METHODS FOR IN VITRO INVESTIGATING MITOCHONDRIAL REPLICATION DYSFUNCTION IN A BIOLOGICAL SAMPLE, KITS AND USES THEREOF, THERAPEUTIC METHODS AGAINST PROGEROID-LIKE SYNDROMES OR SYMPTOMES AND SCREENING METHOD FOR IDENTIFYING PARTICULAR PROTEASE INHIBITOR(S) AND/OR NITROSO-REDOX STRESS SCAVENGER COMPOUND(S)
20200049718 ยท 2020-02-13
Inventors
- Laurent Arnaud CHATRE (Saint Gratien, FR)
- Miria Ricchetti (Paris, FR)
- Alain SARASIN (Thiais, FR)
- Denis BIARD (Thiais, FR)
Cpc classification
G01N33/6872
PHYSICS
A61P43/00
HUMAN NECESSITIES
G01N2800/2835
PHYSICS
A61P25/28
HUMAN NECESSITIES
C12Q1/6883
CHEMISTRY; METALLURGY
International classification
Abstract
The invention relates to a method for in vitro investigating mitochondrial replication dysfunction in a biological sample removed from a subject susceptible of suffering from physiological ageing or physiopathological conditions related to physiological ageing, or physiopathological ageing or associated symptoms or conditions, in particular premature ageing or accelerated ageing, or of a progeroid syndrome, such as Cockayne syndrome (CS), or neurodegenerative disorders or symptoms thereof, in which the levels of at least one species selected in the group of: POLG1 protein, POLG1 RNA, POLG2 protein, protease(s) which have POLG as a target, in particular serine protease(s) such as HTRA3 protein, HTRA2 protein and, HTRA3 RNA or HTRA2 RNA, or any combination of these species, are investigated. The invention also relates to kits and uses thereof, therapeutic methods against progeroid-like syndromes or symptomes and screening method for identifying particular protease inhibitor(s) and/or nitroso-redox stress scavenger compound(s) having relevance for the symptoms discussed herein.
Claims
1-25. (canceled)
26. An in vitro method for investigating mtDNA replication dysfunction in a biological sample removed from a subject susceptible of suffering from physiological ageing or physiopathological conditions related to physiological ageing, or physiopathological ageing or associated symptoms or conditions, said method comprising the steps of: a. contacting said biological sample with at least one marker specific for at least one species selected in the group of: POLG1 protein, HTRA3 protein, HTRA2 protein, or any combination of these species, in conditions enabling said marker(s) to react with their respective targets, and b. determining the level of at least one species selected in step a) from the group of: POLG1 protein, HTRA3 protein, HTRA2 protein, or any combination of these species in said biological sample through measurement of the marker(s) that has(have) reacted with its (their) respective species in step a), or through measurement of the reaction product(s) obtained after reacting the marker(s) with its (their) respective species in step a), and c. comparing the level(s) determined in step b) with respective normal threshold value(s) determined for healthy subject(s) for each species selected in the group set forth in step a) and b) to carry out said steps, and d. from the comparison made in step c), concluding about the existence of a dysfunction in mtDNA replication.
27. The method of claim 26, wherein conclusion is made of the existence of a mtDNA replication dysfunction if the level of each species selected to carry out the above disclosed steps is as follows: the level of POLG1 protein determined in step b) is decreased with respect to the normal threshold value introduced in step c) by at least 10%, and/or the level of POLG2 protein determined in step b) is increased with respect to the normal threshold value introduced in step c) by at least 15%, and/or the level of HTRA3 protein determined in step b) is increased with respect to the normal threshold value introduced in step c) by by at least 2-folds, or when at least two of the above measurements meet the above thresholds.
28. The method of claim 26, wherein the level of POLG1 transcripts, corresponding to POLG1 RNA level(s), is also determined and compared with a normal threshold value determined for healthy subject(s), conclusion being made of the existence of a mtDNA replication dysfunction if the level of POLG1 protein is decreased with respect to the normal threshold value by at least 10% and the level of POLG1 transcripts is within the range of normal threshold value determined for this species on normal cells, in combination with another species and/or marker(s) or not.
29. The method of claim 26, for monitoring or diagnosing the health status of a subject susceptible of suffering from physiological ageing, physiopathological or accelerated ageing or a progeroid syndrome, such as Cockayne syndrome (CS), or neurodegenerative disorders or symptoms thereof, said method further comprising the following step: e. concluding about the health status of a subject from which the tested biological sample has been removed on the basis of the existence of a mtDNA replication dysfunction.
30. The method of claim 29, wherein the conclusion is the presence or a risk of occurrence or of a presence of physiopathological or accelerated ageing or a progeroid syndrome, such as Cockayne syndrome (CS), or neurodegenerative disorders or symptoms thereof if conclusion is made of the existence of a mtDNA replication dysfunction.
31. The method of claim 26, wherein the biological sample is from a subject in need of being diagnosed and/or diagnosed with physiopathological or accelerated ageing or a progeroid syndrome, such as Cockayne syndrome (CS), or neurodegenerative disorders or symptoms thereof, and/or a subject having a family history of physiological or accelerated ageing or progeroid syndrome(s), such as Cockayne syndrome (CS), or neurodegenerative disorders or symptoms thereof.
32. The method of claim 26, wherein the progeroid syndrome is selected amongst: Hutchinson-Guilford progeria syndrome (HGPS), Werner syndrome (WS), Bloom syndrome (BS), Rothmund-Thomson syndrome (RTS), Fanconi anemia (FA), Ataxia telangiectasia (A-T), Cockayne syndrome (CS), Xeroderma pigmentosum (XP) and trichothiodystropy (TTD), and the neurodegenerative disorder is selected amongst Alzheimer and Parkinson diseases.
33. The method of claim 26, wherein the biological sample is from a subject known to be homozygous for a mutation in the CSB or CSA gene associated with a risk of Cockayne syndrome (CS).
34. The method of claim 26, wherein the level of POLG1 protein, HTRA3 protein is determined by immunofluorescence, by Western Blotting or by ELISA testing.
35. The method of claim 26, which is performed on a biological sample consisting of isolated cells or culture(s) thereof.
36. A method for restoring POLG1 levels in a patient in need thereof to treat or delay physiological ageing or physiopathological ageing, or accelerated ageing or a progeroid syndrome, or neurodegenerative disorders or symptoms thereof, comprising administering to a patient in need thereof a protease inhibitor which interacts with protease(s) degrading POLG1.
37. The method of claim 36, wherein the physiological or physiopathological ageing, or accelerated ageing or a progeroid syndrome, or neurodegenerative disorders or symptoms thereof are associated with mtDNA replication dysfunction determined according to an in vitro method for investigating mtDNA replication dysfunction in a biological sample removed from a subject susceptible of suffering from physiological ageing or physiopathological conditions related to physiological ageing, or physiopathological ageing or associated symptoms or conditions, said in vitro method comprising the steps of: a. contacting said biological sample with at least one marker specific for at least one species selected in the group of: POLG1 protein, HTRA3 protein, HTRA2 protein, or any combination of these species, in conditions enabling said marker(s) to react with their respective targets, and b. determining the level of at least one species selected in step a) from the group of: POLG1 protein, HTRA3 protein, HTRA2 protein, or any combination of these species in said biological sample through measurement of the marker(s) that has(have) reacted with its (their) respective species in step a), or through measurement of the reaction product(s) obtained after reacting the marker(s) with its (their) respective species in step a), and c. comparing the level(s) determined in step b) with respective normal threshold value(s) determined for healthy subject(s) for each species selected in the group set forth in step a) and b) to carry out said steps, and d. from the comparison made in step c), concluding about the existence of a dysfunction in mtDNA replication.
38. The method of claim 36, wherein the physiological or physiopathological ageing, or accelerated ageing or a progeroid syndrome, or neurodegenerative disorders or symptoms thereof are associated with an abnormal expression of a functional protease, an abnormal expression being defined by reference to a normal expression value determined for healthy subject(s), said activity value(s) corresponding to level(s) of expressed functional protease(s), for example determined by immunofluorescence or Western Blotting or ELISA testing.
39. The method of claim 36, wherein an abnormal expression of a functional protease is an expression that is increased by reference to a predetermined normal expression value.
40. The method of claim 36, wherein the protease inhibitor targets both the HTRA3 and the HTRA2 proteins.
41. The method of claim 36, wherein the protease inhibitor is selected among: MG132 and Soybean trypsin inhibitor (KSTI).
42. The method of claim 36, wherein the patient is diagnosed with Cockayne syndrome (CS).
43. A method to treat or delay physiological ageing or physiopathological ageing, or accelerated ageing or a progeroid syndrome, or symptoms thereof, and/or to restore the level(s) of protein(s) selected in the group of: HTRA2, HTRA3 and POLG1, or combinations thereof, comprising administering to a patient in need thereof at least one nitroso-redox stress scavenger compound.
44. The method of claim 43, to treat or delay a progeroid syndrome, or symptoms thereof, wherein the progeroid syndrome is selected amongst: Hutchinson-Guilford progeria syndrome (HGPS), Werner syndrome (WS), Bloom syndrome (BS), Rothmund-Thomson syndrome (RTS), Fanconi anemia (FA), Ataxia telangiectasia (A-T), Cockayne syndrome (CS), Xeroderma pigmentosum (XP) and trichothiodystropy (TTD).
45. The method of claim 43, to treat or delay Cockayne syndrome (CS) or symptoms thereof.
46. The method of claim 43, wherein the nitroso-redox stress scavenger compound scavenges both amongst reactive oxygen species (ROS) and reactive nitrogen species (RNS).
47. The method of claim 43, wherein the nitroso-redox stress scavenger compound is a manganese porphyrin.
48. The method according to claim 43, wherein the at least one nitroso-redox stress scavenger compound is selected from: ##STR00002##
49. The method of claim 43, which is to treat or delay Cockayne syndrome (CS) or symptoms thereof and/or to restore the level(s) of protein(s) selected in the group of: HTRA2, HTRA3 and POLG1, or combinations thereof, comprising administering to a patient in need thereof at least one nitroso-redox stress scavenger compound is selected from: ##STR00003##
50. The method according to claim 43, wherein the physiological or physiopathological ageing, or accelerated ageing or a progeroid syndrome, or symptoms thereof are associated with mtDNA replication dysfunction that is determined according to an in vitro method for investigating mtDNA replication dysfunction in a biological sample removed from a subject susceptible of suffering from physiological ageing or physiopathological conditions related to physiological ageing, or physiopathological ageing or associated symptoms or conditions, or accelerated ageing or a progeroid syndrome, or symptoms thereof, said in vitro method comprising the steps of: a. contacting said biological sample with at least one marker specific for at least one species selected in the group of: POLG1 protein, HTRA3 protein, HTRA2 protein, or any combination of these species, in conditions enabling said marker(s) to react with their respective targets, and b. determining the level of at least one species selected in step a) from the group of: POLG1 protein, HTRA3 protein, HTRA2 protein, or any combination of these species in said biological sample through measurement of the marker(s) that has(have) reacted with its (their) respective species in step a), or through measurement of the reaction product(s) obtained after reacting the marker(s) with its (their) respective species in step a), and c. comparing the level(s) determined in step b) with respective normal threshold value(s) determined for healthy subject(s) for each species selected in the group set forth in step a) and b) to carry out said steps, and d. from the comparison made in step c), concluding about the existence of a dysfunction in mtDNA replication.
51. A method to treat or delay physiological ageing or physiopathological ageing, or accelerated ageing or a progeroid syndrome, or neurodegenerative disorders or symptoms thereof, and/or to restore the level(s) of at least one protein selected from HTRA2, HTRA3 and POLG1, comprising administering to a patient in need thereof a protease inhibitor which interacts with protease(s) degrading POLG1 in combination with a nitroso-redox stress scavenger compound.
52. The method according to claim 51, wherein the protease inhibitor and the nitroso-redox stress scavenger are administered to the patient in need thereof concomitantly, separately or in a sequential regime, the protease inhibitor being administered before or after the nitroso-redox stress scavenger.
53. A kit suitable for carrying out a method as defined in claim 26, comprising: at least one pair of specific oligonucleotide primers specific for hybridization with POLG1 cDNA, and/or at least one pair of specific oligonucleotide primers specific for hybridization with POLG1 RNA, and a notice providing instructions for use and expected values for interpretation of results, or comprising: at least one antibody specific for at least one protein selected from POLG1, HTRA3, and HTRA2, a secondary antibody or reagent to reveal a complex between the at least one specific antibody recited above and its target, and a notice providing instructions for use and expected values for interpretation of results.
54. An in vitro process for screening protease inhibitor(s) for identifying protease inhibitor(s) capable of restoring POLG1 level in a cell, and/or for screening nitroso-redox stress scavenger compound(s) for identifying nitroso-redox stress scavenger compound(s) capable of restoring POLG level in a cell, comprising the steps of: i. contacting a cell or a cell culture, having a decreased level of POLG1 by at least 10% with respect to a normal threshold value determined for cells characteristic of healthy subject(s) with a marker specifically recognizing POLG1, ii. contacting said cell(s) with protease inhibitor(s) and/or nitroso-redox stress scavenger compound(s) to assay, wherein steps i. and ii. can be inverted, and iii. measuring and/or visualizing the change(s) in the level of POLG1 of the cell(s) contacted in steps i. and ii.
Description
LEGENDS OF FIGURES
[0200]
[0201]
[0202]
[0203]
[0204]
[0205]
[0206]
[0207]
[0208]
[0209]
TABLE-US-00001 TABLE 1 Characteristics of (a) primary skin fibroblasts from healthy individuals (wildtype), UV.sup.SS, and CS patients, and (b) cellular models including CSB levels, used in the present study. (a) Patient's number Diagnosis Mutation CSA/CSB 198VI Wildtype 194VI Wildtype 911VI Wildtype UVSS1VI UV.sup.SS csa CS539VI CS type I csb Absence of CSB CS548VI CS type I csb Absence of CSB CS359VI CS type I csb Absence of CSB CS333VI CS type I csa Absence of CSA CS466VI CS type I csa Absence of CSA CS797VI CS type II - COFS csb 50% CSB loss CS816VI CS type II - COFS csb Truncated forms CS177VI CS type II - COFS csb Absence of CSB (b) Model Characteristics CSB RNA CSB protein MRC-5 SV-40 transformed Wildtype Wildtype human fibroblasts CSIAN SV-40 transformed Absence of CSB Absence of CSB CSB-deficient human fibroblasts HeLa Human cell line Wildtype Wildtype mock mock Wildtype Wildtype siCSBa siCSB cell line Extinction 89% Absence of CSB siCSBa-RV Reverted siCSB Overexpression High CSB level 282X siCSBb siCSB cell line Extinction 82% Absence of CSB siCSBb-RV Reverted siCSB Overexpression High CSB level 82X
1. MATERIALS AND METHODS
[0210] Immunofluorescence Staining.
[0211] Cells plated on slides were fixed with 2% PFA and permeabilized with 0.5% Triton X-100. The slides were incubated in blocking buffer (BSA 5% in PBS) for 1 h then with the primary antibody (POL.sub.Y and HTRA3 purchased from SantaCruz Biotechnology, or as available from any other provider) for 1 h at room temperature. A second, fluorescent antibody (goat anti-mouse and goat anti-rabbit Alexa Fluor 488, Alexa Fluor 555, conjugated secondary antibodies from Invitrogen or by any other provider), was incubated for 1-2 h at room temperature, and DNA was stained with 10 g/ml Hoechst.
[0212] Fluorescence Quantification and Image Analysis.
[0213] Image analysis was carried out using Perkin-Elmer Ultraview RS Nipkow-spinning disk confocal microscope. Three-dimensional reconstruction of all the z-stacks was achieved using the 3D-volume rendering of IMARIS software (Bitplane). A regular fluorescence microscope can also be used, including for fluorescence quantification, although in this last case it will quantify one section of the cell only and not the entire volume; this quantification may be sufficient for comparative studies (normal versus patient cells). Confocal acquisition (even in the absence of spinning disk) in 3D allows quantification of the entire volume, and differences among samples are therefore more robust.
[0214] RT-qPCR.
[0215] Total RNA was isolated from HeLa cells using the RNAeasy Mini kit (Qiagen), treated with DNasel (Qiagen), then reverse-transcribed using SuperscriptIII Reverse transcriptase (Invitrogen). Real-time quantitative PCR was performed using Power Sybr Green PCR Master Mix (Applied Biosystems) and the rate of dye incorporation was monitored using the StepOne Plus RealTime PCR system (Applied Biosystems). Three biological replicates were used for each condition. Data were analyzed by StepOne Plus RT PCR software v2.1 and Microsoft excel. TBP transcript levels were used for normalisation of each target (=CT). Real-time PCR C.sub.T values were analyzed using the 2.sup.Ct method to calculate the fold expression (Schmittgen and Livak, 2008). Custom primers were designed using the Primer3Plus online software (http://www.bioinformatics.nl/cgi-bin/primer3plus.cgi). Customs primers used by the inventors (SEQ ID NO: 9 to 18) are listed in the table below.
TABLE-US-00002 Primer'ssequence Literature/Reference POLG1forward 5GAGAAGGCCCAGCAGATGTA Setzeretal,2008. POLG1reverse 5 ATCCGACAGCCGATACCA AmericanJ.Pathology 172:681-90 POLG2forward 5 GAGCTGTTGACGGAAAGGAG Armstrongetal,2010. POLG2reverse 5 GTTCTTCCGCAACTCTACGC StemCells28:661- 673 LongHTRA3 5 ATGCGGACGATCACACCAAG Nieetal,2006Biology forward ofreproduction74: LongHTRA3 5 CGCTGCCCTCCGTTGTCTG 366-374 reverse ShortHTRA3 5GAGGGCTGGTCACATGAAGA forward ShortHTRA3 5 GCTCCGCTAATTTCCAGT reverse HTRA2_forward 5 TTTGCCATCCCTTCTGATCG Sequence HTRA2_reverse 5 ACACCATGCTGAACATCGGG NM_013247,1590- 1777
[0216] Protein Extraction and Western Blot.
[0217] Cells were lysed by lysis solution (20 mM Tris, 18 mM NaCl, 0.5% Lauryl Maltoside, 1 mM MgCl.sub.2, 200 mM Na.sub.4P.sub.2O.sub.7, 1 mM EGTA, 20 mM NaF, 2 mM NaVO.sub.4, 1 mM Pefabloc (Sigma), 1 mM Aprotinin (Sigma), 1 mM Leupeptin (Sigma). Protein content was determined with the Bradford reagent (Sigma) and 30 g of protein were loaded for SDS-PAGE. After blotting, Hybond ECL nitrocellulose filters were probed with anti-POL.sub.Y or anti-HTRA3 antibodies. Detection was performed using Odyssey Infrared Imaging system scanner and Odyssey application software v 3.0 (LI-COR Biosciences).
[0218] ELISA methods have been performed according to standard methods as known by the person skilled in the field and according to the recommendations of the fabricant(s) when standard kits were used.
2. EXPERIMENTAL SECTION
A. Diagnosis
Experiment 1 (FIG. 1)
[0219] The inventors found that POLG1 protein levels, measured by immunofluorescence and Western blot, are reduced in fibroblasts from CS patients (either from type I or type II, the latter displaying the most severe phenotype) compared to fibroblasts from healthy individual and from UV.sup.SS patients (
Experiment 2 (FIG. 2)
[0220] Silencing of CSB in HeLa cells using replicative pEBVsiRNA plasmids.sup.19 resulted in decreased polG levels (tested by RT-qPCR and immunofluorescence) at levels compatible with those observed in CS patients (
Experiment 3 (FIG. 3)
[0221] POLG2 is an accessory protein that increases the processivity of the catalytic subunit of POLG1.sup.20. The inventors observed that POLG2 levels essentially increased in cells from CS patients compared to healthy individuals and to UV.sup.SS, although the effect was particularly strong for CSB mutations than for CSA mutations (
Experiment 4 (FIG. 4)
[0222] Reduced levels of POLG1 in CSB altered cells (in patients and by gene silencing) in the presence of regular levels of POLG1 transcripts indicate that either translation is impaired or protein degradation is enhanced. HTRA3 (high-temperature requirement factor A3) is a nuclear-encoded mitochondrial serine protease that degrades damaged proteins, and has a function during development, and possibly as tumor suppressor.sup.21. The inventors observed dramatically high levels of HTRA3 protein, assessed by immunofluorescence, in fibroblasts from CS patients, compared to controls and UV.sup.SS fibroblasts (
Experiment 5 (FIG. 5): Demonstration that PoIG Levels Depend on Htra3 Overexpression
[0223] In Experiment 4, it has been shown association between increase of HtrA3 and depletion of PolG1, but not directly shown that increase of HtrA3 induced depletion of PolG1. This experiment provides direct evidence that this is the case. It is shown that overexpression of HtrA3 protein in HeLa cells decreases PolG1 levels. Both overexpression of HtrA3 (on a logarithmic scale) and PolG1 depletion appear comparable to levels detected in CS patient cells (
Experiment 6 (FIG. 6): Demonstration that HtrA3 does not Affect HtrA2 Levels
[0224] HtrA3 is a serine protease, which could target and degrade HtrA2 or a protein involved in the regulation of HtrA2. The inventors assessed HtrA2 levels in HtrA3 overexpressing HeLa cells, and observed that HtrA2 protein immunofluorescence was not altered by a few thousand-fold increase in HtrA3 (
B. Therapy Strategy
[0225] For the reasons developed above, the precocious ageing phenotype can be ascribed to the mismanagement of oxidative stress in CS and cells affected by ageing, let it be physiological or physiopathological, as described herein.
[0226] Through the preceding experiments, the inventors showed that cells from CS patients, compared to cells from healthy individuals and from UV.sup.SS, are characterized by lower levels (e.g. at least a 20% decrease, in particular when tested by immunofluorescence) of the nuclear encoded mitochondrial DNA polymerase gamma (POLG1), by higher levels of the accessory factor POLG2 (e.g. at least a 25% increase, in particular when tested by immunofluorescence), and by dramatically higher levels of the serine protease HTRA3 (e.g. at least a 10-folds increase, when tested by immunofluorescence). They also showed that alterations in the levels of these proteins are linked to impairment of CSB.
[0227] Thus, CSB impairment directly or indirectly increases Htra3 levels, and this serine protease in turn degrades its targets, which include POLG1. In spite of increased levels of the accessory protein POLG2, likely to compensate for the impaired mitochondrial DNA replication complex, replication of mitochondrial DNA is affected when CSB is not operating, leading to a decline in the mitochondrial function and thereby to enhanced production of oxidative stress. Increased oxidative stress and affected mitochondrial function, which cumulate with time, contribute to leading to precocious ageing phenotype.
[0228] HTRA3 is a serine protease. The inventors hypothesized that inhibition of proteases should decrease HTRA3 levels and help restoring correct POLG1 levels. They thus tested two protease inhibitors, MG132 that is a specific proteasome inhibitor, and Soybean trypsin inhibitor (KSTI), a natural serine protease inhibitor.
Experiment 7 (FIG. 7)
[0229] MG132 is a potent, reversible, and cell-permeable proteasome inhibitor that reduces the degradation of ubiquitin-conjugated proteins in mammalian cells. MG132 is known for its induction of apoptosis and to specifically target cancer cells versus normal cells, although the reasons for this specificity have not been elucidated.sup.23,24. Soybean trypsin inhibitor is a natural serine protease inhibitor.sup.25,26. It is mentioned as Kunitz soybean trypsin inhibitor (KSTI).
[0230] The inventors treated fibroblasts from healthy individuals, from UV.sup.SS and from Cockayne syndrome of type I and II (the last being the more severe), with protease inhibitors MG132 (5 M) and KSTI (100 g/ml) for 5 hours and then tested for POLG1 levels. The inventors found that treatment with either MG132 or KSTI resulted in increased levels of POLG1 immunofluorescence in fibroblasts of healthy individuals and of UV.sup.SS (
[0231] Thus, by treatment with protease inhibitors in CS cells it is possible to restore POLG1 levels at least as high as in normal cells. The fact that in two cases the inventors did not observe increase in POLG1 levels suggests that other proteases could be targeted using additional protease inhibitors. HTRA3 may therefore not be the only protease interacting with POLG1, suggesting that treatment aimed at increasing POLG1 levels can be effective through protease inhibitors having a different specificity than only specificity for HTRA3 as a target, in particular protease inhibitors having a large-range specificity. Alternatively, the POLG1 substrate could be improperly modified by other enzymatic activities, or be poorly modified by these activities, so that the protein becomes a poor target for being degraded by HTRA3 or other proteases.
[0232] In addition, the inventors also carried out experiments aimed at assessing the relative levels of oxidative stress in Cockayne syndrome (CS) fibroblasts, thereby revealing a preminent nitroso-redox imbalance in said fibroblasts.
Experiment 8 (FIG. 8)
[0233] The inventors assessed the relative levels of oxidative stress using the fluorescent probe dichlorofluorescein diacetate (DCFHDA), which prevalently detects reactive oxygen species (ROS).sup.29. They reported that whereas UV.sup.SS cells display moderate (25%) increase of signal compared to controls, all CS cells are characterized by higher levels (1.6 to 2-fold) of oxidative stress (
[0234] High levels of ROS react with nitric oxide (NO), thereby quenching NO and promoting the formation of peroxynitrite (ONOO.sup.), which is a powerful oxidant and nitration agent.sup.31. Using the fluorescent probe dihydrorhodamine 123 (DHR123), which selectively detects peroxynitrite.sup.29, the inventors observed that UV.sup.SS and CS cells significantly accumulate peroxynitrite compared to normal fibroblasts (
[0235] CSB-dependent accumulation of ROS and peroxynitrite was confirmed in CSB-silenced and CSB deficient cells, as well as restoration of CSB-proficient values in cells CSB overexpressing revertants (
[0236] In another experiment, the inventors also showed that ROS and peroxynitrite scavenging rescues altered mitochondrial parameters in fibroblasts from Cockayne Syndrome (CS) patients. By altered mitochondrial parameters, it is in particular meant HTRA2 and/or HTRA3 and/or POLG protein(s) level(s), as illustrated below and in
Experiment 9 (FIG. 9)
[0237] The inventors quantified fluorescence intensities on cells as summarized in Table 1 before and after treatment with MnTBAP (purchased from Millipore) of DCF and of DHR123 per cell (
Experiment 10: Resistance to Protease Inhibitor KSTI and MnTBAP of Primary Cells in Culture
[0238] As KSTI (serine protease inhibitor) and MnTBAP (ROS/RNS scavenger) rescue the CS phenotype by 24 h treatment, the inventors assessed cell survival in culture at longer incubation times with either drug. They used doses of the drugs as those affecting CS cells: 100 g/ml of KSTI and 100 M MnTBAP on adult primary fibroblasts IMR-90 and BJ (from ATCC repository). KSTI did not show effect on cell survival (cell number and cell shape) after continuous treatment by 6 days, and MnTBAP by 3 days. Additional experiments are ongoing to test the survival at longer incubation times and lower doses of the drug.
3. CONCLUSIONS AND DISCUSSION: ORIGINALITY OF THE TESTED APPROACH AND EXTENT OF THE INVESTIGATIONS CARRIED OUT
[0239] Inventors' data point to a completely new mechanism to explain defects in CS cells, which are also relevant for the process of precocious ageing in other diseases, and also for the process of physiological ageing. Inventors' data do not exclude that DNA repairs alterations take place in these cells, and that these alterations may lead to the symptoms of precocious ageing and tumours. Inventors' data show that cells from patients with CS display dramatically reduced POLG1, the nuclear-coded DNA polymerase that replicates mitochondrial DNA, compared to cells from normal individuals and UV.sup.SS patients (these patients carry a mutation in CSA, as it is the case for several CS patients, the other being mutated in CSB). The inventors thus assume that as a consequence the mtDNA is not properly replicated and thereby mitochondria are dysfunctional, in spite of no apparent modifications in shape and network, compared to cells from normal individuals. Such dysfunction will lead to an increase of oxidative stress, which is essentially produced by mitochondria, likely leading to dysfunctions observed in CS cells. The inventors showed that POLG1 decrease is associated with the CSB mutation as silenced CSB in HeLa cells behave as CS cells in this aspect, and restoration of the regular levels of CSB results in returning (at least) to POLG1 values as in non-silenced cells.
[0240] The decrease in POLG1 levels in CS cells is associated with the increase in POLG2, a co-factor of POLG1 that does not contain the catalytic subunit.
[0241] The inventors also showed that reduced levels of POLG1 protein, in particular by at least 20% (but not of POLG transcripts that are not affected) are due to increased levels (in particular by at least a 10-folds increase) of HTRA3 (transcript and protein), a serine protease that has POLG1 and other proteins as potential target. Furthermore, by inhibiting HTRA3 with specific (e.g. Soybean trypsin inhibitor (KSTI)), or large-range (e.g. MG-132) inhibitors of proteases the inventors restored normal POLG1 levels in CS cells (from patients) as well as in CSB-silenced HeLa cells.
[0242] A. Diagnosis
[0243] Inventors' data show that CSA and CSB mutations in cells from Cockayne syndrome patients, and CSB-silencing are associated with decrease of the mitochondrial DNA polymerase POLG1 and with the increase in the accessory factor POLG2. In turn, decrease of POLG1 is associated with dramatic increase in the serine protease HTRA3. POLG1, POLG2 and HTRA3 levels should be considered as markers of Cockayne syndrome and possibly of events of precocious ageing or physiological ageing in general, the symptoms of which are described here above. Indeed, increased levels of HTRA3 or another protease that targets POLG1, generated from misregulation of this protease, which could be also age-driven (in normal subjects), results in decreased levels of POLG1, which in turn induce increased levels of POLG2 to compensate the impairment of the mtDNA replication complex. MtDNA replication is thereby impaired and mitochondria cannot fully ensure their function, leading to progressive dysfunction of the organelle, with reduced ATP production by mitochondria, decreased antioxidative response, and thereby increased oxidative stress, and finally altering global cellular activity, which together leads to the aged cellular and organism phenotype. Moreover, POLG1 mutations that affect the exonuclease activity of the polymerase, which corrects errors produced during DNA synthesis, have also been correlated to ageing phenotype in the literature. Reduced efficiency of mtDNA replication, as in the presence of altered levels of POLG1 and POLG2 could also lead to inefficient accuracy of the mtDNA copy, and therefore contribute to the ageing phenotype.
[0244] Mitochondrial dysfunction has been also associated with neurodegenerative diseases as overproduction of oxidative stress is a central feature of all neurodegenerative disorders (Lin et al, 2006, Nature 443: 787-95). Due to their high energy demand, muscle and nerve are the most affected tissue when mitochondrial function is impaired.
[0245] The inventors found that cells from CS patients are associated with very low levels of mitochondrial DNA polymerase gamma (POLG), which is responsible for replication of the mitochondrial genome. Levels of POLG1 are not altered in cells of healthy individuals and UV.sup.SS patients. Low levels concern the protein POLG1 and not its transcript, which is produced at regular levels in CS cells. The inventors demonstrated that silencing CSB resulted in low levels of POLG1, thereby linking the levels of this polymerase to CSA and CSB impairment.
[0246] They also found that in CS patients lower levels of POLG1 are associated with higher levels of the associated protein POLG2, compared to healthy individuals.
[0247] Moreover, they found that decreased levels of POLG1 in CS cells (from patients and after silencing) are associated with higher levels of HTRA3, a serine-protease that has POLG1 as potential target.
[0248] Therefore, POLG1, POLG2 protein and HTRA3 protein and transcript levels can be used as distinct markers for the diagnosis of Cockayne syndrome, as well as markers of mitochondrial dysfunctions associated with ageing in general, as described herein, and in neurodegenerative disorders.
[0249] B. Therapy Strategy
[0250] In the experiments provided herein, the inventors showed that anti-proteases rescue low POLG1 levels. Administration of anti-proteases is therefore a possible therapy for CS patients. It is important to recall here that absolutely no treatment is proposed to these patients, whom maximum life expectancy is around 20 years.
[0251] Although functional POLG1 can be detected by sequencing the gene or checking that there is no large mtDNA depletion (as it is the case for pathological POLG1 mutations), POLG1 mutations are associated with severe pathological phenotypes in the child, characterized by various levels of muscle and nerve impairment, but not with precocious ageing. In addition, it is not necessary to be sure that POLG1 is functional for providing a treatment within the context of the invention. Indeed the treatment of the invention can only improve mitochondrial function if POLG1 is functional. Would POLG1 not be functional, a treatment according to the invention would not be efficient.
[0252] The inventors found that treating primary fibroblasts with either inhibitor increases the levels of POLG1 in healthy individuals, demonstrating that POLG1 is indeed degraded by a protease that is targeted by MG132 or KSTI.
[0253] Importantly, the inventors found that POLG1 levels increase in most of CS cells in the presence of at least one protease inhibitor resulting in POLG1 levels at least as high as in untreated healthy cells.
[0254] It is therefore proposed to use protease inhibitors to increase POLG1 levels, whose reduction is a major indication of the CS phenotype, for treating Cockayne syndrome patients, and in particular for targeting the precocious ageing phenotype.
[0255] Regarding the ROS imbalance in Cockayne syndrome (CS) fibroblasts, the inventors showed that cells from Cockayne syndrome patients, mutated in CSA or CSB, and CSB-deficient immortalized fibroblasts (CsiAN), as well as CSB-silenced HeLa cells (siCSBA and si CSBb) display high levels of the serine proteases HTRA2 and HTRA3, and in turn low levels of the mitochondrial DNA polymerase POLG. These alterations seem at the base of the mitochondrial impairment observed in CS cells. HTRA3 and POLG levels are not altered in cells from a UV.sup.SS patient (no precocious ageing), which are mutated in CSA. Although it is not clearly elucidated what modulates HTRA3 levels, the inventors postulate, by analogy with HTRA2, whose expression increases in tissues undergoing oxidative stress.sup.27, that HTRA3 expression is also promoted in the presence of stress. CS cells have been reported to accumulate oxidative stress.sup.28. Alteration of ROS levels may also affect the nitroso-redox balance, as ROS and NO are linked. Nitroso-redox imbalance plays a key role in cell and organ failure, and this could also be the case for the aetiology of CS (Nediani et al, 2011 Antioxidants & Redox signaling 14 (2) 289-331; Takahashi, 2012 J. of Reproduction and Development 58 (1):1-9; Taverne et al, 2012 J. Appl. Physiol 112: 1644-1652)
[0256] Regarding the fact that ROS and peroxynitrite scavenging rescues altered mitochondrial parameters in fibroblasts from Cockayne Syndrome (CS) patients, the inventors reasoned that if Reactive Oxygen Species (ROS) and peroxynitrite induce serine proteases accumulation thereby resulting in POLG depletion, original parameters would be restored in CS fibroblasts treated with ROS and peroxynitrite scavengers.
[0257] Manganase(III)tetrakis(4-benzoic acid)porphyrin (MNTBAP) is a synthetic metalloporphyrin which mimics superoxide dismutase and scavenges ROS and peroxynitrite.sup.32. Treatment with MNTBAP for 24 h decreased by two thirds the levels of ROS, measured by DCFHDA, in control and UV.sup.SS fibroblasts, confirming the ROS scavenger effect of this molecule (
[0258] The inventors observed that the ROS and peroxynitrite scavenging action of MNTBAP was able to reduce by one half the levels of serine protease HTRA2 already in control cells. HTRA2 reduction was dramatically higher in UV.sup.SS and all CS cells, which originally displayed elevate levels of this protein (
[0259] Importantly, MNTBAP increased the levels of HTRA3 in control cells, but did reduce in UV.sup.SS and, to a largest extent in CS cells, where it restored control levels of HTRA3 (
[0260] Scavenging of nitro-oxidative molecules by MNTBAP resulted in increased levels of POLG1 in normal fibroblasts and, to a larger extent UV.sup.SS and CS cells, indicating that patient cells are particularly sensitive to ROS and peroxynitrite levels in the context of POLG1 regulation (
[0261] The inventors also observed that the glycolytic shift reported in CS cells is attenuated after 24 h treatment with MNTBAP, increasing the fraction of ATP produced by mitochondria (
[0262] As a consequence, it is therefore proposed to use MnTBAP to rescue altered mitochondrial parameters, in particular POLG levels, whose reduction is a major indication of the CS phenotype, and/or use MnTBAP for treating Cockayne syndrome patients.
[0263] As a short summary of the inventors' findings and conclusions disclosed herein, it is reminded that data in the literature.sup.30 and inventors' data show that CS cells display increased oxidative stress, and thereby display alteration of the oxidative stress management. Increased oxidative stress results in altered ROS levels, which in turn affects the nitroso-redox balance since these two parameters are linked (Nediani et al, 2011 Antioxidants & Redox signaling 14 (2) 289-331; Takahashi, 2012 J. of Reproduction and Development 58 (1):1-9; Taverne et al, 2012 J. Appl. Physiol 112: 1644-1652). Also, CSB mutation(s) result(s) in increased ROS levels and POLG1/POLG2/HTRA3 alterations. According to inventors' data, POLG1/POLG2 alterations induce mitochondrial impairment, revealed notably by altered mitochondrial DNA content and altered mitochondrial mass, reduced mitochondrial respiration, which in turn can generate more ROS. Moreover, the inventors consider that there is a relationship between CSB and the regulation of the levels of ROS. Ultimately, CSB mutation(s) increase(s) ROS levels by affecting the expression of ROS-regulating factors. ROS levels also increase because of dysfunctional mitochondria (due to POLG1/POLG2/HTRA3 alterations, as shown by the inventors), which is a fact also dependent of the CSB mutation(s). The combination of these two aspects results in unbalanced ROS levels (and thereby nitroso-redox levels), which act by promoting ageing. Promoting ageing by ROS is part of the largely accepted free radical and mitochondrial theories of ageing, well discussed in the literaturel.sup.8 (Cui, H., Kong, Y. & Zhang, H. Oxidative stress, mitochondrial dysfunction, and aging. Journal of signal transduction 2012, 646354, doi: 10.1155/2012/646354 (2012)). Therefore, either blocking HTRA3 degradation or scavenging ROS by MnTBAP results in reducing ROS levels, thereby restoring normal conditions (restoring mitochondrial function).
[0264] Since it is possible that the defects observed and discussed herein with respect to the CS phenotype may appear, although at a minor extent, also during normal (physiological) ageing, the treatment(s) described herein may also be considered in the context of preventive or prophylactic therapies. According to a particular embodiment, all the methods described herein are used for preventive or prophylactic purpose.
[0265] Acronyms used within the present disclosure: Ataxia telangiectasia (A-T); Base excision repair (BER); Bloom syndrome (BS); Cockayne syndrome (CS); DNA polymerase gamma (POLG1); DNA polymerase subunit gamma-2 (POLG2); Double strand break repair (DSB); Global genome NER (GG-NER); Fanconi anemia (FA); High-temperature requirement factor A2 (HTRA2); High-temperature requirement factor A3 (HTRA3); Hutchinson-Guilford progeria syndrome (HGPS); Kunitz Soybean trypsin inhibitor (KSTI); Manganese (III) tetrakis (4-benzoic acid)porphyrin (MnaTBP); Mitochondrial transcription factor A (TFAM); Nucleotide excision repair (NER); Rothmund-Thomson syndrome (RTS); Reactive oxygen species (ROS); Spontaneous sister chromatid exchanges (SCE); Transcription-coupled NER (TC-NER also called TCR); Trichothiodystropy (TTD); Xerodema Pigmentosum (XP); Werner syndrome (WS)
REFERENCES
[0266] 1. Nance M A, Berry S A. Cockayne syndrome: review of 140 cases. American journal of medical genetics 1992, 42(1): 68-84. [0267] 2. Kleijer W J, Laugel V, Berneburg M, Nardo T, Fawcett H, Gratchev A, et al. Incidence of DNA repair deficiency disorders in western Europe: Xeroderma pigmentosum, Cockayne syndrome and trichothiodystrophy. DNA repair 2008, 7(5): 744-750. [0268] 3. Henning K A, Li L, Iyer N, McDaniel L D, Reagan M S, Legerski R, et al. The Cockayne syndrome group A gene encodes a WD repeat protein that interacts with CSB protein and a subunit of RNA polymerase II TFIIH. Cell 1995, 82(4): 555-564. [0269] 4. Troelstra C, van Gool A, de Wit J, Vermeulen W, Bootsma D, Hoeijmakers J H. ERCC6, a member of a subfamily of putative helicases, is involved in Cockayne's syndrome and preferential repair of active genes. Cell 1992, 71(6): 939-953. [0270] 5. Laugel V, Dalloz C, Durand M, Sauvanaud F, Kristensen U, Vincent M C, et al. Mutation update for the CSB/ERCC6 and CSA/ERCC8 genes involved in Cockayne syndrome. Human mutation 2010, 31(2): 113-126. [0271] 6. Ganesan A, Spivak G, Hanawalt P C. Transcription-coupled DNA repair in prokaryotes. Progress in molecular biology and translational science 2012, 110: 25-40. [0272] 7. Velez-Cruz R, Egly J M. Cockayne syndrome group B (CSB) protein: at the crossroads of transcriptional networks. Mechanisms of ageing and development 2013, 134(5-6): 234-242. [0273] 8. Khobta A, Epe B. Repair of oxidatively generated DNA damage in Cockayne syndrome. Mechanisms of ageing and development 2013, 134(5-6): 253-260. [0274] 9. Aamann M D, Sorensen M M, Hvitby C, Berquist B R, Muftuoglu M, Tian J, et al. Cockayne syndrome group B protein promotes mitochondrial DNA stability by supporting the DNA repair association with the mitochondrial membrane. FASEB journal: official publication of the Federation of American Societies for Experimental Biology 2010, 24(7): 2334-2346. [0275] 10. Kamenisch Y, Fousteri M, Knoch J, von Thaler A K, Fehrenbacher B, Kato H, et al. Proteins of nucleotide and base excision repair pathways interact in mitochondria to protect from loss of subcutaneous fat, a hallmark of aging. The Journal of experimental medicine 2010, 207(2): 379-390. [0276] 11. Nardo T, Oneda R, Spivak G, Vaz B, Mortier L, Thomas P, et al. A UV-sensitive syndrome patient with a specific CSA mutation reveals separable roles for CSA in response to UV and oxidative DNA damage. Proceedings of the National Academy of Sciences of the U.S. Pat. No. 2,009,106(15): 6209-6214. [0277] 12. Lehmann A R. DNA repair-deficient diseases, xeroderma pigmentosum, Cockayne syndrome and trichothiodystrophy. Biochimie 2003, 85(11): 1101-1111. [0278] 13. Kamenisch Y, Berneburg M. Progeroid syndromes and UV-induced oxidative DNA damage. The journal of investigative dermatology Symposium proceedings/the Society for Investigative Dermatology, Inc [and] European Society for Dermatological Research 2009, 14(1): 8-14. [0279] 14. Hofer A C, Tran R T, Aziz O Z, Wright W, Novelli G, Shay J, et al. Shared phenotypes among segmental progeroid syndromes suggest underlying pathways of aging. The journals of gerontology Series A, Biological sciences and medical sciences 2005, 60(1): 10-20. [0280] 15. Coppede F. Premature aging syndrome. Advances in experimental medicine and biology 2012, 724: 317-331. [0281] 16. Killoran M P, Keck J L. Sit down, relax and unwind: structural insights into RecQ helicase mechanisms. Nucleic acids research 2006, 34(15): 4098-4105. [0282] 17. Stumpf J D, Copeland W C. Mitochondrial DNA replication and disease:
[0283] insights from DNA polymerase gamma mutations. Cellular and molecular life sciences: CMLS 2011, 68(2): 219-233. [0284] 18. Cui, H., Kong, Y. & Zhang, H. Oxidative stress, mitochondrial dysfunction, and aging. Journal of signal transduction 2012, 646354, doi: 10.1155/2012/646354 (2012). [0285] 19. Biard, D. S. Untangling the relationships between DNA repair pathways by silencing more than 20 DNA repair genes in human stable clones. Nucleic acids research 35, 3535-3550, doi: 10.1093/nar/gkm 195 (2007). [0286] 20. Lim, S. E., Longley, M. J. & Copeland, W. C. The mitochondrial p55 accessory subunit of human DNA polymerase gamma enhances DNA binding, promotes processive DNA synthesis, and confers N-ethylmaleimide resistance. The Journal of biological chemistry 274,38197-38203 (1999). [0287] 21. Bovvden, M. A. et al. High-temperature requirement factor A3 (Htra3): a novel serine protease and its potential role in ovarian function and ovarian cancers. Molecular and cellular endocrinology 327, 13-18, doi: 10.1016/j.mce.2010.06.001 (2010). [0288] 22. Dynon, K. et al. HTRA3 as an early marker for preeclampsia: specific monoclonal antibodies and sensitive high-throughput assays for serum screening. PloS one 7, e45956, doi: 10.1371/journal.pone.0045956 (2012). [0289] 23. Gartel, A. L. A new target for proteasome inhibitors: FoxMl. Expert opinion on investigational drugs 19, 235-242, doi: 10.1517/13543780903563364 (2010). [0290] 24. Shah, J. J. & Orlowski, R. Z. Proteasome inhibitors in the treatment of multiple myeloma. Leukemia 23, 1964-1979, doi: 10.1038/Ieu.2009.173 (2009). [0291] 25. Kunitz, M. Crystallization of a Trypsin Inhibitor from Soybean. Science 101, 668-669, doi: 10.1126/science. 101.2635.668 (1945). [0292] 26. Papastoitsis, G. & Wilson, K. A. Initiation of the degradation of the soybean kunitz and bowman-birk trypsin inhibitors by a cysteine protease. Plant physiology 96, 1086-1092 (1991). [0293] 27. Ding, X. et al. Enhanced HtrA2/Omi expression in oxidative injury to retinal pigment epithelial cells and murine models of neurodegeneration. Investigative ophthalmology &visual science 50, 4957-4966, doi:10.1167/iovs.09-3381 (2009). [0294] 28. Pascucci, B. et al. An altered redox balance mediates the hypersensitivity of Cockayne syndrome primary fibroblasts to oxidative stress. Aging Cell 11, 520-529, doi:10.1111/j.1474-9726.2012.00815.x (2012). [0295] 29. Deng, T., Xu, K., Zhang, L. & Zheng, X. Dynamic determination of Ox-LDL-induced oxidative/nitrosative stress in single macrophage by using fluorescent probes. Cell biology international 32, 1425-1432, doi:10.1016/j.cellbi.2008.08.013 (2008). [0296] 30. Nardo, T. et al. A UV-sensitive syndrome patient with a specific CSA mutation reveals separable roles for CSA in response to UV and oxidative DNA damage. Proc Natl Acad Sci USA 106, 6209-6214, doi:0902113106 [pii] 10.1073/pnas.0902113106 (2009). [0297] 31. Wink, D. A., & Mitchell J. B. Chemical biology of nitric oxide: Insights into regulatory, cytotoxic, and cytoprotective mechnaisms of nitric oxide. Free Radic. Biol. Med. 25, 436-56 (1998) [0298] 32. Batinic-Haberle, I. et al. Pure MnTBAP selectively scavenges peroxynitrite over superoxide: comparison of pure and commercial MnTBAP samples to MnTE-2-PyP in two models of oxidative stress injury, an SOD-specific Escherichia coli model and carrageenan-induced pleurisy. Free Radic Biol Med 46, 192-201, doi:10.1016/j.freeradbiomed.2008.09.042 (2009).