ENGINEERED PRIMATE CYSTINE/CYSTEINE DEGRADING ENZYMES AS ANTINEOGENIC AGENTS

20200038511 ยท 2020-02-06

Assignee

Inventors

Cpc classification

International classification

Abstract

Methods and compositions related to the engineering of a protein with L-cyst(e)ine degrading enzyme activity are described. For example, in certain aspects there may be disclosed a modified cystathionine--lyase comprising one or more amino acid substitutions and capable of degrading L-cyst(e)ine. Furthermore, certain aspects of the invention provide compositions and methods for the treatment of cancer with L-cyst(e)ine using the disclosed proteins or nucleic acids.

Claims

1-24. (canceled)

25. A polypeptide comprising a variant of a native primate cystathionine-gamma-lyase (CGL) enzyme, wherein the variant CGL has cysteine/cystine degrading activity, comprises a sequence at least 95% identical to SEQ ID NO: 1, and comprises E59T and E339V substitutions relative to SEQ ID NO: 1.

26. The polypeptide of claim 25, further comprising a heterologous peptide segment.

27. The polypeptide of claim 26, wherein the heterologous peptide segment is an XTEN peptide, an IgG Fc, an albumin, or an albumin binding peptide.

28. The polypeptide of claim 25, wherein the polypeptide is coupled to polyethylene glycol (PEG).

29. The polypeptide of claim 28, wherein the polypeptide is coupled to PEG via one or more lysine or cystine residues.

30. A nucleic acid comprising a nucleotide sequence encoding the polypeptide of claim 25.

31. The nucleic acid of claim 30, wherein the nucleic acid is codon optimized for expression in bacteria, fungus, insects, or mammals.

32. An expression vector comprising the nucleic acid of claim 30.

33. A host cell comprising the nucleic acid of claim 30.

34. The host cell of claim 33, wherein the host cell is a bacterial cell, a fungal cell, an insect cell, or a mammalian cell.

35. A pharmaceutical formulation comprising the polypeptide of claim 25 in a pharmaceutically acceptable carrier.

36. A method of treating a tumor cell or a patient having a tumor cell, the method comprising administering to the tumor cell or the patient a therapeutically effective amount of the formulation of claim 35.

37. The method of claim 36, wherein the subject is maintained on a L-cystine and/or L-cysteine restricted diet.

38. The method of claim 36, wherein the tumor cell has been identified as having a decreased expression level of a cystathionine--synthease or cystathionine--lyase gene relative to a non-tumor cell.

39. The method of claim 36, wherein the tumor cell has been identified as having an increased expression level of a xCT() cysteine transporter relative to a non-tumor cell.

40. The method of claim 36, further comprising administering at least a second anticancer therapy to the patient.

41. A method of reducing cysteine levels and/or cystine levels in a patient in need thereof, the method comprising administering to the patient an amount of the formulation of claim 35 to reduce cysteine levels and/or cystine levels in the patient.

42. The method of claim 41, wherein the cysteine levels and/or cystine levels are serum cysteine levels and/or serum cystine levels.

43. The method of claim 41, wherein the formulation is administered intravenously, intradermally, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostaticaly, intrapleurally, intratracheally, intraocularly, intranasally, intravitreally, intravaginally, intrarectally, intramuscularly, subcutaneously, subconjunctival, intravesicularlly, mucosally, intrapericardially, intraumbilically, orally, by inhalation, by injection, by infusion, by continuous infusion, by localized perfusion bathing target cells directly, via a catheter, or via a lavage.

44. The method of claim 41, wherein the formulation is administered to the patient's blood, lymphatic fluid, or spinal fluid.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0031] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

[0032] FIG. 1Schematic of cyst(e)inease enzyme catalysis: hCGL and engineered hCGL variants convert L-cystine to pyruvate, ammonia, and thiocysteine. Thiocysteine is nonenzymatically degraded to hydrogen sulfide and L-cysteine. L-cysteine is further degraded by hCGL and engineered hCGL variants to pyruvate, ammonia, and hydrogen sulfide.

[0033] FIGS. 2A-2BMichaelis-Menten kinetics of hCGL-TV catalyzed degradation of (A) L-cystine (open circle) and (B) L-cysteine (solid circle).

[0034] FIG. 3Activity over time of hCGL-TV (open circle) in pooled human serum incubated at 37 C., with an apparent T.sub.0.5 of 2286 h.

[0035] FIGS. 4A-4BProstate tumor lines (A) DU145 and (B) PC3 treated with varying concentrations of hCGL-TV, with apparent IC.sub.50 values 60 nM for either cell line.

[0036] FIG. 5Amino acid sequence of hCGL-TV (SEQ ID NO: 11). Contains an N-terminal His.sub.6 tag and the hCGL amino acid sequence from residue 2-405 with mutations E59T-E339V underlined in bold.

[0037] FIGS. 6A-6B(A) A single 50 mg/kg i.p. dose of PEG-hCGL-TV in FVB mice (n=5/group) ablated cystine levels for over 96 h, and (B) lowered cysteine levels for over 48 h. (***p<0.001, **p<0.01, *p<0.05, and NS=Not significant.

[0038] FIG. 7The pharmacokinetics from a single 50 mg/kg i.p. dose of PEG-hCGL-TV in FVB mice (n=5/group) was followed over time resulting in an absorption T.sub.1/2 of 23 h, and an elimination T.sub.1/2 of 407 h.

[0039] FIG. 8FVB mice bearing HMVP2 prostate carcinoma allografts (n=8 each group) were treated i.p. with PEG-hCGL-TV at 50 mg/kg body weight (open square), PEG-hCGL-TV at 100 mg/kg body weight (solid triangle), PBS (open circle), or heat-inactivated PEG-hCGL-TV at 100 mg/kg body weight (solid diamond) once every 4 days.

[0040] FIG. 9Male nude mice bearing human (PC3) prostate carcinoma xenografts (n=7 each group) were treated i.p. with PEG-hCGL-TV at 50 mg/kg body weight (solid triangle), PEG-hCGL-TV at 100 mg/kg body weight (solid circle), PBS (solid diamond), or heat inactivated PEG-hCGL-TV at 100 mg/kg body weight (solid square) once every 4 days.

DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

[0041] Cysteine is considered a non-essential amino acid as it can be synthesized from homocysteine derived from the essential amino acid L-methionine via the transsulfuration pathway, which comprises the enzymes cystathionine--synthase (CBS) and cystathionine--lyase (CGL). Thus, the depletion of cysteine is expected to be relatively non-toxic to normal tissues with an intact transsulfuration pathway. Certain cancers may have abnormally low or absent expression of transsulfuration pathway enzymes CBS and/or CGL thus requiring them to import L-cysteine/L-cystine from the extracellular compartment. In hepatocellular carcinomas, the downregulation of CBS was further correlated with poor prognosis (Kim et al., 2009), and gastrointestinal cancers have also been observed to have frequent epigenetic silencing of CBS (Zhao et al., 2012). In other examples, the absence of CGL expression has been frequently observed in lymphoblastic leukemia cell lines (Glode et al., 1981; Link et al., 1983). The expression levels of CBS and CGL, as well as xCT() cysteine transporter, constitute important tumor biomarkers for patient selection for treatment with a cysteine/cysteine depletion regimen.

[0042] The present invention provides engineered, therapeutic enzymes that degrade L-cyst(e)ine. Also provided are methods of using said enzymes to treat diseases, such as cancer, lysosomal storage disease (i.e., cistinosis), and to abrogate adverse immune effects in a variety of autoimmune conditions. Thus, a therapeutic enzyme that can deplete these amino acids may have utility as an immune modulating agent.

I. Definitions

[0043] As used herein the terms protein and polypeptide refer to compounds comprising amino acids joined via peptide bonds and are used interchangeably.

[0044] As used herein, the term fusion protein refers to a chimeric protein containing proteins or protein fragments operably linked in a non-native way.

[0045] As used herein, the term half-life (-life) refers to the time that would be required for the concentration of a polypeptide thereof to fall by half in vitro or in vivo, for example, after injection in a mammal.

[0046] The terms in operable combination, in operable order, and operably linked refer to a linkage wherein the components so described are in a relationship permitting them to function in their intended manner, for example, a linkage of nucleic acid sequences in such a manner that a nucleic acid molecule capable of directing the transcription of a given gene and/or the synthesis of desired protein molecule, or a linkage of amino acid sequences in such a manner so that a fusion protein is produced.

[0047] The term linker is meant to refer to a compound or moiety that acts as a molecular bridge to operably link two different molecules, wherein one portion of the linker is operably linked to a first molecule, and wherein another portion of the linker is operably linked to a second molecule.

[0048] The term PEGylated refers to conjugation with polyethylene glycol (PEG), which has been widely used as a drug carrier, given its high degree of biocompatibility and ease of modification. PEG can be coupled (e.g., covalently linked) to active agents through the hydroxy groups at the end of the PEG chain via chemical methods; however, PEG itself is limited to at most two active agents per molecule. In a different approach, copolymers of PEG and amino acids have been explored as novel biomaterial that would retain the biocompatibility of PEG, but that would have the added advantage of numerous attachment points per molecule (thus providing greater drug loading), and that can be synthetically designed to suit a variety of applications.

[0049] The term gene refers to a DNA sequence that comprises control and coding sequences necessary for the production of a polypeptide or precursor thereof. The polypeptide can be encoded by a full-length coding sequence or by any portion of the coding sequence so as the desired enzymatic activity is retained.

[0050] The term native refers to the typical form of a gene, a gene product, or a characteristic of that gene or gene product when isolated from a naturally occurring source. A native form is that which is most frequently observed in a natural population and is thus arbitrarily designated the normal or wild-type form. In contrast, the term modified, variant, or mutant refers to a gene or gene product that displays modification in sequence and functional properties (i.e., altered characteristics) when compared to the native gene or gene product.

[0051] The term vector is used to refer to a carrier nucleic acid molecule into which a nucleic acid sequence can be inserted for introduction into a cell where it can be replicated. A nucleic acid sequence can be exogenous, which means that it is foreign to the cell into which the vector is being introduced or that the sequence is homologous to a sequence in the cell but in a position within the host cell nucleic acid in which the sequence is ordinarily not found. Vectors include plasmids, cosmids, viruses (bacteriophage, animal viruses, and plant viruses), and artificial chromosomes (e.g., YACs). One of skill in the art would be well equipped to construct a vector through standard recombinant techniques (see, for example, Maniatis et al., 1988 and Ausubel et al., 1994, both incorporated herein by reference).

[0052] The term expression vector refers to any type of genetic construct comprising a nucleic acid coding for an RNA capable of being transcribed. In some cases, RNA molecules are then translated into a protein, polypeptide, or peptide. In other cases, these sequences are not translated, for example, in the production of antisense molecules or ribozymes. Expression vectors can contain a variety of control sequences, which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operably linked coding sequence in a particular host cell. In addition to control sequences that govern transcription and translation, vectors and expression vectors may contain nucleic acid sequences that serve other functions as well and are described infra.

[0053] The term therapeutically effective amount as used herein refers to an amount of a therapeutic composition (such as a therapeutic polynucleotide and/or therapeutic polypeptide) that is employed in methods to achieve a therapeutic effect. The term therapeutic benefit or therapeutically effective as used throughout this application refers to anything that promotes or enhances the well-being of the subject with respect to the medical treatment of this condition. This includes, but is not limited to, a reduction in the frequency or severity of the signs or symptoms of a disease. For example, treatment of cancer may involve, for example, a reduction in the size of a tumor, a reduction in the invasiveness of a tumor, reduction in the growth rate of the cancer, or prevention of metastasis. Treatment of cancer may also refer to prolonging survival of a subject with cancer.

[0054] The term K.sub.M as used herein refers to the Michaelis-Menten constant for an enzyme and is defined as the concentration of the specific substrate at which a given enzyme yields one-half its maximum velocity in an enzyme catalyzed reaction. The term k.sub.cat as used herein refers to the turnover number or the number of substrate molecules each enzyme site converts to product per unit time, and in which the enzyme is working at maximum efficiency. The term k.sub.cat/K.sub.M as used herein is the specificity constant, which is a measure of how efficiently an enzyme converts a substrate into product.

[0055] The term cystathionine--lyase (CGL or cystathionase) refers to any enzyme that catalyzes the hydrolysis of cystathionine to cysteine. For example, it includes primate forms of cystathionine--lyase, or particularly, human forms of cystathionine--lyase.

[0056] Treatment and treating refer to administration or application of a therapeutic agent to a subject or performance of a procedure or modality on a subject for the purpose of obtaining a therapeutic benefit of a disease or health-related condition. For example, a treatment may include administration of a pharmaceutically effective amount of a cyst(e)inease.

[0057] Subject and patient refer to either a human or non-human, such as primates, mammals, and vertebrates. In particular embodiments, the subject is a human.

II. Cystathionine--lyase

[0058] A lyase is an enzyme that catalyzes the breaking of various chemical bonds, often forming a new double bond or a new ring structure. For example, an enzyme that catalyzed this reaction would be a lyase: ATP.fwdarw.cAMP+PP.sub.i. Lyases differ from other enzymes in that they only require one substrate for the reaction in one direction, but two substrates for the reverse reaction.

[0059] A number of pyrioxal-5-phosphate (PLP)-dependent enzymes are involved in the metabolism of cysteine, homocysteine, and methionine, and these enzymes form an evolutionary related family, designated as Cys/Met metabolism PLP-dependent enzymes. These enzymes are proteins of about 400 amino acids and the PLP group is attached to a lysine residue located in the central location of the polypeptide. Members of this family include cystathionine--lyase (CGL), cystathionine--synthase (CGS), cystathionine--lyase (CBL), methionine--lyase (MGL), O-acetylhomoserine (OAH)/O-acetyl-serine (OAS) sulfhydrylase (OSHS). Common to all of them is the formation of a Michaelis complex leading to an external substrate aldimine. The further course of the reaction is determined by the substrate specificity of the particular enzyme.

[0060] For example, the inventors introduced specific mutations into a PLP-dependent lyase family member, cystathionine--lyase, to change its substrate specificity. In this manner the inventors produced novel variants with the de novo ability to degrade both L-cystine and L-cysteine. In other embodiments, a modification of other PLP-dependent enzymes for producing novel L-cyst(e)ine degrading activity may also be contemplated.

[0061] Cystathionine--lyase (CGL or cystathionase) is an enzyme which breaks down cystathionine into cysteine and -ketobutyrate. Pyridoxal phosphate is a prosthetic group of this enzyme. As shown in Examples, protein engineering was used to convert cystathionase, which has only weak activity for the degradation of L-cysteine and L-cystine, into an enzyme that can degrade these amino acids at a high rate.

III. Cyst(e)inease Engineering

[0062] Some embodiments concern modified proteins and polypeptides. Particular embodiments concern a modified protein or polypeptide that exhibits at least one functional activity that is comparable to the unmodified version, preferably, the L-cyst(e)ine degrading activity. In further aspects, the protein or polypeptide may be further modified to increase serum stability. Thus, when the present application refers to the function or activity of modified protein or a modified polypeptide, one of ordinary skill in the art would understand that this includes, for example, a protein or polypeptide that possesses an additional advantage over the unmodified protein or polypeptide, such as the L-cyst(e)ine degrading activity. In certain embodiments, the unmodified protein or polypeptide is a native CGL, preferably a human CGL. It is specifically contemplated that embodiments concerning a modified protein may be implemented with respect to a modified polypeptide, and vice versa.

[0063] Determination of activity may be achieved using assays familiar to those of skill in the art, particularly with respect to the protein's activity, and may include for comparison purposes, for example, the use of native and/or recombinant versions of either the modified or unmodified protein or polypeptide. For example, the L-cyst(e)ine degrading activity may be determined by any assay to detect the production of any substrates resulting from the degradation of L-cystine and/or L-cysteine, such as the detection of pyruvate using 3-methyl-2-benzothiazolinone hydrazone (MBTH) (Takakura et al., 2004).

[0064] In certain embodiments, a modified polypeptide, such as a modified CGL, may be identified based on its increase in L-cyst(e)ine degrading activity. For example, substrate recognition sites of the unmodified polypeptide may be identified. This identification may be based on structural analysis or homology analysis. A population of mutants involving modifications of such substrate recognitions sites may be generated. In a further embodiment, mutants with increased L-cyst(e)ine degrading activity may be selected from the mutant population. Selection of desired mutants may include methods for the detection of byproducts or products from L-cyst(e)ine degradation.

[0065] Modified proteins may possess deletions and/or substitutions of amino acids; thus, a protein with a deletion, a protein with a substitution, and a protein with a deletion and a substitution are modified proteins. In some embodiments, these modified proteins may further include insertions or added amino acids, such as with fusion proteins or proteins with linkers, for example. A modified deleted protein lacks one or more residues of the native protein, but may possess the specificity and/or activity of the native protein. A modified deleted protein may also have reduced immunogenicity or antigenicity. An example of a modified deleted protein is one that has an amino acid residue deleted from at least one antigenic region that is, a region of the protein determined to be antigenic in a particular organism, such as the type of organism that may be administered the modified protein.

[0066] Substitution or replacement variants typically contain the exchange of one amino acid for another at one or more sites within the protein and may be designed to modulate one or more properties of the polypeptide, particularly its effector functions and/or bioavailability. Substitutions may or may not be conservative, that is, one amino acid is replaced with one of similar shape and charge. Conservative substitutions are well known in the art and include, for example, the changes of: alanine to serine; arginine to lysine; asparagine to glutamine or histidine; aspartate to glutamate; cysteine to serine; glutamine to asparagine; glutamate to aspartate; glycine to proline; histidine to asparagine or glutamine; isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to arginine; methionine to leucine or isoleucine; phenylalanine to tyrosine, leucine, or methionine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and valine to isoleucine or leucine.

[0067] In addition to a deletion or substitution, a modified protein may possess an insertion of residues, which typically involves the addition of at least one residue in the polypeptide. This may include the insertion of a targeting peptide or polypeptide or simply a single residue. Terminal additions, called fusion proteins, are discussed below.

[0068] The term biologically functional equivalent is well understood in the art and is further defined in detail herein. Accordingly, sequences that have between about 70% and about 80%, or between about 81% and about 90%, or even between about 91% and about 99% of amino acids that are identical or functionally equivalent to the amino acids of a control polypeptide are included, provided the biological activity of the protein is maintained. A modified protein may be biologically functionally equivalent to its native counterpart in certain aspects.

[0069] It also will be understood that amino acid and nucleic acid sequences may include additional residues, such as additional N- or C-terminal amino acids or 5 or 3 sequences, and yet still be essentially as set forth in one of the sequences disclosed herein, so long as the sequence meets the criteria set forth above, including the maintenance of biological protein activity where protein expression is concerned. The addition of terminal sequences particularly applies to nucleic acid sequences that may, for example, include various non-coding sequences flanking either of the 5 or 3 portions of the coding region or may include various internal sequences, i.e., introns, which are known to occur within genes.

IV. Enzymatic L-cyst(e)ine Degradation for Therapy

[0070] In certain aspects, the polypeptides may be used for the treatment of diseases, including cancers that are sensitive to L-cyst(e)ine depletion, such as hepatocellular carcinoma, melanoma, and renal cell carcinoma, with novel enzymes that deplete L-cystine and/or L-cysteine. The invention specifically discloses treatment methods using modified CGL with L-cyst(e)ine degrading activity. Certain embodiments of the present invention provide novel enzymes with L-cyst(e)ine degrading activity for increased therapeutic efficacy.

[0071] Certain aspects of the present invention provide a modified CGL with L-cyst(e)ine degrading activity for treating diseases, such as tumors. In one example, the modified polypeptide may have human polypeptide sequences and thus may prevent allergic reactions in human patients, allow repeated dosing, and increase the therapeutic efficacy.

[0072] Tumors for which the present treatment methods are useful include any malignant cell type, such as those found in a solid tumor or a hematological tumor. Exemplary solid tumors can include, but are not limited to, a tumor of an organ selected from the group consisting of pancreas, colon, cecum, stomach, brain, head, neck, ovary, kidney, larynx, sarcoma, lung, bladder, melanoma, prostate, and breast. Exemplary hematological tumors include tumors of the bone marrow, T or B cell malignancies, leukemias, lymphomas, blastomas, myelomas, and the like. Further examples of cancers that may be treated using the methods provided herein include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, leukemia, squamous cell cancer, lung cancer (including small-cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, and squamous carcinoma of the lung), cancer of the peritoneum, hepatocellular cancer, gastric or stomach cancer (including gastrointestinal cancer and gastrointestinal stromal cancer), pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, breast cancer, colon cancer, colorectal cancer, endometrial or uterine carcinoma, salivary gland carcinoma, kidney or renal cancer, prostate cancer, vulval cancer, thyroid cancer, various types of head and neck cancer, melanoma, superficial spreading melanoma, lentigo malignant melanoma, acral lentiginous melanomas, nodular melanomas, as well as B-cell lymphoma (including low grade/follicular non-Hodgkin's lymphoma (NHL); small lymphocytic (SL) NHL; intermediate grade/follicular NHL; intermediate grade diffuse NHL; high grade immunoblastic NHL; high grade lymphoblastic NHL; high grade small non-cleaved cell NHL; bulky disease NHL; mantle cell lymphoma; AIDS-related lymphoma; and Waldenstrom's macroglobulinemia), chronic lymphocytic leukemia (CLL), acute lymphoblastic leukemia (ALL), Hairy cell leukemia, multiple myeloma, acute myeloid leukemia (AML) and chronic myeloblastic leukemia.

[0073] The cancer may specifically be of the following histological type, though it is not limited to these: neoplasm, malignant; carcinoma; carcinoma, undifferentiated; giant and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma, malignant; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyp; adenocarcinoma, familial polyposis coli; solid carcinoma; carcinoid tumor, malignant; branchiolo-alveolar adenocarcinoma; papillary adenocarcinoma; chromophobe carcinoma; acidophil carcinoma; oxyphilic adenocarcinoma; basophil carcinoma; clear cell adenocarcinoma; granular cell carcinoma; follicular adenocarcinoma; papillary and follicular adenocarcinoma; nonencapsulating sclerosing carcinoma; adrenal cortical carcinoma; endometroid carcinoma; skin appendage carcinoma; apocrine adenocarcinoma; sebaceous adenocarcinoma; ceruminous adenocarcinoma; mucoepidermoid carcinoma; cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; infiltrating duct carcinoma; medullary carcinoma; lobular carcinoma; inflammatory carcinoma; paget's disease, mammary; acinar cell carcinoma; adenosquamous carcinoma; adenocarcinoma w/squamous metaplasia; thymoma, malignant; ovarian stromal tumor, malignant; thecoma, malignant; granulosa cell tumor, malignant; androblastoma, malignant; sertoli cell carcinoma; leydig cell tumor, malignant; lipid cell tumor, malignant; paraganglioma, malignant; extra-mammary paraganglioma, malignant; pheochromocytoma; glomangiosarcoma; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; malignant melanoma in giant pigmented nevus; epithelioid cell melanoma; blue nevus, malignant; sarcoma; fibrosarcoma; fibrous histiocytoma, malignant; myxosarcoma; liposarcoma; leiomyosarcoma; rhabdomyosarcoma; embryonal rhabdomyosarcoma; alveolar rhabdomyosarcoma; stromal sarcoma; mixed tumor, malignant; mullerian mixed tumor; nephroblastoma; hepatoblastoma; carcinosarcoma; mesenchymoma, malignant; brenner tumor, malignant; phyllodes tumor, malignant; synovial sarcoma; mesothelioma, malignant; dysgerminoma; embryonal carcinoma; teratoma, malignant; struma ovarii, malignant; choriocarcinoma; mesonephroma, malignant; hemangiosarcoma; hemangioendothelioma, malignant; kaposi's sarcoma; hemangiopericytoma, malignant; lymphangiosarcoma; osteosarcoma; juxtacortical osteosarcoma; chondrosarcoma; chondroblastoma, malignant; mesenchymal chondrosarcoma; giant cell tumor of bone; ewing's sarcoma; odontogenic tumor, malignant; ameloblastic odontosarcoma; ameloblastoma, malignant; ameloblastic fibrosarcoma; pinealoma, malignant; chordoma; glioma, malignant; ependymoma; astrocytoma; protoplasmic astrocytoma; fibrillary astrocytoma; astroblastoma; glioblastoma; oligodendroglioma; oligodendroblastoma; primitive neuroectodermal; cerebellar sarcoma; ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumor; meningioma, malignant; neurofibrosarcoma; neurilemmoma, malignant; granular cell tumor, malignant; malignant lymphoma; hodgkin's disease; hodgkin's; paragranuloma; malignant lymphoma, small lymphocytic; malignant lymphoma, large cell, diffuse; malignant lymphoma, follicular; mycosis fungoides; other specified non-hodgkin's lymphomas; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative small intestinal disease; leukemia; lymphoid leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; myeloid sarcoma; and hairy cell leukemia.

[0074] The engineered primate cyst(e)inease derived from CGL may be used herein as an antitumor agent in a variety of modalities for depleting L-cystine and/or L-cysteine from a tumor cell, tumor tissue, or the circulation of a mammal with cancer, or for depletion of L-cystine and/or L-cysteine where its depletion is considered desirable.

[0075] Depletion can be conducted in vivo in the circulation of a mammal, in vitro in cases where L-cystine and/or L-cysteine depletion in tissue culture or other biological mediums is desired, and in ex vivo procedures where biological fluids, cells, or tissues are manipulated outside the body and subsequently returned to the body of the patient mammal. Depletion of L-cystine and/or L-cysteine from circulation, culture media, biological fluids, or cells is conducted to reduce the amount of L-cystine and/or L-cysteine accessible to the material being treated, and therefore comprises contacting the material to be depleted with a L-cystine- and/or L-cysteine-degrading amount of the engineered primate cyst(e)inease under L-cystine- and/or L-cysteine-degrading conditions as to degrade the ambient L-cystine and/or L-cysteine in the material being contacted.

[0076] Because tumor cells may be dependent upon their nutrient medium for L-cystine and/or L-cysteine, the depletion may be directed to the nutrient source for the cells, and not necessarily the cells themselves. Therefore, in an in vivo application, treating a tumor cell includes contacting the nutrient medium for a population of tumor cells with the engineered cyst(e)inease. In this embodiment, the medium may be blood, lymphatic fluid, spinal fluid and the like bodily fluid where L-cystine and/or L-cysteine depletion is desired.

[0077] L-cystine- and/or L-cysteine-degrading efficiency can vary widely depending upon the application, and typically depends upon the amount of L-cystine and/or L-cysteine present in the material, the desired rate of depletion, and the tolerance of the material for exposure to cyst(e)inease. L-cystine and/or L-cysteine levels in a material, and therefore rates of L-cystine and/or L-cysteine depletion from the material, can readily be monitored by a variety of chemical and biochemical methods well known in the art. Exemplary L-cystine- and/or L-cysteine-degrading amounts are described further herein, and can range from 0.001 to 100 units (U) of engineered cyst(e)inease, preferably about 0.01 to 10 U, and more preferably about 0.1 to 5 U engineered cyst(e)inease per milliliter (mL) of material to be treated.

[0078] L-cystine- and/or L-cysteine-degrading conditions are buffer and temperature conditions compatible with the biological activity of a CGL enzyme, and include moderate temperature, salt, and pH conditions compatible with the enzyme, for example, physiological conditions. Exemplary conditions include about 4-40 C., ionic strength equivalent to about 0.05 to 0.2 M NaCl, and a pH of about 5 to 9, while physiological conditions are included.

[0079] In a particular embodiment, the invention contemplates methods of using engineered cyst(e)inease as an antitumor agent, and therefore comprises contacting a population of tumor cells with a therapeutically effective amount of engineered cyst(e)inease for a time period sufficient to inhibit tumor cell growth.

[0080] In one embodiment, the contacting in vivo is accomplished by administering, by intravenous or intraperitoneal injection, a therapeutically effective amount of a physiologically tolerable composition comprising an engineered cyst(e)inease of this invention to a patient, thereby depleting the circulating L-cystine and/or L-cysteine source of the tumor cells present in the patient. The contacting of engineered cyst(e)inease can also be accomplished by administering the engineered cyst(e)inease into the tissue containing the tumor cells.

[0081] A therapeutically effective amount of an engineered cyst(e)inease is a predetermined amount calculated to achieve the desired effect, i.e., to deplete L-cystine and/or L-cysteine in the tumor tissue or in a patient's circulation, and thereby cause the tumor cells to stop dividing. Thus, the dosage ranges for the administration of engineered cyst(e)inease of the invention are those large enough to produce the desired effect in which the symptoms of tumor cell division and cell cycling are reduced. The dosage should not be so large as to cause adverse side effects, such as hyperviscosity syndromes, pulmonary edema, congestive heart failure, and the like. Generally, the dosage will vary with age of, condition of, sex of, and extent of the disease in the patient and can be determined by one of skill in the art. The dosage can be adjusted by the individual physician in the event of any complication.

[0082] For example, a therapeutically effective amount of an engineered cyst(e)inease may be an amount such that when administered in a physiologically tolerable composition is sufficient to achieve a intravascular (plasma) or local concentration of from about 0.001 to about 100 units (U) per mL, preferably above about 0.1 U, and more preferably above 1 U engineered cyst(e)inease per mL. Typical dosages can be administered based on body weight, and are in the range of about 5-1000 U/kilogram (kg)/day, preferably about 5-100 U/kg/day, more preferably about 10-50 U/kg/day, and more preferably about 20-40 U/kg/day.

[0083] The engineered cyst(e)inease can be administered parenterally by injection or by gradual infusion over time. The engineered cyst(e)inease can be administered intravenously, intraperitoneally, orally, intramuscularly, subcutaneously, intracavity, transdermally, dermally, can be delivered by peristaltic means, can be injected directly into the tissue containing the tumor cells, or can be administered by a pump connected to a catheter that may contain a potential biosensor or L-cyst(e)ine.

[0084] The therapeutic compositions containing engineered cyst(e)inease are conventionally administered intravenously, as by injection of a unit dose, for example. The term unit dose when used in reference to a therapeutic composition refers to physically discrete units suitable as unitary dosage for the subject, each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect in association with the required diluent, i.e., carrier, or vehicle.

[0085] The compositions are administered in a manner compatible with the dosage formulation, and in a therapeutically effective amount. The quantity to be administered depends on the subject to be treated, capacity of the subject's system to utilize the active ingredient, and degree of therapeutic effect desired. Precise amounts of active ingredient required to be administered depend on the judgment of the practitioner and are peculiar to each individual. However, suitable dosage ranges for systemic application are disclosed herein and depend on the route of administration. Suitable regimes for initial administration and booster shots are also contemplated and are typified by an initial administration followed by repeated doses at one or more hour intervals by a subsequent injection or other administration. Exemplary multiple administrations are described herein and are particularly preferred to maintain continuously high serum and tissue levels of engineered cyst(e)inease and conversely low serum and tissue levels of L-cyst(e)ine. Alternatively, continuous intravenous infusion sufficient to maintain concentrations in the blood in the ranges specified for in vivo therapies are contemplated.

V. Conjugates

[0086] Compositions and methods of the present invention involve engineered cyst(e)ineases, such as by forming conjugates with heterologous peptide segments or polymers, such as polyethylene glycol. In further aspects, the engineered cyst(e)ineases may be linked to PEG to increase the hydrodynamic radius of the enzyme and hence increase the serum persistence. In certain aspects, the disclosed polypeptide may be conjugated to any targeting agent, such as a ligand having the ability to specifically and stably bind to an external receptor or binding site on a tumor cell (U.S. Patent Publ. 2009/0304666).

[0087] A. Fusion Proteins

[0088] Certain embodiments of the present invention concern fusion proteins. These molecules may have the modified cystathionase linked at the N- or C-terminus to a heterologous domain. For example, fusions may also employ leader sequences from other species to permit the recombinant expression of a protein in a heterologous host. Another useful fusion includes the addition of a protein affinity tag, such as a serum albumin affinity tag or six histidine residues, or an immunologically active domain, such as an antibody epitope, preferably cleavable, to facilitate purification of the fusion protein. Non-limiting affinity tags include polyhistidine, chitin binding protein (CBP), maltose binding protein (MBP), and glutathione-S-transferase (GST).

[0089] In a particular embodiment, the cyst(e)inease may be linked to a peptide that increases the in vivo half-life, such as an XTEN polypeptide (Schellenberger et al., 2009), IgG Fc domain, albumin, or albumin binding peptide.

[0090] Methods of generating fusion proteins are well known to those of skill in the art. Such proteins can be produced, for example, by de novo synthesis of the complete fusion protein, or by attachment of the DNA sequence encoding the heterologous domain, followed by expression of the intact fusion protein.

[0091] Production of fusion proteins that recover the functional activities of the parent proteins may be facilitated by connecting genes with a bridging DNA segment encoding a peptide linker that is spliced between the polypeptides connected in tandem. The linker would be of sufficient length to allow proper folding of the resulting fusion protein.

[0092] B. Linkers

[0093] In certain embodiments, the engineered cyst(e)inease may be chemically conjugated using bifunctional cross-linking reagents or fused at the protein level with peptide linkers.

[0094] Bifunctional cross-linking reagents have been extensively used for a variety of purposes, including preparation of affinity matrices, modification and stabilization of diverse structures, identification of ligand and receptor binding sites, and structural studies. Suitable peptide linkers may also be used to link the engineered cyst(e)inease, such as Gly-Ser linkers.

[0095] Homobifunctional reagents that carry two identical functional groups proved to be highly efficient in inducing cross-linking between identical and different macromolecules or subunits of a macromolecule, and linking of polypeptide ligands to their specific binding sites. Heterobifunctional reagents contain two different functional groups. By taking advantage of the differential reactivities of the two different functional groups, cross-linking can be controlled both selectively and sequentially. The bifunctional cross-linking reagents can be divided according to the specificity of their functional groups, e.g., amino-, sulfhydryl-, guanidine-, indole-, carboxyl-specific groups. Of these, reagents directed to free amino groups have become especially popular because of their commercial availability, ease of synthesis, and the mild reaction conditions under which they can be applied.

[0096] A majority of heterobifunctional cross-linking reagents contain a primary amine-reactive group and a thiol-reactive group. In another example, heterobifunctional cross-linking reagents and methods of using the cross-linking reagents are described (U.S. Pat. No. 5,889,155, specifically incorporated herein by reference in its entirety). The cross-linking reagents combine a nucleophilic hydrazide residue with an electrophilic maleimide residue, allowing coupling, in one example, of aldehydes to free thiols. The cross-linking reagent can be modified to cross-link various functional groups.

[0097] Additionally, any other linking/coupling agents and/or mechanisms known to those of skill in the art may be used to combine primate engineered cyst(e)inease, such as, for example, antibody-antigen interaction, avidin biotin linkages, amide linkages, ester linkages, thioester linkages, ether linkages, thioether linkages, phosphoester linkages, phosphoramide linkages, anhydride linkages, disulfide linkages, ionic and hydrophobic interactions, bispecific antibodies and antibody fragments, or combinations thereof.

[0098] It is preferred that a cross-linker having reasonable stability in blood will be employed. Numerous types of disulfide-bond containing linkers are known that can be successfully employed to conjugate targeting and therapeutic/preventative agents. Linkers that contain a disulfide bond that is sterically hindered may prove to give greater stability in vivo. These linkers are thus one group of linking agents.

[0099] In addition to hindered cross-linkers, non-hindered linkers also can be employed in accordance herewith. Other useful cross-linkers, not considered to contain or generate a protected disulfide, include SATA, SPDP, and 2-iminothiolane (Wawrzynczak and Thorpe, 1987). The use of such cross-linkers is well understood in the art. Another embodiment involves the use of flexible linkers.

[0100] Once chemically conjugated, the peptide generally will be purified to separate the conjugate from unconjugated agents and from other contaminants. A large number of purification techniques are available for use in providing conjugates of a sufficient degree of purity to render them clinically useful.

[0101] Purification methods based upon size separation, such as gel filtration, gel permeation, or high performance liquid chromatography, will generally be of most use. Other chromatographic techniques, such as Blue-Sepharose separation, may also be used. Conventional methods to purify the fusion proteins from inclusion bodies may be useful, such as using weak detergents, such as sodium N-lauroyl-sarcosine (SLS).

[0102] C. PEGylation

[0103] In certain aspects of the invention, methods and compositions related to PEGylation of engineered cyst(e)inease are disclosed. For example, the engineered cyst(e)inease may be PEGylated in accordance with the methods disclosed herein.

[0104] PEGylation is the process of covalent attachment of poly(ethylene glycol) polymer chains to another molecule, normally a drug or therapeutic protein. PEGylation is routinely achieved by incubation of a reactive derivative of PEG with the target macromolecule. The covalent attachment of PEG to a drug or therapeutic protein can mask the agent from the host's immune system (reduced immunogenicity and antigenicity) or increase the hydrodynamic size (size in solution) of the agent, which prolongs its circulatory time by reducing renal clearance. PEGylation can also provide water solubility to hydrophobic drugs and proteins.

[0105] The first step of the PEGylation is the suitable functionalization of the PEG polymer at one or both terminals. PEGs that are activated at each terminus with the same reactive moiety are known as homobifunctional, whereas if the functional groups present are different, then the PEG derivative is referred as heterobifunctional or heterofunctional. The chemically active or activated derivatives of the PEG polymer are prepared to attach the PEG to the desired molecule.

[0106] The choice of the suitable functional group for the PEG derivative is based on the type of available reactive group on the molecule that will be coupled to the PEG. For proteins, typical reactive amino acids include lysine, cysteine, histidine, arginine, aspartic acid, glutamic acid, serine, threonine, and tyrosine. The N-terminal amino group and the C-terminal carboxylic acid can also be used.

[0107] The techniques used to form first generation PEG derivatives are generally reacting the PEG polymer with a group that is reactive with hydroxyl groups, typically anhydrides, acid chlorides, chloroformates, and carbonates. In the second generation PEGylation chemistry more efficient functional groups, such as aldehyde, esters, amides, etc., are made available for conjugation.

[0108] As applications of PEGylation have become more and more advanced and sophisticated, there has been an increase in need for heterobifunctional PEGs for conjugation. These heterobifunctional PEGs are very useful in linking two entities, where a hydrophilic, flexible, and biocompatible spacer is needed. Preferred end groups for heterobifunctional PEGs are maleimide, vinyl sulfones, pyridyl disulfide, amine, carboxylic acids, and NHS esters.

[0109] The most common modification agents, or linkers, are based on methoxy PEG (mPEG) molecules. Their activity depends on adding a protein-modifying group to the alcohol end. In some instances polyethylene glycol (PEG diol) is used as the precursor molecule. The diol is subsequently modified at both ends in order to make a hetero- or homo-dimeric PEG-linked molecule.

[0110] Proteins are generally PEGylated at nucleophilic sites, such as unprotonated thiols (cysteinyl residues) or amino groups. Examples of cysteinyl-specific modification reagents include PEG maleimide, PEG iodoacetate, PEG thiols, and PEG vinylsulfone. All four are strongly cysteinyl-specific under mild conditions and neutral to slightly alkaline pH but each has some drawbacks. The thioether formed with the maleimides can be somewhat unstable under alkaline conditions so there may be some limitation to formulation options with this linker. The carbamothioate linkage formed with iodo PEGs is more stable, but free iodine can modify tyrosine residues under some conditions. PEG thiols form disulfide bonds with protein thiols, but this linkage can also be unstable under alkaline conditions. PEG-vinylsulfone reactivity is relatively slow compared to maleimide and iodo PEG; however, the thioether linkage formed is quite stable. Its slower reaction rate also can make the PEG-vinylsulfone reaction easier to control.

[0111] Site-specific PEGylation at native cysteinyl residues is seldom carried out, since these residues are usually in the form of disulfide bonds or are required for biological activity. On the other hand, site-directed mutagenesis can be used to incorporate cysteinyl PEGylation sites for thiol-specific linkers. The cysteine mutation must be designed such that it is accessible to the PEGylation reagent and is still biologically active after PEGylation.

[0112] Amine-specific modification agents include PEG NHS ester, PEG tresylate, PEG aldehyde, PEG isothiocyanate, and several others. All react under mild conditions and are very specific for amino groups. The PEG NHS ester is probably one of the more reactive agents; however, its high reactivity can make the PEGylation reaction difficult to control on a large scale. PEG aldehyde forms an imine with the amino group, which is then reduced to a secondary amine with sodium cyanoborohydride. Unlike sodium borohydride, sodium cyanoborohydride will not reduce disulfide bonds. However, this chemical is highly toxic and must be handled cautiously, particularly at lower pH where it becomes volatile.

[0113] Due to the multiple lysine residues on most proteins, site-specific PEGylation can be a challenge. Fortunately, because these reagents react with unprotonated amino groups, it is possible to direct the PEGylation to lower-pK amino groups by performing the reaction at a lower pH. Generally the pK of the alpha-amino group is 1-2 pH units lower than the epsilon-amino group of lysine residues. By PEGylating the molecule at pH 7 or below, high selectivity for the N-terminus frequently can be attained. However, this is only feasible if the N-terminal portion of the protein is not required for biological activity. Still, the pharmacokinetic benefits from PEGylation frequently outweigh a significant loss of in vitro bioactivity, resulting in a product with much greater in vivo bioactivity regardless of PEGylation chemistry.

[0114] There are several parameters to consider when developing a PEGylation procedure. Fortunately, there are usually no more than four or five key parameters. The design of experiments approach to optimization of PEGylation conditions can be very useful. For thiol-specific PEGylation reactions, parameters to consider include: protein concentration, PEG-to-protein ratio (on a molar basis), temperature, pH, reaction time, and in some instances, the exclusion of oxygen. (Oxygen can contribute to intermolecular disulfide formation by the protein, which will reduce the yield of the PEGylated product.) The same factors should be considered (with the exception of oxygen) for amine-specific modification except that pH may be even more critical, particularly when targeting the N-terminal amino group.

[0115] For both amine- and thiol-specific modifications, the reaction conditions may affect the stability of the protein. This may limit the temperature, protein concentration, and pH. In addition, the reactivity of the PEG linker should be known before starting the PEGylation reaction. For example, if the PEGylation agent is only 70 percent active, the amount of PEG used should ensure that only active PEG molecules are counted in the protein-to-PEG reaction stoichiometry.

VI. Proteins and Peptides

[0116] In certain embodiments, the present invention concerns novel compositions comprising at least one protein or peptide, such as an engineered cyst(e)inease. These peptides may be comprised in a fusion protein or conjugated to an agent as described supra.

[0117] As used herein, a protein or peptide generally refers, but is not limited to, a protein of greater than about 200 amino acids, up to a full length sequence translated from a gene; a polypeptide of greater than about 100 amino acids; and/or a peptide of from about 3 to about 100 amino acids. For convenience, the terms protein, polypeptide, and peptide are used interchangeably herein.

[0118] As used herein, an amino acid residue refers to any naturally occurring amino acid, any amino acid derivative, or any amino acid mimic known in the art. In certain embodiments, the residues of the protein or peptide are sequential, without any non-amino acids interrupting the sequence of amino acid residues. In other embodiments, the sequence may comprise one or more non-amino acid moieties. In particular embodiments, the sequence of residues of the protein or peptide may be interrupted by one or more non-amino acid moieties.

[0119] Accordingly, the term protein or peptide encompasses amino acid sequences comprising at least one of the 20 common amino acids found in naturally occurring proteins, or at least one modified or unusual amino acid.

[0120] Proteins or peptides may be made by any technique known to those of skill in the art, including the expression of proteins, polypeptides, or peptides through standard molecular biological techniques, the isolation of proteins or peptides from natural sources, or the chemical synthesis of proteins or peptides. The nucleotide and protein, polypeptide, and peptide sequences corresponding to various genes have been previously disclosed, and may be found at computerized databases known to those of ordinary skill in the art. One such database is the National Center for Biotechnology Information's Genbank and GenPept databases (available on the world wide web at ncbi.nlm.nih.gov/). The coding regions for known genes may be amplified and/or expressed using the techniques disclosed herein or as would be known to those of ordinary skill in the art. Alternatively, various commercial preparations of proteins, polypeptides, and peptides are known to those of skill in the art.

VII. Nucleic Acids and Vectors

[0121] In certain aspects of the invention, nucleic acid sequences encoding an engineered cyst(e)inease or a fusion protein containing a modified cyst(e)inease may be disclosed. Depending on which expression system is used, nucleic acid sequences can be selected based on conventional methods. For example, if the engineered cyst(e)inease is derived from primate CGL and contains multiple codons that are rarely utilized in E. coli, then that may interfere with expression. Therefore, the respective genes or variants thereof may be codon optimized for E. coli expression. Various vectors may be also used to express the protein of interest, such as engineered cyst(e)inease. Exemplary vectors include, but are not limited, plasmid vectors, viral vectors, transposon, or liposome-based vectors.

VIII. Host Cells

[0122] Host cells may be any that may be transformed to allow the expression and secretion of engineered cyst(e)inease and conjugates thereof. The host cells may be bacteria, mammalian cells, yeast, or filamentous fungi. Various bacteria include Escherichia and Bacillus. Yeasts belonging to the genera Saccharomyces, Kiuyveromyces, Hansenula, or Pichia would find use as an appropriate host cell. Various species of filamentous fungi may be used as expression hosts, including the following genera: Aspergillus, Trichoderma, Neurospora, Penicillium, Cephalosporium, Achlya, Podospora, Endothia, Mucor, Cochliobolus, and Pyricularia.

[0123] Examples of usable host organisms include bacteria, e.g., Escherichia coli MC1061, derivatives of Bacillus subtilis BRB1 (Sibakov et al., 1984), Staphylococcus aureus SAI123 (Lordanescu, 1975) or Streptococcus lividans (Hopwood et al., 1985); yeasts, e.g., Saccharomyces cerevisiae AH 22 (Mellor et al., 1983) or Schizosaccharomyces pombe; and filamentous fungi, e.g., Aspergillus nidulans, Aspergillus awamori (Ward, 1989), or Trichoderma reesei (Penttila et al., 1987; Harkki et al., 1989).

[0124] Examples of mammalian host cells include Chinese hamster ovary cells (CHO-K1; ATCC CCL61), rat pituitary cells (GH1; ATCC CCL82), HeLa S3 cells (ATCC CCL2.2), rat hepatoma cells (H-4-II-E; ATCCCRL 1548), SV40-transformed monkey kidney cells (COS-1; ATCC CRL 1650), and murine embryonic cells (NIH-3T3; ATCC CRL 1658). The foregoing being illustrative but not limitative of the many possible host organisms known in the art. In principle, all hosts capable of secretion can be used whether prokaryotic or eukaryotic.

[0125] Mammalian host cells expressing the engineered cyst(e)inease and/or their fusion proteins are cultured under conditions typically employed to culture the parental cell line. Generally, cells are cultured in a standard medium containing physiological salts and nutrients, such as standard RPMI, MEM, IMEM, or DMEM, typically supplemented with 5%-10% serum, such as fetal bovine serum. Culture conditions are also standard, e.g., cultures are incubated at 37 C. in stationary or roller cultures until desired levels of the proteins are achieved.

IX. Protein Purification

[0126] Protein purification techniques are well known to those of skill in the art. These techniques involve, at one level, the homogenization and crude fractionation of the cells, tissue, or organ to polypeptide and non-polypeptide fractions. The protein or polypeptide of interest may be further purified using chromatographic and electrophoretic techniques to achieve partial or complete purification (or purification to homogeneity) unless otherwise specified. Analytical methods particularly suited to the preparation of a pure peptide are ion-exchange chromatography, gel exclusion chromatography, polyacrylamide gel electrophoresis, affinity chromatography, immunoaffinity chromatography, and isoelectric focusing. A particularly efficient method of purifying peptides is fast-performance liquid chromatography (FPLC) or even high-performance liquid chromatography (HPLC).

[0127] A purified protein or peptide is intended to refer to a composition, isolatable from other components, wherein the protein or peptide is purified to any degree relative to its naturally-obtainable state. An isolated or purified protein or peptide, therefore, also refers to a protein or peptide free from the environment in which it may naturally occur. Generally, purified will refer to a protein or peptide composition that has been subjected to fractionation to remove various other components, and which composition substantially retains its expressed biological activity. Where the term substantially purified is used, this designation will refer to a composition in which the protein or peptide forms the major component of the composition, such as constituting about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, or more of the proteins in the composition.

[0128] Various techniques suitable for use in protein purification are well known to those of skill in the art. These include, for example, precipitation with ammonium sulphate, PEG, antibodies and the like, or by heat denaturation, followed by centrifugation; chromatography steps, such as ion exchange, gel filtration, reverse phase, hydroxyapatite, and affinity chromatography; isoelectric focusing; gel electrophoresis; and combinations of these and other techniques. As is generally known in the art, it is believed that the order of conducting the various purification steps may be changed, or that certain steps may be omitted, and still result in a suitable method for the preparation of a substantially purified protein or peptide.

[0129] Various methods for quantifying the degree of purification of the protein or peptide are known to those of skill in the art in light of the present disclosure. These include, for example, determining the specific activity of an active fraction, or assessing the amount of polypeptides within a fraction by SDS/PAGE analysis. A preferred method for assessing the purity of a fraction is to calculate the specific activity of the fraction, to compare it to the specific activity of the initial extract, and to thus calculate the degree of purity therein, assessed by a -fold purification number. The actual units used to represent the amount of activity will, of course, be dependent upon the particular assay technique chosen to follow the purification, and whether or not the expressed protein or peptide exhibits a detectable activity.

[0130] There is no general requirement that the protein or peptide will always be provided in its most purified state. Indeed, it is contemplated that less substantially purified products may have utility in certain embodiments. Partial purification may be accomplished by using fewer purification steps in combination, or by utilizing different forms of the same general purification scheme. For example, it is appreciated that a cation-exchange column chromatography performed utilizing an HPLC apparatus will generally result in a greater -fold purification than the same technique utilizing a low pressure chromatography system. Methods exhibiting a lower degree of relative purification may have advantages in total recovery of protein product, or in maintaining the activity of an expressed protein.

[0131] In certain embodiments a protein or peptide may be isolated or purified, for example, an engineered cyst(e)inease, a fusion protein containing the engineered AAD, or an engineered cyst(e)inease post PEGylation. For example, a His tag or an affinity epitope may be comprised in such an engineered cyst(e)inease to facilitate purification. Affinity chromatography is a chromatographic procedure that relies on the specific affinity between a substance to be isolated and a molecule to which it can specifically bind. This is a receptor-ligand type of interaction. The column material is synthesized by covalently coupling one of the binding partners to an insoluble matrix. The column material is then able to specifically adsorb the substance from the solution. Elution occurs by changing the conditions to those in which binding will not occur (e.g., altered pH, ionic strength, temperature, etc.). The matrix should be a substance that does not adsorb molecules to any significant extent and that has a broad range of chemical, physical, and thermal stability. The ligand should be coupled in such a way as to not affect its binding properties. The ligand should also provide relatively tight binding. It should be possible to elute the substance without destroying the sample or the ligand.

[0132] Size exclusion chromatography (SEC) is a chromatographic method in which molecules in solution are separated based on their size, or in more technical terms, their hydrodynamic volume. It is usually applied to large molecules or macromolecular complexes, such as proteins and industrial polymers. Typically, when an aqueous solution is used to transport the sample through the column, the technique is known as gel filtration chromatography, versus the name gel permeation chromatography, which is used when an organic solvent is used as a mobile phase.

[0133] The underlying principle of SEC is that particles of different sizes will elute (filter) through a stationary phase at different rates. This results in the separation of a solution of particles based on size. Provided that all the particles are loaded simultaneously or near simultaneously, particles of the same size should elute together. Each size exclusion column has a range of molecular weights that can be separated. The exclusion limit defines the molecular weight at the upper end of this range and is where molecules are too large to be trapped in the stationary phase. The permeation limit defines the molecular weight at the lower end of the range of separation and is where molecules of a small enough size can penetrate into the pores of the stationary phase completely and all molecules below this molecular mass are so small that they elute as a single band.

[0134] High-performance liquid chromatography (or high-pressure liquid chromatography, HPLC) is a form of column chromatography used frequently in biochemistry and analytical chemistry to separate, identify, and quantify compounds. HPLC utilizes a column that holds chromatographic packing material (stationary phase), a pump that moves the mobile phase(s) through the column, and a detector that shows the retention times of the molecules. Retention time varies depending on the interactions between the stationary phase, the molecules being analyzed, and the solvent(s) used.

X. Pharmaceutical Compositions

[0135] It is contemplated that the novel cyst(e)inease can be administered systemically or locally to inhibit tumor cell growth and, most preferably, to kill cancer cells in cancer patients with locally advanced or metastatic cancers. They can be administered intravenously, intrathecally, and/or intraperitoneally. They can be administered alone or in combination with anti-proliferative drugs. In one embodiment, they are administered to reduce the cancer load in the patient prior to surgery or other procedures. Alternatively, they can be administered after surgery to ensure that any remaining cancer (e.g., cancer that the surgery failed to eliminate) does not survive.

[0136] It is not intended that the present invention be limited by the particular nature of the therapeutic preparation. For example, such compositions can be provided in formulations together with physiologically tolerable liquid, gel, or solid carriers, diluents, and excipients. These therapeutic preparations can be administered to mammals for veterinary use, such as with domestic animals, and clinical use in humans in a manner similar to other therapeutic agents. In general, the dosage required for therapeutic efficacy will vary according to the type of use and mode of administration, as well as the particularized requirements of individual subjects.

[0137] Such compositions are typically prepared as liquid solutions or suspensions, as injectables. Suitable diluents and excipients are, for example, water, saline, dextrose, glycerol, or the like, and combinations thereof. In addition, if desired, the compositions may contain minor amounts of auxiliary substances, such as wetting or emulsifying agents, stabilizing agents, or pH buffering agents.

[0138] Where clinical applications are contemplated, it may be necessary to prepare pharmaceutical compositions comprising proteins, antibodies, and drugs in a form appropriate for the intended application. Generally, pharmaceutical compositions may comprise an effective amount of one or more CGL variant or additional agents dissolved or dispersed in a pharmaceutically acceptable carrier. The phrases pharmaceutical or pharmacologically acceptable refers to molecular entities and compositions that do not produce an adverse, allergic, or other untoward reaction when administered to an animal, such as, for example, a human, as appropriate. The preparation of a pharmaceutical composition that contains at least one CGL variant isolated by the method disclosed herein, or additional active ingredient will be known to those of skill in the art in light of the present disclosure, as exemplified by Remington's Pharmaceutical Sciences, 18th Ed., 1990, incorporated herein by reference. Moreover, for animal (e.g., human) administration, it will be understood that preparations should meet sterility, pyrogenicity, general safety, and purity standards as required by the FDA Office of Biological Standards.

[0139] As used herein, pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, such like materials and combinations thereof, as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed., 1990, incorporated herein by reference). Except insofar as any conventional carrier is incompatible with the active ingredient, its use in the pharmaceutical compositions is contemplated.

[0140] Certain embodiments of the present invention may comprise different types of carriers depending on whether it is to be administered in solid, liquid, or aerosol form, and whether it needs to be sterile for the route of administration, such as injection. The compositions can be administered intravenously, intradermally, transdermally, intrathecally, intraarterially, intraperitoneally, intranasally, intravaginally, intrarectally, intramuscularly, subcutaneously, mucosally, orally, topically, locally, by inhalation (e.g., aerosol inhalation), by injection, by infusion, by continuous infusion, by localized perfusion bathing target cells directly, via a catheter, via a lavage, in lipid compositions (e.g., liposomes), or by other methods or any combination of the forgoing as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed., 1990, incorporated herein by reference).

[0141] The modified polypeptides may be formulated into a composition in a free base, neutral, or salt form. Pharmaceutically acceptable salts include the acid addition salts, e.g., those formed with the free amino groups of a proteinaceous composition, or which are formed with inorganic acids, such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, or mandelic acid. Salts formed with the free carboxyl groups can also be derived from inorganic bases, such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides; or such organic bases as isopropylamine, trimethylamine, histidine, or procaine. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms, such as formulated for parenteral administrations, such as injectable solutions, or aerosols for delivery to the lungs, or formulated for alimentary administrations, such as drug release capsules and the like.

[0142] Further in accordance with certain aspects of the present invention, the composition suitable for administration may be provided in a pharmaceutically acceptable carrier with or without an inert diluent. The carrier should be assimilable and includes liquid, semi-solid, i.e., pastes, or solid carriers. Except insofar as any conventional media, agent, diluent, or carrier is detrimental to the recipient or to the therapeutic effectiveness of a composition contained therein, its use in administrable composition for use in practicing the methods is appropriate. Examples of carriers or diluents include fats, oils, water, saline solutions, lipids, liposomes, resins, binders, fillers, and the like, or combinations thereof. The composition may also comprise various antioxidants to retard oxidation of one or more component. Additionally, the prevention of the action of microorganisms can be brought about by preservatives, such as various antibacterial and antifungal agents, including but not limited to parabens (e.g., methylparabens, propylparabens), chlorobutanol, phenol, sorbic acid, thimerosal or combinations thereof.

[0143] In accordance with certain aspects of the present invention, the composition is combined with the carrier in any convenient and practical manner, i.e., by solution, suspension, emulsification, admixture, encapsulation, absorption, and the like. Such procedures are routine for those skilled in the art.

[0144] In a specific embodiment of the present invention, the composition is combined or mixed thoroughly with a semi-solid or solid carrier. The mixing can be carried out in any convenient manner, such as grinding. Stabilizing agents can be also added in the mixing process in order to protect the composition from loss of therapeutic activity, i.e., denaturation in the stomach. Examples of stabilizers for use in a composition include buffers, amino acids, such as glycine and lysine, carbohydrates, such as dextrose, mannose, galactose, fructose, lactose, sucrose, maltose, sorbitol, mannitol, etc.

[0145] In further embodiments, the present invention may concern the use of a pharmaceutical lipid vehicle composition that includes CGL variants, one or more lipids, and an aqueous solvent. As used herein, the term lipid will be defined to include any of a broad range of substances that is characteristically insoluble in water and extractable with an organic solvent. This broad class of compounds is well known to those of skill in the art, and as the term lipid is used herein, it is not limited to any particular structure. Examples include compounds that contain long-chain aliphatic hydrocarbons and their derivatives. A lipid may be naturally occurring or synthetic (i.e., designed or produced by man). However, a lipid is usually a biological substance. Biological lipids are well known in the art, and include for example, neutral fats, phospholipids, phosphoglycerides, steroids, terpenes, lysolipids, glycosphingolipids, glycolipids, sulphatides, lipids with ether- and ester-linked fatty acids, polymerizable lipids, and combinations thereof. Of course, compounds other than those specifically described herein that are understood by one of skill in the art as lipids are also encompassed by the compositions and methods.

[0146] One of ordinary skill in the art would be familiar with the range of techniques that can be employed for dispersing a composition in a lipid vehicle. For example, the engineered cyst(e)inease or a fusion protein thereof may be dispersed in a solution containing a lipid, dissolved with a lipid, emulsified with a lipid, mixed with a lipid, combined with a lipid, covalently bonded to a lipid, contained as a suspension in a lipid, contained or complexed with a micelle or liposome, or otherwise associated with a lipid or lipid structure by any means known to those of ordinary skill in the art. The dispersion may or may not result in the formation of liposomes.

[0147] The actual dosage amount of a composition administered to an animal patient can be determined by physical and physiological factors, such as body weight, severity of condition, the type of disease being treated, previous or concurrent therapeutic interventions, idiopathy of the patient, and on the route of administration. Depending upon the dosage and the route of administration, the number of administrations of a preferred dosage and/or an effective amount may vary according to the response of the subject. The practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject.

[0148] In certain embodiments, pharmaceutical compositions may comprise, for example, at least about 0.1% of an active compound. In other embodiments, an active compound may comprise between about 2% to about 75% of the weight of the unit, or between about 25% to about 60%, for example, and any range derivable therein. Naturally, the amount of active compound(s) in each therapeutically useful composition may be prepared in such a way that a suitable dosage will be obtained in any given unit dose of the compound. Factors, such as solubility, bioavailability, biological half-life, route of administration, product shelf life, as well as other pharmacological considerations, will be contemplated by one skilled in the art of preparing such pharmaceutical formulations, and as such, a variety of dosages and treatment regimens may be desirable.

[0149] In other non-limiting examples, a dose may also comprise from about 1 microgram/kg/body weight, about 5 microgram/kg/body weight, about 10 microgram/kg/body weight, about 50 microgram/kg/body weight, about 100 microgram/kg/body weight, about 200 microgram/kg/body weight, about 350 microgram/kg/body weight, about 500 microgram/kg/body weight, about 1 milligram/kg/body weight, about 5 milligram/kg/body weight, about 10 milligram/kg/body weight, about 50 milligram/kg/body weight, about 100 milligram/kg/body weight, about 200 milligram/kg/body weight, about 350 milligram/kg/body weight, about 500 milligram/kg/body weight, to about 1000 milligram/kg/body weight or more per administration, and any range derivable therein. In non-limiting examples of a derivable range from the numbers listed herein, a range of about 5 milligram/kg/body weight to about 100 milligram/kg/body weight, about 5 microgram/kg/body weight to about 500 milligram/kg/body weight, etc., can be administered, based on the numbers described above.

XI. Combination Treatments

[0150] In certain embodiments, the compositions and methods of the present embodiments involve administration of a cyst(e)inease in combination with a second or additional therapy. Such therapy can be applied in the treatment of any disease that is associated with cyst(e)ine dependency. For example, the disease may be cancer.

[0151] The methods and compositions, including combination therapies, enhance the therapeutic or protective effect, and/or increase the therapeutic effect of another anti-cancer or anti-hyperproliferative therapy. Therapeutic and prophylactic methods and compositions can be provided in a combined amount effective to achieve the desired effect, such as the killing of a cancer cell and/or the inhibition of cellular hyperproliferation. This process may involve administering to the cells both a cyst(e)inease and a second therapy. A tissue, tumor, or cell can be exposed to one or more compositions or pharmacological formulation(s) comprising one or more of the agents (i.e., a cyst(e)inease or an anti-cancer agent), or by contacting the tissue, tumor, and/or cell with two or more distinct compositions or formulations, wherein one composition provides 1) a cyst(e)inease, 2) an anti-cancer agent, or 3) both a cyst(e)inease and an anti-cancer agent. Also, it is contemplated that such a combination therapy can be used in conjunction with chemotherapy, radiotherapy, surgical therapy, or immunotherapy.

[0152] The terms contacted and exposed, when applied to a cell, are used herein to describe the process by which a therapeutic construct and a chemotherapeutic or radiotherapeutic agent are delivered to a target cell or are placed in direct juxtaposition with the target cell. To achieve cell killing, for example, both agents are delivered to a cell in a combined amount effective to kill the cell or prevent it from dividing.

[0153] A cyst(e)inease may be administered before, during, after, or in various combinations relative to an anti-cancer treatment. The administrations may be in intervals ranging from concurrently to minutes to days to weeks. In embodiments where the cyst(e)inease is provided to a patient separately from an anti-cancer agent, one would generally ensure that a significant period of time did not expire between the time of each delivery, such that the two compounds would still be able to exert an advantageously combined effect on the patient. In such instances, it is contemplated that one may provide a patient with the cyst(e)inease and the anti-cancer therapy within about 12 to 24 or 72 h of each other and, more particularly, within about 6-12 h of each other. In some situations it may be desirable to extend the time period for treatment significantly where several days (2, 3, 4, 5, 6, or 7) to several weeks (1, 2, 3, 4, 5, 6, 7, or 8) lapse between respective administrations.

[0154] In certain embodiments, a course of treatment will last 1-90 days or more (this such range includes intervening days). It is contemplated that one agent may be given on any day of day 1 to day 90 (this such range includes intervening days) or any combination thereof, and another agent is given on any day of day 1 to day 90 (this such range includes intervening days) or any combination thereof. Within a single day (24-hour period), the patient may be given one or multiple administrations of the agent(s). Moreover, after a course of treatment, it is contemplated that there is a period of time at which no anti-cancer treatment is administered. This time period may last 1-7 days, and/or 1-5 weeks, and/or 1-12 months or more (this such range includes intervening days), depending on the condition of the patient, such as their prognosis, strength, health, etc. It is expected that the treatment cycles would be repeated as necessary.

[0155] Various combinations may be employed. For the example below a cyst(e)inease is A and an anti-cancer therapy is B:

TABLE-US-00001 A/B/A B/A/B B/B/A A/A/B A/B/B B/A/A A/B/B/B B/A/B/B B/B/B/A B/B/A/B A/A/B/B A/B/A/B A/B/B/A B/B/A/A B/A/B/A B/A/A/B A/A/A/B B/A/A/A A/B/A/A A/A/B/A

[0156] Administration of any compound or therapy of the present embodiments to a patient will follow general protocols for the administration of such compounds, taking into account the toxicity, if any, of the agents. Therefore, in some embodiments there is a step of monitoring toxicity that is attributable to combination therapy.

[0157] A. Chemotherapy

[0158] A wide variety of chemotherapeutic agents may be used in accordance with the present embodiments. The term chemotherapy refers to the use of drugs to treat cancer. A chemotherapeutic agent is used to connote a compound or composition that is administered in the treatment of cancer. These agents or drugs are categorized by their mode of activity within a cell, for example, whether and at what stage they affect the cell cycle. Alternatively, an agent may be characterized based on its ability to directly cross-link DNA, to intercalate into DNA, or to induce chromosomal and mitotic aberrations by affecting nucleic acid synthesis.

[0159] Examples of chemotherapeutic agents include alkylating agents, such as thiotepa and cyclosphosphamide; alkyl sulfonates, such as busulfan, improsulfan, and piposulfan; aziridines, such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylamelamines, including altretamine, triethylenemelamine, trietylenephosphoramide, triethiylenethiophosphoramide, and trimethylolomelamine; acetogenins (especially bullatacin and bullatacinone); a camptothecin (including the synthetic analogue topotecan); bryostatin; callystatin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues); cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycin (including the synthetic analogues, KW-2189 and CB1-TM1); eleutherobin; pancratistatin; a sarcodictyin; spongistatin; nitrogen mustards, such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, and uracil mustard; nitrosureas, such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine; antibiotics, such as the enediyne antibiotics (e.g., calicheamicin, especially calicheamicin gammalI and calicheamicin omegaI1); dynemicin, including dynemicin A; bisphosphonates, such as clodronate; an esperamicin; as well as neocarzinostatin chromophore and related chromoprotein enediyne antiobiotic chromophores, aclacinomysins, actinomycin, authrarnycin, azaserine, bleomycins, cactinomycin, carabicin, carminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, doxorubicin (including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins, such as mitomycin C, mycophenolic acid, nogalarnycin, olivomycins, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, and zorubicin; anti-metabolites, such as methotrexate and 5-fluorouracil (5-FU); folic acid analogues, such as denopterin, pteropterin, and trimetrexate; purine analogs, such as fludarabine, 6-mercaptopurine, thiamiprine, and thioguanine; pyrimidine analogs, such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, and floxuridine; androgens, such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, and testolactone; anti-adrenals, such as mitotane and trilostane; folic acid replenisher, such as frolinic acid; aceglatone; aldophosphamide glycoside; aminolevulinic acid; eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elformithine; elliptinium acetate; an epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids, such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; podophyllinic acid; 2-ethylhydrazide; procarbazine; PSKpolysaccharide complex; razoxane; rhizoxin; sizofiran; spirogermanium; tenuazonic acid; triaziquone; 2,2,2-trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A, roridin A and anguidine); urethan; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside (Ara-C); cyclophosphamide; taxoids, e.g., paclitaxel and docetaxel gemcitabine; 6-thioguanine; mercaptopurine; platinum coordination complexes, such as cisplatin, oxaliplatin, and carboplatin; vinblastine; platinum; etoposide (VP-16); ifosfamide; mitoxantrone; vincristine; vinorelbine; novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronate; irinotecan (e.g., CPT-11); topoisomerase inhibitor RFS 2000; difluorometlhylornithine (DMFO); retinoids, such as retinoic acid; capecitabine; carboplatin, procarbazine, plicomycin, gemcitabien, navelbine, farnesyl-protein tansferase inhibitors, transplatinum, and pharmaceutically acceptable salts, acids, or derivatives of any of the above.

[0160] B. Radiotherapy

[0161] Other factors that cause DNA damage and have been used extensively include what are commonly known as -rays, X-rays, and/or the directed delivery of radioisotopes to tumor cells. Other forms of DNA damaging factors are also contemplated, such as microwaves, proton beam irradiation (U.S. Pat. Nos. 5,760,395 and 4,870,287), and UV-irradiation. It is most likely that all of these factors affect a broad range of damage on DNA, on the precursors of DNA, on the replication and repair of DNA, and on the assembly and maintenance of chromosomes. Dosage ranges for X-rays range from daily doses of 50 to 200 roentgens for prolonged periods of time (3 to 4 wk), to single doses of 2000 to 6000 roentgens. Dosage ranges for radioisotopes vary widely, and depend on the half-life of the isotope, the strength and type of radiation emitted, and the uptake by the neoplastic cells.

[0162] C. Immunotherapy

[0163] The skilled artisan will understand that immunotherapies may be used in combination or in conjunction with methods of the embodiments. In the context of cancer treatment, immunotherapeutics, generally, rely on the use of immune effector cells and molecules to target and destroy cancer cells. Rituximab (RITUXAN) is such an example. The immune effector may be, for example, an antibody specific for some marker on the surface of a tumor cell. The antibody alone may serve as an effector of therapy or it may recruit other cells to actually affect cell killing. The antibody also may be conjugated to a drug or toxin (chemotherapeutic, radionuclide, ricin A chain, cholera toxin, pertussis toxin, etc.) and serve merely as a targeting agent. Alternatively, the effector may be a lymphocyte carrying a surface molecule that interacts, either directly or indirectly, with a tumor cell target. Various effector cells include cytotoxic T cells and NK cells.

[0164] In one aspect of immunotherapy, the tumor cell must bear some marker that is amenable to targeting, i.e., is not present on the majority of other cells. Many tumor markers exist and any of these may be suitable for targeting in the context of the present embodiments. Common tumor markers include CD20, carcinoembryonic antigen, tyrosinase (p97), gp68, TAG-72, HMFG, Sialyl Lewis Antigen, MucA, MucB, PLAP, laminin receptor, erb B, and p155. An alternative aspect of immunotherapy is to combine anticancer effects with immune stimulatory effects. Immune stimulating molecules also exist including: cytokines, such as IL-2, IL-4, IL-12, GM-CSF, gamma-IFN, chemokines, such as MIP-1, MCP-1, IL-8, and growth factors, such as FLT3 ligand.

[0165] Examples of immunotherapies currently under investigation or in use are immune adjuvants, e.g., Mycobacterium bovis, Plasmodium falciparum, dinitrochlorobenzene, and aromatic compounds (U.S. Pat. Nos. 5,801,005 and 5,739,169; Hui and Hashimoto, 1998; Christodoulides et al., 1998); cytokine therapy, e.g., interferons , , and , IL-1, GM-CSF, and TNF (Bukowski et al., 1998; Davidson et al., 1998; Hellstrand et al., 1998); gene therapy, e.g., TNF, IL-1, IL-2, and p53 (Qin et al., 1998; Austin-Ward and Villaseca, 1998; U.S. Pat. Nos. 5,830,880 and 5,846,945); and monoclonal antibodies, e.g., anti-CD20, anti-ganglioside GM2, and anti-p185 (Hollander, 2012; Hanibuchi et al., 1998; U.S. Pat. No. 5,824,311). It is contemplated that one or more anti-cancer therapies may be employed with the antibody therapies described herein.

[0166] D. Surgery

[0167] Approximately 60% of persons with cancer will undergo surgery of some type, which includes preventative, diagnostic or staging, curative, and palliative surgery. Curative surgery includes resection in which all or part of cancerous tissue is physically removed, excised, and/or destroyed and may be used in conjunction with other therapies, such as the treatment of the present embodiments, chemotherapy, radiotherapy, hormonal therapy, gene therapy, immunotherapy, and/or alternative therapies. Tumor resection refers to physical removal of at least part of a tumor. In addition to tumor resection, treatment by surgery includes laser surgery, cryosurgery, electrosurgery, and microscopically-controlled surgery (Mohs' surgery).

[0168] Upon excision of part or all of cancerous cells, tissue, or tumor, a cavity may be formed in the body. Treatment may be accomplished by perfusion, direct injection, or local application of the area with an additional anti-cancer therapy. Such treatment may be repeated, for example, every 1, 2, 3, 4, 5, 6, or 7 days, or every 1, 2, 3, 4, and 5 weeks or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months. These treatments may be of varying dosages as well.

[0169] E. Other Agents

[0170] It is contemplated that other agents may be used in combination with certain aspects of the present embodiments to improve the therapeutic efficacy of treatment. These additional agents include agents that affect the upregulation of cell surface receptors and GAP junctions, cytostatic and differentiation agents, inhibitors of cell adhesion, agents that increase the sensitivity of the hyperproliferative cells to apoptotic inducers, or other biological agents. Increases in intercellular signaling by elevating the number of GAP junctions would increase the anti-hyperproliferative effects on the neighboring hyperproliferative cell population. In other embodiments, cytostatic or differentiation agents can be used in combination with certain aspects of the present embodiments to improve the anti-hyperproliferative efficacy of the treatments. Inhibitors of cell adhesion are contemplated to improve the efficacy of the present embodiments. Examples of cell adhesion inhibitors are focal adhesion kinase (FAKs) inhibitors and Lovastatin. It is further contemplated that other agents that increase the sensitivity of a hyperproliferative cell to apoptosis, such as the antibody c225, could be used in combination with certain aspects of the present embodiments to improve the treatment efficacy.

XII. Kits

[0171] Certain aspects of the present invention may provide kits, such as therapeutic kits. For example, a kit may comprise one or more pharmaceutical composition as described herein and optionally instructions for their use. Kits may also comprise one or more devices for accomplishing administration of such compositions. For example, a subject kit may comprise a pharmaceutical composition and catheter for accomplishing direct intravenous injection of the composition into a cancerous tumor. In other embodiments, a subject kit may comprise pre-filled ampoules of an engineered cyst(e)inease, optionally formulated as a pharmaceutical, or lyophilized, for use with a delivery device.

[0172] Kits may comprise a container with a label. Suitable containers include, for example, bottles, vials, and test tubes. The containers may be formed from a variety of materials, such as glass or plastic. The container may hold a composition that includes an engineered cyst(e)inease that is effective for therapeutic or non-therapeutic applications, such as described above. The label on the container may indicate that the composition is used for a specific therapy or non-therapeutic application, and may also indicate directions for either in vivo or in vitro use, such as those described above. The kit of the invention will typically comprise the container described above and one or more other containers comprising materials desirable from a commercial and user standpoint, including buffers, diluents, filters, needles, syringes, and package inserts with instructions for use.

XIII. Examples

[0173] The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

Example 1Cystathionine--lyase as a Scaffold for a Human Cyst(e)inease Enzyme

[0174] Due to the undesired effects of immunogenicity seen clinically with the use of non-human protein therapeutics, the inventors sought to engineer therapeutically relevant cystine/cysteine degrading activity into a human enzyme (i.e., engineer an enzyme with high k.sub.cat and low K.sub.M values for cystine/cysteine and also displaying a favorable specificity). Humans have an enzyme called cystathionine--lyase (hCGL) whose function is to catalyze the last step in the mammalian transsulfuration pathway (Rao et al., 1990), namely the conversion of L-cystathionine to L-cysteine, alpha-ketobutyrate, and ammonia. Human CGL can also weakly degrade L-cysteine and its disulfide form, L-cystine, making it an ideal candidate for engineering. Using structurally- and phylogenetically-guided mutagenesis, hCGL variants were engineered to efficiently hydrolyze both L-cysteine and L-cystine.

Example 2Gene Synthesis and Expression of Human Cysthionine--lyase and Human Cyst(e)inease

[0175] The hCGL gene contains multiple codons that are rarely utilized in E. coli and can interfere with expression. Thus, in order to optimize protein expression in E. coli, the respective genes were assembled with codon optimized oligonucleotides designed using the DNA-Works software (Hoover et al., 2002). Each construct contains an N-terminal NcoI restriction site, an in-frame N-terminal His.sub.6 tag and a C-terminal EcoRI site for simplifying cloning. After cloning into a pET28a vector (Novagen), E. coli (BL21) containing an appropriate hCGL expression vector were grown at 37 C. using Terrific Broth (TB) media containing 50 g/ml kanamycin in shaking flasks at 250 rpm until reaching an OD.sub.600 of 0.5-0.6. At this point the cultures were switched to a shaker at 25 C. and induced with 0.5 mM IPTG and allowed to express protein for an additional 12 h. Cell pellets were then collected by centrifugation and re-suspended in an IMAC buffer (10 mM NaPO.sub.4/10 mM imidazole/300 mM NaCl, pH 8). After lysis by a French pressure cell, lysates were centrifuged at 20,000g for 20 min at 4 C., and the resulting supernatant applied to a nickel IMAC column, washed with 10-20 column volumes of IMAC buffer, and then eluted with an IMAC elution buffer (50 mM NaPO.sub.4/250 mM imidazole/300 mM NaCl, pH 8). Fractions containing enzyme were then incubated with 10 mM pyridoxal phosphate (PLP) for an hour at 25 C. Using a 10,000 MWCO centrifugal filter device (AMICON), proteins were then buffer exchanged several times into a 100 mM PBS, 10% glycerol, pH 7.3 solution. Aliquots of hCGL enzyme or hCGL-variant enzyme were then flash frozen in liquid nitrogen and stored at 80 C. hCGL or hCGL-variant enzyme purified in this manner was >95% homogeneous as assessed by SDS-PAGE and coomassie staining. The yield was calculated to be 200-300 mg/L culture based upon the calculated extinction coefficient, .sub.280=29,870 M.sup.1 cm.sup.1 in a final buffer concentration of 6 M guanidinium hydrochloride, 20 mM phosphate buffer, pH 6.5 (Gill and von Hippel, 1989).

Example 396-Well Plate Screen for Cyst(e)inease Activity and Ranking Clones

[0176] Human CGL slowly degrades L-cysteine to pyruvate, ammonia and H.sub.2S, and converts L-cystine to pyruvate, ammonia and thiocysteine (k.sub.cat/K.sub.M 0.2 s.sup.1 mM.sup.1 and 0.5 s.sup.1 mM.sup.1, respectively) (FIG. 1). Thiocysteine is further nonenzymatically degraded to L-cysteine and H.sub.2S. A colorimetric assay for the detection of pyruvate using 3-methyl-2-benzothiazolinone hydrazone (MBTH) (Takakura et al., 2004) was scaled to a 96-well plate format for screening small libraries and for ranking clones with the greatest cystine and/or cysteine lyase activity. This plate screen provides a facile method for picking the most active clones from the mutagenic libraries. Clones displaying greater activity than parental controls were selected for further characterization.

[0177] Single colonies containing mutagenized hCGL, or hCGL controls, were picked into 96-well culture plates containing 75 L of TB media/well containing 50 g/ml kanamycin. These cultures are then grown at 37 C. on a plate shaker until reaching an OD.sub.600 of 0.8-1. After cooling to 25 C., an additional 75 L of media/well containing 50 g/ml kanamycin and 2 mM IPTG was added. Expression was performed at 25 C. with shaking for at least 2 h, following which 100 L of culture/well was transferred to a 96-well assay plate. The assay plates were then centrifuged to pellet the cells, the media was removed, and the cells were lysed by addition of 50 L/well of B-PER protein extraction reagent (Pierce). After clearing by centrifugation the lysate was split between two plates for incubation with 0.8 mM L-cystine in one plate and 1.2 mM L-cysteine in the other and incubated 37 C. for 10-12 hrs. The reaction was then derivatized by addition of 3 parts of 0.03% MBTH solution in 1 M sodium acetate pH 5. The plates were heated at 50 C. for 40 min and after cooling were read at =320 nm in a microtiter plate reader.

Example 4Effect of Mutagenesis Upon Residues E59, R119, and E339 of hCGL

[0178] Structural analysis indicated that residues E59, R119, and E339 were likely involved in the recognition of hCGL for it substrate L-cystathionine. NNS codon (N can be A, T, G, or C; S can be G or C) saturation libraries were constructed at these sites and screened using the following mutagenic primers: (E59) Forward 5-GGCCAGCATAGCGGTTTTNNSTATAGCCGTAGCGGC (SEQ ID NO: 12), Reverse 5-GCCGCTACGGCTATASNNAAAACCGCTATGCTGGCC (SEQ ID NO: 13), (R119) Forward 5-GTATGGTGGGACCAATNNSTATTTCCGTCAGGTGGCG (SEQ ID NO: 14), Reverse 5-CGCCACCTGACGGAAATASNNATTGGTCCCACCATAC (SEQ ID NO: 15), (E339) Forward 5-CTGAAACTGTTTACCCTGGCANNSAGCTTGGGCGGCTTTG (SEQ ID NO: 16), and Reverse 5-CAAAGCCGCCCAAGCTSNNTGCCAGGGTAAACAGTTTCAG (SEQ ID NO: 17), using the hCGL gene as template DNA and specific end primers; forward 5-GATATACCATGGGAGGCCATCACCACCATCATCATGGCGGGCAGGAAAAGGATGCG (Seq ID NO: 18) and reverse 5-CTCGAATTCTCAACTGTGGCTTCCCGATGGGGGATGGGCCGCTTTCAGCGCCTGATC C (SEQ ID NO: 19). The PCR product was digested with NcoI and EcoRI and ligated into pET28a vector with T4 DNA ligase. The resulting ligations were transformed directly into E. coli (BL21) and plated on LB-kanamycin plates for subsequent screening as described in Example 3. All libraries were screened in two-fold excess of their theoretical size. Clones displaying activity were isolated and the sequences of the hCGL gene variants were determined to identify the mutations.

[0179] The enzyme variants were purified to greater than 95% homogeneity as assessed by SDS-PAGE. Incubation with PLP was shown to enhance the specific activity presumably because the E. coli cells used for expression do not produce sufficient PLP for the amount of enzyme produced. Once the enzyme had been loaded with PLP it was stable and no loss of the cofactor and thus no decrease in activity could be detected following several days of storage.

Example 5Characterization of Human Cyst(e)inease Variant hCGL-TV

[0180] One particular variant identified from the screen as having the highest catalytic activity for degrading both L-cystine and L-cysteine was found to have the following mutations: E59T, a synonymous codon change of R119R, and E339V. This variant was called hCGL-TV (FIG. 5) and was characterized for its ability to degrade L-cyst(e)ine in a 100 mM PBS buffer at pH 7.3 and 37 C. using a 1 mL scale MBTH assay similar to that described in Example 3. Under these conditions, the hCGL-TV variant was found to degrade L-cystine with a k.sub.cat of 1.00.05 s.sup.1, a K.sub.M of 0.160.02 mM, and a k.sub.cat/K.sub.M of 6.31.0 s.sup.1mM.sup.1 (FIG. 2A). The hCGL-TV variant was further found to have a k.sub.cat of 0.80.03 s.sup.1, a K.sub.M of 0.250.04 mM, and a k.sub.cat/K.sub.M of 3.20.6 s.sup.1mM.sup.1 for degradation of L-cysteine (FIG. 2B).

[0181] The serum stability of hCGL-TV was tested by incubation in pooled human serum at 37 C. At time points, aliquots were withdrawn and tested for remaining activity using L-cystine as a substrate. After plotting the data, the hCGL-TV variant was found to be very stable with an apparent T.sub.0.5 of 2286 h (FIG. 3).

Example 6In Vitro Cytotoxicity of hCGL-TV Against Prostate Tumor Cell Lines

[0182] The in vitro cytotoxicity of hCGL-TV was assessed using DU145 and PC3 prostate tumor cell lines. Cells were seeded at 3000 cells/well in RPMI-1640 media and allowed to grow for 24 h before titrations of hCGL-TV ranging from 0-10 M were added to each well. After incubation for 3 days the relative number of surviving cells was assessed colorimetrically using the (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) assay. Analysis of the resulting data yielded an apparent IC.sub.50 value of 60 nM for both the DU145 cell line and the PC3 cell line (FIGS. 4A and 4B, respectively).

Example 7Pharmacological Preparation of Human Cyst(e)inease

[0183] The hCGL-TV enzyme was purified as described in Example 2 with one exception: after binding to the IMAC column, the protein is washed extensively (90-100 column volumes) with an IMAC buffer containing 0.1% TRITON 114 in the sample. The sample was washed again with 10-20 column volumes of IMAC buffer, and then eluted with an IMAC elution buffer (50 mM NaPO.sub.4/250 mM imidazole/300 mM NaCl, pH 8). The wash with TRITON 114 was employed for endotoxin removal. The purified protein was subjected to buffer exchange into a 100 mM NaPO.sub.4 buffer at pH 8.3 using a 10,000 MWCO filtration device (AMICON). Subsequently, PLP was added at a concentration of 10 mM and the protein was incubated for 1 h at 25 C. Methoxy PEG Succinimidyl Carboxymethyl Ester 5000 MW (JenKem Technology) was then added to hCGL-TV at an 80:1 molar ratio and allowed to react for 1 h at 25 C. under constant stirring. The resulting mixture was extensively buffer exchanged (PBS with 10% glycerol) using a 100,000 MWCO filtration device (AMICON), and sterilized with a 0.2 micron syringe filter (VWR). All PEGylated enzymes were analyzed for lipopolysaccharide (LPS) content using a Limulus Amebocyte Lysate (LAL) kit (Cape Cod Incorporated).

Example 8Engineering of Primate Cyst(e)ineases

[0184] The sequences of CGLs from primate species, such as chimpanzees (Pan troglodytes; SEQ ID NO: 9), bonobos (Pan paniscus; SEQ ID NO: 10), orangutans (Pongo abelii; SEQ ID NO: 7), and macaques (Macaca fascicularis; SEQ ID NO: 8) are, respectively, about 99.3%, 98.8%, 96%, and 95.3% identical in amino acid composition to human CGL (SEQ ID NO: 1). Due to the sequence similarity, engineered CGLs from these organisms will not likely cause significant immune responses if introduced into humans as a therapeutic. Primate CGL enzymes with mutations conferring enhanced cyst(e)inease activity will be constructed using standard mutagenesis techniques as described in Example 4. The resulting genes will be cloned into pET28a and the sequence verified to ensure that no undesired mutations are incorporated. The constructs used to express and purify the resulting enzymes are described above. Primate CGLs engineered with amino acid positions corresponding to 59T and 339V (SEQ ID NOs: 3-6) are expected to have enhanced activity for both L-cystine and L-cysteine with k.sub.cat/K.sub.M values of at least 110.sup.3 s.sup.1M.sup.1 or higher. The serum stability at 37 C. of the engineered primate CGLs with enhanced cyst(e)inease activity will be determined as described above.

Example 9Pharmacodynamic (PD) Analyses of PEG-hCGL-TV in Mice

[0185] Male FVB mice were injected i.p. with 50 mg/kg of PEG-hCGL-TV and sacrificed at days 0, 1, 2, 4, and 6 (n=5 per group) for blood and serum collection. Serum samples were mixed with an internal standard mixture of 10 picomole deuterated cystine and cysteine and ultrafiltered using NANOSEP OMEGA centrifugal devices, 3 kDa cutoff (Pall Life Biosciences) (Tiziani et al., 2008; Tiziani et al., 2013). The filtered polar fractions were chromatographed using a reverse-phase BEH C18, 1.7 m, 2.1150 mm column (THERMO SCIENTIFIC ACCELA 1250 UPLC, Waters Corporation, USA) and introduced into an EXACTIVE Plus ORBITRAP mass spectrometer coupled with electrospray ionization (Thermo Fisher Scientific, San Jose, Calif.). Data was acquired in centroid MS mode from 50 to 700 m/z mass range with the XCALIBUR software provided with instrument. The relative concentrations of cystine and cysteine are reported as mean valuesSEM. As can be seen in FIG. 6A, PEG-hCGL-TV drastically reduces serum cystine levels (>95%) for over 96 h, and an 80% reduction in cysteine levels for over 48 h (FIG. 6B).

Example 10Pharmacokinetic (PK) Analyses of PEG-hCGL-TV in Mice

[0186] The circulatory persistence of PEG-hCGL-TV was assessed using the same serum samples as described in Example 9. Using a dot blot densitometry technique, samples were probed with an anti-hCGL antibody (rabbit anti-CTH Sigma # C8248) followed by addition of anti-rabbit IgG-FITC (Santa Cruz Biotechnology # sc-2012) for visualization by excitation at 488 nm on a TYPHOON scanner (GE Healthcare). Using ImageJ software (Schneider et al., 2012), densitometry bands of the samples were compared to titrations of known amounts of PEG-hCGL-TV within the same blot to construct a standard curve and calculate relative serum PEG-hCGL-TV levels. Fitting this data to an extravascular model of administration (Foye et al., 2007; Stone et al., 2012) demonstrated an absorption T.sub.1/2 of approximately 23 h, and an elimination of 407 h for PEG-hCGL-TV (FIG. 7).

Example 11Effect of PEG-hCGL-TV on the Growth of HMVP2 Tumor Cells in an Allograft Model

[0187] The ability of PEG-hCGL-TV to inhibit tumor development was evaluated in a mouse prostate carcinoma (HMVP2) allograft model. For this experiment, HMVP2 cells were grown as spheroids and used to initiate tumors in the flanks of four groups (eight mice/group) of FVB/N male mice following s.c. injection. Cells were grown for approximately two weeks, at which time small tumors at the injection site became palpable. Each of the four groups was then administered either PEG-hCGL-TV at 50 or 100 mg/kg, PBS (control), or heat-inactivated PEG-hCGL-TV (additional control) at 100 mg/kg by i.p. injection every 4 days. As shown in FIG. 8, treatment with PEG-hCGL-TV produced a dramatic inhibition of tumor growth, which was highly statistically significant at both doses (50 and 100 mg/kg) compared to both control groups (i.e., PBS injection alone and inactivated enzyme injection control groups). Importantly, repeated dosing was very well tolerated throughout the treatment period. In this regard, there were no differences in body weight or food consumption among the treated and control groups of mice over the course of the experiment. Finally, at the termination of this experiment, mice were necropsied and no abnormalities were seen in any major organs upon macroscopic evaluation.

Example 12Effect of PEG-hCGL-TV on the Growth of PC3 Prostate Tumor Cells in a Xenograft Model

[0188] The ability of PEG-hCGL-TV to inhibit tumor development was evaluated in a human prostate carcinoma (PC3) xenograft model. For this experiment, PC3 cells were used to initiate tumors in the flanks of four groups (seven mice/group) of FVB/N male mice following s.c. injection. Cells were grown for 10 days at which time tumors at the injection site became palpable. Each of the four groups was then administered either PEG-hCGL-TV at 50 or 100 mg/kg, PBS (control), or heat-inactivated PEG-hCGL-TV (additional control) at 100 mg/kg by i.p. injection every 4 days. As can be seen in FIG. 9, treatment with PEG-hCGL-TV caused a pronounced retardation of tumor growth, at both doses (50 and 100 mg/kg) compared to both control groups (i.e., PBS injection alone and inactivated enzyme injection control groups). Repeated dosing was also very well tolerated in this mouse strain throughout the treatment period with no differences in body weight or food consumption among the treated and control groups of mice over the course of the experiment. At the termination of this experiment, mice were necropsied and no abnormalities were seen in any major organs upon macroscopic evaluation.

[0189] All of the methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

REFERENCES

[0190] The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference. [0191] U.S. Pat. No. 4,870,287 [0192] U.S. Pat. No. 5,739,169 [0193] U.S. Pat. No. 5,760,395 [0194] U.S. Pat. No. 5,801,005 [0195] U.S. Pat. No. 5,824,311 [0196] U.S. Pat. No. 5,830,880 [0197] U.S. Pat. No. 5,846,945 [0198] U.S. Pat. No. 5,889,155 [0199] U.S. Pat. Publn. 2009/0304666 [0200] Austin-Ward and Villaseca, Revista Medica de Chile, 126(7):838-845, 1998. [0201] Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley

[0202] Interscience, N.Y., 1994. [0203] Bukowski et al., Clinical Cancer Res., 4(10):2337-2347, 1998. [0204] Christodoulides et al., Microbiology, 144(Pt 11):3027-3037, 1998. [0205] Davidson et al., J. Immunother., 21(5):389-398, 1998. [0206] Doxsee et al., Sulfasalazine-induced cystine starvation: Potential use for prostate cancer therapy. The Prostate, 67(2): 162-171, 2007. [0207] Foye et al., Foye's Principles of Medicinal Chemistry, Lippincott Williams & Wilkins, 2007. [0208] Gill and von Hippel, Calculation of protein extinction coefficients from amino acid sequence data. Anal Biochem, 182(2):319-326, 1989. [0209] Glode et al., Cysteine auxotrophy of human leukemic lymphoblasts is associated with decreased amounts of intracellular cystathionase protein. Biochemistry, 20(5): 1306-1311, 1981. [0210] Guan et al., The x c-cystine/glutamate antiporter as a potential therapeutic target for small-cell lung cancer: use of sulfasalazine. Cancer Chemotherapy and Pharmacology, 64(3):463-472, 2009. [0211] Hanibuchi et al., Int. J. Cancer, 78(4):480-485, 1998. [0212] Harkki et al., BioTechnology, 7:596-603, 1989. [0213] Hellstrand et al., Acta Oncologica, 37(4):347-353, 1998. [0214] Hollander, Front. Immun., 3:3, 2012. [0215] Hopwood et al., In: Genetic Manipulation of Streptomyces, A Laboratory Manual, The John Innes Foundation, Norwich, Conn., 1985. [0216] Hoover et al., The structure of human macrophage inflammatory protein-3alpha/CCL20. Linking antimicrobial and CC chemokine receptor-6-binding activities with human beta-defensins. J Biol Chem, 277(40):37647-37654, 2002. [0217] Kim et al., Expression of cystathionine -synthase is downregulated in hepatocellular carcinoma and associated with poor prognosis. Oncology Reports, 21(6):1449-1454, 2009. [0218] Hui and Hashimoto, Infection Immun., 66(11):5329-5336, 1998. [0219] Ito et al., J. Biochem., 79:1263, 1976. [0220] Link et al., Cystathionase: a potential cytoplasmic marker of hematopoietic differentiation. Blut, 47(1):31-39, 1983. [0221] Lordanescu, J. Bacteriol, 12:597 601, 1975. [0222] Maniatis et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y., 1988. [0223] Mellor et al., Gene, 24:1-14, 1983. [0224] Penttila et al., Gene, 61:155-164, 1987. [0225] Qin et al., Proc. Natl. Acad. Sci. USA, 95(24):14411-14416, 1998. [0226] Rao et al., Role of the Transsulfuration Pathway and of {gamma}-Cystathionase Activity in the Formation of Cysteine and Sulfate from Methionine in Rat Hepatocytes. Journal of Nutrition, 120(8):837, 1990. [0227] Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1289-1329, 1990. [0228] Schneider et al., 671 nih image to imageJ: 25 years of image analysis. Nature Methods, 9:2012. [0229] Sibakov et al., Eur. J Biochem., 145:567 572, 1984. [0230] Stone et al., Strategies for optimizing the serum persistence of engineered human arginase I for cancer therapy. Journal of Controlled Release, 158:171-179, 2012. [0231] Takakura et al., Assay method for antitumor L-methionine-lyase: comprehensive kinetic analysis of the complex reaction with L-methionine. Analytical Biochemistry, 327(2):233-240, 2004. [0232] Tiziani et al., Optimized metabolite extraction from blood serum for 1H nuclear magnetic resonance spectroscopy. Analytical Biochemistry, 377:16-23, 2008. [0233] Tiziani et al., Metabolomics of the tumor microenvironment in pediatric acute lymphoblastic leukemia. PLoS One, 8:e82859, 2013. [0234] Ward, Proc, Embo-Alko Workshop on Molecular Biology of Filamentous Fungi, Helsinki, 119-128, 1989. [0235] Wawrzynczak and Thorpe, In: Immunoconjugates, Antibody Conuugates In Radioimaging And Therapy Of Cancer, Vogel (Ed.), NY, Oxford University Press, 28, 1987. [0236] Zhang et al., Stromal control of cystine metabolism promotes cancer cell survival in chronic lymphocytic leukaemia. Nature Cell Biology, 14(3):276-286, 2012. [0237] Zhao et al., Frequent Epigenetic Silencing of the Folate-Metabolising Gene Cystathionine-Beta-Synthase in Gastrointestinal Cancer. PLoS One, 7(11):e49683, 2012.