SiRNAs with vinylphosphonate at the 5′ end of the antisense strand

11560563 · 2023-01-24

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to nucleic acids for inhibiting expression of a target gene in a cell, comprising at least one duplex region that comprises at least a portion of a first strand and at least a portion of a second strand that is at least partially complementary to the first strand, wherein said first strand is at least partially complementary to at least a portion of RNA transcribed from said target gene to be inhibited. The first strand of the nucleic acid has a terminal 5′ (E)-vinylphosphonate nucleotide that is linked to the second nucleotide in the first strand by a phosphodiester linkage.

Claims

1. A nucleic acid for inhibiting expression of a target gene in a cell, comprising at least one duplex region that comprises at least a portion of a first strand and at least a portion of a second strand that is at least partially complementary to the first strand, wherein said first strand is at least partially complementary to at least a portion of RNA transcribed from said target gene to be inhibited, wherein: the first strand has a terminal 5′ (E)-vinylphosphonate nucleotide; the terminal 5′ (E)-vinylphosphonate nucleotide is linked to the second nucleotide in the first strand by a phosphodiester linkage; all even-numbered nucleotides of the first strand are modified by a 2′-F modification; all odd-numbered nucleotides of the first strand are modified by a 2′-OMe modification; all nucleotides of the second strand in positions corresponding to nucleotides 11-13 of the first strand are modified by a 2′-F modification; and all nucleotides of the second strand other than the nucleotides corresponding to nucleotides 11-13 of the first strand are modified by a 2′-OMe modification.

2. The nucleic acid of claim 1, wherein the first strand comprises more than 1 phosphodiester linkage.

3. The nucleic acid of claim 1, wherein the first strand comprises phosphodiester linkages between i) at least the terminal three 5′ nucleotides; or ii) at least the terminal four 5′ nucleotides.

4. The nucleic acid of claim 1, wherein the first strand comprises i) at least one phosphorothioate (ps) linkage.

5. The nucleic acid of claim 1, wherein the first strand comprises i) a phosphorothioate linkage between the terminal two 3′ nucleotides; or ii) phosphorothioate linkages between the terminal three 3′ nucleotides.

6. The nucleic acid of claim 5, wherein the linkages between the other nucleotides in the first strand are phosphodiester linkages.

7. The nucleic acid of claim 1, wherein the second strand comprises i) a phosphorothioate linkage between the terminal two or three 3′ nucleotides; and/or ii) a phosphorothioate linkage between the terminal two or three 5′ nucleotides.

8. The nucleic acid of claim 1, wherein the terminal 5′ (E)-vinylphosphonate nucleotide is an RNA nucleotide.

9. The nucleic acid of claim 1, wherein i) the first strand of the nucleic acid has a length in the range of 15-30 nucleotides; and/or ii) the second strand of the nucleic acid has a length in the range of 15-30 nucleotides.

10. A conjugate for inhibiting expression of a target gene in a cell, said conjugate comprising a nucleic acid portion and one or more ligand portions, said nucleic acid portion comprising a nucleic acid as defined in claim 1.

11. The conjugate of claim 10, wherein the second strand of the nucleic acid is conjugated to the one or more ligand portion(s).

12. The conjugate of claim 10, wherein the ligand portion comprises i) one or more GaINAc ligand; ii) one or more GaINAc ligand derivative; or iii) a GaINAc moiety conjugated at the 5′ end of the second strand of the nucleic acid.

13. A composition comprising a nucleic acid of any one of claims 1 to 9 or a conjugate of any one of claims 10 to 12 and a physiologically acceptable excipient.

14. The nucleic acid of claim 9, wherein: i) the first strand of the nucleic acid has a length in the range of 19-25 nucleotides; and/or ii) the second strand of the nucleic acid has a length in the range of 19-25 nucleotides.

15. The conjugate of claim 12, wherein the ligand portion comprises a GaINAc moiety conjugated at the 5′ end of the second strand of the nucleic acid through a linker moiety.

16. A method for prophylaxis or treatment of a disease or disorder in a subject in need thereof, comprising administering a nucleic acid according to any one of claims 1 to 9 or a conjugate according to any one of claims 10 to 12, to said subject.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) FIG. 1—GalNAc siRNA conjugates with vinylphosphonate at the 5′ end of the first strand and phosphodiester internucleotide linkages at the 5′ end of the first strand effect improved reduction of TTR target mRNA levels in vitro.

(2) FIG. 2—GalNAc siRNA conjugates with vinylphosphonate at the 5′ end of the first strand and phosphodiester internucleotide linkages at the 5′ end of the first strand effect improved reduction of TMPRSS6 target mRNA levels in vitro.

(3) FIG. 3—GalNAc siRNA conjugates with vinylphosphonate at the 5′ end of the first strand and phosphodiester internucleotide linkages at the 5′ end of the first strand effect reduction of ALDH2 target mRNA levels in vitro.

(4) FIG. 4—GalNAc siRNA conjugates with vinylphosphonate at the 5′ end of the first strand and phosphodiester internucleotide linkages at the 5′ end of the first strand effect improved reduction of ALDH2 target mRNA levels in vitro.

(5) FIG. 5—GalNAc siRNA conjugates with vinylphosphonate at the 5′ end of the first strand and phosphodiester internucleotide linkages at the 5′ end of the first strand are stable in acidic tritosome lysate.

(6) FIG. 6—GalNAc siRNA conjugates with vinylphosphonate at the 5′ end of the first strand and phosphodiester internucleotide linkages at the 5′ end of the first strand are stable in acidic tritosome lysate.

(7) FIG. 7—GalNAc siRNA conjugates with vinylphosphonate at the 5′ end of the first strand and phosphodiester internucleotide linkages at the 5′ end of the first strand are stable in acidic tritosome lysate.

(8) FIG. 8—GalNAc siRNA conjugates with vinylphosphonate at the 5′ end of the first strand and phosphodiester internucleotide linkages at the 5′ end of the first strand are stable in acidic tritosome lysate.

(9) FIG. 9—GalNAc siRNA conjugates with vinylphosphonate at the 5′ end of the first strand and phosphodiester internucleotide linkages at the 5′ end of the first strand effect improved reduction of TMPRSS6 target mRNA levels in vivo.

(10) FIG. 10—GalNAc siRNA conjugates with vinylphosphonate at the 5′ end of the first strand and phosphodiester internucleotide linkages at the 5′ end of the first strand effect improved reduction of TMPRSS6 target mRNA levels in vivo over six weeks.

(11) FIG. 11—GalNAc siRNA conjugates with vinylphosphonate at the 5′ end of the first strand and phosphodiester internucleotide linkages at the 5′ end of the first strand effect reduction of ALDH2 target mRNA levels in vitro.

(12) FIG. 12—Oligonucleotide synthesis of 3′ and 5′ GalNAc conjugated oligonucleotides precursors.

(13) FIGS. 13a, 13b and 13c—the structure of GalNAc ligands referred to herein respectively as GN, GN2 and GN3 to which the oligonuclotides were conjugated.

(14) FIG. 14—shows inhibition of TMPRSS6 gene expression in primary murine hepatocytes 24 h following treatment with TMPRSS6-siRNA carrying vinyl-(E)-phosphonate 2′-OMe-Uracil at the 5-position of the anti-sense strand and two phosphorothioate linkages between the first three nucleotides (X0204), vinyl-(E)-phosphonate 2′-OMe-Uracil at the 5-position of the anti-sense strand and phosphodiester bonds between the first three nucleotides (X0205), (X0139) or tetrameric (X0140)) or a tree like trimeric GalNAc-cluster (X0004) or a non-targeting GalNAc-siRNA (X0028) at indicated concentrations or left untreated (UT).

(15) FIG. 15—shows Serum stability of siRNA-conjugates vs. less stabilized positive control for nuclease degradation.

(16) FIG. 16—shows the synthesis of A0268 which is a 3′ mono-GalNAc conjugated single stranded oligonucleotide and is the second strand starting material in the synthesis of an exemplary conjugate of the invention.

(17) FIG. 17—shows the synthesis of A0006 which is a 5′ tri-antennary GalNAc conjugated single stranded oligonucleotide is the second strand starting material in the synthesis of an exemplary conjugate of the invention.

EXAMPLES

(18) Herein we show examples of GalNAc siRNA conjugates which are modified with (E)-vinylphosphonate (VP) at the 5′ end of the first strand and, in addition to that, contain either phosphorothioate (PS) internucleotide linkages or phosphodiester internucleotide linkages between the first, second and third nucleotide at the 5′ end of the first strand. In context of siRNA conjugates with each one serinol-linked GalNAc moiety at the 5′ end and at the 3′ end of the second strand, siRNA conjugates with either (I) PS, or (II) VP without PS, or (III) VP with PS at the 5′ end of the first strand are equally stable when incubated with acidic tritosome lysate. However, we show better dose response for target gene knockdown with GalNAc siRNA conjugates with VP and without PS at the 5′ end of the first strand.

(19) Material & Methods

(20) Primers:

(21) TABLE-US-00023 TTR fw TGGACACCAAATCGTACTGGAA rev CAGAGTCGTTGGCTGTGAAAAC probe BHQ1-ACTTGGCATTTCCCCGTTCCATGAATT-FAM TMPRSS6 fw CCGCCAAAGCCCAGAAG rev GGTCCCTCCCCAAAGGAATAG probe BHQ1-CAGCACCCGCCTGGGAACTTACTACAAC-FAM ALDH2 fw GGCAAGCCTTATGTCATCTCGT rev GGAATGGTTTTCCCATGGTACTT probe BHQ1-TGAAATGTCTCCGCTATTACGCTGGCTG-FAM ApoB fw AAAGAGGCCAGTCAAGCTGTTC rev GGTGGGATCACTTCTGTTTTGG probe BHQ1-CAGCAACACACTGCATCTGGTCTCTACCA-VIC PTEN fw CACCGCCAAATTTAACTGCAGA rev AAGGGTTTGATAAGTTCTAGCTGT probe BHQ1-TGCACAGTATCCTTTTGAAGACCATAACCCA-VIC

(22) Cell Culture

(23) Primary murine hepatocytes (Thermo Scientific: GIBCO Lot: #MC798) were thawn and cryo-preservation medium exchanged for Williams E medium supplemented with 5% FBS, 1 μM dexamethasone, 2 mM GlutaMax, 1% PenStrep, 4 mg/ml human recombinant insulin, 15 mM Hepes. Cell density was adjusted to 250,000 cells per 1 ml. 100 μl per well of this cell suspension were seeded into collagen pre-coated 96 well plates. The test article was prediluted in the same medium (5 times concentrated) for each concentration and 25 μl of this prediluted siRNA or medium only were added to the cells. Cells were cultured in at 37° C. and 5% CO.sub.2. 24 h post treatment the supernatant was discarded, and cells were washed in cold PBS and 250 μl RNA-Lysis Buffer S (Stratec) was added. Following 15 min incubation at room temperature plates were storage at −80° C. until RNA isolation according to the manufacturer's protocol.

(24) TaqMan Analysis

(25) For mTTR & ApoB MultiPlex TaqMan analysis 10 μl isolated RNA for each treatment group were mixed with 10 μl PCR mastermix (TAKYON low Rox) containing 600 nM mTTR-primer, 400 nM ApoB-primer and 200 nM of each probe as well as 0.5 units Euroscript II RT polymerase with 0.2 units RNAse inhibitor. TaqMan analysis was performed in 384-well plate with a 10 min RT step at 48° C., 3 min initial denaturation at 95° C. and 40 cycles of 95° C. for 10 s and 60° C. for 1 min.

(26) For TMPRSS6 & ApoB MultiPlex TaqMan analysis 10 μl isolated RNA for each treatment group were mixed with 10 μl PCR mastermix (TAKYON low Rox) containing 800 nM TMPRSS6 primer, 100 nM ApoB primer and 200 nM of either probe as well as 0.5 units Euroscript II RT polymerase with 0.2 units RNAse inhibitor. TaqMan analysis was performed in 384-well plate with a 10 min reverse transcription step at 48° C., 3 min initial denaturation at 95° C. and 40 cycles of 95° C. for 10 s and 60° C. for 1 min.

(27) Tritosome Stability Assay

(28) To probe for RNAase stability in the endosomal/lysosomal compartment of hepatic cells in vitro siRNA was incubated for 0 h, 4 h, 24 h or 72 h in Sprague Dawley Rat Liver Tritosomes (Tebu-Bio, CatN.: R0610.LT, lot: 1610405, pH: 7.4, 2.827 Units/ml). To mimic the acidified environment the Tritosomes were mixed 1:10 with low pH buffer (1.5 M acetic acid, 1.5 M sodium acetate pH 4.75). 30 μl of this acidified Tritosomes Following 10 μl siRNA (20 μM) were mixed with and incubated for the indicated times at 37° C. Following incubation RNA was isolated with the Clarity OTX Starter Kit-Cartridges (Phenomenex CatNo: KSO-8494) according to the manufacturer's protocol for biological fluids. Lyophilized RNA was reconstituted in 30 μl H.sub.2O, mixed with 4× loading buffer and 5 μl were loaded to a 20% TBE-polyacrylamide gel electrophoresis (PAGE) for separation qualitative semi-quantitative analysis. PAGE was run at 120 V for 2 h and RNA visualized by Ethidum-bromide staining with subsequent digital imaging with a Biorad Imaging system.

(29) TABLE-US-00024 Sequences Duplex Strand Sequence (A first strand; B, second strand, both 5′-3′) X0181 X0181A mU(ps)fU(ps)mAfUmAfGmAfGmCfAmAfGmAfAmCfAmCfUmG(ps)fU(ps)mU X0181B Ser(GN)(ps)fA(ps)mA(ps)fCmAfGmUfGmUfUmCfUmUfGmCfUmCfUmAfU (ps)mA(ps)fA(ps)Ser(GN) X0349 X0349A (vp)-mUfUmAfUmAfGmAfGmCfAmAfGmAfAmCfAmCfUmG(ps)fU(ps)mU X0349B Ser(GN)(ps)fA(ps)mA(ps)fCmAfGmUfGmUfUmCfUmUfGmCfUmCfUmAfU (ps)mA(ps)fA(ps)Ser(GN) X0430 X0430A (vp)-mU(ps)fU(ps)mAfUmAfGmAfGmCfAmAfGmAfAmCfAmCfUmG(ps)fU (ps)mU X0430B Ser(GN)(ps)fA(ps)mA(ps)fCmAfGmUfGmUfUmCfUmUfGmCfUmCfUmAfU (ps)mA(ps)fA(ps)Ser(GN) X0322 X0322A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA X0322B Ser(GN)(ps)fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU (ps)fU(ps)Ser(GN) X0365 X0365A (vp)-mUfAmCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA X0365B Ser(GN)(ps)fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU (ps)fA(ps)Ser(GN) X0431 X0431A (vp)-mU(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA X0431B Ser(GN)(ps)fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU (ps)fA(ps)Ser(GN) X0319 X0319A mA(ps)fA(ps)mUfGmUfUmUfUmCfCmUfGmCfUmGfAmC(ps)fG(ps)mG X0319B Ser(GN)(ps)fC(ps)mC(ps)fGmUfCmAfGmCfAmGfGmAfAmAfAmCfA(ps)mU (ps)fU(ps)Ser(GN) X0362 X0362A (vp)-mUfAmUfGmUfUmUfUmCfCmUfGmCfUmGfAmC(ps)fG(ps)mG X0362B Ser(GN)(ps)fC(ps)mC(ps)fGmUfCmAfGmCfAmGfGmAfAmAfAmCfA(ps)mU (ps)fA(ps)Ser(GN) X0320 X0320A mU(ps)fC(ps)mUfUmCfUmUfAmAfAmCfUmGfAmGfUmU(ps)fU(ps)mC X0320B Ser(GN)(ps)fG(ps)mA(ps)fAmAfCmUfCmAfGmUfUmUfAmAfGmAfA(ps)mG (ps)fA(ps)Ser(GN) X0363 X0363A (vp)-mUfCmUfUmCfUmUfAmAfAmCfUmGfAmGfUmU(ps)fU(ps)mC X0363B Ser(GN)(ps)fG(ps)mA(ps)fAmAfCmUfCmAfGmUfUmUfAmAfGmAfA(ps)mG (ps)fA(ps)Ser(GN) X0028 X0028A mU(ps)fC(ps)mGfAmAfGmUfAmUfUmCfCmGfCmGfUmA(ps)fC(ps)mG X0028B [ST23(ps)]3ST41(ps)fCmGUmAfCmGfCmGfGmAfAmUfAmCfUmUfC(ps)mG (ps)fA X0027 X0027A mA(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA X0027B [ST23(ps)]3ST41(ps)fU(ps)mC(ps)fAmCfCmUfGmCfUmUfCmUfUmCfUmG fG(ps)mU(ps)fU X0204 X0204A (vp)-mU(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA X0204B [ST23(ps)]3ST41(ps)fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU (ps)fA X0205 X0205A (vp)-mUfAmCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA X0205B [ST23(ps)]3ST41(ps)fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU (ps)fA X0207 X0207A mU(ps)fA(ps)mCfCmAfGmAfAmGfAmAfGmCfAmGfGmU(ps)fG(ps)mA X0207B [ST23(ps)]3ST41(ps)fUmCfAmCfCmUfGmCfUmUfCmUfUmCfUmGfG(ps)mU (ps)fA X0477 X0477A mU(ps)fC(ps)mUfUmCfUmUfAmAfAmCfUmGfAmGfUmU(ps)fU(ps)mC X0477B Ser(GN)(ps)mG(ps)mA(ps)mAmAmCmUfCfAfGmUmUmUmAmAmGmAmA (ps)mG(ps)mA(ps)Ser(GN) X0478 X0478A (vp)-mUfCmUfUmCfUmUfAmAfAmCfUmGfAmGfUmU(ps)fU(ps)mC X0478B Ser(GN)(ps)mG(ps)mA(ps)mAmAmCmUfCfAfGmUmUmUmAmAmGmAmA (ps)mG(ps)mA(ps)Ser(GN)

Example 1

(30) GalNAc siRNA conjugates with vinylphosphonate at the 5′ end of the first strand and phosphodiester internucleotide linkages at the 5′ end of the first strand effect improved reduction of TTR target mRNA levels in vitro.

(31) All tested conjugates contain each one Serinol-linked GalNAc moiety at the 5′ end and at the 3′ end of the second strand. The siRNAs are modified with alternating 2′-OMe/2′-F and contain each two phosphorothioate internucleotide linkages at their 5′ and 3′ termini, if not stated differently. X0181 contains two phosphorothioate internucleotide linkages at the 5′ end of the first strand. X0430 contains a vinylphosphonate modification at the first nucleotide and two phosphorothioate internucleotide linkages at the 5′ end of the first strand. X0349 contains a vinylphosphonate modification at the first nucleotide and no phosphorothioate internucleotide linkages at the 5′ end of the first strand. Compared to X0181 and X0430, X0349 shows improved reduction of TTR target gene levels in vitro. “ut” indicates an untreated sample which the other samples were normalised to. “Luc” indicates an siRNA targeting Luciferase (X0028), which was used as non-targeting control and does not reduce target mRNA levels.

(32) The experiment was conducted in mouse primary hepatocytes. 25,000 cells were seeded per 96-well and treated with 0.001-10 nM GalNAc-conjugated siRNA directly after plating. Cells were lysed after 24 h, total RNA was extracted and TTR and ApoB mRNA levels were determined by Taqman qRT-PCR. Each bar represents mean±SD from three technical replicates.

(33) Data are shown in FIG. 1.

Example 2

(34) GalNAc siRNA conjugates with vinylphosphonate at the 5′ end of the first strand and phosphodiester internucleotide linkages at the 5′ end of the first strand effect improved reduction of TMPRSS6 target mRNA levels in vitro.

(35) All tested conjugates contain each one Serinol-linked GalNAc moiety at the 5′ end and at the 3′ end of the second strand. The siRNAs are modified with alternating 2′-OMe/2′-F and contain each two phosphorothioate internucleotide linkages at their 5′ and 3′ termini, if not stated differently. X0322 contains two phosphorothioate internucleotide linkages at the 5′ end of the first strand. X0431 contains a vinylphosphonate modification at the first nucleotide and two phosphorothioate internucleotide linkages at the 5′ end of the first strand. X0365 contains a vinylphosphonate modification at the first nucleotide and no phosphorothioate internucleotide linkages at the 5′ end of the first strand. Compared to X0322 and X0431, X0365 shows improved reduction of TMPRSS6 target gene levels in vitro. “ut” indicates an untreated sample, which the other samples were normalised to. “Luc” indicates an siRNA targeting Luciferase (X0028), which was used as non-targeting control and does not reduce target mRNA levels.

(36) The experiment was conducted in mouse primary hepatocates. 25,000 cells were seeded per 96-well and treated with 0.01-100 nM GalNAc-conjugated siRNA directly after plating. Cells were lysed after 24 h, total RNA was extracted and TMPRSS6 and ApoB mRNA levels were determined by Taqman qRT-PCR. Each bar represents mean±SD from three technical replicates.

(37) Data are shown in FIG. 2.

(38) It is clear from examples 1 and 2 that the presence of a vinylphosphonate at the 5′ end of the antisense strand increases the activity of an siRNA. This activity is further increased when the linkages between the first three nucleotides at the 5′ end of the first strand are phosphodiester linkages rather than phosphorothioate linkages. This effect is independent of the nucleotide sequence of the siRNAs.

Example 3

(39) GalNAc siRNA conjugates with vinylphosphonate at the 5′ end of the first strand and phosphodiester internucleotide linkages at the 5′ end of the first strand effect reduction of ALDH2 target mRNA levels in vitro.

(40) All tested conjugates contain each one Serinol-linked GalNAc moiety at the 5′ end and at the 3′ end of the second strand. The siRNAs are modified with alternating 2′-OMe/2′-F and contain each two phosphorothioate internucleotide linkages at their 5′ and 3′ termini, if not stated differently. X0319 contains two phosphorothioate internucleotide linkages at the 5′ end of the first strand. X0362 contains a vinylphosphonate modification at the first nucleotide and no phosphorothioate internucleotide linkages at the 5′ end of the first strand. Both siRNA conjugates reduce ALDH2 target gene levels in vitro. “ut” indicates an untreated sample, which the other samples were normalised to. “Luc” indicates an siRNA targeting Luciferase (X0028), which was used as non-targeting control and does not reduce target mRNA levels.

(41) The experiment was conducted in mouse primary hepatocytes. 25,000 cells were seeded per 96-well and treated with 0.1-100 nM GalNAc-conjugated siRNA directly after plating. Cells were lysed after 24 h, total RNA was extracted and ALDH2 and ApoB mRNA levels were determined by Taqman qRT-PCR. Each bar represents mean±SD from three technical replicates.

(42) Data are shown in FIG. 3.

Example 4

(43) GalNAc siRNA conjugates with vinylphosphonate at the 5′ end of the first strand and phosphodiester internucleotide linkages at the 5′ end of the first strand effect improved reduction of ALDH2 target mRNA levels in vitro.

(44) All tested conjugates contain each one Serinol-linked GalNAc moiety at the 5′ end and at the 3′ end of the second strand. The siRNAs are modified with alternating 2′-OMe/2′-F and contain each two phosphorothioate internucleotide linkages at their 5′ and 3′ termini, if not stated differently. X0320 contains two phosphorothioate internucleotide linkages at the 5′ end of the first strand. X0363 contains a vinylphosphonate modification at the first nucleotide and no phosphorothioate internucleotide linkages at the 5′ end of the first strand. Compared to X0320, X0363 shows improved reduction of ALDH2 target gene levels in vitro. “ut” indicates an untreated sample, which the other samples were normalised to. “Luc” indicates an siRNA targeting Luciferase (X0028), which was used as non-targeting control and does not reduce target mRNA levels.

(45) The experiment was conducted in mouse primary hepatocates. 25,000 cells were seeded per 96-well and treated with 0.1-100 nM GalNAc-conjugated siRNA directly after plating. Cells were lysed after 24 h, total RNA was extracted and ALDH2 and ApoB mRNA levels were determined by Taqman qRT-PCR. Each bar represents mean±SD from three technical replicates.

(46) Data are shown in FIG. 4.

(47) The anti-ALDH2 siRNAs of examples 3 and 4 have different sequences. These examples show that the presence of a vinylphosphonate and phosphorothioate linkages at the 5′ end of the first strand improve activity of the siRNA regardless of the sequence.

Example 5

(48) GalNAc siRNA conjugates with vinylphosphonate at the 5′ end of the first strand and phosphodiester internucleotide linkages at the 5′ end of the first strand are stable in acidic tritosome lysate.

(49) All tested conjugates contain each one Serinol-linked GalNAc moiety at the 5′ end and at the 3′ end of the second strand. The siRNAs are modified with alternating 2′-OMe/2′-F and contain each two phosphorothioate internucleotide linkages at their 5′ and 3′ termini, if not stated differently. X0181 contains two phosphorothioate internucleotide linkages at the 5′ end of the first strand. X0430 contains a vinylphosphonate modification at the first nucleotide (“vp-mU”) and two phosphorothioate (“PS”) internucleotide linkages at the 5′ end of the first strand. X0349 contains a vinylphosphonate modification at the first nucleotide and no phosphorothioate internucleotide linkages at the 5′ end of the first strand. All GalNAc siRNA conjugates are stable for at least 72 hours. This is surprising because it is generally thought in the art that a phosphorothioate internucleotide linkages are required at the ends of siRNAs to be stable. The inventors have surprisingly found that in the presence of a vinylphosphonate, phosphorothioate internucleotide linkages are not required at the end at which the vinylphosphonate is located. The number of phosphorothioate internucleotide linkages can therefore be unexpectedly reduced without leading to unstable molecules. This is an advantage because such molecules have fewer stereogenic centres (the phosphorothioate are stereogenic).

(50) To assess stability, 5 μM siRNA conjugate was incubated with acidic rat tritosome extract (pH 5) at 37° C. for 0, 4, 24, and 72 hours. After incubation, RNA was purified, separated on 20% TBE polyacrylamide gels and visualised by ethidium bromide staining.

(51) Data are shown in FIG. 5.

Example 6

(52) GalNAc siRNA conjugates with vinylphosphonate at the 5′ end of the first strand and phosphodiester internucleotide linkages at the 5′ end of the first strand are stable in acidic tritosome lysate.

(53) All tested conjugates contain each one Serinol-linked GalNAc moiety at the 5′ end and at the 3′ end of the second strand. The siRNAs are modified with alternating 2′-OMe/2′-F and contain each two phosphorothioate internucleotide linkages at their 5′ and 3′ termini, if not stated differently. X0322 contains two phosphorothioate internucleotide linkages at the 5′ end of the first strand. X0431 contains a vinylphosphonate modification at the first nucleotide (“vp-mU”) and two phosphorothioate (“PS”) internucleotide linkages at the 5′ end of the first strand. X0365 contains a vinylphosphonate modification at the first nucleotide and no phosphorothioate internucleotide linkages at the 5′ end of the first strand. All GalNAc siRNA conjugates are stable for at least 72 hours.

(54) To assess stability, 5 μM siRNA conjugate was incubated with acidic rat tritosome extract (pH 5) at 37° C. for 0, 4, 24, and 72 hours. After incubation, RNA was purified, separated on 20% TBE polyacrylamide gels and visualised by ethidium bromide staining.

(55) Data are shown in FIG. 6.

Example 7

(56) GalNAc siRNA conjugates with vinylphosphonate at the 5′ end of the first strand and phosphodiester internucleotide linkages at the 5′ end of the first strand are stable in acidic tritosome lysate.

(57) Both tested siRNA conjugates contain each one Serinol-linked GalNAc moiety at the 5′ end and at the 3′ end of the second strand. The siRNAs are modified with alternating 2′-OMe/2′-F and contain each two phosphorothioate internucleotide linkages at their 5′ and 3′ termini, if not stated differently. X0319 contains two phosphorothioate internucleotide linkages at the 5′ end of the first strand. X0362 contains a vinylphosphonate modification at the first nucleotide and no phosphorothioate internucleotide linkages at the 5′ end of the first strand. Both GalNAc siRNA conjugates are stable for at least 72 hours.

(58) To assess stability, 5 μM siRNA conjugate was incubated with acidic rat tritosome extract (pH 5) at 37° C. for 0, 4, and 72 hours. After incubation, RNA was purified, separated on 20% TBE polyacrylamide gels and visualised by ethidium bromide staining.

(59) Data are shown in FIG. 7.

Example 8

(60) GalNAc siRNA conjugates with vinylphosphonate at the 5′ end of the first strand and phosphodiester internucleotide linkages at the 5′ end of the first strand are stable in acidic tritosome lysate.

(61) Both tested siRNA conjugates contain each one Serinol-linked GalNAc moiety at the 5′ end and at the 3′ end of the second strand. The siRNAs are modified with alternating 2′-OMe/2′-F and contain each two phosphorothioate internucleotide linkages at their 5′ and 3′ termini, if not stated differently. X0320 contains two phosphorothioate internucleotide linkages at the 5′ end of the first strand. X0363 contains a vinylphosphonate modification at the first nucleotide and no phosphorothioate internucleotide linkages at the 5′ end of the first strand. Both GalNAc siRNA conjugates are stable for at least 72 hours.

(62) To assess stability, 5 μM siRNA conjugate was incubated with acidic rat tritosome extract (pH 5) at 37° C. for 0, 4, and 72 hours. After incubation, RNA was purified, separated on 20% TBE polyacrylamide gels and visualised by ethidium bromide staining.

(63) Data are shown in FIG. 8.

(64) Collectively, examples 5-8 show that the stability of siRNAs that lack phosphorothioate internucleotide linkages at the 5′ end of the sense strand is not a function of the sequences of the siRNAs because the same result is obtained with siRNAs that have four entirely different sequences.

Example 9

(65) GalNAc siRNA conjugates with vinylphosphonate at the 5′ end of the first strand and phosphodiester internucleotide linkages at the 5′ end of the first strand effect improved reduction of TMPRSS6 target mRNA levels in vivo.

(66) All tested conjugates contain a triantennary GalNAc moiety at the 5′ end of the second strand. The siRNAs are modified with alternating 2′-OMe/2′-F and contain each two phosphorothioate internucleotide linkages at all non-conjugated ends if not stated differently. X0027 and X0207 contain two phosphorothioate internucleotide linkages at the 5′ end of the first strand. X0204 contains a vinylphosphonate modification at the first nucleotide and two phosphorothioate internucleotide linkages at the 5′ end of the first strand. X0205 contains a vinylphosphonate modification at the first nucleotide and no phosphorothioate internucleotide linkages at the 5′ end of the first strand. X0205 shows improved reduction of TMPRSS6 transcript levels in vivo compared to X0027, X0207 and X0204. “PBS” indicates a group of animals, which was treated with PBS.

(67) C57BL6 male mice (n=6) were subcutaneously treated with 0.3 mg/kg and 1 mg/kg GalNAc conjugate. Liver sections were prepared 7 days after treatment, total RNA was extracted from the tissue and TMPRSS6 and PTEN mRNA levels were determined by TaqMan qRT-PCR.

(68) Data are shown in FIG. 9.

Example 10

(69) GalNAc siRNA conjugates with vinylphosphonate at the 5′ end of the first strand and phosphodiester internucleotide linkages at the 5′ end of the first strand effect improved reduction of TMPRSS6 target mRNA levels in vivo over six weeks.

(70) The tested conjugates contain a triantennary GalNAc moiety at the 5′ end of the second strand. The siRNAs are modified with alternating 2′-OMe/2′-F and contain each two phosphorothioate internucleotide linkages at all non-conjugated ends if not stated differently. X0027 contains two phosphorothioate internucleotide linkages at the 5′ end of the first strand. X0205 contains a vinylphosphonate modification at the first nucleotide and no phosphorothioate internucleotide linkages at the 5′ end of the first strand. X0027 and X0205 contain different nucleobases at position 1 of the first strand and at position 19 of the second strand, whereas the remaining nucleobase sequence is identical. Compared to X0027, X0205 shows improved initial reduction of TMPRSS6 target gene levels in vivo and improved duration of action in vivo. “PBS” indicates a group of animals, which was treated with PBS.

(71) C57BL6 male mice (n=6) were subcutaneously treated with 1 mg/kg GalNAc conjugate. Liver sections were prepared 10, 20, and 41 days after treatment, total RNA was extracted from the tissue and TMPRSS6 and ACTB mRNA levels were determined by Taqman qRT-PCR.

(72) Data are shown in FIG. 10.

Example 11

(73) GalNAc siRNA conjugates with vinylphosphonate at the 5′ end of the first strand and phosphodiester internucleotide linkages at the 5′ end of the first strand effect reduction of ALDH2 target mRNA levels in vitro.

(74) All tested conjugates contain each one Serinol-linked GalNAc moiety at the 5′ end and at the 3′ end of the second strand. The siRNAs contain each two phosphorothioate internucleotide linkages at their 5′ and 3′ termini, if not stated differently. X0320 and X363 are modified with alternating 2′-OMe/2′-F. X0477 and X0478 are modified with alternating 2′-OMe/2′-F in the first strand and with 2′-OMe at positions 1-6 and 10-19 of the second strand and with 2′-F at positions 7-9 of the second strand. X0320 and X0477 contain two phosphorothioate internucleotide linkages at the 5′ end of their first strands. X0363 and X0478 contains a vinylphosphonate modification at the first nucleotide and no phosphorothioate internucleotide linkages at the 5′ end of the first strand. Compared to X0320, X0363 reduced ALDH2 mRNA levels more. Compared to X0477, X0478 reduced ALDH2 mRNA levels more. “ut” indicates an untreated sample, which the other samples were normalised to. “Luc” indicates an siRNA targeting Luciferase (X0028), which was used as non-targeting control and does not reduce target mRNA levels.

(75) The experiment was conducted in mouse primary hepatocates. 20,000 cells were seeded per 96-well and treated with 1-100 nM GalNAc-conjugated siRNA directly after plating. Cells were lysed after 24 h, total RNA was extracted and ALDH2 and ACTB mRNA levels were determined by Taqman qRT-PCR. Each bar represents mean±SD from three technical replicates.

(76) Data are shown in FIG. 11.

(77) Example 11 shows that a combination of a vinylphosphonate at the 5′ end of the antisense strand and the 2′ nucleotide modification pattern of the second strand of X0478 lead to an unexpectedly higher down-regulation of the target gene.

Example 12—Synthesis

(78) General Synthesis Schemes

(79) Example compounds can be synthesised according to methods described below and known to the person skilled in the art. Whilst the schemes illustrate the synthesis of particular conjugates, it will be understood that other claimed conjugates may be prepared by analogous methods. Assembly of the oligonucleotide chain and linker building blocks may, for example, be performed by solid phase synthesis applying phosphoramidte methodology. Solid phase synthesis may start from a base or modified building block loaded Icaa CPG. Phosphoramidite synthesis coupling cycle consists of 1) DMT-removal, 2) chain elongation using the required DMT-masked phosphoramidite and an activator, which may be benzylthiotetrazole (BTT), 3) capping of non-elongated oligonucleotide chains, followed by oxidation of the P(III) to P(V) either by Iodine (if phosphodiester linkage is desired) or EDITH (if phosphorothioate linkage is desired) and again capping (Cap/Ox/Cap or Cap/Thio/Cap). GalNAc conjugation may be achieved by peptide bond formation of a GalNAc-carboxylic acid building block to the prior assembled and purified oligonucleotide having the necessary number of amino modified linker building blocks attached. The necessary building blocks are either commercially available or synthesis is described below. All final single stranded products were analysed by AEX-HPLC to prove their purity. Purity is given in % FLP (% full length product) which is the percentage of the UV-area under the assigned product signal in the UV-trace of the AEX-HPLC analysis of the final product. Identity of the respective single stranded products was proved by LC-MS analysis.

(80) Synthesis of Synthons

(81) ##STR00066##

(82) (S)-DMT-Serinol(TFA)-phosphoramidite 7 can be synthesised from (L)-serine methyl ester derivative 1 according to literature published methods (Hoevelmann et al. Chem. Sci., 2016, 7, 128-135).

(83) (S)-DMT-Serinol(TFA)-succinate 6 can be made by conversion of intermediate 5 with succinic anhydride in presence of a catalyst such as DMAP.

(84) Loading of 6 to a solid support such as a controlled pore glass (CPG) support may be achieved by peptide bond formation to a solid support such as an amino modified native CPG support (500 A) using a coupling reagent such as HBTU. The (S)-DMT-Serinol(TFA)-succinate 6 and a coupling reagent such as HBTU is dissolved in a solvent such as CH.sub.3CN. A base, such as diisopropylethylamine, is added to the solution, and the reaction mixture is stirred for 2 min. A solid support such as a native amino-Icaa-CPG support (500 A, 3 g, amine content: 136 umol/g) is added to the reaction mixture and a suspension forms. The suspension is gently shaken at room temperature on a wrist-action shaker for 16 h then filtered, and washed with solvent such as DCM and EtOH. The support is dried under vacuum for 2 h. The unreacted amines on the support can be capped by stirring with acetic anhydride/lutidine/N-methylimidazole at room temperature. Washing of the support may be repeated as above. The solid support is dried under vacuum to yield solid support 10.

(85) ##STR00067##

(86) Synthesis of the GalNAc synthon 9 can be prepared according to methods as described in Nair et al. (2014), starting from commercially available per-acetylated galactose amine 8.

(87) Synthesis of single stranded serinol-derived GalNAc conjugates

(88) ##STR00068##

(89) Oligonucleotide synthesis of 3′ mono-GalNAc conjugated oligonucleotides (such as compound A0264) is outlined in FIG. 16 and summarised in Scheme 3. Synthesis is commenced using (S)-DMT-Serinol(TFA)-succinate-Icaa-CPG 10 as in example compound A0264. In case additional serinol building blocks are needed the (S)-DMT-serinol(TFA) amidite (7) is used in the appropriate solid phase synthesis cycle. For example, to make compound A0329, the chain assembly is finished with an additional serinol amidite coupling after the base sequence is fully assembled. Further, oligonucleotide synthesis of 5′ mono-GalNAc conjugated oligonucleotides may be commenced from a solid support loaded with the appropriate nucleoside of its respected sequence. In example compound A0220 this may be 2′fA. The oligonucleotide chain is assembled according to its sequence and as appropriate, the building block (S)-DMT-serinol(TFA)-amidite (7) is used. Upon completion of chain elongation, the protective DMT group of the last coupled amidite building block is removed, as in step 1) of the phosphoramidite synthesis cycle.

(90) Upon completion of the last synthesizer step, the single strands can be cleaved off the solid support by treatment with an amine such as 40% aq. methylamine treatment. Any remaining protecting groups are also removed in this step and methylamine treatment also liberates the serinol amino function. The crude products were then purified each by AEX-HPLC and SEC to yield the precursor oligonucleotide for further GalNAc conjugation.

(91) ##STR00069##

(92) Post solid phase synthesis GalNAc-conjugation was achieved by pre-activation of the GalN(Ac4)-C4-acid (9) by a peptide coupling reagent such as HBTU. The pre-activated acid 9 was then reacted with the amino-groups in 11 (e.g. A0264) to form the intermediate GalN(Ac4)-conjugates. The acetyl groups protecting the hydroxyl groups in the GalNAc-moieties were cleaved off by methylamine treatment to yield the desired example compounds 12 (e.g. A0268), which were further purified by AEX-HPLC and SEC.

(93) Synthesis of Single Stranded Non-Serinol-Derived GalNAc Conjugates

(94) Amino modified building blocks other than serinol are commercially available from various suppliers and can be used instead of serinol to provide reactive amino-groups that allow for GalNAc conjugation. For example the commercially available building blocks shown in Table 1 below can be used to provide non-serinol-derived amino modified precursor oligonucleotides 14 (Scheme 5A) by using amino-modifier loaded CPG such as 10-1 to 10-3 followed by sequence assembly as described above and finally coupling of amino-modifier phosohoramidites such as 13-1, 13-2 or 13-4.

(95) For example, to make 14 (A0653) GyC3Am-CPG (10-2) was used in combination with GIyC3Am-Amidite 13-2. Structurally differing modifiers can be used to make 14, for example for A0651 C7Am-CPG was used in combination with C6Am-Amidite as second amino modification. In a similar fashion commercially available amino-modifier loaded CPG 10-5 and amino-modified phosphoramidite 13-5 can be used to synthesise amino-modified precursor molecules 14 (A0655).

(96) TABLE-US-00025 TABLE 1 Commercially available building blocks C3Am-CPG (10-1) is: 0embedded image GlyC3Am-CPG (10-2) is: embedded image C7Am-CPG (10-3) is: embedded image PipAm-CPG (10-5) is: embedded image C3Am-Phos (13-1) is: embedded image GlyC3Am-Phos (13-2) is: embedded image C6Am-Phos (13-4) is: embedded image PipAm-Phos (13-5) is: embedded image

(97) ##STR00078##

(98) The resulting precursor oligonucleotides 14 can then be conjugated with GalN(Ac4)-C.sub.4-acid (9) to yield the desired example compounds 15 (Scheme 6).

(99) ##STR00079##

(100) Synthesis of the Single Stranded Tri-Antennary GalNAc Conjugates

(101) Oligonucleotides synthesis of tri-antennary GalNAc-cluster conjugated siRNA is outlined in FIG. 17. Oligonucleotide chain assembly is commenced using base loaded support e.g. 5′DMT-2′FdA(bz)-succinate-Icaa-CPG as in example compound A0006. Phosphoramidite synthesis coupling cycle consisting of 1) DMT-removal, 2) chain elongation using the required DMT-masked phosphoramidite, 3) capping of non-elongated oligonucleotide chains, followed by oxidation of the P(III) to P(V) either by Iodine or EDITH (if phosphorothioate linkage is desired) and again capping (Cap/Ox/Cap or Cap/Thio/Cap) is repeated until full length of the product is reached. For the on-column conjugation of a trivalent tri-antennary GalNAc cluster the same synthesis cycle was applied with using the necessary trivalent branching amidite C4XLT-phos followed by another round of the synthesis cycle using the GalNAc amidite ST23-phos. Upon completion of this last synthesizer step, the oligonucleotide was cleaved from the solid support and additional protecting groups may be removed by methylamine treatment. The crude products were then purified each by AEX-HPLC and SEC.

(102) General Procedure of Double Strand Formation

(103) In order to obtain the double stranded conjugates, individual single strands are dissolved in a concentration of 60 OD/mL in H.sub.2O. Both individual oligonucleotide solutions can be added together to a reaction vessel. For reaction monitoring a titration can be performed. The first strand is added in 25% excess over the second strand as determined by UV-absorption at 260 nm. The reaction mixture is heated e.g. to 80° C. for 5 min and then slowly cooled to RT. Double strand formation may be monitored by ion pairing reverse phase HPLC. From the UV-area of the residual single strand the needed amount of the second strand can be calculated and added to the reaction mixture. The reaction is heated e.g. to 80° C. again and slowly cooled to RT. This procedure can be repeated until less than 10% of residual single strand is detected.

(104) The above process (including Schemes 1-6) may be easily adapted to replace GalNac with another targeting ligand e.g. a saccharide.

(105) In any of the above aspects, instead of post solid phase synthesis conjugation it is possible to make a preformed Serinol(GN)-phosphoramidite and use this for on-column conjugation.

(106) Example compounds were synthesised according to methods described below and methods known to the person skilled in the art. Assembly of the oligonucleotide chain and linker building blocks was performed by solid phase synthesis applying phosphoramidite methodology. GalNAc conjugation was achieved by peptide bond formation of a GalNAc-carboxylic acid building block to the prior assembled and purified oligonucleotide having the necessary number of amino modified linker building blocks attached.

(107) Oligonucleotide synthesis, deprotection and purification followed standard procedures that are known in the art.

(108) All oligonucleotides were synthesized on an AKTA oligopilot synthesizer using standard phosphoramidite chemistry. Commercially available solid support and 2′O-Methyl RNA phosphoramidites, 2′Fluoro, 2′Deoxy RNA phosphoramidites (all standard protection, ChemGenes, LinkTech) and commercially available 3′-Amino Modifier TFA Amino C-6 Icaa CPG 500 Å (Chemgenes) were used. Per-acetylated galactose amine 8 is commercially available.

(109) Ancillary reagents were purchased from EMP Biotech. Synthesis was performed using a 0.1 M solution of the phosphoramidite in dry acetonitrile and benzylthiotetrazole (BTT) was used as activator (0.3M in acetonitrile). Coupling time was 15 min. A Cap/OX/Cap or Cap/Thio/Cap cycle was applied (Cap: Ac.sub.2O/NMI/Lutidine/Acetonitrile, Oxidizer: 0.1M 12 in pyridine/H.sub.2O). Phosphorothioates were introduced using standard commercially available thiolation reagent (EDITH, Link technologies). DMT cleavage was achieved by treatment with 3% dichloroacetic acid in toluene. Upon completion of the programmed synthesis cycles a diethylamine (DEA) wash was performed. All oligonucleotides were synthesized in DMT-off mode.

(110) Attachment of the serinol-derived linker moiety was achieved by use of either base-loaded (S)-DMT-Serinol(TFA)-succinate-Icaa-CPG 10 or a (S)-DMT-Serinol(TFA) phosphoramidite 7 (synthesis was performed as described in literature Hoevelmann et al. Chem. Sci., 2016, 7, 128-135) in the appropriate synthesis cycle. Tri-antennary GalNAc clusters (ST23/C4XLT or ST23/C6XLT) were introduced by successive coupling of the respective trebler amidite derivatives (C4XLT-phos or C6XLT-phos) followed by the GalNAc amidite (ST23-phos).

(111) Synthesis of the phosphoramidite derivatives of C4XLT (C4XLT-phos), C6XLT (C6XLT-phos) as well as ST23 (ST23-phos) can be performed as described in WO2017/174657. Synthesis of (vp)-mU-phos can be performed as described in Prakash, Nucleic Acids Res. 2015, 43(6), 2993-3011 and Haraszti, Nucleic Acids Res. 2017, 45(13), 7581-7592.

(112) Attachment of vinylphosphonate-mU moiety was achieved by use of (vp)-mU-phos (synthesis was performed as described in Prakash, Nucleic Acids Res. 2015, 43(6), 2993-3011 and Nucleic Acids Res. 2017, 45(13), 7581-7592) in the last synthesis cycle. The (vp)-mU-phos does not provide a hydroxy group suitable for further synthesis elongation and therefore, does not possess an DMT-group. Hence coupling of (vp)-mU-phos results in synthesis termination. For the removal of the methyl-esters masking the phosphonate, the CPG carrying the fully assembled oligonucleotide was dried under reduced pressure and transferred into a 20 mL PP syringe reactor for solid phase peptide synthesis equipped with a disc frit (Carl Roth GmbH). The CPG was then brought into contact with 10 mL of a solution of 250 μL TMSBr and 177 μL pyridine in CH.sub.2Cl.sub.2 at room temperature and the reactor was sealed with a luer cap. The reaction vessels were slightly agitated over a period of 30 min, the excess reagent discarded, and the residual CPG washed 2× with 10 mL acetonitrile. Further downstream processing did not alter from any other example compound.

(113) The single strands were cleaved off the CPG by 40% aq. methylamine treatment. The resulting crude oligonucleotide was purified by ion exchange chromatography (Resource Q, 6 mL, GE Healthcare) on a AKTA Pure HPLC System using a sodium chloride gradient. Product containing fractions were pooled, desalted on a size exclusion column (Zetadex, EMP Biotech) and lyophilized.

(114) Individual single strands were dissolved in a concentration of 60 OD/mL in H.sub.2O. Both individual oligonucleotide solutions were added together in a reaction vessel. For easier reaction monitoring a titration was performed. The first strand was added in 25% excess over the second strand as determined by UV-absorption at 260 nm. The reaction mixture was heated to 80° C. for 5 min and then slowly cooled to RT. Double strand formation was monitored by ion pairing reverse phase HPLC. From the UV-area of the residual single strand the needed amount of the second strand was calculated and added to the reaction mixture. The reaction was heated to 80° C. again and slowly cooled to RT. This procedure was repeated until less than 10% of residual single strand was detected.

(115) Synthesis of Compounds 2-10

(116) Compounds 2 to 5 and (S)-DMT-Serinol(TFA)-phosphoramidite 7 were synthesised according to literature published methods (Hoevelmann et al. Chem. Sci., 2016, 7, 128-135).

(117) (S)-4-(3-(bis(4-methoxyphenyl)(phenyl)methoxy)-2-(2,2,2-trifluoroacetamido)propoxy)-4-oxobutanoic acid (6)

(118) To a solution of 5 in pyridine was added succinic anhydride, followed by DMAP. The resulting mixture was stirred at room temperature overnight. All starting material was consumed, as judged by TLC. The reaction was concentrated. The crude material was chromatographed in silica gel using a gradient 0% to 5% methanol in DCM (+1% triethylamine) to afford 1.33 g of 6 (yield=38%). m/z (ESI−): 588.2 (100%), (calcd. for C30H29F3NO8.sup.− [M-H].sup.− 588.6). 1H-NMR: (400 MHz, CDCl3) δ [ppm]=7.94 (d, 1H, NH), 7.39-7.36 (m, 2H, CHaryl), 7.29-7.25 (m, 7H, CHaryl), 6.82-6.79 (m, 4H, CHaryl), 4.51-4.47 (m, 1H), 4.31-4.24 (m, 2H), 3.77 (s, 6H, 2xDMTr-OMe), 3.66-3.60 (m, 16H, HNEt.sub.3.sup.+), 3.26-3.25 (m, 2H), 2.97-2.81 (m, 20H, NEt.sub.3), 2.50-2.41 (4H, m), 1.48-1.45 (m, 26H, HNEt.sub.3.sup.+), 1.24-1.18 (m, 29H, NEt.sub.3).

(119) (S)-DMT-Serinol(TFA)-succinate-Icaa-CPG (10)

(120) The (S)-DMT-Serinol(TFA)-succinate (159 mg, 270 umol) and HBTU (113 mg, 299 umol) were dissolved in CH.sub.3CN (10 mL). Diisopropylethylamine (DIPEA, 94 μL, 540 umol) was added to the solution, and the mixture was swirled for 2 min followed by addition native amino-Icaa-CPG (500 A, 3 g, amine content: 136 umol/g). The suspension was gently shaken at room temperature on a wrist-action shaker for 16 h then filtered and washed with DCM and EtOH. The solid support was dried under vacuum for 2 h. The unreacted amines on the support were capped by stirring with acetic anhydride/lutidine/N-methylimidazole at room temperature. The washing of the support was repeated as above. The solid was dried under vacuum to yield solid support 10 (3 g, 26 umol/g loading).

(121) GalNAc Synthon (9)

(122) Synthesis of the GalNAc synthon 9 was performed as described in Nair et al. J. Am. Chem. Soc., 2014, 136 (49), pp 16958-16961, in 46% yield over two steps.

(123) The characterising data matched the published data.

(124) Synthesis of Oligonucleotides

(125) All single stranded oligonucleotides were synthesised according to the reaction conditions described above and in FIGS. 12, 16 and 17.

(126) All final single stranded products were analysed by AEX-HPLC to prove their purity. Purity is given in % FLP (% full length product) which is the percentage of the UV-area under the assigned product signal in the UV-trace of the AEX-HPLC analysis of the final product. Identity of the respective single stranded products (non-modified, amino-modified precursors, C4XLT/ST23 or C6XLT/ST23 GalNAc conjugated oligonucleotides) was proved by LC-MS analysis.

(127) TABLE-US-00026 TABLE 2 Single stranded un-conjugated and on-column conjugated oligonucleotides MW % FLP MW (ESI-) (AEX- Product calc. Found HPLC) X0181A 6943.3 Da 6943.3 Da 86.3% X0349A 6987.3 Da 6986.7 Da 93.4% X0430A 7019.3 Da 7019.0 Da 90.3% X0322A 6416.1 Da 6416.1 Da 94.1% X0365A 6437.0 Da 6436.8 Da 91.0% X0431A 6469.0 Da 6468.7 Da 84.3% X0319A 6237.8 Da 6237.7 Da 97.2% X0362A 6258.8 Da 6258.2 Da 91.3% X0320A 6143.8 Da 6143.7 Da 94.6% X0363A 6187.8 Da 6187.3 Da 85.4% X0028A 6259.9 Da 6259.8 Da 76.5% X0027A 6416.1 Da 6415.8 Da 92.8% X0204A 6469.0 Da 6468.7 Da 84.3% X0205A 6437.0 Da 6436.8 Da 91.0% X0207A 6393.1 Da 6392.9 Da 77.6% X0477A 6143.8 Da 6143.4 Da 85.6% X0478A 6187.8 Da 6187.3 Da 85.4% X0181B-prec 7183.3 da 7183.2 Da 88.8% X0349B-prec 7183.3 Da 7183.3 Da 96.2% X0430B-prec 7183.3 Da 7183.3 Da 96.2% X0322B-prec 6437.7 Da 6437.8 Da 91.1% X0365B-prec 6460.8 Da 6460.9 Da 92.9% X0431B-prec 6460.8 Da 6460.9 Da 92.9% X0319B-prec 6616.0 Da 6616.0 Da 75.6% X0362B-prec 6639.0 Da 6639.0 Da 85.7% X0320B-prec 6665.0 Da 6664.8 Da 87.0% X0363B-prec 6665.0 Da 6664.8 Da 81.7% X0028B 7813.2 Da 7813.1 Da 74.3% X0027B 7642.0 Da 7641.8 Da 88.2% X0204B 7665.0 Da 7664.9 Da 90.4% X0205B 7665.0 Da 7664.9 Da 90.4% X0207B 7665.0 Da 7664.9 Da 90.4% X0477B-prec 6749.3 Da 6749.2 Da 83.1% X0478B-prec 6749.3 Da 6749.2 Da 83.1%

(128) Synthesis of Conjugate with Serinol-Derived Linker

(129) Conjugation of the GalNAc synthon (9) was achieved by coupling to the serinol-amino function of the respective oligonucleotide strand 11 using a peptide coupling reagent. Therefore, the respective amino-modified precursor molecule 11 was dissolved in H.sub.2O (500 OD/mL) and DMSO (DMSO/H.sub.2O, 2/1, v/v) was added, followed by DIPEA (2.5% of total volume). In a separate reaction vessel pre-activation of the GalN(Ac4)-C4-acid (9) was performed by reacting 2 eq. (per amino function in the amino-modified precursor oligonucleotide 11) of the carboxylic acid component with 2 eq. of HBTU in presence of 8 eq. DIPEA in DMSO. After 2 min the pre-activated compound 9 was added to the solution of the respective amino-modified precursor molecule. After 30 min the reaction progress was monitored by LCMS or AEX-HPLC. Upon completion of the conjugation reaction the crude product was precipitated by addition of 10× iPrOH and 0.1×2M NaCl and harvested by centrifugation and decantation. To set free the acetylated hydroxyl groups in the GalNAc moieties the resulting pellet was dissolved in 40% MeNH2 (1 mL per 500 OD) and after 15 min at RT diluted in H.sub.2O (1:10) and finally purified again by anion exchange and size exclusion chromatography and lyophilised to yield the final product 12.

(130) TABLE-US-00027 TABLE 3 Single stranded GalNAc-conjugated oligonucleotides Starting MW % FLP Product Material MW (ESI-) (AEX- (12) (11) calc. found HPLC) X0181B X0181B-prec 7789.9 Da 7789.8 Da 95.5% X0349B X0349B-prec 7789.9 Da 7790.0 Da 97.5% X0430B X0430B-prec 7789.9 Da 7790.0 Da 97.5% X0322B X0322B-prec 7044.4 Da 7044.4 Da 96.0% X0365B X0365B-prec 7067.4 Da 7067.2 Da 95.7% X0431B X0431B-prec 7067.4 Da 7067.2 Da 95.7% X0319B X0319B-prec 7222.7 Da 7222.9 Da 82.5% X0362B X0362B-prec 7245.7 Da 7245.2 Da 85.6% X0320B X0320B-prec 7271.7 Da 7271.7 Da 90.0% X0363B X0363B-prec 7271.7 Da 7271.3 Da 94.9% X0477B X0477B-prec 7356.0 Da 7355.7 Da 91.4% X0478B X0478B-prec 7356.0 Da 7355.7 Da 91.4%

(131) Double Strand Formation

(132) Double strand formation was performed according to the methods described above. The double strand purity is given in % double strand which is the percentage of the UV-area under the assigned product signal in the UV-trace of the IPRP-HPLC analysis.

(133) TABLE-US-00028 TABLE 4 Nucleic acid conjugates Starting Materials % First Second double Product Strand Strand strand X0181 X0181A X0181B 98.5 X0349 X0349A X0349B 98.8 X0430 X0430A X0430B 96.1 X0322 X0322A X0322B 98.0 X0365 X0365A X0365B 95.4 X0431 X0431A X0431B >99.0 X0319 X0319A X0319B 97.0 X0362 X0362A X0362B 98.3 X0320 X0320A X0320B 98.6 X0363 X0363A X0363B 94.5 X0028 X0028A X0028B 96.8 X0027 X0027A X0027B 93.4 X0204 X0204A X0204B 89.2 X0205 X0205A X0205B 92.0 X0207 X0207A X0207B 93.0 X0477 X0477A X0477B 96.0 X0478 X0478A X0478B 96.5

Example 13

(134) Reduction of TMPRSS6 expression in primary murine hepatocytes by GalNAc siRNA conjugates with 2′-OMe-uridine or 5′-(E)-vinylphosphonate-2′-OMe-uridine replacing the 2′-OMe-adenin at the 5′ position of the first strand.

(135) Murine primary hepatocytes were seeded into collagen pre-coated 96 well plates (Thermo Fisher Scientific, #A1142803) at a cell density of 30,000 cells per well and treated with siRNA-conjugates at concentrations ranging from 100 nM to 0.1 nM. 24 h post treatment cells were lysed and RNA extracted with InviTrap® RNA Cell HTS 96 Kit/C24×96 preps (Stratec #7061300400) according to the manufactures protocol. Transcripts levels of TMPRSS6 and housekeeping mRNA (Ptenll) were quantified by TaqMan analysis.

(136) siRNA Conjugates:

(137) TABLE-US-00029 first strand/ siRNA second duplex strand sequence & modification STS12009L4 TMPRSS6- mA (ps) fA (ps) mC fC mA fG mA fA mG fA mA fG mC fA (X0027) hcm9-A mG fG mU (ps) fG (ps) mA TMPRSS6- GN2 fU mC fA mC fC mU fG mC fU mU fC mU fU mC fU hcm9-BL4 mG fG (ps) mU (ps) fU STS12209V4L4 TMPRSS6- vinylphosphonate-mU (ps) fA (ps) mC fC mA fG mA fA mG (X0204) hcm209AV4 fA mA fG mC fA mG fG mU (ps) fG (ps) mA TMPRSS6- GN2 fU mC fA mC fC mU fG mC fU mU fC mU fU mC fU hcm209- mG fG (ps) mU (ps) fA BL4 STS12209V5L4 TMPRSS6- vinylphosphonate-mU fA mC fC mA fG mA fA mG fA mA (x0205) hcm209- fG mC fA mG fG mU (ps) fG (ps) mA AV5 TMPRSS6- GN2 fU mC fA mC fC mU fG mC fU mU fC mU fU mC fU hcm209- mG fG (ps) mU (ps) fA BL4 STS12209L4 TMPRSS6- mU (ps) fA (ps) mC fC mA fG mA fA mG fA mA fG mC fA (x0207) hcm209A mG fG mU (ps) fG (ps) mA TMPRSS6- GN2 fU mC fA mC fC mU fG mC fU mU fC mU fU mC fU hcm209- mG fG (ps) mU (ps) fA BL4 STS12209V1L4 TMPRSS6- mU fA mC fC mA fG mA fA mG fA mA fG mC fA mG fG (x0208) hcm9-AV1 mU (ps) fG (ps) mA TMPRSS6- GN2 fU mC fA mC fC mU fG mC fU mU fC mU fU mC fU hcm209- mG fG (ps) mU (ps) fA BL4 STS18001 STS18001A mU(ps)fC(ps)mGfAmAfGmUfAmUfUmCfCmGfCmGfUmA (X0028) (ps)fC(ps)mG STS18001B GN2 fCmGfUmAfCmGfCmGfGmAfAmUfAmCfUmUfC(ps) L4 mG (ps) fA

(138) TaqMan Primer and Probes

(139) TABLE-US-00030 PTEN-2 CACCGCCAAATTTAACTGCAGA PTEN-2 AAGGGTTTGATAAGTTCTAGCTGT PTEN-2 FAM-TGCACAGTATCCTTTTGAAGACCATAACCCA-TAMRA hTMPRSS6:379U17 CCGCCAAAGCCCAGAAG hTMPRSS6:475L21 GGTCCCTCCCCAAAGGAATAG hTMPRSS6:416U28FL FAM-CAGCACCCGCCTGGGAACTTACTACAAC-BHQ1

(140) In Vitro Dose Response

(141) Target gene expression in primary murine hepatocytes 24 h following treatment with TMPRSS6-siRNA carrying vinyl-(E)-phosphonate 2′-OMe-Uracil at the 5-position of the antisense strand and two phosphorothioate linkages between the first three nucleotides (STS12209V4L4), vinyl-(E)-phosphonate 2′-OMe-Uracil at the 5-position of the anti-sense strand and phosphodiester bonds between the first three nucleotides (STS12209V5L4), carrying 2′-OMe-Uracil and two phosphorothioate linkages between the first three nucleotides at the 5-position (STS12209L4) or carrying 2′-OMe-Uracil or 2′-OMe-Adenine and two phosphodiester linkages between the first three nucleotides at the 5-position (STS12209V1L4 and STS12009L4) as reference or a non-targeting GalNAc-siRNA (STS18001) at indicated concentrations or left untreated (UT).

(142) Results are shown in FIG. 14. This figure confirms that a vinylphosphonate at the 5′ end of the first strand, preferably in combination with phosphodiester linkages at the 5′ end of the first strand lead to increased expression reduction of the target gene.

(143) Serum Stability

(144) Serum stability of siRNA conjugates incubated for 4 hours (4 h) or 3 days (3d) or left untreated (0 h) in 50% FCS at 37° C. RNA was then extracted by phenol/chlorophorm/isoamyl alcohol extraction. Degradation was visualized by TBE-Polyacrylamid-gel-electrophoresis and staining RNA with SybrGold.

(145) Results are shown in FIG. 15: serum stability of siRNA-conjugates vs. less stabilized positive control for nuclease degradation.

(146) TABLE-US-00031 Sequence Summary Table: SEQ Unmodified sequence 5′-3′ ID Seq name Sequence 5′-3′ counterpart  1 X0181A mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU UUAUAGAGCAAGAACACUGUU mG (ps) fU (ps) mU  2 X0181B Ser(GN) (ps) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG AACAGUGUUCUUGCUCUAUAA mC fU mC fU mA fU (ps) mA (ps) fA (ps) Ser(GN)  3 X0349A (vp)-mU fU mA fU mA fG mA fG mC fA mA fG mA fA mC fA mC fU mG UUAUAGAGCAAGAACACUGUU (ps) fU (ps) mU  4 X0349B Ser(GN) (ps) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG AACAGUGUUCUUGCUCUAUAA mC fU mC fU mA fU (ps) mA (ps) fA (ps) Ser(GN)  5 X0430A (vp)-mU (ps) fU (ps) mA fU mA fG mA fG mC fA mA fG mA fA mC fA UUAUAGAGCAAGAACACUGUU mC fU mG (ps) fU (ps) mU  6 X0430B Ser(GN) (ps) fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG AACAGUGUUCUUGCUCUAUAA mC fU mC fU mA fU (ps) mA (ps) fA (ps) Ser(GN)  7 X0322A mA (ps) fA (ps) mC fC mA fG mA fA mG fA mA fG mC fA mG fG mU AACCAGAAGAAGCAGGUGA (ps) fG (ps) mA  8 X0322B Ser(GN) (ps) fU (ps) mC (ps) fA mC fC mU fG mC fU mU fC mU fU UCACCUGCUUCUUCUGGUU mC fU mG fG (ps) mU (ps) fU (ps) Ser(GN)  9 X0365A (vp)-mU fA mC fC mA fG mA fA mG fA mA fG mC fA mG fG mU (ps) UACCAGAAGAAGCAGGUGA fG (ps) mA 10 X0365B Ser(GN) (ps) fU (ps) mC (ps) fA mC fC mU fG mC fU mU fC mU fU UCACCUGCUUCUUCUGGUA mC fU mG fG (ps) mU (ps) fA (ps) Ser(GN) 11 X0431A (vp)-mU (ps) fA (ps) mC fC mA fG mA fA mG fA mA fG mC fA mG fG UACCAGAAGAAGCAGGUGA mU (ps) fG (ps) mA 12 X0431B Ser(GN) (ps) fU (ps) mC (ps) fA mC fC mU fG mC fU mU fC mU fU UCACCUGCUUCUUCUGGUA mC fU mG fG (ps) mU (ps) fA (ps) Ser(GN) 13 X0319A mA (ps) fA (ps) mU fG mU fU mU fU mC fC mU fG mC fU mG fA mC AAUGUUUUCCUGCUGACGG (ps) fG (ps) mG 14 X0319B Ser(GN) (ps) fC (ps) mC (ps) fG mU fC mA fG mC fA mG fG mA fA CCGUCAGCAGGAAAACAUU mA fA mC fA (ps) mU (ps) fU (ps) Ser(GN) 15 X0362A (vp)-mU fA mU fG mU fU mU fU mC fC mU fG mC fU mG fA mC (ps) fG UAUGUUUUCCUGCUGACGG (ps) mG 16 X0362B Ser(GN) (ps) fC (ps) mC (ps) fG mU fC mA fG mC fA mG fG mA fA CCGUCAGCAGGAAAACAUA mA fA mC fA (ps) mU (ps) fA (ps) Ser(GN) 17 X0320A mU (ps) fC (ps) mU fU mC fU mU fA mA fA mC fU mG fA mG fU mU UCUUCUUAAACUGAGUUUC (ps) fU (ps) mC 18 X0320B Ser(GN) (ps) fG (ps) mA (ps) fA mA fC mU fC mA fG mU fU mU fA GAAACUCAGUUUAAGAAGA mA fG mA fA (ps) mG (ps) fA (ps) Ser(GN) 19 X0363A (vp)-mU fC mU fU mC fU mU fA mA fA mC fU mG fA mG fU mU (ps) fU UCUUCUUAAACUGAGUUUC (ps) mC 20 X0363B Ser(GN) (ps) fG (ps) mA (ps) fA mA fC mU fC mA fG mU fU mU fA GAAACUCAGUUUAAGAAGA mA fG mA fA (ps) mG (ps) fA (ps) Ser(GN) 21 X0028A mU (ps) fC (ps) mG fA mA fG mU fA mU fU mC fC mG fC mG fU mA UCGAAGUAUUCCGCGUACG (ps) fC (ps) mG 22 X0028B [ST23 (ps)]3 ST41(ps) fC mG fU mA fC mG fC mG fG mA fA mU fA mC CGUACGCGGAAUACUUCGA fU mU fC (ps) mG (ps) fA 23 X0027A mA (ps) fA (ps) mC fC mA fG mA fA mG fA mA fG mC fA mG fG mU AACCAGAAGAAGCAGGUGA (ps) fG (ps) mA 24 X0027B [ST23 (ps)]3 ST41 (ps) fU (ps) mC (ps) fA mC fC mU fG mC fU mU UCACCUGCUUCUUCUGGUU fC mU fU mC fU mG fG (ps) mU (ps) fU 25 X0204A (vp)-mU (ps) fA (ps) mC fC mA fG mA fA mG fA mA fG mC fA mG fG UACCAGAAGAAGCAGGUGA mU (ps) fG (ps) mA 26 X0204B [ST23 (ps)]3 ST41 (ps) fU mC fA mC fC mU fG mC fU mU fC mU fU UCACCUGCUUCUUCUGGUA mC fU mG fG (ps) mU (ps) fA 27 X0205A (vp)-mU fA mC fC mA fG mA fA mG fA mA fG mC fA mG fG mU (ps) fG UACCAGAAGAAGCAGGUGA (ps) mA 28 X0205B [ST23 (ps)]3 ST41 (ps) fU mC fA mC fC mU fG mC fU mU fC mU fU UCACCUGCUUCUUCUGGUA mC fU mG fG (ps) mU (ps) fA 29 X0207A mU (ps) fA (ps) mC fC mA fG mA fA mG fA mA fG mC fA mG fG mU UACCAGAAGAAGCAGGUGA (ps) fG (ps) mA 30 X0207B [ST23 (ps)]3 ST41 (ps) fU mC fA mC fC mU fG mC fU mU fC mU fU UCACCUGCUUCUUCUGGUA mC fU mG fG (ps) mU (ps) fA 31 X0477A mU (ps) fC (ps) mU fU mC fU mU fA mA fA mC fU mG fA mG fU mU UCUUCUUAAACUGAGUUUC (ps) fU (ps) mC 32 X0477B Ser(GN) (ps) mG (ps) mA (ps) mA mA mC mU fC fA fG mU mU mU mA GAAACUCAGUUUAAGAAGA mA mG mA mA (ps) mG (ps) mA (ps) Ser(GN) 33 X0478A (vp)-mU fC mU fU mC fU mU fA mA fA mC fU mG fA mG fU mU (ps) fU UCUUCUUAAACUGAGUUUC (ps) mC 34 X0478B Ser(GN) (ps) mG (ps) mA (ps) mA mA mC mU fC fA fG mU mU mU mA GAAACUCAGUUUAAGAAGA mA mG mA mA (ps) mG (ps) mA (ps) Ser(GN) 35 mTTR fw TGGACACCAAATCGTACTGGAA TGGACACCAAATCGTACTGGAA primer 36 mTTR rev CAGAGTCGTTGGCTGTGAAAAC CAGAGTCGTTGGCTGTGAAAAC primer 37 mTTR probe BHQ1-ACTTGGCATTTCCCCGTTCCATGAATT-FAM ACTTGGCATTTCCCCGTTCCAT primer GAATT 38 hTMPRSS6fw CCGCCAAAGCCCAGAAG CCGCCAAAGCCCAGAAG primer 39 hTMPRSS6 GGTCCCTCCCCAAAGGAATAG GGTCCCTCCCCAAAGGAATAG rev primer 40 hTMPRSS6 BHQ1-CAGCACCCGCCTGGGAACTTACTACAAC-FAM CAGCACCCGCCTGGGAACTTAC probe TACAAC primer 41 ALDH2 fw GGCAAGCCTTATGTCATCTCGT primer 42 ALDH2 rev GGAATGGTTTTCCCATGGTACTT GGAATGGTTTTCCCATGGTACT primer T 43 ALDH2 BHQ1-TGAAATGTCTCCGCTATTACGCTGGCTG-FAM TGAAATGTCTCCGCTATTACGC probe TGGCTG primer 44 ApoB fw AAAGAGGCCAGTCAAGCTGTTC AAAGAGGCCAGTCAAGCTGTTC primer 45 ApoB rev GGTGGGATCACTTCTGTTTTGG GGTGGGATCACTTCTGTTTTGG primer 46 ApoB probe BHQ1-CAGCAACACACTGCATCTGGTCTCTACCA-VIC CAGCAACACACTGCATCTGGTC primer TCTACCA 47 PTEN fw CACCGCCAAATTTAACTGCAGA CACCGCCAAATTTAACTGCAGA primer 48 PTEN rev AAGGGTTTGATAAGTTCTAGCTGT AAGGGTTTGATAAGTTCTAGCT primer GT 49 PTEN probe BHQ1-TGCACAGTATCCTTTTGAAGACCATAACCCA-VIC TGCACAGTATCCTTTTGAAGAC primer CATAACCCA 50 TMPRSS6- mA (ps) fA (ps) mC fC mA fG mA fA mG fA mA fG mC fA mG fG mU AACCAGAAGAAGCAGGUGA hcm9-A (ps) fG (ps) mA 51 TMPRSS6- GN2 fU mC fA mC fC mU fG mC fU mU fC mU fU mC fU mG fG (ps) mU UCACCUGCUUCUUCUGGUU hcm9-BL4 (ps) fU 52 TMPRSS6- vinylphosphonate-mU (ps) fA (ps) mC fC mA fG mA fA mG fA mA fG UACCAGAAGAAGCAGGUGA hcm209AV4 mC fA mG fG mU (ps) fG (ps) mA 53 TMPRSS6- GN2 fU mC fA mC fC mU fG mC fU mU fC mU fU mC fU mG fG (ps) mU UCACCUGCUUCUUCUGGUA hcm209-BL4 (ps) fA 54 TMPRSS6- vinylphosphonate-mU fA mC fC mA fG mA fA mG fA mA fG mC fA mG UACCAGAAGAAGCAGGUGA hcm209-AVS fG mU (ps) fG (ps) mA 55 TMPRSS6- GN2 fU mC fA mC fC mU fG mC fU mU fC mU fU mC fU mG fG (ps) mU UCACCUGCUUCUUCUGGUA hcm209-BL4 (ps) fA 56 TMPRSS6- mU (ps) fA (ps) mC fC mA fG mA fA mG fA mA fG mC fA mG fG mU UACCAGAAGAAGCAGGUGA hcm209A (ps) fG (ps) mA 57 TMPRSS6- GN2 fU mC fA mC fC mU fG mC fU mU fC mU fU mC fU mG fG (ps) mU UCACCUGCUUCUUCUGGUA hcm209-BL4 (ps) fA 58 TMPRSS6- mU fA mC fC mA fG mA fA mG fA mA fG mC fA mG fG mU (ps) fG (ps) UACCAGAAGAAGCAGGUGA hcm9-AV1 mA 59 TMPRSS6- GN2 fU mC fA mC fC mU fG mC fU mU fC mU fU mC fU mG fG (ps) mU UCACCUGCUUCUUCUGGUA hcm209-BL4 (ps) fA 60 STS18001A mU(ps)fC(ps)mGfAmAfGmUfAmUfUmCfCmGfCmGfUmA(ps)fC(ps)mG UCGAAGUAUUCCGCGUACG 61 STS18001BL4 GN2 fCmGfUmAfCmGfCmGfGmAfAmUfAmCfUmUfC (ps) mG (ps) fA CGUACGCGGAAUACUUCGA 62 PTEN-2 CACCGCCAAATTTAACTGCAGA CACCGCCAAATTTAACTGCAGA 63 PTEN-2 AAGGGTTTGATAAGTTCTAGCTGT AAGGGTTTGATAAGTTCTAGCT GT 64 PTEN-2 FAM-TGCACAGTATCCTTTTGAAGACCATAACCCA-TAMRA TGCACAGTATCCTTTTGAAGAC CATAACCCA 65 hTMPRSS6: CCGCCAAAGCCCAGAAG CCGCCAAAGCCCAGAAG 379U17 66 hTMPRSS6: GGTCCCTCCCCAAAGGAATAG GGTCCCTCCCCAAAGGAATAG 475L21 67 hTMPRSS6: FAM-CAGCACCCGCCTGGGAACTTACTACAAC-BHQ1 CAGCACCCGCCTGGGAACTTAC 416U28FL TACAAC 68 TMPRSS6 AS (vp)-UACCAGAAGAAGCAGGUGA UACCAGAAGAAGCAGGUGA 69 TMPRSS6 S UCACCUGCUUCUUCUGGUA UCACCUGCUUCUUCUGGUA un 70 TMPRSS6S fU (ps) mC (ps) fA mC fC mU fG mC fU mU fC mU fU mC fU mG fG UCACCUGCUUCUUCUGGUA (ps) mU (ps) fA 71 TTR AS (vp)-UUAUAGAGCAAGAACACUGUU UUAUAGAGCAAGAACACUGUU 72 TTR S un AACAGUGUUCUUGCUCUAUAA AACAGUGUUCUUGCUCUAUAA 73 TTR S fA (ps) mA (ps) fC mA fG mU fG mU fU mC fU mU fG mC fU mC fU mA AACAGUGUUCUUGCUCUAUAA fU (ps) mA (ps) fA 74 ALDH2 AS (vp)-UCUUCUUAAACUGAGUUUC UCUUCUUAAACUGAGUUUC 75 ALDH2 S un GAAACUCAGUUUAAGAAGA GAAACUCAGUUUAAGAAGA 76 ALDH2 S ABA mG (ps) mA (ps) mA mA mC mU fC fA fG mU mU mU mA mA mG mA mA GAAACUCAGUUUAAGAAGA (ps) mG (ps) mA 77 ALDH2 S Alt fG (ps) mA (ps) fA mA fC mU fC mA fG mU fU mU fA mA fG mA fA GAAACUCAGUUUAAGAAGA (ps) mG (ps) fA

(147) The sequences listed above may be disclosed with a linker or ligand, such as GalNAc or (ps) linkages for example. These form an optional, but preferred, part of the sequence of the sequence listing.

(148) Summary Abbreviations Table

(149) TABLE-US-00032 Abbreviation Meaning A, U, C, G adenine, uracil, cytosine, guanine mA, mU, mC, mG 2′-O-Methyl RNA nucleotides 2′-OMe 2′-O-Methyl modification fA, fU, fC, fG 2′ deoxy-2′-F RNA nucleotides 2′-F 2′-fluoro modification (ps) phosphorothioate FAM 6-Carboxyfluorescein TAMRA 5-Carboxytetramethylrhodamine BHQ1 Black Hole Quencher 1 (vp) or Vinyl-(E)-phosphonate vinylphosphonate (vp)-mU 0embedded image (vp)-mU-phos embedded image ST23 embedded image ST23-phos embedded image ST41 (or C4XLT) embedded image ST41-phos (or C4XLT-phos) embedded image ST43 (or C6XLT) embedded image ST43-phos (or C6XLT-phos) embedded image GN embedded image GN2 or [ST23 (ps)]3 ST41 (ps) embedded image GN3 or [ST23 (ps)]3 ST43 (ps) 0embedded image Ser(GN) embedded image embedded image linkage between the oxygen atom and e.g. H, phosphodiester linkage or phosphorothioate linkage

(150) The abbreviations as shown in this abbreviation table may be used herein. The list of abbreviations may not be exhaustive and further abbreviations and their meaning may be found throughout this document.