PEPTIDE HAVING CYTOPROTECTIVE EFFECT AGAINST ENVIRONMENTAL POLLUTANT AND USE THEREOF
20230227501 · 2023-07-20
Inventors
Cpc classification
A61K8/64
HUMAN NECESSITIES
A23V2002/00
HUMAN NECESSITIES
International classification
A61K8/64
HUMAN NECESSITIES
Abstract
Provided are a peptide with a cytoprotective effect against environmental pollutants and a use thereof. The peptide consisting of an amino acid sequence of SEQ ID NO: 1, 2, or 3 directly binds to 2,3,7,8-tetrachlorodibenzo-p-dioxin (hereinafter, referred to as TCDD), known as being the most toxic among the class of dioxins, to prevent dermal penetration and the activation mechanism of AhR by TCDD and polycyclic aromatic hydrocarbons contained in fine dust. Such a direct cytoprotective effect against environmental pollutants is distinguished from preexisting methods that are configured to indirectly block opportunities to contact these materials or to reduce toxicity through barrier reinforcement.
Claims
1-7. (canceled)
8. A peptide consisting of the amino acid sequence of SEQ ID NO: 2, wherein the peptide binds to a dioxin or a dioxin-like substance, and optionally wherein the N— or C-terminus of the peptide is modified.
9. A pharmaceutical composition for treating a disease caused by a dioxin or a dioxin-like substance, the pharmaceutical composition comprising a peptide consisting of the amino acid sequence of SEQ ID NO: 2 as an active ingredient, optionally wherein the N— or C-terminus of the peptide is modified.
10. The pharmaceutical composition of claim 9, wherein the disease caused by a dioxin or a dioxin-like substance is selected from the group consisting of skin disease, decreased sperm count, testicular cancer, prostate cancer, endometrial hyperplasia, breast cancer, hepatotoxicity, weakened immunity, hyperlipidemia, hypospadia, cryptorchidism, deformed child birth, vascular damage, hepatocellular carcinoma, hepatomegaly, adenofibrosis, weight loss, hair loss, oral edema, blepharedema, and gastric mucosal ulcer.
11. The pharmaceutical composition of claim 9, wherein the dioxin-like substance is selected from the group consisting of polychlorinated dibenzo-p-dioxin (PCDD), polychlorinated dibenzofuran (PDCF), and polychlorinated biphenyl (PCB).
12. The pharmaceutical composition of claim 11, wherein the polychlorinated dibenzo-p-dioxin is 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD).
13. A food composition antagonistic to a dioxin or a dioxin-like substance, the food composition comprising a peptide consisting of the amino acid sequence of SEQ ID NO: 2 as an active ingredient, optionally wherein the N— or C-terminus of the peptide is modified.
14. A cosmetic composition for improving skin condition comprising the peptide of claim 8 as an active ingredient.
15. The pharmaceutical composition of claim 10, wherein the disease caused by a dioxin or a dioxin-like substance is a skin disease, which is chloracne.
16. A method for treating a disease caused by a dioxin or a dioxin-like substance in a subject, the method comprising administering a pharmaceutical, cosmetic, or food composition comprising a peptide of claim 8 as an active ingredient to the subject.
17. The method of claim 16, wherein the disease caused by a dioxin or a dioxin-like substance is selected from the group consisting of a skin disease, decreased sperm count, testicular cancer, prostate cancer, endometrial hyperplasia, breast cancer, hepatotoxicity, weakened immunity, hyperlipidemia, hypospadia, cryptorchidism, deformed child birth, vascular damage, hepatocellular carcinoma, hepatomegaly, adenofibrosis, weight loss, hair loss, oral edema, blepharedema, and gastric mucosal ulcer.
18. The method of claim 16, wherein the dioxin-like substance is selected from the group consisting of polychlorinated dibenzo-p-dioxin (PCDD), polychlorinated dibenzofuran (PDCF), and polychlorinated biphenyl (PCB).
19. The method of claim 18, wherein the polychlorinated dibenzo-p-dioxin is 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD).
20. The peptide of claim 8, wherein the peptide comprises an N— or a C-terminal modification.
21. The peptide of claim 20, wherein the peptide comprises an N-terminal modification which is a protective group selected from the group consisting of an acetyl group, a fluoreonylmethoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, and a polyethylene glycol (PEG).
22. The peptide of claim 20, wherein the peptide comprises a C-terminal modification which is selected from the group consisting of an amino group (—NH.sub.2) and an azide group (—NHNH.sub.2).
23. The peptide of claim 8, wherein the dioxin-like substance is selected from the group consisting of polychlorinated dibenzo-p-dioxin (PCDD), polychlorinated dibenzofuran (PDCF), and polychlorinated biphenyl (PCB).
Description
BRIEF DESCRIPTION OF DRAWINGS
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
BEST MODE
[0094] The present disclosure relates to a peptide consisting of an amino acid sequence of SEQ ID NO: 1, 2, or 3.
MODE OF DISCLOSURE
[0095] Hereinafter, the present disclosure will be described in more detail with reference to the following examples. However, these examples are for illustrative purposes only and are not intended to limit the scope of the present disclosure.
Preparation Example. Synthesis of Sequence List
[0096] 70 g of chloro trityl chloride resin (CTC resin, Nova biochem Cat No. 01-64-0021) was added to a reactor and 490 ml of methylene chloride (MC) was added thereto, followed by stirring for 3 minutes. Subsequently, after the solution was removed therefrom, 490 ml of dimethyl formamide (DMF) was added thereto, the mixture was stirred for 3 minutes, and the solvent was removed therefrom. 700 ml of dichloromethane solution was added to the reactor, and then 200 mmole of Fmoc-Tyr(tBu)-OH (Bachem, Swiss) and 400 mmole of diisopropyl ethylamine (DIEA) were added thereto. The mixture was dissolved by stirring and maintained for 1 hour while stirring. After the resultant was washed, methanol and DIEA (2:1) were dissolved in dichloromethane (DCM) and maintained for 10 minutes, and then the resultant was washed with an excess of DCM/DMF (1:1). Then, after the solution was removed, 490 ml of dimethyl formamide (DMF) was added thereto, and the mixture was stirred for 3 minutes, and then the solvent was removed therefrom. 700 ml of a deprotection solution (20 % piperidine/DMF) was added to the reactor and stirred for 10 minutes at room temperature, and then the solution was removed. After the same amount of the deprotection solution was added thereto and maintained for 10 minutes, the solution was removed and the resultant was washed twice with DMF, once with MC, and once with DMF, each for 3 minutes to prepare a Tyr(tBu)-CTL resin.
[0097] 700 ml of a DMF solution was added to a new reactor, and 200 mmole of Fmoc-Arg(Pbf)-OH (Bachem, Swiss), 200 mmole of HoBt, and 200 mmole of HBTu were added thereto and dissolved by stirring. 400 mmole of DIEA was added to the reactor in twice and the mixture was stirred for at least 5 minutes to completely dissolve all solids. The dissolved amino acid mixture solution was added to the reactor including the deprotected resin and maintained for 1 hour at room temperature while stirring. After the reaction solution was removed, the resultant was stirred with a DMF solution three times each for 5 minutes and then the DMF solution was removed therefrom. A small amount of the reaction resin was taken and the degree of reaction was checked by Kaiser test (Nihydrin Test). Deprotection reaction was conducted twice in the same manner using the deprotection solution to prepare an Arg(Pbf)-Tyr(tBu)-CTL resin. The resin was sufficiently washed with DMF and MC and subjected to the Kaiser test again, followed by amino acid binding test as describe above. According to a selected amino acid sequence, chain reactions were conducted in the order of Fmoc-Gly-OH, Fmoc-Gly-OH, Fmoc-Gly-OH, Fmoc-Trp-OH, and Fmoc-Lys(Boc)-OH. After the Fmoc-protective group was reacted with the deprotection solution twice each for 10 minutes, the deprotection solution was removed by washing. The peptidyl resin was washed with DMF, MC, and methanol three times each, and dried while slowly flowing nitrogen gas, and then completely dried under the P.sub.2O.sub.5 atmosphere in a vacuum. Then, 1,900 ml of a leaving solution [81.5 % of trifluroacetic acid, 5.0 % of distilled water, 5.0 % of thioanisole, 5.0 % of phenol, 2.5 % of ethanedithiol (EDT), and 1.0 5 of triisopropylsilane (TIS)] was added thereto, and reactions of the mixture were maintained at room temperature for 2 hours while shaking. The resin was filtered, washed with a small amount of a TFA solution, and mixed with a mother solution. Cold ether was added to 2,090 ml of the mother solution to induce precipitation, and the mixture was centrifuged to collect precipitates, and then washed twice with cold ether. After removing the mother solution, the resultant was sufficiently dried under a nitrogen atmosphere to synthesize 70.8 g of a peptide consisting of an amino acid sequence of SEQ ID NO: 1 before purification (Yield: 97.0%). A molecular weight of 822.9 (Theoretical value: 822.9) was obtained using a molecular weight measurer.
[0098] Peptides having amino acid sequences of SEQ ID NO: 2 or SEQ ID NO: 3 are synthesized in the same manner as the above method.
TABLE-US-00001 SEQ ID NO: Sequence list Analysis value (mass spectrometer) Obtained value Theoretical value 1 KWGGGRY 822.9 822.9 2 ILGRWCG 803.9 803.9 3 DVENTS 663.6 663.6
Example 1. In Vitro Binding Assay
[0099] Each of the peptides having amino acid sequences of SEQ ID NOS: 1, 2, and 3 mixed with a coating buffer (20 mM sodium phosphate, pH 9.6) at a concentration of 1.8 mM was seeded on a plate for an enzyme-linked immunosorbent assay (ELISA) and cultured at 4° C. overnight. Subsequently, the peptide was washed with phosphate buffered saline with Tween-20 (PBST) and blocked with 3% of bovine serum albumin (BSA) for 2 hours at room temperature. After washing with PBST, 2 .Math.M of 2,3,7,8-tetrachlorodibenzo-p-dioxin (hereinafter, referred to as TCDD) was added to each well and cultured at room temperature for 2 hours. Subsequently, after washing with PBST, treatment with anti-TCDD antibody conjugated with fluorescein isothiocyanate (FITC) was conducted at a ratio of antibody:PBST=1:100 and the resultant was cultured for 2 hours at room temperature. Then, after washing with PBST, an excitation 488 nm/emission 520 nm value was measured using a fluorescence meter, and the results are shown in
TABLE-US-00002 SEQ ID NO: Control 50 .Math.M 500 .Math.M 1000 .Math.M 2000 .Math.M 1 100% 193% 360% 394% 575% 2 100% 128% 264% 358% 405% 3 100% 159% 253% 400% 420%
[0100] As shown in
Example 2. AhR Nuclear Translocation Test
[0101] HaCaT cells, human keratinocyte cells, were seeded on a 6-well plate at a density of 3x10.sup.5 cells/well and cultured overnight. Subsequently, 10 nM of TCDD and 50 .Math.M of the peptide consisting of an amino acid sequence of SEQ ID NO: 1, 2, or 3 were added to the culture medium. After 30 minutes of reaction, the cells were treated for 1 hour and collected to obtain nuclei and cytoplasmic proteins separated from each other. Westin blotting was performed using an aryl hydrocarbon receptor (AhR) antibody (Santa Cruz Biotechnology, U.S.A.) to identify activated nuclear translocation of AhR, and the results are shown in
TABLE-US-00003 SEQ ID NO: Control TCDD TCDD + Peptide 5 .Math.M 50 .Math.M 1 1 times 5.8 times 1.9 times 1.9 times 2 1 times 5.7 times 2.5 times 0.9 times 3 1 times 5.9 times 3 times 1.5 times
[0102] As shown in
Example 3. TCDD ICC
[0103] HaCaT cells, human keratinocyte cells, were seeded on a 6-well plate at a density of 3×10.sup.5 cells/well and cultured overnight. Subsequently, 50 nM of TCDD and 50 .Math.M of the peptide consisting of an amino acid sequence of SEQ ID NO: 1, 2, or 3 were added to the culture medium. After 30 minutes of reaction, the cells were treated for 5 minutes and immobilized with 4% paraformaldehyde for 30 minutes. Then, after washing three times, the cells were reacted with 0.5 % Triton X-100 for 15 minutes and washed three times. Subsequently, the cells were blocked with 3 % BSA for 1 hour and reacted with a primary antibody against TCDD conjugated with fluorescein isothiocyanate (FITC) (1:100) at 4° C. overnight. The cells were stained and mounted with 4,6-diamidino-2-phenylindole (DAPI) and observed with a fluorescence microscope. The results are shown in
[0104] As shown in
Example 4. ROS Analysis in Cell
[0105] HaCaT cells, human keratinocyte cells, were seeded on a 6-well plate at a density of 3×10.sup.5 cells/well and cultured overnight. Subsequently, 10 nM of TCDD and 50 .Math.M of the peptide consisting of an amino acid sequence of SEQ ID NO: 1, 2, or 3 were added to the culture medium. After 30 minutes of reaction, the cells were treated for 24 hours and further treated with DCFH-DA for 30 minutes. Then, the cells were collected and subjected to FACS analysis to observe changes of average FL1 values, and the results are shown in
[0106] As shown in
Example 5. RT-PCR of CYP1A1 and Inflammatory Molecules
[0107] HaCaT cells, human keratinocyte cells, were seeded on a 6-well plate at a density of 3×10.sup.5 cells/well and cultured overnight. Subsequently, 10 nM of TCDD and 50 .Math.M of the peptide consisting of an amino acid sequence of SEQ ID NO: 1, 2, or 3 were added to the culture medium. After 30 minutes of reaction, the cells were treated for 6 hours or 24 hours and collected to separate RNA therefrom. After quantifying RNA, cDNA was synthesized using a cDNA synthesis kit (Intron, Korea). Then, polymerase chain reaction (PCR) was performed using a PCR PreMix kit (Intron, Korea) and a primer for each of CYP1A1, TNF-a, IL-6, IL-1b, and COX-2 shown in Table 4. Then, by running the resultant on a 5 % agarose gel, the expression levels of mRNA of the growth factors were compared under the conditions of treating the respective samples, and the results are shown in
TABLE-US-00004 SEQ ID NO: Primer Sequence (5′-3′) 4 CYP1A1_F GGATCTTTCTCTGTACCCTGG 5 CYP1A1_R AGCATGTCCTTCAGCCCAGA 6 TNF-a_F CGTCAGCCGATTRTGCTATCT 7 TNF-a_R CGGACTCCGCAAAGTCTAAG 8 IL-6_F AAAGAGGCACTGCCAGAAAA 9 IL-6_R ATCTGAGGTGCCCATGCTAC 10 IL-1_b_F TTCGACACATGGGATAACGA 11 IL-1_b_R TCTTTCAACACGCAGGACAG 12 COX-2_F ATCATTCACCAGGCAAATTGC 13 COX-2_R GGCTTCAGCATAAAGCGTTTG
[0108] As shown in
Example 6. AhR Nuclear Translocation Test
[0109] HaCaT cells, human keratinocyte cells, were seeded on a 6-well plate at a density of 3×10.sup.5 cells/well and cultured overnight. 10 nM of urban particulate matter (PM, Sigma Aldrich, USA) and 50 .Math.M of the peptide consisting of an amino acid sequence of SEQ ID NO: 1, 2, or 3 were added to the culture medium. After 30 minutes of reaction, the cells were treated for 1 hour and collected to obtain nuclei and cytoplasmic proteins separated from each other. Then, Westin blotting was performed using aryl hydrocarbon receptor (AhR) antibody (Santa Cruz Biotechnology, USA) to identify activated nuclear translocation of AhR, and the results are shown in
[0110] As shown in
Example 7. RT-PCR of CYP1A1 and Inflammatory Molecules
[0111] HaCaT cells, human keratinocyte cells, were seeded on a 6-well plate at a density of 3×10.sup.5 cells/well and cultured overnight. Subsequently, 10 nM of particulate matter (PM) and 50 .Math.M of the peptide consisting of an amino acid sequence of SEQ ID NO: 1, 2, or 3 were added to the culture medium. After 30 minutes of reaction, the cells were treated for 6 hours or 24 hours and collected to separate RNA therefrom. After quantifying RNA, cDNA was synthesized using a cDNA synthesis kit (Intron, Korea). Then, PCR was performed using a PCR PreMix kit (Intron, Korea) and a primer for each of CYP1A1, TNF-a, IL-6, IL-1b, and COX-2 shown in Table 5. Then, by running the resultant on a 5 % agarose gel, the expression levels of mRNA of the growth factors were compared under the conditions of treating the respective samples, and the results are shown in
TABLE-US-00005 SEQ ID NO: Primer Sequence (5′-3′) 4 CYP1A1_F GGATCTTTCTCTGTACCCTGG 5 CYP1A1_R AGCATGTCCTTCAGCCCAGA 6 TNF-a_F CGTCAGCCGATTRTGCTATCT 7 TNF-a_R CGGACTCCGCAAAGTCTAAG 8 IL-6_F AAAGAGGCACTGCCAGAAAA 9 IL-6_R ATCTGAGGTGCCCATGCTAC 10 IL-1b_F TTCGACACATGGGATAACGA 11 IL-1b_R TCTTTCAACACGCAGGACAG 12 COX-2_F ATCATTCACCAGGCAAATTGC 13 COX-2_R GGCTTCAGCATAAAGCGTTTG
[0112] As identified in
INDUSTRIAL AVAILABILITY
[0113] The present disclosure relates to a peptide with a cytoprotective effect against environmental pollutants and a use thereof.