Primer set for detecting trichophyton gene by lamp method, kit including same, and method for detecting trichophyton using same

Abstract

The present invention has an object to provide a simpler and quicker method for diagnosing tinea, method for detecting a Trichophyton, or method for detecting the Trichophyton gene. Use of at least four kinds of specific primers each designed based on a DNA sequence of the Trichophyton gene makes it possible to simply and quickly detect the Trichophyton gene.

Claims

1. A primer set for detecting a Trichophyton gene by a LAMP method, comprising four primers represented by base sequences of SEQ ID NOs: 1 to 4.

2. The primer set according to claim 1, further comprising at least one loop primer.

3. The primer set according to claim 2, wherein the at least one loop primer is represented by base sequence of SEQ ID NO: 5 or 6.

4. The primer set according to claim 1, wherein the Trichophyton gene is of Trichophyton rubrum.

5. A kit for detecting a Trichophyton gene in a sample, comprising the primer set according to claim 1.

6. The kit according to claim 5, wherein the Trichophyton gene is of Trichophyton rubrum.

7. A method for detecting a Trichophyton gene in a sample, the method comprising the steps of: amplifying a nucleic acid in the Trichophyton gene by a LAMP method with the primer set according to claim 1 or the kit according to claim 5; and detecting the amplified nucleic acid.

8. The method according to claim 7, wherein the amplified nucleic acid is detected by turbidity measurement, fluorescence measurement using a fluorescent substance, immunochromatography, nucleic acid hybridization, or electrophoresis.

9. The method according to claim 7, wherein the Trichophyton gene is of Trichophyton rubrum.

Description

BRIEF DESCRIPTION OF DRAWING

(1) FIG. 1 presents a fluorescence measurement result of DNA amplified by a LAMP method using a primer set containing four kinds of oligonucleotides in the present invention.

DESCRIPTION OF EMBODIMENTS

(2) A “Trichophyton” described in the present specification refers to a fungus in a genus such as Trichophyton, Microsporum, or Epidermophyton genera. The dermatophyte may be, for example, T. rubrum, T. mentagrophytes, T. tonsurans, or Microsporum canis, and may be preferably T. rubrum or T. mentagrophytes.

(3) The “Trichophyton gene” described in the present specification refers to a gene characteristic of the genus or species of the Trichophyton, and can be useful for identifying the genus or species. The Trichophyton gene may be, for example, the gene of T. rubrum, T. mentagrophytes or T. tonsurans, and may be preferably the gene of T. rubrum with GenBank Accession No. U18352 (SEQ ID NO: 13) or the gene of T. mentagrophytes with GenBank Accession No. KC146353 (SEQ ID NO: 14) as shown in Table 1.

(4) TABLE-US-00001 TABLE 1 Examples of Trichophyton Genes GenBank Accession No. Base Sequence U18352 aagtaaaagt cgtaacaagg tttccgtagg tgaacctgcg gaaggatcat taacgcgcag gccggaggct (SEQ ID NO: 13) ggccccccac gatagggacc gacgttccat caggggtgag cagacgtgcg ccggccgtac gcccccattc ttgtctacct cacccggttg cctcggcggg ccgcgctccc cctgccaggg agagccgtcc ggcgggcccc ttctgggagc ctcgagccgg accgcgcccg ccggaggaca gacaccaaga aaaaattctc tgaagagctg tcagtctgag cgtttagcaa gcacaatcag ttaaaacttt caacaacgga tctcttggtt ccggcatcga  tgaagaacgc agcgaaatgc gataagtaat gtgaattgca gaattccgtg aatcatcgaa tctttgaacg cacattgcgc cctctggcat tccggggggc atgcctgttc gagcgtcatt tcaacccctc aagcccggct tgtgtgatgg acgaccgtcc ggcccctccc ttcgggggcg ggacgcgccc gaaaagcagt ggccaggccg cgattccggc ttcctaggcg aatgggcagc caattcagcg ccctcaggac cggccgccct ggccccaatc tttatatata tatatatctt ttcaggttga cctcggatca ggtagggata cccgctgaac ttaagcatat caataagcgg KC146353 ggtttccgta ggtgaacctg cggaaggatc attagcgcgc aggccggagg ctggcccccc acgatagggc (SEQ ID NO: 14) caaacgtccg tcaggggtga gcagatgtgc gccggccgta ccgccccatt cttgtctaca ttactcggtt gcctcggcgg gccgcgctct cccaggagag ccgttcggcg agcctctctt tagtggctaa acgctggacc gcgcccgccg gaggacagac gcaaaaaaat tctttcagaa gagctgtcag tctgagcgtt agcaagcaaa aatcagttaa aactttcaac aacggatctc ttggttccgg catcgatgaa gaacgcagcg aaatgcgata agtaatgtga attgcagaat tccgtgaatc atcgaatctt tgaacgcaca ttgcgccccc tggcattccg gggggcatgc ctgttcgagc gtcatttcag cccctcaagc ccggcttgtg tgatggacga ccgtccggcg cccccgtctt tgggggtgcg ggacgcgccc gaaaagcagt ggccaggccg cgattccggc ttcctaggcg aatgggcaac aaaccagcgc ctccaggacc ggccgccctg gcctcaaaat ctgttttata cttatcaggt tgacctcgga tcaggtaggg atacccgctg aacttaagca t

(5) The “LAMP method” described in the present specification refers to a gene amplification method using multiple primers, which produces an amplification product with hairpin structures at ends by a strand displacement reaction that proceeds continuously under isothermal conditions as described in Patent Literatures 2 to 4 listed above. First, in the initial reaction, two inner primers (FIP and BIP), two outer primers (F3 primer and B3 primer) and a strand displacement-type DNA polymerase are used to synthesize, from a template DNA, a dumbbell-shaped structure with single-stranded loops at both ends. This structure serves as the initiating structure of the amplification cycle, and the DNA elongation/synthesis reaction proceeds from the 3′-end side of this structure using itself as a template. The amplification product is composed of a large number of repeating structures, and the unit of the repeating structure includes complementary regions in the same strand in which two base sequences of nucleic acids constituting the amplified regions between the primers are reverse to each other. When the template is RNA, the initiating structure can be similarly synthesized by adding a reverse transcriptase to a reaction solution composition for a DNA template, and then the amplification can be allowed to proceed (Patent Literature 2).

(6) As described above, the LAMP method requires at least four kinds of primers. In a target DNA to be amplified, regions F3c, F2c, and F1c are defined in order from the 3′-end side, and regions B3, B2, and B1 are defined in order from the 5′-end side. Then, the at least four kinds of primers are designed based on base sequences of oligonucleotides substantially identical or complementary to at least these six regions. The terms, identical or complementary, used to characterize the base sequences constituting the oligonucleotides do not have to be completely identical or completely complementary. That is, the term “identical” to a certain sequence can also include a sequence complementary to a base sequence capable of hybridizing to the certain sequence. On the other hand, the term “complementary” means a sequence that is capable of hybridizing under stringent conditions and providing the 3′ end to serve as an initiator of complementary strand synthesis. The “stringent conditions” refer to salt concentration and/or temperature conditions in which only specific hybridization occurs and non-specific hybridization does not occur, and may be conditions where, for example, an amplification reaction solution containing KCl, MgSO.sub.4 and/or (NH.sub.4).sub.2SO.sub.4 in amounts of 5 to 15 mM is incubated at 55 to 70° C.

(7) Each of the primers designed based on the base sequences of the target DNA constitutes one of FIP, F3 primer, BIP, and B3 primer. The FIP is designed such that the 3′ end has a base sequence of an F2 region substantially complementary to the F2c region of the target DNA and the 5′ end has a base sequence substantially identical to that of the F1c region of the target DNA. In this case, a sequence independent of the target DNA may be interposed between the F2 and F1c sequences. The sequence length of the sequence independent of the target DNA may be 0 to 50 bases and preferably 0 to 40 bases. The F3 primer is designed to have a base sequence that is substantially identical to that of an F3 region substantially complementary to the F3c region of the target DNA. The BIP is designed such that the 3′ end has a base sequence of the B2 region substantially complementary to a B2c region of the target DNA and the 5′ end has a base sequence substantially identical to that of a B1c region of the target DNA. Also in the BIP, a sequence independent of the target DNA may be interposed between the B2 and B1c sequences as in the FIP. The B3 primer is designed to have a base sequence that is substantially identical to that of the B3 region substantially complementary to a B3c region of the target DNA.

(8) The “four kinds of oligonucleotides” contained in the primer set of the present invention are equivalent to the FIP, the F3 primer, the BIF, and the B3 primer, and can be designed based on the base sequence of the Trichophyton gene. The length of the FIP or BIP may be 30 to 50 bases and preferably 35 to 45 bases. The length of the F3 primer or B3 primer may be 15 to 25 bases and preferably 18 to 22 bases. Table 2 presents examples of the F3c, F2c, F1c, B1, B2, and B3 regions in the base sequences of the Trichophyton genes.

(9) TABLE-US-00002 TABLE 2 F3c, F2c, F1c, B1, B2, and B3 regions of Trichophyton Genes GenBank Accession GenBank Accession No. U18352 No. KC146353 Region (T. rubrum) (T. mentagrophytes) F3c 43 to 61 positions 19 to 37 positions F2c 82 to 99 positions 57 to 75 positions F1c 122 to 141 positions 106 to 124 positions B1 144 to 165 positions 127 to 148 positions B2 209 to 225 positions 183 to 204 positions B3 242 to 260 positions 219 to 236 positions

(10) Table 3 presents an example of loop primers and their base sequences in the present invention, but primers substantially identical to them may be also used. To be more specific, the base sequence of each primer may have a loss, substitution, and/or addition of one to several bases as long as the primer has a function to amplify the target gene by the LAMP method.

(11) TABLE-US-00003 TABLE 3 Primers Used to Detect Trichophyton Gene SEQ ID Primer Base Sequence NO <For Detection of Gene of T. rubrum> TrF3 AGGATCATTAACGCGCAGG 1 TrB3 TCTTGGTGTCTGTCCTCCG 2 TrFIP AGAATGGGGGCGTACGGCCGATAGGGACCGACGTTCCA 3 TrBIP TCTACCTCACCCGGTTGCCTCGTCGAGGCTCCCAGAAGG 4 <For Detection of Gene of T. mentagrophytes> TmF3 TGCGGAAGGATCATTAGCG 7 TmB3 TTTTGCGTCTGTCCTCCG 8 TmFIP CAAGAATGGGGCGGTACGGCCCCACGATAGGGCCAAAC 9 TmBIP TACATTACTCGGTTGCCTCGGCGCGTTTAGCCACTAA 10 AGAGAGG

(12) The “loop primer” described in the present specification refers to a primer containing a sequence complementary to a single-stranded part of the loop at the 5′-end side of the dumbbell-shaped structure (for example, between the B1 and B2 regions or between the F1 and F2 regions). In the LAMP method, the initiators of DNA synthesis can be increased by using at least one of the above loop primers in combination, so that the amplification time can be shortened (Patent Literature 3). The loop primer is designed to hybridize to a loop region to which the FIP or BIP formed in the DNA synthesis process does not hybridize.

(13) In an embodiment, the primer set may contain at least one kind of loop primer. The optional loop primer may be designed within a range of 100 to 121 positions or 166 to 208 positions in U18352 or 76 to 105 positions or 149 to 182 positions in KC146353. The length of the loop primer may be 10 to 25 bases or preferably 15 to 20 bases.

(14) Table 4 presents an example of loop primers and their base sequences in the present invention, but primers substantially identical to them may be also used. To be more specific, the base sequence of each primer may have a loss, substitution, and/or addition of one to several bases as long as the primer has a function to amplify the target gene by the LAMP method.

(15) TABLE-US-00004 TABLE 4 Loop Primer Primer Base Sequence SEQ ID NO <For Detection of Gene of T. rubrum> TrLF ACGTCTGCTCACCCCTGA 5 TrLB CCGCGCTCCCCCTGC 6 <For Detection of Gene of T. mentagrophytes TmLF TCTGCTCACCCCTGACGGAC 11 TmLB TCTCCCAGGAGAGCCGT 12

(16) In an embodiment, the primer set of the present invention is included in a “kit for detecting a Trichophyton in a sample”. The kit may include, for example, a Bst DNA polymerase, a reaction buffer, dNTPs, a positive control DNA, a reaction tube, or an instruction manual in addition to the primer set.

(17) The “sample” described in the present specification refers to a Trichophyton, its gene, or a composition containing any of them. As the sample, various kinds of samples can be employed, and examples thereof include specimens of tinea patients or patients suspected of having tinea, or strains cultured in a laboratory. The specimen may be the skin or a skin appendage such as a nail or hair, which may be directly collected from a living body, or be one adhered to clothes or daily necessities or dispersed in the environment. A nucleic acid such as DNA or RNA can be extracted from the sample by a well-known method and used as a template for the LAMP method.

(18) The step of “amplifying a nucleic acid by a LAMP method” described in the present specification may use any of the LAMP methods used in this technical field without limitation, such as the method described in the package insert of a DNA amplification reagent kit (Eiken Chemical Co., Ltd., product No. LMP206). For example, a primer mixture liquid containing the primer set, a Bst DNA polymerase, dNTPs, and distilled water are mixed, and the resultant mixture is dispensed into a reaction tube, to which then the sample or the nucleic acid extracted from the sample is added as a template. The reaction tube is subjected to incubation, for example, for 30 to 90 minutes at 55 to 70° C. and preferably 60 to 65° C. to amplify the nucleic acid. The primer mixture liquid may be prepared by mixing the FIP, the F3 primer, the BIP, and the B3 primer at a molar ratio of 6 to 10:0.5 to 1.5:6 to 10:0.5 to 1.5 and preferably a ratio of 7 to 9:0.8 to 1.2:7 to 9:0.8 to 1.2. In the case of using the optional loop primers LF and LB, the primer mixture liquid may be prepared by mixing the FIP, the F3 primer, the BIP, the B3 primer, and the loop primers LF and LB at a molar ratio of 6 to 10:0.5 to 1.5:6 to 10:0.5 to 1.5:2 to 6:2 to 6 and preferably a ratio of 7 to 9:0.8 to 1.2:7 to 9:0.8 to 1.2:3 to 5:3 to 5.

(19) The “step of detecting the amplified nucleic acid” described in the present specification may be executed by any known method. For example, the amplified nucleic acid may be detected by turbidity measurement, fluorescence measurement using a fluorescent substance, immunochromatography, nucleic acid hybridization, or electrophoresis on the liquid containing the amplification product, and the detection can be performed by a visual check. In the case of turbidity measurement, the turbidity may be measured over time by a real-time turbidity measuring device, or the turbidity of the final product may be measured by a turbidity measuring device. In the case of fluorescence measurement, for example, a fluorescent substance is added to the reaction tube, and the fluorescence may be measured by a real-time PCR device, or the fluorescence of the final product may be measured by a fluorometer. As the fluorescent substance, various kinds of substances used for analysis of nucleic acids in solutions or analysis of the progress degree of the LAMP reaction. For example, the fluorescent substance may be an intercalator such as YO-PRO-1 or SYBR Green or calcein that is activated by a by-product (such as pyrophosphate ion) of the LAMP reaction.

(20) In the case where the sample contains the target gene, the gene is amplified in the amplifying step. On the other hand, in the case where the sample does not contain the target gene, no nucleic acid is amplified. Therefore, according to the present invention, it is possible to detect whether the sample contains a Trichophyton, and thereby detect the Trichophyton or make diagnoses of tinea patients. In addition, the primer sets target the genes derived from different Trichophyton species, and are therefore capable of diagnosing whether a patient is infected with any one or both of T. rubrum and T. mentagrophytes.

(21) Hereinafter, the present invention will be described specifically by using Examples, but the scope of the present invention should not be limited to these Examples.

EXAMPLES

Example 1

(22) This Example demonstrates that the four kinds of oligonucleotides of the present invention are capable of functioning as a primer set in the LAMP method and amplifying the target gene.

(23) A plasmid DNA was extracted from T. rubrum genetically modified E. coli by using QIAGEN Plasmid Midi Kit (QIAGEN K.K., product No. 12143). As a 2×DNA amplification reagent and a Bst DNA polymerase for the LAMP method, those commercially available as the DNA amplification reagent kit (Eiken Chemical Co., Ltd., product No. LMP206) were used. A LAMP amplification reaction solution was prepared by mixing 12.5 μL of the 2×DNA amplification reagent, 2.6 μL of a 100 μM primer mixture liquid (TrF3:TrB3:TrFIP:TrBIP=1:1:8:8 (molar ratio)), 2.5 μL of 10 μM YO-PRO-1 (Invitrogen, product No. Y3603), 1.0 μL of the Bst DNA polymerase, 2.0 μL of the plasmid DNA (1.4×10.sup.10 copies), and at most 25 μL of UltraPure™ DNase/RNase-Free Distilled Water (Invitrogen, product No. 10977). As a negative control, a LAMP amplification reaction solution not containing the plasmid DNA was prepared. The LAMP amplification reaction solutions were incubated at 57° C., and the fluorescence was measured in 2-min cycles.

(24) The results are presented in FIG. 1. The LAMP amplification solution (A) containing the plasmid DNA containing the target gene of T. rubrum demonstrates an increase in the fluorescent intensity from 50 cycles, while the negative control (B) demonstrates no increase in the fluorescent intensity. This indicates that the four kinds of primers TrF3, TrB3, TrFIP, and TrBIP amplified the target gene of T. rubrum. Therefore, it is found that the primer set containing the four kinds of oligonucleotides of the present invention is useful to detect the Trichophyton gene by the LAMP method.

Example 2

(25) This Example demonstrates that the four kinds of oligonucleotides and the two kinds of loop primers of the present invention are capable of functioning as a primer set in the LAMP method and amplifying the target gene.

(26) As a template DNA, a plasmid DNA or a genomic DNA was used. The plasmid DNA was extracted from T. rubrum genetically modified E. coli or T. mentagrophytes genetically modified E. coli by using QIAGEN Plasmid Midi Kit. The genomic DNA was extracted, by using QIAamp® DNA Micro Kit (QIAGEN K. K., product No. 56304), from a nail specimen found to be infected with T. rubrum or T. mentagrophytes by known means. The primer mixture liquid was prepared by mixing a primer set for T. rubrum detection (TrF3, TrB3, TrFIP, TrBIP, TrLF, and TrLB; a primer set Tr) or a primer set for T. mentagrophytes detection (TmF3, TmB3, TmFIP, TmBIP, TmLF, and TmLB; a primer set Tm) at a ratio of F3:B3:FIP:BIP:LF:LB=1:1:8:8:4:4. As presented in Table 5, the LAMP amplification reaction solution was prepared, and an amplification reaction was allowed to proceed. The signal of the fluorescent substance (YO-PRO-1) that was intercalated into the amplified DNA was measured by a real-time PCR device (Applied Biosystems Japan Ltd., Step One Plus, CT-97).

(27) TABLE-US-00005 TABLE 5 Composition of LAMP Amplification Reaction Solution and Amplification Reaction Conditions For T. rubrum For T. mentagrophytes Detection Detection 1. Reaction Solution 2× DNA Amplification 12.5 μL 12.5 μL Reagent Primer Mixture Liquid 2.6 μL 1.3 μL (100 μM) (Primer Set Tr) (Primer Set Tm) YO-PRO-1 (10 μM) 2.5 μL 2.5 μL Bst DNA Polymerase 1.0 μL 1.0 μL Template DNA 2.0 μL 2.0 μL UltraPure ™ DNase/RNase- Up to 25 μL Up to 25 μL Free Distilled Water 2. Amplification Reaction Amplification Conditions 65° C., 1 min 63° C., 1 min (110 Cycles) (110 Cycles) Stop Conditions 95° C., 2 min 95° C., 2 min

(28) Table 6 presents a cycle number (Ct value) at which the fluorescent intensity exceeds a threshold. In the reaction solution using the primer set Tr, the template DNA containing the gene of T. rubrum was amplified. In the reaction solution using the primer set Tm, the template DNA containing the gene of T. mentagrophytes was amplified. Therefore, it is found that the target gene of T. rubrum or T. mentagrophytes can be amplified and detected by the primer set Tr or the primer set Tm, respectively.

(29) TABLE-US-00006 TABLE 6 Amplified Template DNA and Ct Value Fungus Species Template DNA Ct Value <Reaction Solution for T. rubrum Detection> T. rubrum Plasmid (10.sup.4 copies/well) 28 T. rubrum Genomic DNA (10 ng/well) 28 <Reaction Solution for T. mentagrophytes Detection> T. mentagrophytes Plasmid (10.sup.4 copies/well) 18 T. mentagrophytes Genomic DNA (10 ng/well) 30

Example 3

(30) This Example demonstrates a specificity of a reaction using each primer set.

(31) Using, as template DNAs, appropriate amounts (5 to 100 ng) of Trichophyton-negative nail-derived DNA and genomic DNA derived from each of 16 fungal species, DNA amplification and detection using a reaction solution containing the primer set Tr or the primer set Tm were performed according to the method described in Example 2. Table 7 presents a reaction specificity of each of the fungal species and the primer sets used.

(32) TABLE-US-00007 TABLE 7 Reaction Specificity of Primer Set Primer Primer Fungal Species Set Tr Set Tm 1 Trichophyton rubrum NBRC 5467 + − 2 Trichophyton rubrum NBRC 5807 + − 3 Trichophyton rubrum NBRC 9185 + − 4 Trichophyton mentagrophytes NBRC 5466 − + 5 Trichophyton mentagrophytes NBRC 5809 − + 6 Trichophyton mentagrophytes NBRC 5929 − + 7 Arthroderma vanbreuseghemii JCM 1891 − − 8 Arthroderma vanbreuseghemii JCM 1892 − − 9 Arthroderma benhamiae JCM 1885 − − 10 Arthroderma benhamiae JCM 1886 − − 11 Trichophyton tonsurans NBRC 5928 − − 12 Malassezia furfur NBRC 0656 − − 13 Microsporum canis NBRC 7863 − − 14 Candida albicans NBRC 0197 − − 15 Aspergillus fumigatus NBRC 4057 − − 16 Fusarium solani NBRC 5232 − −

(33) In the reaction solution containing the primer set Tr, the DNA amplification was detected only when the template DNA contains the gene of T. rubrum. In the reaction solution containing the primer set Tm, the DNA amplification was detected only when the template DNA contains the gene of T. mentagrophytes. In any of the reaction solutions, the DNA derived from the fungal species other than the Trichophyton was not amplified. Therefore, since the genes of T. rubrum and T. mentagrophytes are specifically amplified by using the reaction solutions containing the primer set Tr and the primer set Tm, respectively, it is found that the presence of a Trichophyton, in particular, T. rubrum or T. mentagrophytes can be specifically detected in samples.

(34) The conventional fungal culture method requires several weeks, for example, eight weeks, to obtain results, has low sensitivity, and requires skilled operations due to a difficulty in culturing specimens derived from tinea unguium, in particular. On the other hand, the LAMP method requires only about two days to obtain results, involves relatively easy operations, and does not need any sophisticated equipment as a matter of course nor even preparation of a selective medium.

(35) As described above, the primer set containing the at least four kinds of oligonucleotides of the present invention makes it possible to specifically detect the Trichophyton gene in a sample such as a specimen with high sensitivity by the LAMP method. Then, the detection results are sufficiently comparable to the results obtained by the conventional method, but can be obtained more simply and quickly than those of the conventional method.

(36) It is also possible to detect the Trichophyton genes by the LAMP method using primer sets presented in Tables 8 and 9 instead of the primer sets described above in the present specification.

(37) TABLE-US-00008 TABLE 8 T. Other Primers Usable for T. rubrum Gene Detection Primer Base Sequence SEQ ID NO 1) Primer Set Tr-II TrF3-II AAGGTTTCCGTAGGTGAACC 15 TrB3-II TCGAGGCTCCCAGAAGG 16 TrFIP-II GAACGTCGGTCCCTATCGTGGTGCGGAA 17 GGATCATTAACGC TrBIP-II GGCCGTACGCCCCCATTCTACGGCTCTC 18 CCTGGCA TrLF-II TCTACCTCACCCGGTTGCC 19 TrLB-II CAGCCTCCGGCCTGC 20 2) Primer Set Tr-III TrF3-III TGAACCTGCGGAAGGATCA 21 TrB3-III TCTTGGTGTCTGTCCTCCG 22 TrFIP-III AGAATGGGGGCGTACGGCCTGGCCCCCC 23 ACGATAG TrBIP-III TCTACCTCACCCGGTTGCCTCGTCGAGG 24 CTCCCAGAAGG

(38) TABLE-US-00009 TABLE 9 Other Primers Usable for T. mentagrophytes Gene Detection Primer Base Sequence  SEQ ID NO 1) Primer Set Tm-II TmF3-II CCACGATAGGGCCAAACG 25 TmB3-II CTCAGACTGACAGCTCTTCTG 26 TmFIP-II GCCGAGGCAACCGAGTAATGTACGTC 27 AGGGGTGAGCAGAT TmBIP-II CGTTCGGCGAGCCTCTCTTTAATTTT 28 TTTGCGTCTGTCCTCC 2) Primer Set Tm-III TmF3-III TCAGGGGTGAGCAGATGTG 29 TmB3-III GCTCAGACTGACAGCTCTTC 30 TmFIP-III AACGGCTCTCCTGGGAGAGCCGTACC 31 GCCCCATTCTTG TmBIP-III CGGCGAGCCTCTCTTTAGTGGAAT 32 TTTTTTGCGTCTGTCCTCC