has at least 80%, e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, but less than 100% sequence identity to the mature polypeptide of SEQ ID NO: 6.

(515) [8] The enzyme composition of any of paragraphs 1-7, wherein the number of substitutions is 1-4, such as 1, 2, 3, or 4 substitutions.

(516) [9] The enzyme composition of any of paragraphs 1-8, wherein the variant comprises a substitution at a position corresponding to position 100, a substitution at a position corresponding to position 283, a substitution at a position corresponding to position 456, and/or a substitution at a position corresponding to position 512.

(517) [10] The enzyme composition of paragraph 9, wherein the substitution at the position corresponding to position 100 is Asp; the substitution at the position corresponding to position 283 is Gly; the substitution at the position corresponding to position 456 is Glu; and the substitution at the position corresponding to position 512 is Tyr.

(518) [11] The enzyme composition of any of paragraphs 1-10, wherein the variant comprises one or more (e.g., several) substitutions selected from the group consisting of F100D, S283G, N456E, and F512Y.

(519) [12] The enzyme composition of any of paragraphs 1-11, wherein the variant comprises the substitutions F100D+S283G; F100D+N456E; F100D+F512Y; S283G+N456E; S283G+F512Y; N456E+F512Y; F100D+S283G+N456E; F100D+S283G+F512Y; F100D+N456E+F512Y; S283G+N456E+F512Y; or F100D+S283G+N456E+F512Y.

(520) [13] The enzyme composition of any of paragraphs 1-12, wherein the variant comprises or consists of SEQ ID NO: 36 or the mature polypeptide thereof.

(521) [14] The enzyme composition of any of paragraphs 1-13, which comprises the cellobiohydrolase I, the cellobiohydrolase II, and the beta-glucosidase or the variant thereof.

(522) [15] The enzyme composition of any of paragraphs 1-13, which comprises the cellobiohydrolase I, the cellobiohydrolase II, and the AA9 polypeptide having cellulolytic enhancing activity.

(523) [16] The enzyme composition of any of paragraphs 1-13, which comprises the cellobiohydrolase I, the cellobiohydrolase II, and the GH10 xylanase.

(524) [17] The enzyme composition of any of paragraphs 1-13, which comprises the cellobiohydrolase I, the cellobiohydrolase II, and the beta-xylosidase.

(525) [18] The enzyme composition of any of paragraphs 1-13, which comprises the cellobiohydrolase I, the cellobiohydrolase II, the beta-glucosidase or the variant thereof, and the AA9 polypeptide having cellulolytic enhancing activity.

(526) [19] The enzyme composition of any of paragraphs 1-13, which comprises the cellobiohydrolase I, the cellobiohydrolase II, the beta-glucosidase or the variant thereof, and the GH10 xylanase.

(527) [20] The enzyme composition of any of paragraphs 1-13, which comprises the cellobiohydrolase I, the cellobiohydrolase II, the beta-glucosidase or the variant thereof, and the beta-xylosidase.

(528) [21] The enzyme composition of any of paragraphs 1-13, which comprises the cellobiohydrolase I, the cellobiohydrolase II, the AA9 polypeptide having cellulolytic enhancing activity, and the GH10 xylanase.

(529) [22] The enzyme composition of any of paragraphs 1-13, which comprises the cellobiohydrolase I, the cellobiohydrolase II, the AA9 polypeptide having cellulolytic enhancing activity, and the beta-xylosidase.

(530) [23] The enzyme composition of any of paragraphs 1-13, which comprises the cellobiohydrolase I, the cellobiohydrolase II, the GH10 xylanase, and the beta-xylosidase.

(531) [24] The enzyme composition of any of paragraphs 1-13, which comprises the cellobiohydrolase I, the cellobiohydrolase II, the beta-glucosidase or the variant thereof, the AA9 polypeptide having cellulolytic enhancing activity, and the GH10 xylanase.

(532) [25] The enzyme composition of any of paragraphs 1-13, which comprises the cellobiohydrolase I, the cellobiohydrolase II, the beta-glucosidase or the variant thereof, the AA9 polypeptide having cellulolytic enhancing activity, and the beta-xylosidase.

(533) [26] The enzyme composition of any of paragraphs 1-13, which comprises the cellobiohydrolase I, the cellobiohydrolase II, the beta-glucosidase or the variant thereof, the GH10 xylanase, and the beta-xylosidase.

(534) [27] The enzyme composition of any of paragraphs 1-13, which comprises the cellobiohydrolase I, the cellobiohydrolase II, the AA9 polypeptide having cellulolytic enhancing activity, the GH10 xylanase, and the beta-xylosidase.

(535) [28] The enzyme composition of any of paragraphs 1-13, which comprises the cellobiohydrolase I, the cellobiohydrolase II, the beta-glucosidase or the variant thereof, the AA9 polypeptide having cellulolytic enhancing activity, the GH10 xylanase, and the beta-xylosidase.

(536) [29] The enzyme composition of any of paragraphs 1-28, which further comprises one or more enzymes selected from the group consisting of a cellulase, an AA9 polypeptide having cellulolytic enhancing activity, a cellulose inducible protein, a hemicellulase, an esterase, an expansin, a laccase, a ligninolytic enzyme, a pectinase, a catalase, a peroxidase, a protease, and a swollenin.

(537) [30] The enzyme composition of paragraph 29, wherein the cellulase is one or more enzymes selected from the group consisting of an endoglucanase, a cellobiohydrolase, and a beta-glucosidase.

(538) [31] The enzyme composition of paragraph 30, wherein the endoglucanase is an endoglucanase I.

(539) [32] The enzyme composition of paragraph 31, wherein the endoglucanase I is a Trichoderma endoglucanase I.

(540) [33] The enzyme composition of paragraph 32, wherein the Trichoderma endoglucanase I is a Trichoderma reesei endoglucanase I or a homolog thereof.

(541) [34] The enzyme composition of any of paragraphs 31-33, wherein the endoglucanase I is selected from the group consisting of: (i) an endoglucanase I comprising or consisting of the mature polypeptide of SEQ ID NO: 16; (ii) an endoglucanase I comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 16; (iii) an endoglucanase I encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 15; and (iv) an endoglucanase I encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 15 or the full-length complement thereof.

(542) [35] The enzyme composition of paragraph 30, wherein the endoglucanase is an endoglucanase II.

(543) [36] The enzyme composition of paragraph 35, wherein the endoglucanase II is a Trichoderma endoglucanase II.

(544) [37] The enzyme composition of paragraph 36, wherein the Trichoderma endoglucanase II is a Trichoderma reesei endoglucanase II or a homolog thereof.

(545) [38] The enzyme composition of any of paragraphs 35-37, wherein the endoglucanase II is selected from the group consisting of: (i) an endoglucanase II comprising or consisting of the mature polypeptide of SEQ ID NO: 18; (ii) an endoglucanase II comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 18; (iii) an endoglucanase II encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 17; and (iv) an endoglucanase II encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 17 or the full-length complement thereof.

(546) [39] The enzyme composition of paragraph 35, wherein the endoglucanase II is selected from the group consisting of: (i) an endoglucanase II comprising or consisting of the mature polypeptide of SEQ ID NO: 106; (ii) an endoglucanase II comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 106; (iii) an endoglucanase II encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 105; and (iv) an endoglucanase II encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 105 or the full-length complement thereof.

(547) [40] The enzyme composition of paragraph 29, wherein the hemicellulase is one or more enzymes selected from the group consisting of a xylanase, an acetylxylan esterase, a feruloyl esterase, an arabinofuranosidase, a xylosidase, and a glucuronidase.

(548) [41] The enzyme composition of any of paragraphs 1-40, which further comprises a catalase.

(549) [42] The enzyme composition of paragraph 41, wherein the catalase is selected from the group consisting of: (i) a catalase comprising or consisting of the mature polypeptide of SEQ ID NO: 34; (ii) a catalase comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 34; (iii) a catalase encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 33; and (iv) a catalase encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 33 or the full-length complement thereof.

(550) [43] The enzyme composition of any of paragraphs 1-42, which further comprises a Trichoderma whole broth preparation.

(551) [44] The enzyme composition of paragraph 43, wherein the Trichoderma whole broth preparation is a Trichoderma reesei whole broth preparation.

(552) [45] The enzyme composition of any of paragraphs 1-44, which further comprises a Myceliophthora whole broth preparation.

(553) [46] The enzyme composition of paragraph 47, wherein the Myceliophthora whole broth preparation is a Myceliophthora thermophila whole broth preparation.

(554) [47] The enzyme composition of any of paragraphs 1-46, which further comprises a Talaromyces emersonii whole broth preparation.

(555) [48] The enzyme composition of any of paragraphs 1-47, which is a fermentation broth formulation or a cell composition.

(556) [49] A recombinant fungal host cell, comprising polynucleotides encoding an enzyme composition comprising: (A) (i) a cellobiohydrolase I, (ii) a cellobiohydrolase II, and (iii) at least one enzyme selected from the group consisting of a beta-glucosidase or a variant thereof, an AA9 polypeptide having cellulolytic enhancing activity, a GH10 xylanase, and a beta-xylosidase; (B) (i) a GH10 xylanase and (ii) a beta-xylosidase; or (C) (i) a cellobiohydrolase I, (ii) a cellobiohydrolase II, (iii) a GH10 xylanase, and (iv) a beta-xylosidase;

(557) wherein the cellobiohydrolase I is selected from the group consisting of: (i) a cellobiohydrolase I comprising or consisting of the mature polypeptide of SEQ ID NO: 2; (ii) a cellobiohydrolase I comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 2; (iii) a cellobiohydrolase I encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 1; and (iv) a cellobiohydrolase I encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 1 or the full-length complement thereof;

(558) wherein the cellobiohydrolase II is selected from the group consisting of: (i) a cellobiohydrolase II comprising or consisting of the mature polypeptide of SEQ ID NO: 4; (ii) a cellobiohydrolase II comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 4; (iii) a cellobiohydrolase II encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 3; and (iv) a cellobiohydrolase II encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 3 or the full-length complement thereof;

(559) wherein the beta-glucosidase is selected from the group consisting of: (i) a beta-glucosidase comprising or consisting of the mature polypeptide of SEQ ID NO: 6; (ii) a beta-glucosidase comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 6; (iii) a beta-glucosidase encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 5; and (iv) a beta-glucosidase encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 5 or the full-length complement thereof;

(560) wherein the xylanase is selected from the group consisting of: (i) a xylanase comprising or consisting of the mature polypeptide of SEQ ID NO: 10 or the mature polypeptide of SEQ ID NO: 12; (ii) a xylanase comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 10 or the mature polypeptide of SEQ ID NO: 12; (iii) a xylanase encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 9 or the mature polypeptide coding sequence of SEQ ID NO: 11; and (iv) a xylanase encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 9 or the mature polypeptide coding sequence of SEQ ID NO: 11; or the full-length complement thereof; and

(561) wherein the beta-xylosidase is selected from the group consisting of: (i) a beta-xylosidase comprising or consisting of the mature polypeptide of SEQ ID NO: 14; (ii) a beta-xylosidase comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 14; (iii) a beta-xylosidase encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 13; and (iv) a beta-xylosidase encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 13 or the full-length complement thereof.

(562) [50] The recombinant fungal host cell of paragraph 49, wherein the AA9 polypeptide is any AA9 polypeptide having cellulolytic enhancing activity.

(563) [51] The recombinant fungal host cell of paragraph 49 or 50, wherein the AA9 polypeptide having cellulolytic enhancing activity is selected from the group consisting of: (i) an AA9 polypeptide having cellulolytic enhancing activity comprising or consisting of the mature polypeptide of SEQ ID NO: 8; (ii) an AA9 polypeptide having cellulolytic enhancing activity comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 8; (iii) an AA9 polypeptide having cellulolytic enhancing activity encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 7; and (iv) an AA9 polypeptide having cellulolytic enhancing activity encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 7 or the full-length complement thereof.

(564) [52] The recombinant fungal host cell of any of paragraphs 49-51, wherein the beta-glucosidase variant comprises a substitution at one or more positions corresponding to positions 100, 283, 456, and 512 of the full-length polypeptide of SEQ ID NO: 6 or the mature polypeptide thereof, wherein the variant has beta-glucosidase activity.

(565) [53] The recombinant fungal host cell of any of paragraphs 49-52, wherein the parent beta-glucosidase of the variant is (a) a polypeptide comprising or consisting of the mature polypeptide of SEQ ID NO: 6; (b) a polypeptide having at least 80% sequence identity to the mature polypeptide of SEQ ID NO: 6; (c) a polypeptide encoded by a polynucleotide that hybridizes under high or very high stringency conditions with (i) the mature polypeptide coding sequence of SEQ ID NO: 5, (ii) the cDNA sequence contained in the mature polypeptide coding sequence of SEQ ID NO: 5, or (iii) the full-length complementary strand of (i) or (ii); (d) a polypeptide encoded by a polynucleotide having at least 80% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 5 or the cDNA sequence thereof; or (e) a fragment of the mature polypeptide of SEQ ID NO: 6, which has beta-glucosidase activity.

(566) [54] The recombinant fungal host cell of any of paragraphs 49-53, wherein the variant has at least 80%, e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, but less than 100%, sequence identity to the amino acid sequence of the parent beta-glucosidase.

(567) [55] The recombinant fungal host cell of any of paragraphs 49-54, wherein the variant has at least 80%, e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, but less than 100% sequence identity to the mature polypeptide of SEQ ID NO: 6.

(568) [56] The recombinant fungal host cell of any of paragraphs 49-55, wherein the number of substitutions is 1-4, such as 1, 2, 3, or 4 substitutions.

(569) [57] The recombinant fungal host cell of any of paragraphs 49-56, wherein the variant comprises a substitution at a position corresponding to position 100, a substitution at a position corresponding to position 283, a substitution at a position corresponding to position 456, and/or a substitution at a position corresponding to position 512.

(570) [58] The recombinant fungal host cell of paragraph 57, wherein the substitution at the position corresponding to position 100 is Asp; the substitution at the position corresponding to position 283 is Gly; the substitution at the position corresponding to position 456 is Glu; and the substitution at the position corresponding to position 512 is Tyr.

(571) [59] The recombinant fungal host cell of any of paragraphs 49-58, wherein the variant comprises one or more (e.g., several) substitutions selected from the group consisting of G142S, Q183R, H266Q, and D703G.

(572) [60] The recombinant fungal host cell of any of paragraphs 49-59, wherein the variant comprises the substitutions F100D+S283G; F100D+N456E; F100D+F512Y; S283G+N456E; S283G+F512Y; N456E+F512Y; F100D+S283G+N456E; F100D+S283G+F512Y; F100D+N456E+F512Y; S283G+N456E+F512Y; or F100D+S283G+N456E+F512Y.

(573) [61] The recombinant fungal host cell of any of paragraphs 49-60, wherein the variant comprises or consists of SEQ ID NO: 36 or the mature polypeptide thereof.

(574) [62] The recombinant fungal host cell of any of paragraphs 49-61, which further comprises one or more polynucleotides encoding one or more enzymes selected from the group consisting of a cellulase, an AA9 polypeptide having cellulolytic enhancing activity, a cellulose inducible protein, a hemicellulase, an esterase, an expansin, a laccase, a ligninolytic enzyme, a pectinase, a catalase, a peroxidase, a protease, and a swollenin.

(575) [63] The recombinant fungal host cell of paragraph 62, wherein the cellulase is one or more enzymes selected from the group consisting of an endoglucanase, a cellobiohydrolase, and a beta-glucosidase.

(576) [64] The recombinant fungal host cell of paragraph 63, wherein the endoglucanase is an endoglucanase I.

(577) [65] The recombinant fungal host cell of paragraph 64, wherein the endoglucanase I is a Trichoderma endoglucanase I.

(578) [66] The recombinant fungal host cell of paragraph 65, wherein the Trichoderma endoglucanase I is a Trichoderma reesei endoglucanase I or a homolog thereof.

(579) [67] The recombinant fungal host cell of any of paragraphs 64-66, wherein the endoglucanase I is selected from the group consisting of: (i) an endoglucanase I comprising or consisting of the mature polypeptide of SEQ ID NO: 16; (ii) an endoglucanase I comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 16; (iii) an endoglucanase I encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 15; and (iv) an endoglucanase I encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 15 or the full-length complement thereof.

(580) [68] The recombinant fungal host cell of paragraph 63, wherein the endoglucanase is an endoglucanase II.

(581) [69] The recombinant fungal host cell of paragraph 68, wherein the endoglucanase II is a Trichoderma endoglucanase II.

(582) [70] The recombinant fungal host cell of paragraph 69, wherein the Trichoderma endoglucanase II is a Trichoderma reesei endoglucanase II or a homolog thereof.

(583) [71] The recombinant fungal host cell of any of paragraphs 68-70, wherein the endoglucanase II is selected from the group consisting of: (i) an endoglucanase II comprising or consisting of the mature polypeptide of SEQ ID NO: 18; (ii) an endoglucanase II comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 18; (iii) an endoglucanase II encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 17; and (iv) an endoglucanase II encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 17 or the full-length complement thereof.

(584) [72] The recombinant fungal host cell of any of paragraphs 68-70, wherein the endoglucanase II is selected from the group consisting of: (i) an endoglucanase II comprising or consisting of the mature polypeptide of SEQ ID NO: 106; (ii) an endoglucanase II comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 106; (iii) an endoglucanase II encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 105; and (iv) an endoglucanase II encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 105 or the full-length complement thereof.

(585) [73] The recombinant fungal host cell of paragraph 62, wherein the hemicellulase is one or more enzymes selected from the group consisting of a xylanase, an acetylxylan esterase, a feruloyl esterase, an arabinofuranosidase, a xylosidase, and a glucuronidase.

(586) [74] The recombinant fungal host cell of any of paragraphs 49-73, further comprising a polynucleotide encoding a catalase.

(587) [75] The recombinant fungal host cell of paragraph 74, wherein the catalase is selected from the group consisting of: (i) a catalase comprising or consisting of the mature polypeptide of SEQ ID NO: 34; (ii) a catalase comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 34; (iii) a catalase encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 33; and (iv) a catalase encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 33 or the full-length complement thereof.

(588) [76] The recombinant fungal host cell of any of paragraphs 49-75, wherein one or more of the enzymes are native to the fungal host cell.

(589) [77] The recombinant fungal host cell of any of paragraphs 49-76, wherein one or more of the enzymes are heterologous to the fungal host cell.

(590) [78] The recombinant fungal host cell of any of paragraphs 49-77, which is a Trichoderma cell.

(591) [79] The recombinant fungal host cell of paragraph 78, wherein the Trichoderma cell is selected from the group consisting of Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, and Trichoderma viride.

(592) [80] The recombinant fungal host cell of paragraph 78, which is Trichoderma reesei.

(593) [81] The recombinant fungal host cell of any of paragraphs 49-77, which is a Myceliophthora cell.

(594) [82] The recombinant fungal host cell of paragraph 81, which is a Myceliophthora thermophila cell.

(595) [83] The recombinant fungal host cell of any of paragraphs 49-77, which is a Talaromyces emersonii cell.

(596) [84] The recombinant fungal host cell of any of paragraphs 49-83, wherein one or more of the cellulase genes, one or more of the hemicellulase genes, or a combination thereof, endogenous to the fungal host cell have been inactivated.

(597) [85] The recombinant fungal host cell of paragraph 84, wherein the cellulase gene inactivated is a cellobiohydrolase I gene.

(598) [86] The recombinant fungal host cell of paragraph 85, wherein the cellobiohydrolase I gene encodes a cellobiohydrolase I selected from the group consisting of: (i) a cellobiohydrolase I comprising or consisting of the mature polypeptide of SEQ ID NO: 20; (ii) a cellobiohydrolase I comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 20; (iii) a cellobiohydrolase I encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 19; and (iv) a cellobiohydrolase I encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 19 or the full-length complement thereof.

(599) [87] The recombinant fungal host cell of any of paragraphs 84-86, wherein the cellulase gene inactivated is a cellobiohydrolase II gene.

(600) [88] The recombinant fungal host cell of paragraph 87, wherein the cellobiohydrolase II gene encodes a cellobiohydrolase II selected from the group consisting of: (i) a cellobiohydrolase I comprising or consisting of the mature polypeptide of SEQ ID NO: 22; (ii) a cellobiohydrolase II comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 22; (iii) a cellobiohydrolase II encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 21; and (iv) a cellobiohydrolase II encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 21 or the full-length complement thereof.

(601) [89] The recombinant fungal host cell of any of paragraphs 84-88, wherein the cellulase gene inactivated is a beta-glucosidase gene.

(602) [90] The recombinant fungal host cell of paragraph 89, wherein the beta-glucosidase gene encodes a beta-glucosidase selected from the group consisting of: (i) a beta-glucosidase comprising or consisting of the mature polypeptide of SEQ ID NO: 24; (ii) a beta-glucosidase comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 24; (iii) a beta-glucosidase encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 23; and (iv) a beta-glucosidase encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 23 or the full-length complement thereof.

(603) [91] The recombinant fungal host cell of any of paragraphs 84-90, wherein the hemicellulase gene inactivated is a xylanase I gene.

(604) [92] The recombinant fungal host cell of paragraph 91, wherein the xylanase I gene encodes a xylanase I selected from the group consisting of: (i) a xylanase I comprising or consisting of the mature polypeptide of SEQ ID NO: 26; (ii) a xylanase I comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 26; (iii) a xylanase I encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 25; and (iv) a xylanase I encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 25 or the full-length complement thereof.

(605) [93] The recombinant fungal host cell of any of paragraphs 84-92, wherein the hemicellulase gene inactivated is a xylanase II gene.

(606) [94] The recombinant fungal host cell of paragraph 93, wherein the xylanase II gene encodes a xylanase II selected from the group consisting of: (i) a xylanase II comprising or consisting of the mature polypeptide of SEQ ID NO: 28; (ii) a xylanase II comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 28; (iii) a xylanase II encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 27; and (iv) a xylanase II encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 27 or the full-length complement thereof.

(607) [95] The recombinant fungal host cell of any of paragraphs 84-94, wherein the hemicellulase gene inactivated is a xylanase III gene.

(608) [96] The recombinant fungal host cell of paragraph 95, wherein the xylanase III gene encodes a xylanase III selected from the group consisting of: (i) a xylanase III comprising or consisting of the mature polypeptide of SEQ ID NO: 30; (ii) a xylanase III comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 30; (iii) a xylanase III encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 29; and (iv) a xylanase III encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 29 or the full-length complement thereof.

(609) [97] The recombinant fungal host cell of any of paragraphs 84-96, wherein the hemicellulase gene inactivated is a beta-xylosidase gene.

(610) [98] The recombinant fungal host cell of paragraph 97, wherein the beta-xylosidase gene encodes a beta-xylosidase selected from the group consisting of: (i) a beta-xylosidase comprising or consisting of the mature polypeptide of SEQ ID NO: 32; (ii) a beta-xylosidase comprising or consisting of an amino acid sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the mature polypeptide of SEQ ID NO: 32; (iii) a beta-xylosidase encoded by a polynucleotide comprising or consisting of a nucleotide sequence having at least 70%, e.g., at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 31; and (iv) a beta-xylosidase encoded by a polynucleotide that hybridizes under at least high stringency conditions, e.g., very high stringency conditions, with the mature polypeptide coding sequence of SEQ ID NO: 31 or the full-length complement thereof.

(611) [99] A process of producing an enzyme composition, comprising: (a) cultivating one or more of the recombinant fungal host cells of any of paragraphs 49-98 under conditions conducive for production of the enzyme composition; and optionally (b) recovering the enzyme composition.

(612) [100] A process for degrading a cellulosic or hemicellulosic material, comprising: treating the cellulosic or hemicellulosic material with the enzyme composition of any of paragraphs 1-48.

(613) [101] The process of paragraph 100, wherein the cellulosic or hemicellulosic material is pretreated.

(614) [102] The process of paragraph 100 or 101, further comprising recovering the degraded cellulosic or hemicellulosic material.

(615) [103] The process of paragraph 102, wherein the degraded cellulosic or hemicellulosic material is a sugar.

(616) [104] The process of paragraph 103, wherein the sugar is selected from the group consisting of glucose, xylose, mannose, galactose, and arabinose.

(617) [105] A process for producing a fermentation product, comprising: (a) saccharifying a cellulosic or hemicellulosic material with the enzyme composition of any of paragraphs 1-48; (b) fermenting the saccharified cellulosic or hemicellulosic material with one or more fermenting microorganisms to produce the fermentation product; and (c) recovering the fermentation product from the fermentation.

(618) [106] The process of paragraph 105, wherein the cellulosic or hemicellulosic material is pretreated.

(619) [107] The process of paragraph 105 or 106, wherein steps (a) and (b) are performed simultaneously in a simultaneous saccharification and fermentation.

(620) [108] The process of any of paragraphs 105-107, wherein the fermentation product is an alcohol, an alkane, a cycloalkane, an alkene, an amino acid, a gas, isoprene, a ketone, an organic acid, or polyketide.

(621) [109] A process of fermenting a cellulosic or hemicellulosic material, comprising: fermenting the cellulosic or hemicellulosic material with one or more fermenting microorganisms, wherein the cellulosic or hemicellulosic material is saccharified with the enzyme composition of any of paragraphs 1-48.

(622) [110] The process of paragraph 109, wherein the fermenting of the cellulosic or hemicellulosic material produces a fermentation product.

(623) [111] The process of paragraph 110, further comprising recovering the fermentation product from the fermentation.

(624) [112] The process of paragraph 110 or 111, wherein the fermentation product is an alcohol, an alkane, a cycloalkane, an alkene, an amino acid, a gas, isoprene, a ketone, an organic acid, or polyketide.

(625) [113] The process of any of paragraphs 109-112, wherein the cellulosic or hemicellulosic material is pretreated before saccharification.

(626) The invention described and claimed herein is not to be limited in scope by the specific aspects herein disclosed, since these aspects are intended as illustrations of several aspects of the invention. Any equivalent aspects are intended to be within the scope of this invention. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. In the case of conflict, the present disclosure including definitions will control.