Human microRNAs for treatment of malignant tumours

10556019 · 2020-02-11

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention relates to a nucleic acid molecule for use in a method of treatment of cancer. The nucleic acid molecule comprises a sequence selected from SEQ ID NO 001 to SEQ ID NO 038. The nucleic acid molecules provided are not provided for the treatment of laryngeal cancer.

Claims

1. A method of treatment of breast cancer, comprising: administering to a subject in need thereof a therapeutically effective amount of a nucleic acid molecule consisting essentially of a sequence selected from the group consisting of SEQ ID NO 001 and SEQ ID NO 002, wherein the nucleic acid molecule initiates apoptosis in cancerous cells, thereby treating the breast cancer.

2. The method of claim 1, wherein the nucleic acid is provided in a pharmaceutical composition additionally comprising polyethylene glycol coupled liposomes, tissue specific antibodies or virus-like particles, cell-penetrating peptides (CPP), penetrating metal particles, magnetic particles, photo activated penetrating particles, chemically activated penetrating particles and enzymatically activated penetrating particle.

3. The method of claim 1, wherein the nucleic acid molecule is provided by a recombinant expression vector.

4. The method of claim 1, wherein the nucleotide sequence is operably linked to a promoter, particularly a promoter operable in a human cell.

Description

SHORT DESCRIPTION OF THE FIGURES

(1) FIG. 1 shows twenty microRNAs that interact with the 3UTR of Oct4. Bars represent z-values. The preceding z-transformation of signal values of Renilla luciferase (reporter enzyme) and Firefly luciferase (normalization enzyme, for cell number) makes a standardization of all results for the whole library possible. Error bars are standard error of means (n=3).

(2) FIG. 2 shows repression of Oct4 expression by microRNAs miRNA-299-3p and miRNA-335. NCC-IT based cells with a genomically integrated Oct4-responsive reporter construct were transfected with the indicated miRNAs. Oct4-reporter signal (Firefly luciferase) corresponding to the expression of Oct4 was measured after 24 hours.

(3) FIG. 3 shows the disruption of Oct4mRNA-miRNA hybridization by mutation of the respective binding sites for microRNA-299-3p and microRNA-335. WT: wild type, mut: mutated binding site, scramble: non-human microRNA sequence (negative control). Error bars are standard error of means (n=6).

(4) FIG. 4 shows the effect of microRNA-299-3p and microRNA-335 on the capability for invasion of MDA-MB-231 breast cancer cells. a) schematic overview of the used invasion assay; inhibiting effect of miRNA-299-3p and miRNA-335 on the invasive behaviour of MDA-MB-231 breast cancer cells. Both miRNAs reduced the b) invasion depth in m, c) number of invasive cells and d) branching of invading cells. Error bars are standard error of means (n=11/9/7). Statistical significance was tested with t-test. No branching was observed after stimulation with microRNA-299-3p.

(5) FIG. 5 shows that microRNA-299-3p induces apoptosis in MDA-MB-231 breast cancer cells. Cytotoxicity assays were performed with CellToxGreen-dye as described in the examples. scramble: non-human microRNA sequence (negative control). Error bars are standard error of means (n=10/9/10/5). Statistical significance was tested with H-test (Kruskal-Wallis-Test).

(6) FIG. 6 shows the reduction of OCT4 protein content by microRNA-299-3p and microRNA-335. A) Immunoblotting analysis of the transcription factor Oct4 (isoform A) in NCC-IT-Oct4 cells transfected with either miR-299-3p, miR-335 or a non-human miR used as negative control (scramble). B) Densitometric analysis of Oct4 expression (isoform A) in NCC-IT-Oct4 cells transfected with either miR-299-3p, miR-335 or a non-human miR used as negative control (scramble). Error bars are standard error of means (n=4). Statistical significance was tested with H-test (Kruskal-Wallis-Test).

(7) FIG. 7 shows photographs taken from the invasion assays described in FIG. 4. MDA-MB-231 cells were transfected with different pre-miRs A) scramble (negative control), B) miR-299-3p, C) magnification of A), D) miR-335 and E) schematic representation. Object lenses used: 10 for A), B) and D) and 40 for C).

EXAMPLES

Example 1 (Identification of Oct4 Interacting and Modulating miRNAs)

(8) A high-throughput detection method was utilized to identify human miRNAs that interact with Oct4.

(9) Cloning of Oct4-3UTR Vector

(10) The 3UTR sequence of Oct4 was amplified from a human genomic template by PCR and cloned into a fusion plasmid with the reporter genes for Firefly and Renilla luciferase controlled by a CMV promoter. The fusion plasmid called pc5/Psi was cloned previously by using parts of pcDNA5/FRT (Invitrogen) and psiCHECK-2 (Promega, catalog C8021). Renilla luciferase was coupled with the 3UTR serving as reporter gene, and Firefly luciferase served as cell number control.

(11) Stable Transfection of HEK293-FRT Cells by Homologous Recombination

(12) Using the Flp-In system (Invitrogen), HEK293 cells were transfected with the 3UTR dual luciferase vectors. Both the cells and the plasmids possessed a Flippase Recognition Target site (FRT). The Flippase gene was provided by an additional vector called pOG44 (Invitrogen). The enzyme recognizes the FRTs, cuts the DNA and ligates the 3UTR vectors with the genomic site. The resulting transgenic HEK293 cells were thus isogenic and could be selected by hygromycin due to the resistance gene of the vector. The cellular genomic transgene was verified by PCR.

(13) For the preparation of the transfection solution 100 l of Opti-MEM (Gibco), 2 g of the pc5/Psi vector and 18 g of pOG44 were mixed and combined with a mix of 100 l of Opti-MEM and 10 l Roti-Fect (Roth). The combined solution was incubated for at least 15 min at ambient temperature.

(14) After 24 hours, the transfection medium was replaced by fresh complete medium (DMEM based, Gibco), and the cells were cultured for another day. Next, cells were splitted 1:5 and after growth of the cells, 10 ml of complete medium with 300 g/ml hygromycin B were then added to the cells. After 24 hours, the medium was replaced by 10 ml complete medium supplemented with 100 g/ml hygromycin. The cells were further cultured for at least a week.

(15) microRNA and Oct4 Interaction and Validation

(16) The pre-microRNA library provided by Ambion contained 477 individual human microRNAs distributed on six 96-well plates. The manufacturer's term pre-microRNA (double stranded DNA w/o stem-loop structure) must not be confused with the scientific concept (stem loop DNA). The absolute amount per miRNA species was 250 pmol. Using a multichannel pipette, the nucleotides were dissolved in 50 l RNase-free water to achieve a concentration of 5 pmol/l. The plates were then cryopreserved (20 C.).

(17) In preparation for the transfection, the miRNA solutions were dispensed into luminometer plates (Greiner; 3 pmol/5 l) using a cell culture robot (CyBio Selma) under sterile conditions.

(18) For the transfection, the plates were thawed and centrifuged briefly to collect the liquid in the ground. Using the luminometer (Labsystems), 15 l of transfection solution (14.8 l of Opti-MEM, 0.2 l Lipofectamine RNAiMAX) were injected into each well. The plates were incubated for at least 15 min at 20 C. in the dark in order to achieve a complete complexation of liposomes and nucleic acids.

(19) Then, 100 l of cell suspension, always containing 12,500 cells, were injected into each well with the luminometer after previous sterilization of the injector hoses.

(20) After incubation of the plates for 24 hours at 37 C. and 5% CO.sub.2 the cells were lysed with 20 l of 1:5 diluted passive lysis buffer (Promega) and shaked rigorously. In order to perform the luciferase assay later, the plates were frozen at 20 C.

(21) No later than three days after cryopreservation, the luciferase activity in the cell lysates was determined using 100 l Firefly and Renilla buffer each. The luminometer was programmed to measure with a delay of six seconds after injection and a duration of ten seconds.

(22) The obtained luminescence values were standardized using a z-transformation to make the signals of all the samples comparable. This standardization relates the mean and standard deviation of the entire 96-well luminometer plate values.

(23) MicroRNA Interaction with the 3UTR of Oct4

(24) In FIG. 1 the twenty most strongly interacting miRNAs are shown. The strongest interaction (note that z-values are always negative and the lower the value the stronger the interaction) was found for the miRNA-299-3p. The second best miRNA was miRNA-335, which was already reported to interact with Oct4 and therefore represents a valuable positive control demonstrating the validity of the used assay.

Example 2: Regulation of Oct4 Expression by miRNAs

(25) An Oct4 reporter system established in NCC-IT cells was used to identify effects of miRNAs on Oct4 expression levels.

(26) Long-Term Measurement of miRNA Interaction with Lentiviral Reporter System

(27) In order to investigate the effect of miR-299-3p in alternative cellular systems, a NCC-IT based cell line (Teshima et al., Lab Invest. 1988 September; 59(3):328-36). with a genomically integrated HIV-derived lentiviral Oct4-reporter construct (Cignal, Qiagen) was transfected with miR-299-3p. Additionally miR-335 was used as positive control and scrambled miR as negative control, respectively.

(28) The Oct4-reporter construct consists of an Oct4-responsive promoter sequence and the gene for the Firefly luciferase. The gene for Oct4 is expressed natively in the selected cell line Approximately 12,500 cells per well were transfected with 3 pmol miRNA incl. negative control (see above) in 100 l medium (DMEM w/o phenol red, 10% FCS, 1% HEPES, 250 M Luciferin D) in a 96-well luminometer plate.

(29) The response of NCC-IT-Oct4 cells to miRNA stimulation was recorded over a period of 24 h in a temperature-controlled luminometer at 37 C. (Top Count, Packard).

(30) Immunoblot Analysis

(31) In order to investigate the effect of miR-299-3p and miR-335 on the abundance of Oct4 protein levels, around 62,500 NCC-IT-Oct4 cells were seeded into a 24-well-cell culture plate and were transfected with 0.75 l Lipofectamine RNAiMAX and 15 pmol premicroRNA-299-3p, -335 and the negative control in Opti-MEM (ad 500 l).

(32) This procedure was twice repeated every 24 h.

(33) A degenerative miRNA effect could be observed after 3 days by visual inspection. The cells were lysed in 40 l urea buffer (6 M). The cell debris was removed by centrifugation. The protein content of the solution was determined using a spectrophotometer.

(34) For the detection of Oct4 protein isoform A (45 kDa), a concentration of 10% was chosen for the polyacrylamide gel separation. Vinculin was used as a loading control. For electrophoresis, 40 l protein solution (c=50 g/ml) were applied.

(35) After protein transfer, the blot membrane (PVDF) was incubated with the two primary antibody solutions (against Oct4, isoform A and B, sc-5279, Santa Cruz; each with antibody against vinculin, 4650, Cell signaling technology, 1:100,000=2 ng/ml). The blot membrane was washed and afterwards incubated with a secondary antibody solution (infrared chromophore, 35568, Thermo Fisher). The infrared signals of the hybridizing secondary antibodies were detected with a documentation tool and digitized. The signal bands in the files were obtained by densitometry measured with an Image Analyzer program (Aida).

(36) miRNA-299-3p Regulates Oct4 Expression

(37) The reduction of Oct4 expression is shown in FIG. 2 using the lentiviral reporter system mentioned above. Both tested microRNAs reduced the expression of Oct 4 significantly when compared to a non-human control microRNA used as negative control (scramble).

(38) In FIG. 6 the effect of miR-299-3p and miR-335 on the abundance of Oct4 protein levels in NCC-IT-Oct4 cells is shown. Transfection with miR-335 significantly reduced Oct4 protein levels by 40% as compared to negative control (scramble). Treatment with miR-299-3p resulted in a significant reduction of Oct4 protein levels by 55% as compared to negative control (scramble).

Example 3: Mutation of Putative Binding Site

(39) Binding Analysis of the Interaction Between miRNA and Oct4

(40) To investigate which area of the Oct4 3UTR is bound by effective microRNAs, the putative binding sites were determined using the bioinformatical service TargetScan (www.targetscan.com).

(41) The potentially binding nucleotides for both microRNAs were partially replaced in silico (FIG. 3). The two mutated 3UTR sequences with additional restriction sites were synthesized by a service provider and afterwards cloned into the pc5/Psi dual luciferase vector.

(42) The two plasmids with both mutated 3UTRs of Oct4 (mut) and a pc5/Psi vector with an unaltered 3UTR sequence (WT) serving as control were transiently transfected into HEK293. The transfection medium was added to about 500,000 cells in a 6-well plate with 2 ml medium per well. After 24 h at 37 C. and 5% CO.sub.2, the cells were trypsinized and seeded in a microtiter plate luminometer (96 well plate) with a concentration of about 25,000 cells per well. The cells were transfected with miRNAs-299-3p, 335 or a negative control (scramble). After additional incubation for 24 h, the cells were lysed and the luciferase activity was determined using a luminometer.

(43) Mutation of the Binding Site Abolishes Effect of miRNAs 299-3p and 355 on Oct4 Expression

(44) As shown in FIG. 3 mutation of the binding sites for the miRs 299-3p and 335 prevents their inhibitory effect on Oct4 expression. Whereas miR-299-3p significantly reduces Oct4 expression in unmutated control cells (WT), this effect is completely absent in cells with a mutated binding site (mut; FIG. 3 upper graph). Non-human miR used as a negative control (scramble) did not affect Oct4 expression in the wildtype or mutants, thereby demonstrating the sequence specific effect of miR-299-3p. Identical results are observed using miR-335 (FIG. 3 lower graph).

Example 4: Effect of miRNAs on Invasive Capacity of Cancer Cells

(45) Invasion Assays

(46) The invasion assays were performed in hydrophilized thermoplastic microfluidic chips (made of Zeonor, Fluidik 221, microfluidic ChipShop). The chamber of a chip was filled half with 50 l matrigel (BD) containing the fluorescent dye DY-630-OH (c=100 g/l, Dyomics). After thermosetting of the matrigel, an additional air outlet was created with a glowing felting needle in the middle of the chamber.

(47) The day before highly invasive breast carcinoma cells (MDA-MB 231) were transfected with premicroRNA-299-3p, 335 or negative control (scramble; 150 pmol and around 400,000 cells per well in a 6-well cell culture plate). Then, a cell suspension with a concentration of about 1000 cells/l was injected into the other half of the chip chambers. After 48 h, the contact area of cell suspension and matrigel was photographed with a fluorescence microscope.

(48) miR-299-3p and miR-335 Reduce Invasive Capacity of Cancer Cells

(49) Using this assays three different parameters relating to the invasive capacity of a cancer cell can be measured, the sum of invasive depth, the number of cells that showed invasive action (invasive counts) and the branching index of invading cells.

(50) In FIG. 4b the mean sum of invasive depths is shown for breast cancer cells transfected with either miR-299-3p, miR-335 or a non-human miR used as negative control (scramble). Whereas treatment with miR-335 almost halfed the invasive depth in comparison to the negative control, treatment with miR-299-3p almost completely abolished the invasion of cancer cells.

(51) A similar picture can be observed regarding the number of cells that showed invasive behavior. Treatment with miR-35 reduced the number of invading cells by 30% whereas miR-299-3p reduced the number of invading cells by more than 80%.

(52) The number of branches invading cells can develop is associated with the aggressiveness. The branching index is calculated from the number of branched invasions multiplied with the number of branches in each event. Whereas cells treated with miR-335 have a dramatic reduction of their branching index by 85%, cells treated with miR-299-3p practically show no branching at all.

(53) Photographic images of invasions assays with cells treated with various miRs are provided in FIG. 7. In FIGS. 7 A) and C) cells treated with a non-human miR as negative control are shown. Treatment with miR-299-3p is shown in FIG. 7 B) and treatment with miR-335 is seen in FIG. 7 D).

Example 5: Induction of Apoptosis in Cancer Cells

(54) Cytotoxicity Assays

(55) MDA-MB-231 cells were pre-stained with Hoechst 33342 (bisBenzimide, as cell number control) with a concentration of 1 g/ml dye in full RPMI 1640 medium (incl. 10% FCS and 1% Pen/Strep). After 24 h the Hoechst medium war removed and the cells were transfected with 3 pmol premiRNA-335 and -299-3p in 96-well luminometer plates. Simultaneously, the cells were stained with CellTox Green dye (Promega) following the manufacturer's recommendations for endpoint express protocol. After an additional 48 h, the fluorescence of CellTox Green (CTG) and Hoechst 33342 (H) was measured in a standard plate reader.

(56) miR-299-3p Induces Apoptosis in Cancer Cells

(57) Treatment of MDA-MB-231 breast cancer cells with miR-335 had no significant effect of the rate of apoptosis as compared to cells treated with a non-human miR used as negative control (scramble). In stark contrast, treatment with miR-299-3p more than tripled the rate of apoptosis in contrast to the negative control.

(58) TABLE-US-00001 Sequencelistingofprecursorandmature microRNAsinthisapplication SEQIDNO1:>pre-miR-299;MI0000744 AAGAAAUGGUUUACCGUCCCACAUACAUUUUGAAUAUGUAUGUGGGAUGG UAAACCGCUUCUU SEQIDNO2:>miR-299-3p;MIMAT0000687 UAUGUGGGAUGGUAAACCGCUU SEQIDNO3:>pre-miR-573;MI0003580; UUUAGCGGUUUCUCCCUGAAGUGAUGUGUAACUGAUCAGGAUCUACUCAU GUCGUCUUUGGUAAAGUUAUGUCGCUUGUCAGGGUGAGGAGAGUUUUUG SEQIDNO4:>miR-573;MIMAT0003238 CUGAAGUGAUGUGUAACUGAUCAG SEQIDNO5:>pre-miR-595;MI0003607 ACGGAAGCCUGCACGCAUUUAACACCAGCACGCUCAAUGUAGUCUUGUAA GGAACAGGUUGAAGUGUGCCGUGGUGUGUCUGGAGGAAGCGCCUGU SEQIDNO6:>miR-595;MIMAT0003263 GAAGUGUGCCGUGGUGUGUCU SEQIDNO7:>pre-miR-301a-3p;MI0000745 CAGUGCAAUAGUAUUGUCAAAGC SEQIDNO8:>miR-301a;MI0000745 ACUGCUAACGAAUGCUCUGACUUUAUUGCACUACUGUACUUUACAGCUAG CAGUGCAAUAGUAUUGUCAAAGCAUCUGAAAGCAGG SEQIDNO9:>pre-mir-671;MI0003760 GCAGGUGAACUGGCAGGCCAGGAAGAGGAGGAAGCCCUGGAGGGGCUGGA GGUGAUGGAUGUUUUCCUCCGGUUCUCAGGGCUCCACCUCUUUCGGGCCG UAGAGCCAGGGCUGGUGC SEQIDNO10:>miR-671-5p;MIMAT0003880 AGGAAGCCCUGGAGGGGCUGGAG SEQIDNO11:>pre-miR-142;MI0000458 GACAGUGCAGUCACCCAUAAAGUAGAAAGCACUACUAACAGCACUGGAGG GUGUAGUGUUUCCUACUUUAUGGAUGAGUGUACUGUG SEQIDNO12:>miR-142-3p;MIMAT0000434 UGUAGUGUUUCCUACUUUAUGGA SEQIDNO13:>pre-miR-489;MI0003124 GUGGCAGCUUGGUGGUCGUAUGUGUGACGCCAUUUACUUGAACCUUUAGG AGUGACAUCACAUAUACGGCAGCUAAACUGCUAC SEQIDNO14:>miR-489-3p;MIMAT0002805 GUGACAUCACAUAUACGGCAGC SEQIDNO15:>pre-miR-542;MI0003686 CAGAUCUCAGACAUCUCGGGGAUCAUCAUGUCACGAGAUACCAGUGUGCA CUUGUGACAGAUUGAUAACUGAAAGGUCUGGGAGCCACUCAUCUUCA SEQIDNO16:>miR-542-3p;MIMAT0003389 UGUGACAGAUUGAUAACUGAAA SEQIDNO17:>pre-miR-506MI0003193 GCCACCACCAUCAGCCAUACUAUGUGUAGUGCCUUAUUCAGGAAGGUGUU ACUUAAUAGAUUAAUAUUUGUAAGGCACCCUUCUGAGUAGAGUAAUGUGC AACAUGGACAACAUUUGUGGUGGC SEQIDNO18:>miR-506-3p;MIMAT0002878 UAAGGCACCCUUCUGAGUAGA SEQIDNO19:>pre-miR-494;MI0003134 GAUACUCGAAGGAGAGGUUGUCCGUGUUGUCUUCUCUUUAUUUAUGAUGA AACAUACACGGGAAACCUCUUUUUUAGUAUC SEQIDNO20:>miR-494-3p;MIMAT0002816 UGAAACAUACACGGGAAACCUC SEQIDNO21:>pre-miR-26astemloop;MI0000083 GUGGCCUCGUUCAAGUAAUCCAGGAUAGGCUGUGCAGGUCCCAAUGGGCC UAUUCUUGGUUACUUGCACGGGGACGC SEQIDNO22:hsa-miR-26a-5p,MIMAT0000082 UUCAAGUAAUCCAGGAUAGGC SEQIDNO23:>pre-miR-326;MI0000808 CUCAUCUGUCUGUUGGGCUGGAGGCAGGGCCUUUGUGAAGGCGGGUGGUG CUCAGAUCGCCUCUGGGCCCUUCCUCCAGCCCCGAGGCGGAUUCA SEQIDNO24:>miR-326;MIMAT0000756 CCUCUGGGCCCUUCCUCCAG SEQIDNO25:>pre-miR-520c;MI0003158 UCUCAGGCUGUCGUCCUCUAGAGGGAAGCACUUUCUGUUGUCUGAAAGAA AAGAAAGUGCUUCCUUUUAGAGGGUUACCGUUUGAGA SEQIDNO26:>miR-520c-3p;MIMAT0002846 AAAGUGCUUCCUUUUAGAGGGU SEQIDNO27:>pre-miR-765;MI0005116 UUUAGGCGCUGAUGAAAGUGGAGUUCAGUAGACAGCCCUUUUCAAGCCCU ACGAGAAACUGGGGUUUCUGGAGGAGAAGGAAGGUGAUGAAGGAUCUGUU CUCGUGAGCCUGAA SEQIDNO28:>miR-765;MIMAT0003945 UGGAGGAGAAGGAAGGUGAUG SEQIDNO29:>pre-miR-376b;MI0002466 CAGUCCUUCUUUGGUAUUUAAAACGUGGAUAUUCCUUCUAUGUUUACGUG AUUCCUGGUUAAUCAUAGAGGAAAAUCCAUGUUUUCAGUAUCAAAUGCUG SEQIDNO30:>miR-376b-3p;MIMAT0002172 AUCAUAGAGGAAAAUCCAUGUU SEQIDNO31:>pre-miR-128b;MI0000727 UGUGCAGUGGGAAGGGGGGCCGAUACACUGUACGAGAGUGAGUAGCAGGU CUCACAGUGAACCGGUCUCUUUCCCUACUGUGUC SEQIDNO32:>miR-128-3p;MIMAT0000424 UCACAGUGAACCGGUCUCUUU SEQIDNO33:>pre-miR-650;MI0003665 CAGUGCUGGGGUCUCAGGAGGCAGCGCUCUCAGGACGUCACCACCAUGGC CUGGGCUCUGCUCCUCCUCACCCUCCUCACUCAGGGCACAGGUGAU SEQIDNO34:>miR-650;MIMAT0003320 AGGAGGCAGCGCUCUCAGGAC SEQIDNO35:>pre-miR-662;MI0003670 GCUGUUGAGGCUGCGCAGCCAGGCCCUGACGGUGGGGUGGCUGCGGGCCU UCUGAAGGUCUCCCACGUUGUGGCCCAGCAGCGCAGUCACGUUGC SEQIDNO36:>miR-662;MIMAT0003325 UCCCACGUUGUGGCCCAGCAG SEQIDNO37:>pre-miR-593;MI0003605 CCCCCAGAAUCUGUCAGGCACCAGCCAGGCAUUGCUCAGCCCGUUUCCCU CUGGGGGAGCAAGGAGUGGUGCUGGGUUUGUCUCUGCUGGGGUUUCUCCU SEQIDNO38:>miR-593-5p;MIMAT0003261 AGGCACCAGCCAGGCAUUGCUCAGC