Attenuated swine influenza vaccines and methods of making and use thereof

10548967 ยท 2020-02-04

Assignee

Inventors

Cpc classification

International classification

Abstract

This disclosure provides attenuated swine influenza strains, particularly those produced via a reverse genetics approach, compositions comprising same, and methods of production and use thereof.

Claims

1. A vaccine comprising a pharmaceutically or veterinary acceptable vehicle, diluent or excipient and an effective amount of an attenuated swine influenza virus (SIV), wherein the SIV comprises: a) an HA gene segment having at least 90% sequence identity to SEQ ID NO: 93, and an NA gene segment having at least 90% sequence identity to SEQ ID NO: 94, or b) an HA gene segment having at least 90% sequence identity to SEQ ID NO: 93, an NA gene segment having at least 90% sequence identity to SEQ ID NO: 94, and an NS1 gene segment having at least 90% sequence identity to SEQ ID NO: 90, or c) an HA gene segment having at least 90% sequence identity to SEQ ID NO: 105, and an NA gene segment having at least 90% sequence identity to SEQ ID NO: 96, or d) an HA gene segment having at least 90% sequence identity to SEQ ID NO: 105, an NA gene segment having at least 90% sequence identity to SEQ ID NO: 96, and an NS1 gene segment having at least 90% sequence identity to SEQ ID NO: 90, or e) an HA gene segment having at least 90% sequence identity to SEQ ID NO: 91, and an NA gene segment having at least 90% sequence identity to SEQ ID NO: 92, or f) an HA gene segment having at least 90% sequence identity to SEQ ID NO: 91, an NA gene segment having at least 90% sequence identity to SEQ ID NO: 92, and an NS1 gene segment having at least 90% sequence identity to SEQ ID NO: 90.

2. A vaccine comprising a pharmaceutically or veterinary acceptable vehicle, diluent or excipient and an effective amount of an attenuated swine influenza virus (SIV), wherein the SIV comprises: a) an HA gene segment having SEQ ID NO: 93, and an NA gene segment having SEQ ID NO: 94, or b) an HA gene segment having SEQ ID NO: 93, an NA gene segment having SEQ ID NO: 94, and an NS1 gene segment having least 90% sequence identity to SEQ ID NO: 90, or c) an HA gene segment having SEQ ID NO: 105, and an NA gene segment having SEQ ID NO: 96, or d) an HA gene segment having SEQ ID NO: 105, an NA gene segment having SEQ ID NO: 96, and an NS1 gene segment having least 90% sequence identity to SEQ ID NO: 90, or e) an HA gene segment having least 90% sequence identity to SEQ ID NO: 91, and an NA gene segment having SEQ ID NO: 92, or f) an HA gene segment having SEQ ID NO: 91, an NA gene segment having SEQ ID NO: 92, and an NS1 gene segment having SEQ ID NO: 90.

3. The vaccine according to claim 2 comprising SIV a).

4. The vaccine according to claim 2 comprising SIV b).

5. The vaccine according to claim 2 comprising SIV c).

6. The vaccine according to claim 2 comprising SIV d).

7. The vaccine according to claim 2 comprising SIV e).

8. The vaccine according to claim 2 comprising SIV f).

9. The vaccine according to claim 1 wherein SIV a), c) and e) further comprise an NS gene segment having SEQ ID NO:83, an M gene segment having SEQ ID NO:82, an NP gene segment having SEQ ID NO:81, a PA gene segment having SEQ ID NO:80, a PB1 gene segment having SEQ ID NO:79, and a PB2 gene segment having SEQ ID NO:78.

10. The vaccine according to claim 2 wherein SIV a), c) and e) further comprise an NS gene segment having SEQ ID NO:83, an M gene segment having SEQ ID NO:82, an NP gene segment having SEQ ID NO:81, a PA gene segment having SEQ ID NO:80, a PB1 gene segment having SEQ ID NO:79, and a PB2 gene segment having SEQ ID NO:78; or, wherein the SIV comprises vSIV01, vSIV03, or vSIV05.

11. The vaccine according to claim 3 wherein SIV a) further comprises an NS gene segment having SEQ ID NO:83, an M gene segment having SEQ ID NO:82, an NP gene segment having SEQ ID NO:81, a PA gene segment having SEQ ID NO:80, a PB1 gene segment having SEQ ID NO:79, and a PB2 gene segment having SEQ ID NO:78.

12. The vaccine according to claim 5 wherein SIV c) further comprises an NS gene segment having SEQ ID NO:83, an M gene segment having SEQ ID NO:82, an NP gene segment having SEQ ID NO:81, a PA gene segment having SEQ ID NO:80, a PB1 gene segment having SEQ ID NO:79, and a PB2 gene segment having SEQ ID NO:78.

13. The vaccine according to claim 7 wherein SIV e) further comprises an NS gene segment having SEQ ID NO:83, an M gene segment having SEQ ID NO:82, an NP gene segment having SEQ ID NO:81, a PA gene segment having SEQ ID NO:80, a PB1 gene segment having SEQ ID NO:79, and a PB2 gene segment having SEQ ID NO:78.

14. The vaccine according to claim 1 wherein SIV b), d) and f) further comprise an M gene segment having SEQ ID NO:82, an NP gene segment having SEQ ID NO:81, a PA gene segment having SEQ ID NO:80, a PB1 gene segment having SEQ ID NO:79, and a PB2 gene segment having SEQ ID NO:78.

15. The vaccine according to claim 2 wherein SIV b), d) and f) further comprise an M gene segment having SEQ ID NO:82, an NP gene segment having SEQ ID NO:81, a PA gene segment having SEQ ID NO:80, a PB1 gene segment having SEQ ID NO:79, and a PB2 gene segment having SEQ ID NO:78; or wherein the SIV comprises vSIV02, vSIV04, or vSIV06.

16. The vaccine according to claim 4 wherein SIV b) further comprises an M gene segment having SEQ ID NO:82, an NP gene segment having SEQ ID NO:81, a PA gene segment having SEQ ID NO:80, a PB1 gene segment having SEQ ID NO:79, and a PB2 gene segment having SEQ ID NO:78.

17. The vaccine according to claim 6 wherein SIV d) further comprises an M gene segment having SEQ ID NO:82, an NP gene segment having SEQ ID NO:81, a PA gene segment having SEQ ID NO:80, a PB1 gene segment having SEQ ID NO:79, and a PB2 gene segment having SEQ ID NO:78.

18. The vaccine according to claim 8 wherein SIV f) further comprises an M gene segment having SEQ ID NO:82, an NP gene segment having SEQ ID NO:81, a PA gene segment having SEQ ID NO:80, a PB1 gene segment having SEQ ID NO:79, and a PB2 gene segment having SEQ ID NO:78.

19. The vaccine of claim 1, further comprising at least one additional antigen associated with or derived from a porcine pathogen other than swine influenza.

20. The vaccine of claim 19, wherein the at least one or more additional antigen(s) is capable of eliciting in a porcine an immune response against Mycoplasma hyopneumoniae (M hyo), porcine circovirus 2 (PCV2), or porcine respiratory and reproductive syndrome virus (PRRSV).

21. The vaccine of claim 1, further comprising an adjuvant.

22. The vaccine of claim 20, further comprising an adjuvant.

23. A method of eliciting a protective immune response in a porcine subject comprising administering to the porcine subject a prophylactically or therapeutically effective dose of the vaccine of claim 1.

24. A method of eliciting a protective immune response in a porcine subject comprising administering to the porcine subject a prophylactically or therapeutically effective dose of the vaccine of claim 21.

25. A method of vaccinating a porcine animal comprising at least one administration of the vaccine of claim 1.

26. The method of claim 25, wherein the porcine animal is a sow from about 3 weeks to about 6 weeks prefarrowing.

27. The method of 26, wherein the resulting piglets have a reduced morbidity and/or mortality as compared to piglets coming from unvaccinated sows.

28. A vaccine according to claim 1, wherein the vaccine comprises a bivalent vaccine comprising (i) (1) SIV e) or SIV f) and (2) SIV c) or SIV d), or (ii) (1) SIV a) or SIV b) and (2) SIV c) or SIV d), or (iii) (1) SIV e) or SIV f) and (2) SIV c) or SIV d) and (3) SIV a) or SIV b), or (iv) (1) vSIV05 or vSIV06 and (2) vSIV03 or vSIV04, or (v) (1) vSIV01 or vSIV02 and (2) vSIV03 or vSIV04, or (vi) (1) vSIV05 or vSIV06, (2) vSIV03 or vSIV04, and (3) vSIV01 or vSIV02.

29. A composition for producing the vaccine of claim 1 comprising: (A) vectors comprising (i) the HA gene segment operably linked to a promoter, and (ii) the NA gene segment operably linked to a promoter, or (B) vectors comprising (i) the HA gene segment operably linked to a promoter, (ii) the NA gene segment operably linked to a promoter, (iii) the NS gene segment operably linked to a promoter, (iv) the M gene segment operably linked to a promoter, (v) the NP gene segment operably linked to a promoter, (vi) the PA gene segment operably linked to a promoter, (vii) the PB1 gene segment operably linked to a promoter, and (viii) the PB2 gene segment operably linked to a promoter, or (C) vectors comprising (i) the HA gene segment operably linked to a promoter, (ii) the NA gene segment operably linked to a promoter, and, (iii) the NS gene segment operably linked to a promoter.

30. A method of preparing an attenuated swine influenza virus (SIV) vaccine strain, comprising: contacting a cell with an amount of the composition of claim 28 that is effective to yield reassortant, attenuated, infectious influenza virus particles.

31. An isolated cell comprising the composition of claim 28.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) A full and enabling disclosure of the present invention, including the best mode thereof, to one of ordinary skill in the art, is set forth more particularly in the remainder of the specification, including reference to the accompanying figures, wherein:

(2) FIG. 1 is a graph showing overall % consolidation by group (1=vSIV01, 2=vSIV02, 3=vSIV05, 4=vSIV06, 5=Control);

(3) FIG. 2 is a table describing the sequences disclosed in this application;

(4) FIG. 3A is a map of the pHW2000 cloning vector, used to carry gene segments for producing infectious, re-assortant, reverse genetics-produced swine influenza viruses (rgSIV);

(5) FIG. 3B schematizes the construction of pHW2000, beginning with a synthesized pHW2000 cloning region and the pcDNA3.1/V5-His B plasmid;

(6) FIG. 4 shows PCR amplicons of 3UTR/signal sequences and transmembrane/tail domain/5UTR of HA segment (H1 subtype);

(7) FIG. 5 presents a graphical map of the sequence (SEQ ID NO:103) comprising a 3UTR, signal sequence (SS), transmembrane domain (TMD), cytoplasmic tail domain (CTD), and a 5UTR of HA segment (H1N2-DO);

(8) FIG. 6 presents the cloning scheme for pHW2000-H1 SP-TM chimera;

(9) FIG. 7 nucleotide sequence of H3 ectodomain PCR amplicon (indicated by the underlined section, corresponding to nucleotides 609-2147 of SEQ ID NO:113);

(10) FIG. 8 shows the cloning scheme for production of pHW2000-HA-DO (H1-H3 chimera);

(11) FIG. 9 presents the nucleotide sequence of pHW2000-HA-DO (H1-H3 chimera) (SEQ ID NO:105);

(12) FIG. 10 is a graph showing group mean vaccinate temperature post-challenge;

(13) FIG. 11 is a graph showing the incidence of respiratory scores observed by treatment group and for each day after challenge;

(14) FIG. 12 is a graph showing total depression score by treatment group and for each day after challenge;

(15) FIG. 13 is a graph showing SIV ELISA results by group and day;

(16) FIG. 14 is a boxplot showing post-challenge lung lesion scores as indicated by overall % consolidation by group.

DETAILED DESCRIPTION OF THE INVENTION

(17) The present invention provides nucleotide sequences and genes involved in the attenuation of a microorganism, such as virus, for instance, Influenza, products (e.g., proteins, antigens, immunogens, epitopes) encoded by the nucleotide sequences, methods for producing such nucleotide sequences, products, micro-organisms, and uses therefor, such as for preparing vaccine or immunogenic compositions or for eliciting an immunological or immune response or as a vector, e.g., as an expression vector (for instance, an in vitro or in vivo expression vector).

(18) Mutations introduced into nucleotide sequences and genes of micro-organisms produce novel and nonobvious attenuated mutants. These mutants are useful for the production of live attenuated immunogenic compositions or live attenuated vaccines having a high degree of immunogenicity.

(19) Identification of the mutations provides novel and nonobvious nucleotide sequences and genes, as well as novel and nonobvious gene products encoded by the nucleotide sequences and genes.

(20) The invention is based in part upon the remarkable observation that pigs vaccinated with the disclosed attenuated SIV, and then challenged with virulent H1N2 SIV, had significantly reduced lung lesions and virus shedding from the respiratory tract as compared to unvaccinated pigs. Because vaccination with currently approved commercial inactivated products does not fully prevent transmission, the team recommends introduction of a new control strategy that involves the use of LAIV vaccines in conjunction with additional control measures in swine to limit shedding, transmission and zoonotic spillover. Such a strategy will minimize the risk of swine being the source of the next pandemic.

(21) In some embodiments, the invention provides a new model for evaluating the ability of the attenuated SIV to reduce disease spillover/transmission. In some embodiments, animals are vaccinated with one more attenuated SIV according to the present disclosure. After a sufficient period of time for the animals to develop protective immunity has passed, the animals may be challenged with an effective amount of a virulent strain of SIV. Typically, the amount of challenge strain administered is sufficient to enable a skilled person to determine whether the vaccines have elicited protective immunity, including heterologous protective immunity, in vaccinates, relative to control/sham-vaccinates.

(22) Once the animals have been challenged, they may be placed in proximity with sentinel animals, to evaluate the extent to which vaccination protects sentinels against SIV transmission. In some embodiments, the vaccinated and control animals may be placed in sufficiently close proximity to a group of sentinels such that if the animals are shedding a sufficient amount of virus, the sentinels will be exposed and infected. Each group of vaccinates and sentinels may be physically isolated from one another, such that sentinels housed with one group of vaccinates will not be exposed to challenge virus shed by another group of vaccinates or controls.

(23) In an embodiment, the invention provides an attenuated swine influenza virus (SIV) strain capable of providing a safe and effective immune response in porcine against influenza or diseases caused by influenza.

(24) In some embodiments, the deoptimized sequences were produced by providing wild type HA sequences having at least 70%, at least 80%, or at least 90% sequence identity to a sequence set forth in SEQ ID NO: 21, 28 or 34), wild type NA sequences having at least 70%, at least 80%, or at least 90% sequence identity to a sequence set forth in SEQ ID NO: 24, 31 or 37), and optionally an NS1 sequence having at least 70%, at least 80%, or at least 90% identity to a sequence set forth in SEQ ID NO: 1. In some embodiments, these wild type sequences are identical to wild type, virulent H1N1, H1N2 or H3N2 SIV strains.

(25) In a particular embodiment, the mutant virus comprises vRNA nucleic acid sequences which correspond to (i.e. are reverse complementary and have uracils in place of thymidines) the deoptimized DNA sequences set forth in SEQ ID NO: 22, 29, 35 or 105 (HA-DO); SEQ ID NO: 25, 32 or 38 (NA-DO); and optionally, SEQ ID NO:27 (NS1-DO), which cause the mutant virus to be attenuated/non-virulent, relative to the virulent wild type/parental virus.

(26) In some embodiments, the balance of the SIV gene segments (i.e. M, NP, PA, PB1, PB2 and optionally NS) comprise wild type coding sequences. In a particular embodiment, the wild type (i.e. non-deoptimized) sequences are H1N1 SIV M, NP, PA, PB1, PB2 and optionally NS sequences.

(27) In some embodiments, the H1N1 NS1 wild type coding sequence comprises a sequence having at least 70%, at least 80%, or at least 90% identity to a sequence set forth in SEQ ID NO: 1. In some embodiments, the NS1 wild type coding sequence comprises the sequence set forth in SEQ ID NO: 1.

(28) In some embodiments, the H1N1 M1 wild type coding sequence comprises a sequence having at least 70%, at least 80%, or at least 90% identity to a sequence set forth in SEQ ID NO: 3. In some embodiments, the M1 wild type coding sequence comprises the sequence set forth in SEQ ID NO: 3.

(29) In some embodiments, the H1N1 M2 wild type coding sequence comprises a sequence having at least 70%, at least 80%, or at least 90% identity to a sequence set forth in SEQ ID NO: 5. In some embodiments, the M2 wild type coding sequence comprises the sequence set forth in SEQ ID NO: 5.

(30) In some embodiments, the H1N1 NP wild type coding sequence comprises a sequence having at least 70%, at least 80%, or at least 90% identity to a sequence set forth in SEQ ID NO: 9. In some embodiments, the NP wild type coding sequence comprises the sequence set forth in SEQ ID NO: 9.

(31) In some embodiments, the H1N1 PA wild type coding sequence comprises a sequence having at least 70%, at least 80%, or at least 90% identity to a sequence set forth in SEQ ID NO:13. In some embodiments, the PA wild type coding sequence comprises the sequence set forth in SEQ ID NO:13.

(32) In some embodiments, the H1N1 PB1 wild type coding sequence comprises a sequence having at least 70%, at least 80%, or at least 90% identity to a sequence set forth in SEQ ID NO:15. In some embodiments, the PB1 wild type coding sequence comprises the sequence set forth in SEQ ID NO:15.

(33) In some embodiments, the H1N1 PB2 wild type coding sequence comprises a sequence having at least 70%, at least 80%, or at least 90% identity to a sequence set forth in SEQ ID NO:17. In some embodiments, the PB2 wild type coding sequence comprises the sequence set forth in SEQ ID NO:17.

(34) In other embodiments, the non-deoptimized coding sequences may also be taken from H1N2 or H3N2 SIV strain. For example, the HA, NA and optionally NS1 coding sequences, prior to deoptimization, may comprise sequences as set forth in 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74 or 76. Moreover, the base strains (i.e. the wild type H1N1, H1N2 or H3N2 SIV strains) may also themselves be synthetically or naturally attenuated versions of their more-virulent parental strains.

(35) In another aspect, the invention provides immunological composition comprising attenuated influenza strains as detailed above. In one embodiment, the compositions may further comprise a pharmaceutically or veterinary acceptable vehicle, diluent or excipient.

(36) In some embodiments, the immunological composition may include various components to improve its storage stability. Vaccines may be formulated and tested using, for example, accelerated stability studies. In some embodiments, the following combinations of ingredients may be used to produce stabile vaccine formulations according to the present invention: sucrose, phosphate buffer, glutamatic acid, bovine serum albumin soy peptone, dextran 70, glutamic acid, sucrose gelatin, casein hydrolysate, sucrose dextran 40, sorbitol, gelatin, casein hydrolysate, sucrose

(37) Accordingly, in some embodiments, suitable polymers may include Dextran 40, Dextran 70, PEG, povidone, or combinations thereof. Suitable animal proteins may include casein hydrolysate, gelatin, bovine serum albumin (BSA), lactalbumin hydrolysate, and non-animal proteins may include soy peptone. Suitable carbohydrate components may include sucrose, raffinose, lactose, and suitable buffers may include phosphate and histidine. Some advantageous formulation components include PEG and povidone, lactalbumin hydrolysate, raffinose and lactose, and histidine.

(38) In some embodiments, the immunological composition may comprise any or all of the following stabilizing components: about 0.1% to about 2.5% of a polymer bulking agent (e.g. dextran, PEG, povidone, etc.), about 0.1 to about 4.5% of a sugar alcohol (e.g. sorbitol, mannitol, etc.), about 0.1% to about 2.5% of an animal protein (e.g. casein hydrosylate, gelatin, BSA, LAH, etc.), about 0.1% to about 2.5% of a vegetable protein (e.g. soy peptone, etc.), a phosphate buffer, a histidine buffer, about 1.0% to about 7.5% of a carbohydrate (e.g. lactose, raffinose, sucrose, combinations thereof, etc.).

(39) In some embodiments, the immunological composition may comprise the following components, each expressed in w/v (g/100 mL) of the composition: About 0.5% to about 1.0% of a first protein type, about 0.5% to about 1.0% of a second protein type, and about 2.0% to about 5.0% of a non-reducing saccharide About 0.5% to about 1.0% gelatin, about 0.5% to about 1.0% casein hydrosylate (CH), and about 2.0% to about 5.0% sucrose About 1.0% to about 2.0% of a polymer, about 1.0% to about 2.0% of a non-animal sourced protein, and about 0.25% to about 0.5% of a glutamic acid salt, and about 2% to about 5% of a non-reducing sugar About 1.0% to about 2.0% of a dextran polymer, about 1.0% to about 2.0% of a soy peptone, and about 0.25% to about 0.5% 1-glutamic acid monopotassium salt, about 2% to about 5% sucrose About 1.0% to about 2.0% of BSA, about 0.05% KH.sub.2PO.sub.4, about 0.14% K.sub.2HPO.sub.4, about 0.03% to about 0.1% of a glutamic acid salt, and about 2% to about 5% sucrose About 1.2% to about 2.4% of a dextran polymer, about 1.2% to about 2.4% sorbitol, about 0.6% to about 1.2% CH, about 0.75% to about 1.5% gelatin, about 0.015% to about 0.031% KH.sub.2PO.sub.4, about 0.0375% to about 0.075% K.sub.2HPO.sub.4, and about 2% to about 5% sucrose

(40) In an embodiment, the composition provides a protective immune response in porcine against virulent swine influenza challenge. Protection may be homologous, heterologous or both. In some embodiments, the composition further comprises at least one additional antigen associated with a pathogen other than swine influenza.

(41) In another embodiment, the at least one additional antigen is selected from Mycoplasma hyopneumoniae (M. hyo), PCV2, PRRSV, SIV or other pathogen capable of infecting and causing illness or susceptibility to illness in a porcine, or combinations thereof.

(42) In some embodiments, combinations include a trivalent H1N1, H1N2, H3N2 vaccine composition. Such a composition may be administered to young pigs, for example, via the intranasal route. Other combinations include a one dose MLV in powder formulation for mucosal administration, a multi-dose sachet presentation for reconstitution at pig side, and a codon de-optimized, M2 gene negative SIV composition.

(43) In an embodiment, the invention provides methods of vaccinating an animal comprising at least one administration of the attenuated SIV compositions. In another embodiment, the porcine is a sow or gilt from about 3 weeks to about 6 weeks prefarrowing. In yet another embodiment, the resulting piglets may have a reduced morbidity and/or mortality as compared to piglets coming from unvaccinated sows. In other embodiments, the animal to be vaccinated is a piglet. The piglet may be any age, including about 1 day old to about 30 days old. In some embodiments, the piglets are between about 1 day old and about 2 to 4 weeks old.

(44) In an embodiment, the invention provides a method to prepare influenza virus, comprising: contacting a cell with one of the inventive compositions in an amount effective to yield infectious influenza virus. The method may further comprise isolating the virus.

(45) In another embodiment, the invention provides a method to prepare a gene delivery vehicle, comprising: contacting cells with the inventive composition in an amount effective to yield influenza virus, and isolating the virus. The invention further provides a cell contacted with the inventive composition.

(46) In an embodiment, the invention provides a vertebrate cell comprising a plurality of vectors for production of attenuated swine influenza including a vector comprising a promoter operably linked to influenza virus HA, NA and optionally NS1 coding sequences, wherein the HA, NA and optionally NS1 coding sequences are codon deoptimized, relative to non-deoptimized HA, NA and NS1 coding sequences present in virulent parental SIV strains.

(47) The invention further encompasses gene products, which provide antigens, immunogens and epitopes, and are useful as isolated gene products.

(48) Such isolated gene products, as well as epitopes thereof, are also useful for generating antibodies, which are useful in diagnostic applications.

(49) Such gene products, which can provide or generate epitopes, antigens or immunogens, are also useful for immunogenic or immunological compositions, as well as vaccines.

(50) In an aspect, the invention provides viruses containing an attenuating mutation in a nucleotide sequence or a gene wherein the mutation modifies the biological activity of a polypeptide or protein encoded by a gene, resulting in attenuated virulence of the virus.

(51) In particular, the present invention encompasses attenuated swine influenza strains and vaccines comprising the same, which elicit an immunogenic response in an animal, particularly the attenuated swine influenza strains that elicit, induce or stimulate a response in a porcine.

(52) Particular swine influenza attenuated strains of interest have mutations in genes, relative to wild type virulent parent strain, which are associated with virulence. It is recognized that, in addition to strains having the disclosed mutations, attenuated strains having any number of mutations in the disclosed virulence genes can be used in the practice of this invention.

(53) In another aspect, the novel attenuated reassortant swine influenza strains are formulated into safe, effective vaccine against swine influenza and infections/diseases cause by swine influenza.

(54) In an embodiment, the swine influenza vaccines further comprise an adjuvant. In a particular embodiment, the adjuvant is a mucosal adjuvant, such as chitosan, methylated chitosan, trimethylated chitosan, or derivatives or combinations thereof.

(55) In an embodiment, the adjuvant comprises whole bacteria and/or viruses, including H. parasuis, clostridium, swine influenza virus (SIV), porcine circovirus 2 (PCV2), porcine reproductive and respiratory syndrome virus (PRRSV), Mannheimia, Pasteurella, Histophilus, Salmonella, Escherichia coli, or combinations and/or variations thereof. In several embodiments, the adjuvant increases the animal's production of IgM, IgG, IgA, and/or combinations thereof.

(56) As used herein, the term gene will be used in a broad sense, and shall encompass both coding and non-coding sequences (i.e. upstream and downstream regulatory sequences, promoters, 5/3 UTR, introns, and exons). Where reference to only a gene's coding sequence is intended, the term gene's coding sequence or CDS will be used interchangeably throughout this disclosure. When a specific nucleic acid is discussed, for example, the sequence as set forth in SEQ ID NO:17 (the DNA sequence equivalent of parental virus cRNA sense strand), the skilled person will instantly be in possession of all derivable forms of that sequence (mRNA, vRNA, cRNA, DNA, protein, etc.). For example, the influenza virus is a negative single strand RNA virus (ssRNA). To replicate, its negative ssRNA (defined herein as vRNA) must be transcribed to positive or sense RNA (defined herein as cRNA). Host cell machinery is co-opted to use the cRNA to produce the viral proteins and vRNA. A skilled person using the well-known genetic code can routinely derive from a DNA sequence the vRNA, cRNA, and peptide sequences.

(57) As used herein, wild type is intended to mean that a sequence or strain contains the same genetic sequence as it did when it was isolated from nature. For example, field isolates that have been recovered from the cells, tissues or organs of a virus-infected animal are wild type viruses. The gene segments contained within these field isolates contain wild type polynucleotide sequences, which encode for wild type polypeptides. Non-wild type strains and sequences are those that have been altered either using genetic engineering techniques, or by serially passaging wild type or modified viruses in cells, tissues or organs. Cell passaging is a well-known technique for producing attenuated viruses.

(58) By antigen or immunogen means a substance that induces a specific immune response in a host animal. The antigen may comprise a whole organism, killed, attenuated or live; a subunit or portion of an organism; a recombinant vector containing an insert with immunogenic properties; a piece or fragment of DNA capable of inducing an immune response upon presentation to a host animal; a polypeptide, an epitope, a hapten, or any combination thereof. Alternately, the immunogen or antigen may comprise a toxin or antitoxin.

(59) The terms protein, peptide, polypeptide and polypeptide fragment are used interchangeably herein to refer to polymers of amino acid residues of any length. The polymer can be linear or branched, it may comprise modified amino acids or amino acid analogs, and it may be interrupted by chemical moieties other than amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling or bioactive component.

(60) The term immunogenic or antigenic polypeptide as used herein includes polypeptides that are immunologically active in the sense that once administered to the host, it is able to evoke an immune response of the humoral and/or cellular type directed against the protein. Preferably the protein fragment is such that it has substantially the same immunological activity as the total protein. Thus, a protein fragment according to the invention comprises or consists essentially of or consists of at least one epitope or antigenic determinant. An immunogenic protein or polypeptide, as used herein, includes the full-length sequence of the protein, analogs thereof, or immunogenic fragments thereof. By immunogenic fragment is meant a fragment of a protein which includes one or more epitopes and thus elicits the immunological response described above. Such fragments can be identified using any number of epitope mapping techniques, well known in the art. See, e.g., Epitope Mapping Protocols in Methods in Molecular Biology, Vol. 66 (Glenn E. Morris, Ed., 1996). For example, linear epitopes may be determined by e.g., concurrently synthesizing large numbers of peptides on solid supports, the peptides corresponding to portions of the protein molecule, and reacting the peptides with antibodies while the peptides are still attached to the supports. Such techniques are known in the art and described in, e.g., U.S. Pat. No. 4,708,871; Geysen et al., 1984; Geysen et al., 1986. Similarly, conformational epitopes are readily identified by determining spatial conformation of amino acids such as by, e.g., x-ray crystallography and 2-dimensional nuclear magnetic resonance. See, e.g., Epitope Mapping Protocols, supra. Methods especially applicable to the proteins of T. parva are fully described in PCT/US2004/022605 incorporated herein by reference in its entirety.

(61) As discussed herein, the invention encompasses active fragments and variants of the antigenic polypeptide. Thus, the term immunogenic or antigenic polypeptide further contemplates deletions, additions and substitutions to the sequence, so long as the polypeptide functions to produce an immunological response as defined herein. The term conservative variation denotes the replacement of an amino acid residue by another biologically similar residue, or the replacement of a nucleotide in a nucleic acid sequence such that the encoded amino acid residue does not change or is another biologically similar residue. In this regard, particularly preferred substitutions will generally be conservative in nature, i.e., those substitutions that take place within a family of amino acids. For example, amino acids are generally divided into four families: (1) acidicaspartate and glutamate; (2) basiclysine, arginine, histidine; (3) non-polaralanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polarglycine, asparagine, glutamine, cystine, serine, threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified as aromatic amino acids. Examples of conservative variations include the substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another hydrophobic residue, or the substitution of one polar residue for another polar residue, such as the substitution of arginine for lysine, glutamic acid for aspartic acid, or glutamine for asparagine, and the like; or a similar conservative replacement of an amino acid with a structurally related amino acid that will not have a major effect on the biological activity. Proteins having substantially the same amino acid sequence as the reference molecule but possessing minor amino acid substitutions that do not substantially affect the immunogenicity of the protein are, therefore, within the definition of the reference polypeptide. All of the polypeptides produced by these modifications are included herein. The term conservative variation also includes the use of a substituted amino acid in place of an unsubstituted parent amino acid provided that antibodies raised to the substituted polypeptide also immunoreact with the unsubstituted polypeptide.

(62) The term epitope refers to the site on an antigen or hapten to which specific B cells and/or T cells respond. The term is also used interchangeably with antigenic determinant or antigenic determinant site. Antibodies that recognize the same epitope can be identified in a simple immunoassay showing the ability of one antibody to block the binding of another antibody to a target antigen.

(63) An immunological response to a composition or vaccine is the development in the host of a cellular and/or antibody-mediated immune response to a composition or vaccine of interest. Usually, an immunological response includes but is not limited to one or more of the following effects: the production of antibodies, B cells, helper T cells, and/or cytotoxic T cells, directed specifically to an antigen or antigens included in the composition or vaccine of interest. Preferably, the host will display either a therapeutic or protective immunological response such that resistance to new infection will be enhanced and/or the clinical severity of the disease reduced. Such protection will be demonstrated by either a reduction or lack of symptoms and/or clinical disease signs normally displayed by an infected host, a quicker recovery time and/or a lowered viral titer in the infected host.

(64) By animal is intended mammals, birds, and the like. Animal or host as used herein includes mammals and human. The animal may be selected from the group consisting of equine (e.g., horse), canine (e.g., dogs, wolves, foxes, coyotes, jackals), feline (e.g., lions, tigers, domestic cats, wild cats, other big cats, and other felines including cheetahs and lynx), ovine (e.g., sheep), bovine (e.g., cattle), porcine (e.g., pig), avian (e.g., chicken, duck, goose, turkey, quail, pheasant, parrot, finches, hawk, crow, ostrich, emu and cassowary), primate (e.g., prosimian, tarsier, monkey, gibbon, ape), ferrets, seals, and fish. The term animal also includes an individual animal in all stages of development, including newborn, embryonic and fetal stages.

(65) Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The singular terms a, an, and the include plural referents unless context clearly indicates otherwise. Similarly, the word or is intended to include and unless the context clearly indicate otherwise.

(66) It is noted that in this disclosure and particularly in the claims and/or paragraphs, terms such as comprises, comprised, comprising and the like can have the meaning attributed to it in U.S. patent law; e.g., they can mean includes, included, including, and the like; and that terms such as consisting essentially of and consists essentially of have the meaning ascribed to them in U.S. patent law, e.g., they allow for elements not explicitly recited, but exclude elements that are found in the prior art or that affect a basic or novel characteristic of the invention.

(67) The term about, as used herein, means approximately, in the region of, roughly, or around. When the term about is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In general, the term about is used herein to modify a numerical value above and below the stated value by a variance of 10%. In one aspect, the term about means plus or minus 20% of the numerical value of the number with which it is being used. Therefore, about 50% means in the range of 45%-55%. Numerical ranges recited herein by endpoints include all numbers and fractions subsumed within that range (e.g. 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.90, 4, and 5). It is also to be understood that all numbers and fractions thereof are presumed to be modified by the term about.

(68) Compositions

(69) The present invention relates to a swine influenza vaccine or composition which may comprise an attenuated swine influenza strain and a pharmaceutically or veterinarily acceptable carrier, excipient, or vehicle, which elicits, induces or stimulates a response in an animal.

(70) The term nucleic acid and polynucleotide refers to RNA or DNA that is linear or branched, single or double stranded, or a hybrid thereof. The term also encompasses RNA/DNA hybrids. The following are non-limiting examples of polynucleotides: a gene or gene fragment, exons, introns, mRNA, tRNA, rRNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs, uracyl, other sugars and linking groups such as fluororibose and thiolate, and nucleotide branches. The sequence of nucleotides may be further modified after polymerization, such as by conjugation, with a labeling component. Other types of modifications included in this definition are caps, substitution of one or more of the naturally occurring nucleotides with an analog, and introduction of means for attaching the polynucleotide to proteins, metal ions, labeling components, other polynucleotides or solid support. The polynucleotides can be obtained by chemical synthesis or derived from a microorganism.

(71) The term gene is used broadly to refer to any segment of polynucleotide associated with a biological function. Thus, genes include introns and exons as in genomic sequence, or just the coding sequences as in cDNAs and/or the regulatory sequences required for their expression. For example, gene also refers to a nucleic acid fragment that expresses mRNA or functional RNA, or encodes a specific protein, and which includes regulatory sequences.

(72) An isolated biological component (such as a nucleic acid or protein or organelle) refers to a component that has been substantially separated or purified away from other biological components in the cell of the organism in which the component naturally occurs, for instance, other chromosomal and extra-chromosomal DNA and RNA, proteins, and organelles. Nucleic acids and proteins that have been isolated include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids and proteins prepared by recombinant technology as well as chemical synthesis.

(73) The term conservative variation denotes the replacement of an amino acid residue by another biologically similar residue, or the replacement of a nucleotide in a nucleic acid sequence such that the encoded amino acid residue does not change or is another biologically similar residue. In this regard, particularly preferred substitutions will generally be conservative in nature, as described above.

(74) The term recombinant means a polynucleotide with semisynthetic, or synthetic origin which either does not occur in nature or is linked to another polynucleotide in an arrangement not found in nature.

(75) Heterologous means derived from a genetically distinct entity from the rest of the entity to which it is being compared. For example, a polynucleotide may be placed by genetic engineering techniques into a plasmid or vector derived from a different source, and is a heterologous polynucleotide. A promoter removed from its native coding sequence and operatively linked to a coding sequence other than the native sequence is a heterologous promoter.

(76) The polynucleotides of the invention may comprise additional sequences, such as additional encoding sequences within the same transcription unit, controlling elements such as promoters, ribosome binding sites, 5UTR, 3UTR, transcription terminators, polyadenylation sites, additional transcription units under control of the same or a different promoter, sequences that permit cloning, expression, homologous recombination, and transformation of a host cell, and any such construct as may be desirable to provide embodiments of this invention.

(77) Methods of Use and Article of Manufacture

(78) The present invention includes the following method embodiments. In an embodiment, a method of vaccinating an animal comprising administering a composition comprising an attenuated swine influenza strain and a pharmaceutical or veterinarily acceptable carrier, excipient, or vehicle to an animal is disclosed. In one aspect of this embodiment, the animal is a porcine.

(79) In one embodiment of the invention, a prime-boost regimen can be employed, which is comprised of at least one primary administration and at least one booster administration using at least one common polypeptide, antigen, epitope or immunogen. Typically the immunological composition or vaccine used in primary administration is different in nature from those used as a booster. However, it is noted that the same composition can be used as the primary administration and the booster administration. This administration protocol is called prime-boost.

(80) A prime-boost regimen comprises at least one prime-administration and at least one boost administration using at least one common polypeptide and/or variants or fragments thereof. The vaccine used in prime-administration may be different in nature from those used as a later booster vaccine. The prime-administration may comprise one or more administrations. Similarly, the boost administration may comprise one or more administrations.

(81) In some embodiments, the prime-vaccination may be performed with one of the disclosed reassortant attenuated SIV vaccine formulations. In such embodiments, the boost may be performed using the same attenuated SIV vaccine formulation, or, it may performed using a different attenuated SIV vaccine formulation. In other embodiments, the prime-vaccination may performed with an autogenous vaccine (i.e. a vaccine based upon or derived from the strain currently circulating in a population of porcine animals). In such embodiments, the boost-vaccination may be performed with either the same autogenous vaccine, or, with one or more of the attenuated SIV vaccine formulations disclosed herein. Other effective combinations of prime and boost will be readily apparent to the skilled person, now that the invention has been disclosed.

(82) The dose volume of compositions for target species that are mammals, e.g., the dose volume of pig or swine compositions, based on viral antigens, is generally between about 0.1 to about 2.0 ml, between about 0.1 to about 1.0 ml, and between about 0.5 ml to about 1.0 ml.

(83) The efficacy of the vaccines may be tested about 2 to 4 weeks after the last immunization by challenging animals, such as porcine, with a virulent strain of swine influenza. Both homologous and heterologous strains are used for challenge to test the efficacy of the vaccine. The animal may be challenged by IM or SC injection, spray, intra-nasally, intra-ocularly, intra-tracheally, and/or orally. Samples from joints, lungs, brain, and/or mouth may be collected before and post-challenge and may be analyzed for the presence of swine influenza-specific antibody.

(84) The compositions comprising the attenuated viral strains of the invention used in the prime-boost protocols are contained in a pharmaceutically or veterinary acceptable vehicle, diluent or excipient. The protocols of the invention protect the animal from swine influenza and/or prevent disease progression in an infected animal.

(85) The various administrations are preferably carried out 1 to 6 weeks apart. In particular embodiments, the time interval is from about 3 to about 5 weeks. In more particular embodiments, the interval is about 4 weeks, and an annual booster is also envisioned. The porcine animals may be at least about 3-4 weeks of age at the time of the first administration, or, they may even be as young as 1 day old.

(86) In some embodiments, the disclosed attenuated SIV vaccine formulations may be administered during each gestation. Accordingly, in some embodiments, sows may be vaccinated between about 2 to about 3 times per year (i.e. about 4 to about 6 times per year, in the case where a prime-boost vaccination regimen is used). A particularly useful route of administration for sow is intramuscular (IM).

(87) It should be understood by one of skill in the art that the disclosure herein is provided by way of example and the present invention is not limited thereto. From the disclosure herein and the knowledge in the art, the skilled artisan can determine the number of administrations, the administration route, and the doses to be used for each injection protocol, without any undue experimentation.

(88) Another embodiment of the invention is a kit for performing a method of eliciting or inducing an immunological or protective response against swine influenza in an animal comprising an attenuated swine influenza immunological composition or vaccine and instructions for performing the method of delivery in an effective amount for eliciting an immune response in the animal.

(89) Another embodiment of the invention is a kit for performing a method of inducing an immunological or protective response against swine influenza in an animal comprising a composition or vaccine comprising an attenuated swine influenza strain of the invention, and instructions for performing the method of delivery in an effective amount for eliciting an immune response in the animal.

(90) Yet another aspect of the present invention relates to a kit for prime-boost vaccination according to the present invention as described above. The kit may comprise at least two vials: a first vial containing a vaccine or composition for the prime-vaccination according to the present invention, and a second vial containing a vaccine or composition for the boost-vaccination according to the present invention. The kit may advantageously contain additional first or second vials for additional prime-vaccinations or additional boost-vaccinations.

(91) The pharmaceutically or veterinarily acceptable carriers or vehicles or excipients are well known to the one skilled in the art. For example, a pharmaceutically or veterinarily acceptable carrier or vehicle or excipient can be a 0.9% NaCl (e.g., saline) solution or a phosphate buffer. Other pharmaceutically or veterinarily acceptable carrier or vehicle or excipients that can be used for methods of this invention include, but are not limited to, poly-(L-glutamate) or polyvinylpyrrolidone. The pharmaceutically or veterinarily acceptable carrier or vehicle or excipients may be any compound or combination of compounds facilitating the administration of the vector (or protein expressed from an inventive vector in vitro); advantageously, the carrier, vehicle or excipient may facilitate transfection and/or improve preservation of the vector (or protein). Doses and dose volumes are herein discussed in the general description and can also be determined by the skilled artisan from this disclosure read in conjunction with the knowledge in the art, without any undue experimentation.

(92) The immunological compositions and vaccines according to the invention may comprise or consist essentially of one or more adjuvants. Suitable adjuvants for use in the practice of the present invention are (1) polymers of acrylic or methacrylic acid, maleic anhydride and alkenyl derivative polymers, (2) immunostimulating sequences (ISS), such as oligodeoxyribonucleotide sequences having one or more non-methylated CpG units (Klinman et al., 1996; WO98/16247), (3) an oil in water emulsion, such as the SPT emulsion described on page 147 of Vaccine Design, The Subunit and Adjuvant Approach published by M. Powell, M. Newman, Plenum Press 1995, and the emulsion MF59 described on page 183 of the same work, (4) cationic lipids containing a quaternary ammonium salt, e.g., DDA (5) cytokines, (6) aluminum hydroxide or aluminum phosphate, (7) saponin or (8) other adjuvants discussed in any document cited and incorporated by reference into the instant application, or (9) any combinations or mixtures thereof.

(93) In an embodiment, adjuvants include those which promote improved absorption through mucosal linings. Some examples include MPL, LTK63, toxins, PLG microparticles and several others (Vajdy, M. Immunology and Cell Biology (2004) 82, 617-627). In an embodiment, the adjuvant may be a chitosan (Van der Lubben et al. 2001; Patel et al. 2005; Majithiya et al. 2008; U.S. Pat. No. 5,980,912).

(94) In some embodiments, the invention provides a vaccine comprising an attenuated swine influenza virus (SIV), which comprises a nucleic acid molecule encoding a deoptimized SIV hemagglutinin (HA) gene, a deoptimized SIV neuraminidase (NA) gene, non-deoptimized SIV M, NP, PA, PB1 and PB2 genes, and optionally, a deoptimized SIV NS1 gene; wherein, it is the presence in the SIV of the deoptimized genes, relative to a corresponding virulent parental SIV strain, which contains wild type versions of the deoptimized genes, which is responsible for the attenuated phenotype.

(95) In some embodiments, the attenuated SIV strain comprises a deoptimized SIV NS1 gene.

(96) In some embodiments, the virulent parental SIV strain is a natural SIV isolate. In some embodiments, the virulent parental strain is an H1N1, H1N2 or H3N2 strain.

(97) In some embodiments, the deoptimized HA gene comprises a nucleic acid molecule having the sequence as set forth in SEQ ID NO:22, 29 or 105; and, the deoptimized NA gene comprises a nucleic acid molecule having the sequence as set forth in SEQ ID NO:25, 32 or 38.

(98) In some embodiments, the deoptimized HA and NA genes comprise nucleic acid molecules having the sequences as set forth in SEQ ID NO:22 & 25, respectively; 29 & 32, respectively; or 105 & 38, respectively.

(99) In some embodiments, the deoptimized NS1 gene comprises a nucleic acid sequence having the sequence as set forth in SEQ ID NO:27.

(100) In some embodiments, the non-deoptimized M, NP, PA, PB1 and PB2 are: a) SIV H1N1 genes, each gene having at least 70%, at least 80%, or at least 90% identity to the sequences as set forth in SEQ ID NOs: 19 (M), 9 (NP), 13 (PA), 15 (PB1) and 17 (PB2); or b) SIV H1N2 genes, each gene having at least 70%, at least 80%, or at least 90% identity to the sequences as set forth in SEQ ID NOs: 44 (M), 48 (NP), 52 (PA), 54 (PB1) and 56 (PB2); or c) SIV H3N2 genes, each gene having at least 70%, at least 80%, or at least 90% identity to the sequences as set forth in SEQ ID NOs: 62 (M1), 64 (M2), 68 (NP), 72 (PA), 74 (PB1) and 76 (PB2).

(101) In some embodiments, the non-deoptimized M, NP, PA, PB1 and PB2 are: a) SIV H1N1 genes, each gene comprising the sequences as set forth in SEQ ID NOs: 19 (M), 9 (NP), 13 (PA), 15 (PB1) and 17 (PB2); or b) SIV H1N2 genes, each gene comprising the sequences as set forth in SEQ ID NOs: 44 (M), 48 (NP), 52 (PA), 54 (PB1) and 56 (PB2); or c) SIV H3N2 genes, each gene comprising the sequences as set forth in SEQ ID NOs: 62 (M1), 64 (M2), 68 (NP), 72 (PA), 74 (PB1) and 76 (PB2).

(102) In another aspect, the invention provides a vaccine composition, for inducing a protective immune response in a porcine animal, comprising one or more attenuated swine influenza viruses according to the present disclosure, and wherein the protective response is elicited within about three (3) weeks after vaccination.

(103) In some embodiments, the vaccine composition comprises one or more attenuated SIV(s), which comprise at least one nucleic acid molecule encoding a deoptimized SIV hemagglutinin (HA) gene, a deoptimized SIV neuraminidase (NA) gene, non-deoptimized SIV M, NP, PA, PB1 and PB2 genes, and optionally, a deoptimized SIV NS1 gene. In the cases where the attenuated SIV comprises a non-deoptimized NS gene, said SIV does not contain also a deoptimized NS1 gene.

(104) In some embodiments, it is the presence of the deoptimized genes in the reassortant SIV, relative to a corresponding parental SIV, which contains wild type versions of the deoptimized genes, which is responsible for the attenuated phenotype. In some embodiments, the attenuated SIV strain comprises a deoptimized SIV NS1 gene, a deoptimized HA gene and a deoptimized NA gene segment, with the proviso that the remaining SIV gene segments are non-deoptimized.

(105) In some embodiments, the vaccine composition further comprises a pharmaceutically or veterinary acceptable vehicle, diluent or excipient. In some embodiments, the vaccine provides a protective immune response in porcine against virulent swine influenza challenge. In some embodiments, the protection is homologous. In other embodiments, the protection is both homologous and heterologous. In still other embodiments, vaccine comprises multiple subtype attenuated reassortant SIV, and elicits protective immune responses in porcines against virulent challenge and/or subsequent exposure to virulent SIV H1N1, H1N2 and H3N2 subtypes.

(106) In some embodiments, the vaccine composition further comprises at least one additional antigen associated with or derived from a porcine pathogen other than swine influenza.

(107) In some embodiments, the at least one or more additional antigen(s) is capable of eliciting in a porcine an immune response against Mycoplasma hyopneumoniae (M. hyo), porcine circovirus 2 (PCV2), porcine respiratory and reproductive syndrome virus (PRRSV) or other pathogen capable of infecting and causing illness or susceptibility to illness in a porcine.

(108) In another aspect, the invention provides a method of eliciting a protective immune response in a porcine subject comprising administering to the subject a prophylactically or therapeutically effective dose of the disclosed vaccine compositions, which minimally comprise an attenuated SIV according to the present disclosure.

(109) In some embodiments, the method further comprises administering to the subject at least one adjuvant.

(110) In another aspect, the invention provides a method of vaccinating an animal comprising at least one administration of at least vaccine composition according to this disclosure.

(111) In some embodiments of the method, the porcine is a sow from about 3 weeks to about 6 weeks prefarrowing.

(112) In some embodiments of the method, the resulting piglets have a reduced morbidity and/or mortality as compared to piglets coming from unvaccinated sows.

(113) In another aspect, the invention provides a vaccine-producing composition comprising a plurality of vectors for the production of attenuated reassortant swine influenza viruses (SIVs) including vectors comprising promoters operably linked to SIV HA, NA and optionally NS1 cDNAs, wherein the HA, NA and optionally NS1 cDNAs encode deoptimized coding sequences, relative to the corresponding virulent SIV strain's HA, NA and NS1 coding sequences. As used herein, vaccine-producing composition means that when the composition is transfected into a suitable host cell, for example, an HEK cell, a re-assortant influenza vaccine strain will be produced.

(114) In some embodiments, the composition comprises plasmids comprising deoptimized HA and NA genes comprise nucleic acid molecules having the sequences as set forth in SEQ ID NO:22 & 25, respectively; 29 & 32, respectively; or 105 & 38, respectively; and optionally, wherein the deoptimized NS1 gene comprises a nucleic acid sequence having the sequence as set forth in SEQ ID NO:27.

(115) In some embodiments, the deoptimized HA and NA genes comprise nucleic acid molecules having the sequences as set forth in SEQ ID NO:91 & 92, respectively; 93 & 94, respectively; or 105 & 96, respectively; and optionally, wherein the deoptimized NS1 gene comprises a nucleic acid sequence having the sequence as set forth in SEQ ID NO:90.

(116) In some embodiments, the vectors comprise the following TRIG gene segments: NS (SEQ ID NO:83), M (SEQ ID NO:82), NP (SEQ ID NO:81), PA (SEQ ID NO:80), PB1 (SEQ ID NO:79), PB2 (SEQ ID NO:78).

(117) In some embodiments, the vectors comprise the following TRIG gene segments: NS (SEQ ID NO:83), M (SEQ ID NO:82), NP (SEQ ID NO:81), PA (SEQ ID NO:80), PB1 (SEQ ID NO:79), PB2 (SEQ ID NO:78).

(118) In some embodiments, the plasmids have the sequences as set forth in: a) SEQ ID NOs:109 and 110; b) SEQ ID NOs:108, 109 and 110; c) SEQ ID NOs:111 and 112; d) SEQ ID NOs:108, 111 and 112; e) SEQ ID NOs:115 and 114; or f) SEQ ID NOs:108, 115 and 114.

(119) In some embodiments, when the plasmids are transfected into suitable, virus-producing cells, attenuated, reassortant viruses selected from vSIV01, vSIV02, vSIV03, vSIV04, vSIV05 and vSIV06 are produced and are rescuable.

(120) In another aspect, the invention provides a method to prepare influenza virus, comprising: contacting a cell with an amount of the composition of any one of claims 19 to 26 that is effective to yield reassortant, attenuated, infectious influenza virus.

(121) In another aspect, the invention provides a cell comprising the composition comprising the disclosed plurality of reverse genetic vectors encoding SIV gene segments.

(122) In still another aspect, the invention provides a bi-valent attenuated SIV vaccine, comprising an effective amount of an attenuated H1N1 SIV and an effective amount an attenuated H3N2 SIV.

(123) In some embodiments, the bi-valent attenuated SIV vaccine comprises an effective amount of an attenuated H1N2 SIV and an effective amount of an attenuated H3N2 SIV.

(124) In some embodiments, the invention provides a tri-valent attenuated SIV vaccine, comprising an effective amount of an attenuated H1N1 SIV, an effective amount of an attenuated H1N2, and an effective amount of an attenuated H3N2 SIV.

REFERENCES

(125) Coleman J R et al. Virus attenuation by genome-scale changes in codon pair bias. Science 2008. 320(5884):1784-1787. PMID: 18583614 Mueller S et al. Live attenuated influenza virus vaccines by computer-aided rational design. Nat. Biotechn. 2010. 28:723-727. PMID: 20543832 Yang C et al. Deliberate reduction of hemagglutinin and neuraminidase expression of influenza virus leads to an ultra-protective influenza vaccine in mice. Proc. Natl., Acad. Sci. USA 2013. 110:9481-9486. PMID: 23690603 Le Noun C et al. Attenuation of Human Respiratory Syncytial Virus by Genome Scale Codon-Pair Deoptimization. Proc. Natl. Acad. Sci. USA Aug. 25, 2014. pii: 201411290. PMID: 25157129 Altschul S F, Madden T L. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402. Bragstad K et al. 2008. The evolution of human influenza A viruses from 1999 to 2006: A complete genome study. Virology J. 5:40. Cai Z et al. 2010. A computational framework for influenza antigenic cartography. PLoS Computational Biology, 6(10):e1000949. Cottey R et al. 2001. Influenza virus. Curr. Protoc. Immunol. 19.11:1-32. Das S R et al. 2011. Fitness costs limit influenza A virus hemagglutinin glycosylation as an immune evasion strategy. Proc. Natl. Acad. Sci. 108:E1417-E1422. Desselberger U et al. 1978. Biochemical evidence that new influenza virus strains in nature may arise by recombination (reassortment). Proc. Natl. Acad. Sci. 75:3341-3345. Hause B M et al. 2011. Genetic and antigenic characterization of recent human-like H1 (8-cluster) swine influenza virus isolates. J. Swine Health Prod. 19:268-276. Hause B M et al. 2010. Antigenic categorization of contemporary H3N2 swine influenza virus isolates using a high-throughput serum neutralization assay. J. Vet. Diagn. Invest. 22:352-359. Hay A J et al. 2001. The evolution of human influenza viruses. Philos. T. R. Soc. B. 356:1861-1870. Hensley S E et al. 2011. Influenza A virus hemagglutinin antibody escape promotes neuraminidase antigenic variation and drug resistance. PLoS ONE 6:e15190. Hoffmann E et al. 2001. Universal primer set for the full length amplification of al influenza viruses. Arch. Virol. 146:2275-2289. Hoffmann E et al. 2000. A DNA transfection system for generation of influenza A virus from eight plasmids. Proc. Natl. Acad. Sci. 97:6108-6113. Karasin A I et al. 2006. Identification of human H1N2 and human-swine reassortant H1N2 and H1N1 influenza A viruses among pigs in Ontario, Canada (2003-2005). J. Clin. Microbiol. 44:1123-1126. Long J et al. 2011. Evolution of H3N2 influenza virus in a guinea pig model. PLoS ONE 6:e20130. Lorusso A et al. 2012. Contemporary epidemiology of North American lineage triple reassortant influenza A viruses in pigs. Curr. Top. Microbiol. Immunol. January 22 [epub ahead of print]. Sali A, Potterton L. 1995. Evaluation of comparative protein modeling by MODELLER. Proteins 23: 318-326. Schild G et al. 1974. Antigenic variation in current influenza A viruses: evidence for a high frequency of antigenic drift for the Hong Kong virus. Bull. World Health Organ. 51:1-11. Strengell M et al. 2011. Minor changes in the hemagglutinin of influenza A(H1N1)2009 virus alter its antigenic properties. PLoS ONE 6:e25848. Vincent A L et al. 2009. Characterization of a newly emerged genetic cluster of H1N1 and H1N2 swine influenza virus in the United States. Virus Genes 39:176-185.

(126) The invention will now be further described by way of the following non-limiting examples.

EXAMPLES

Example 1Construction of Deoptimized Swine Influenza Viruses

(127) Materials/Methods.

(128) Briefly, beginning with a triple reassortant internal gene (TRIG) swine influenza virus (SIV) (A/swine/North Carolina/3793/08 (H1N1)) base genome, reassortant Modified Live Attenuated (MLV) Influenza Viruses (LAIVs) were produced using a standard eight plasmid reverse genetics approach (Hoffman, 2003; U.S. Pat. No. 9,216,211 (to Merial, Inc.)). To make the reassortant LAIVs, the TRIG sequences were added to codon deoptimized HA (SEQ ID NOs:22, 29, 35 or 105), NA (SEQ ID NOs:25, 32 or 38) and NS (SEQ ID NO:27). The deoptimized sequences were produced beginning with the following base sequences: H1N1 HA (SEQ ID NO:21), H1N2 HA (SEQ ID NO:28), and H3N2 HA (SEQ ID NO:-34); H1N1 NA (SEQ ID NO:24), H1N2 NA (SEQ ID NO:31), and H3N2 NA (SEQ ID NO:37). The base CDS were subjected to computer-assisted codon deoptimization, without altering the originally encoded amino acids. The CDS content of the LAIV constructs is summarized in Table 1.

(129) TABLE-US-00001 TABLE 1 CDS present in vSIV01, vSIV02, vSIV05 and vSIV06. rgSIV Subtype Deoptimized Gene CDS TRIG Gene CDS vSIV01 H1N2 HA-DO (SEQ ID NO: 29); NA-DO (SEQ NS (SEQ ID NO: 20), M (SEQ ID ID NO: 32) NO: 19), NP (SEQ ID NO: 9), PA (SEQ ID NO: 13), PB1 (SEQ ID NO: 15), PB2 (SEQ ID NO: 17) vSIV02 H1N2 HA-DO (SEQ ID NO: 29); NA-DO (SEQ M (SEQ ID NO: 19), NP (SEQ ID ID NO: 32); NS1-DO (SEQ ID NO: 27) NO: 9), PA (SEQ ID NO: 13), PB1 (SEQ ID NO: 15), PB2 (SEQ ID NO: 17) vSIV05 H1N1 HA-DO (SEQ ID NO: 22); NA-DO (SEQ NS (SEQ ID NO: 20), M (SEQ ID ID NO: 25) NO: 19), NP (SEQ ID NO: 9), PA (SEQ ID NO: 13), PB1 (SEQ ID NO: 15), PB2 (SEQ ID NO: 17) vSIV06 H1N1 HA-DO (SEQ ID NO:-22); NA-DO (SEQ M (SEQ ID NO: 19), NP (SEQ ID ID NO: 25); NS1-DO (SEQ ID NO: 27) NO: 9), PA (SEQ ID NO: 13), PB1 (SEQ ID NO: 15), PB2 (SEQ ID NO: 17)

(130) When the TRIG sequences were combined with the HA-DO, NA-DO and NS1-DO from either wild type H1N1 or wild type H1N2 SIV strains, infectious re-assortant SIV virions were recovered. In contrast, when the TRIG sequences were combined with the HA-DO, NA-DO and NS1-DO from an H3N2 SIV strain, infectious re-assortant SIV virions were not recovered. Accordingly, applicants have demonstrated the broad principle that HA, NA and NS1 genes, from either H1N1 or H1N2 influenza strainsbut not one specific H3N2 strainmay be successfully combined with the H1N1-based TRIG genes to produce attenuated reassortant SIV.

(131) In order to address the unforeseen problem that the H3N2-derived HA-DO, NA-DO and NS1-DO sequences did not successfully combine with the TRIG sequences to produce infectious virions, applicants devised and constructed chimeric versions of the H3N2 codon deoptimized HA genes. Briefly, wild type H3N2 HA (SEQ ID NO:34) and NA (SEQ ID NO:37) gene coding sequences were subjected to codon de-optimization (Codagenix) to produce codon de-optimized H3N2 HA-DO (SEQ ID NO:35) and H3N2 NA-DO (SEQ ID NO:38). The encoded amino acid sequences remained the same, such that SEQ ID NOs:34 & 35 both encode for the amino acid sequence set forth in SEQ ID NO:36; and, SEQ ID NOs:37 & 38 both encode the amino acid sequence set forth in SEQ ID NO:39. Additionally, the coding sequence of the NS1 gene (SEQ ID NO: 1) of A/swine/NC/3793/2008 (H1N1) was codon deoptimized to produce NS1-DO (SEQ ID NO:27.

(132) Six internal gene segments from A/swine/North Carolina/3793/2008 (H1N1) were cloned into the pHW2000 cloning vector (FIG. 3A) (SEQ ID NO:107), to produce: pHW2000-PB2, pHW2000-PB1, pHW2000-PA, pHW2000-NP, pHW2000-M, pHW2000-NS. pHW2000 itself was produced by synthesizing a dual promoter-tail cassette, pHW2000 cloning region, including 5 and 3 EcoRV restriction sites (see Virology 267, 310-317, 2000, which is herein incorporated by reference in its entirety). Then, the antibiotics resistance gene cassette and pUC origin were taken from pCDNA3.1/V5-His B by cutting out the HincII restriction fragment, and ligating said fragment together with the dual promoter-containing EcoRV fragment. The resulting plasmid was pHW2000, the construction of which is schematize in FIG. 3B.

(133) A plurality of plasmids, each containing the dual promoter cassette (pCMV-tI-restriction site-pIh-BGH tail) and one or more influenza virus gene segment(s), may be transfected into cells to produce infectious influenza virus particles (see, e.g., US 2005/0186563 A1, to St. Jude Children's Research Hospital, which is also incorporated herein by reference in its entirety).

(134) Now that the inventive sequences and combinations of SIV reassortant viruses have been disclosed, the skilled person will appreciate that any suitable reverse genetics system may be employed to produce influenza particles disclosed herein. For example, the disclosed deoptimized and TRIG sequences could be expressed to produce intact, infectious reassortant virions using the eight-plasmid system (U.S. Pat. No. 6,951,754 B2, to St. Jude) or the single plasmid system (U.S. Pat. No. 9,163,219 B2, to Arizona Board of Regents), both publications herein incorporated by reference in their entirety.

(135) The complete TRIG H1N1 segments have the following sequence designations: PB2 (SEQ ID NO:78); PB1 (SEQ ID NO:79); PA (SEQ ID NO:80); NP (SEQ ID NO:81); M (SEQ ID NO:82); NS (SEQ ID NO:83). The HA and NA have the following sequence designations: HA of H1N1 (SEQ ID NO:84); NA of H1N1 (SEQ ID NO:85); HA of H1N2 (SEQ ID NO:86); NA of H1N2 (SEQ ID NO:87); HA of H3N2 (SEQ ID NO:88); and NA of H3N2 (SEQ ID NO:89).

(136) To produce the H3N2 re-assortant SIV, codon deoptimized H3N2 HA (HA-DO) (SEQ ID NO:95) and NA (NA-DO) (SEQ ID NO:96) gene segments were chemically synthesized (GenScript) and cloned into pHW2000 by subcloning: pHW2000-H3N2-HA-DO (SEQ ID NO:113); and pHW2000-H3N2-NA-DO (SEQ ID NO:114). The pHW2000-TRIG-NS-DO (SEQ ID NO:108) was similarly constructed, and contains a codon deoptimized NS1 gene (SEQ ID NO:90).

(137) Virus Rescue.

(138) Co-transfection of eight (8) reverse genetics plasmids, consisting of internal segment plasmids (PB2, PB1, PA, NP, M, NS or NS-DO) from TRIG (H1N1) and codon deoptimized HA, NA segment from H3N2 was conducted with Lipofectamine 2000CD (Invitrogen) as per the manufacturer's protocol (Tables 2 and 3). However, three independent attempts of transfection/passage were not successful to rescue the infectious virus.

(139) TABLE-US-00002 TABLE 2 Reverse genetics plasmids for H3N2 HA, NA deoptimized virus Segment SEQ ID NO Strain Subtype 1 PB2 78 3793 H1N1 2 PB1 79 3793 H1N1 3 PA 80 3793 H1N1 4 HA-DO 95 14-3037 H3N2 5 NP 81 3793 H1N1 6 NA-DO 96 14-3037 H3N2 7 M 82 3793 H1N1 8 NS 83 3793 H1N1

(140) TABLE-US-00003 TABLE 3 Reverse genetics plasmids for H3N2 HA, NA, NS deoptimized virus Segment SEQ ID NO Strain Subtype 1 PB2 78 3793 H1N1 2 PB1 79 3793 H1N1 3 PA 80 3793 H1N1 4 HA-DO 95 14-3037 H3N2 5 NP 81 3793 H1N1 6 NA-DO 96 14-3037 H3N2 7 M 82 3793 H1N1 8 NS-DO 90 3793 H1N1

(141) Transfection with Different NA Segments.

(142) Since the deoptimized H3N2 virus could not be rescued, a codon deoptimized NA segment (H1N2 NA-DO; SEQ ID NO:94; from A/Swine/NC/0036-2/2010 (H1N2)) was used instead of H3N2 NA-DO (Tables 4 & 5). The H1N2-NA-DO supports the codon deoptimized H1N2 virus rescue with the same protocol (i.e. the H1N2 re-assortant virus with HA-DO, NA-DO, NS1-DO was recovered easily). Since NA has an important role in the release of SIV from cells, Applicants tried to recover the H3 virus using H1N2-NA-DO. Further, this approach seemed plausible, since both NAs are N2 sub-types, and have about 92% amino acid identity. However, no H3/H1N2-NA-DO re-assortant virus was recoverable. This indicated that HA might be the problem, but not NA. Therefore, a chimeric HA segment was devised and constructed.

(143) TABLE-US-00004 TABLE 4 Transfection for codon deoptimized H3N2 with H1N2 NA segment Segment SEQ ID NO Strain Subtype 1 PB2 78 3793 H1N1 2 PB1 79 3793 H1N1 3 PA 80 3793 H1N1 4 HA-DO 95 14-3037 H3N2 5 NP 81 3793 H1N1 6 NA-DO 94 0036-2 H1N2 7 M 82 3793 H1N1 8 NS 83 3793 H1N1

(144) TABLE-US-00005 TABLE 5 Transfection for codon deoptimized H3N2 with H1N2 NA segment Segment SEQ ID NO Strain Subtype 1 PB2 78 3793 H1N1 2 PB1 79 3793 H1N1 3 PA 80 3793 H1N1 4 HA-DO 95 14-3037 H3N2 5 NP 81 3793 H1N1 6 NA-DO 94 0036-2 H1N2 7 M 82 3793 H1N1 8 NS-DO 90 3793 H1N1

(145) Unfortunately (and unpredictably), rescue of infectious reassortant virus was not achieved using the codon deoptimized H1N2 NA segment (pHW2000-H1N2-NA-DO). Thus, the combination of TRIG PB2, PB1, PA, NP, M, (NS) and H3N2 HA-DO, (TRIG NS-DO) did not yield rescuable amounts of infectious virus. In a further effort to produce a reassortant H3N2 SIV, combinations of different deoptimized HA or NA segments were used to examine the compatibility of H3N2 HA and NA segment with backbone plasmids (Tables 6 & 7). Nevertheless, no infectious virus was rescued despite multiple attempts.

(146) TABLE-US-00006 TABLE 6 Transfection for virus rescue with different HA segment Segment SEQ ID NO Strain Subtype 1 PB2 78 3793 H1N1 2 PB1 79 3793 H1N1 3 PA 80 3793 H1N1 4 HA-DO 93 0036-2 H1N2 5 NP 81 3793 H1N1 6 NA-DO 96 14-3037 H3N2 7 M 82 3793 H1N1 8 NS 83 3793 H1N1

(147) TABLE-US-00007 TABLE 7 Transfection for virus rescue with different NA segment Segment SEQ ID NO Strain Subtype 1 PB2 78 3793 H1N1 2 PB1 79 3793 H1N1 3 PA 80 3793 H1N1 4 HA-DO 95 14-3037 H3N2 5 NP 81 3793 H1N1 6 NA-DO 92 14-0081 H1N1 7 M 82 3793 H1N1 8 NS 83 3793 H1N1

(148) Construction of Chimeric HA.

(149) Because reassortant SIV could not be rescued using H3N2 HA-DO or H3N2 NA-DO, chimeric HA-DO segments were constructed in which the ectodomain domain of H3N2 was fused to signal sequences (SS) and transmembrane domain (TMD)/cytoplasmic tail domain (CTD) of an H1N2 HA-DO protein (SEQ ID NO:86). Thus, the polynucleotide sequence encoding the ecto-domain of HA (H3N2) was cloned into pHW2000 containing SS, TMD and CTD of H1N2 HA protein (pHW2000-H1 SP-TM).

(150) Construction of pHW2000-H1 SP-TM.

(151) The 3UTR/signal sequences of HA segment were amplified by PCR with Bm-HA-F and 3-Rev primer sets from pUC57-Kan-H1N2-HA-DO (Table 8, FIG. 4). Also, the TMD, CTD, and 5UTR of the HA segment were amplified by PCR from pUC57-Kan-H1N2-HA-DO using 5-For and Bm-HA-R primer sets (Table 8, FIG. 4). Two PCR amplicons had overlapping sequences (21 nt, 5-GACACAATATGTGTAGGCTAC-3) (SEQ ID NO:103), which allowed amplification of the entire region. A mixture of two PCR amplicons was used as template to amplify the 3UTR/SS/TMD/CTD/5UTR of the HA segment (H1 chimeric PCR amplicon) with Bm-HA-Forward and Bm-HA-Reverse primer set (FIG. 5).

(152) TABLE-US-00008 TABLE8 PrimersusedtoconstructpHW2000-H1SP-TM SEQ ID primer Sequences(5 to3) NO Bm-HA-F TATTCGTCTCAGGGAGCAAAAGCAGGGG 97 3-Rev GTAGCCTACACATATTGTGTC 98 5-For GACACAATATGTGTAGGCTACGATATCTTAGCGAT 99 ATATTCGACGGT Bm-HA-R ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT 100 H3ectFP CTACATATGCACAAAAACTTCCCGGAAGT 101 H3ectRP TAAGATATCTTTATATCCCGATTTTA 102

(153) Construction of pHW2000-H1 SP-TM.

(154) The H1 chimeric PCR amplicons were cloned into pHW2000 by BsmBI restriction site (FIG. 6).

(155) PCR Amplification of H3 Ecto-Domain and Cloning into pHW2000-H1-SP-TM Chimera.

(156) The ecto-domain of HA (H3N2) was amplified from pUC57-Kan-H3N2-HA-DO (FIG. 7) using H3ectFP (SEQ ID NO:101) and H3ectRP (SEQ ID NO:102) primers. Next, the H3 ectodomain PCR amplicons (FIG. 7) were cloned into pHW2000-H1 SP-TM Chimera by NdeI and EcoRV restriction site (FIG. 8). The nucleotide sequences of resulting plasmid were confirmed by sequencing analysis (FIG. 9).

(157) H3N2 Virus Rescue.

(158) Co-transfection of reverse genetics plasmids including internal segment plasmids, pHW2000-HA-DO (H1-H3 chimera) and pHW2000-H3N2-NA-DO or pHW2000-H1N2-NA-DO, pHW2000-H1N1-NA-DO was conducted with by Lipofectamine 2000CD as detailed above and summarized below (Tables 9, 10 & 11).

(159) TABLE-US-00009 TABLE 9 Reverse genetics plasmids for codon deoptimized HA-DO-H1-H3/H3N2 NA-DO virus Segment SEQ ID NO Strain Subtype 1 PB2 78 3793 H1N1 2 PB1 79 3793 H1N1 3 PA 80 3793 H1N1 4 HA-DO-H1-H3 105 14-3037 H1N2-H3N2 5 NP 81 3793 H1N1 6 NA-DO 96 14-3037 H3N2 7 M 82 3793 H1N1 8 NS 83 3793 H1N1

(160) TABLE-US-00010 TABLE 10 Reverse genetics plasmids for codon deoptimized HA-DO-H1-H3/H1N2 NA-DO virus Segment SEQ ID NO Strain Subtype 1 PB2 78 3793 H1N1 2 PB1 79 3793 H1N1 3 PA 80 3793 H1N1 4 HA-DO-H1-H3 105 14-3037 H1N2-H3N2 5 NP 81 3793 H1N1 6 NA-DO 94 0036-2 H1N2 7 M 82 3793 H1N1 8 NS 83 3793 H1N1

(161) TABLE-US-00011 TABLE 11 Reverse genetics plasmids for codon deoptimized HA-DO-H1-H3/H1N1 NA-DO virus Segment SEQ ID NO Strain Subtype 1 PB2 78 3793 H1N1 2 PB1 79 3793 H1N1 3 PA 80 3793 H1N1 4 HA-DO-H1-H3 105 14-3037 H1N2-H3N2 5 NP 81 3793 H1N1 6 NA-DO 92 14-0081-1 H1N1 7 M 82 3793 H1N1 8 NS 83 3793 H1N1

(162) All three viruses were recovered from transfection in HEK cells and passages in MDCK cells. The recovered virus with codon deoptimized HA H1-H3 chimera (SEQ ID NO:105), and codon deoptimized NA segment (H3N2) (SEQ ID NO:96) was designated as vSIV03. In addition, deoptimized NS segment with deoptimized HA and NA segment viruses were recovered with same protocol (Tables 12 & 13).

(163) TABLE-US-00012 TABLE 12 Reverse genetics plasmids for codon deoptimized H3 virus Segment SEQ ID NO Strain Subtype 1 PB2 78 3793 H1N1 2 PB1 79 3793 H1N1 3 PA 80 3793 H1N1 4 HA-DO-H1-H3 105 14-3037 H1N2-H3N2 5 NP 81 3793 H1N1 6 NA-DO 96 14-3037 H3N2 7 M 82 3793 H1N1 8 NS-DO 90 3793 H1N1

(164) TABLE-US-00013 TABLE 13 Reverse genetics plasmids for codon deoptimized H3 virus Segment SEQ ID NO Strain Subtype 1 PB2 78 3793 H1N1 2 PB1 79 3793 H1N1 3 PA 80 3793 H1N1 4 HA-DO-H1-H3 105 14-3037 H1N2-H3N2 5 NP 81 3793 H1N1 6 NA-DO 92 14-0081-1 H1N1 7 M 82 3793 H1N1 8 NS-DO 90 3793 H1N1

(165) By using H1-H3 chimeric HA segment, infectious influenza viruses with codon deoptimized HA, NA segments or codon deoptimized HA, NA, NS segments were successfully recovered and propagated. The recovered virus with codon deoptimized HA H1-H3 chimera (SEQ ID NO:105), codon deoptimized NA (SEQ ID NO:96), and codon deoptimized NS segment (SEQ ID NO:90) was designated as vSIV04.

(166) Accordingly, six (6) sets of eight (8) pHW2000-based, reverse genetics plasmids were used to produce vSIV01, vSIV02, vSIV03, vSIV04, vSIV05 and vSIV06, as described and tested herein. Table 14 summarizes the gene segments used to produce these reassortant SIV.

(167) TABLE-US-00014 TABLE 14 Gene segments used to produce vSIV01, vSIV02, vSIV03, vSIV04, vSIV05 and vSIV06 rgSIV Subtype Deoptimized Gene Segments TRIG Gene Segments vSIV01 H1N2 HA-DO (SEQ ID NO: 93); NA-DO (SEQ NS (SEQ ID NO: 83), M (SEQ ID ID NO: 94) NO: 82), NP (SEQ ID NO: 81), PA (SEQ ID NO: 80), PB1 (SEQ ID NO: 79), PB2 (SEQ ID NO: 78) vSIV02 H1N2 HA-DO (SEQ ID NO: 93); NA-DO (SEQ M (SEQ ID NO: 82), NP (SEQ ID ID NO: 94); NS1-DO (SEQ ID NO: 90) NO: 81), PA (SEQ ID NO: 80), PB1 (SEQ ID NO: 79), PB2 (SEQ ID NO: 78) vSIV03 H3N2 HA-DO H1-H3 chimera (SEQ ID NS (SEQ ID NO: 83), M (SEQ ID NO: 105); NA-DO (H3N2) (SEQ ID NO: 82), NP (SEQ ID NO: 81), PA NO: 96) (SEQ ID NO: 80), PB1 (SEQ ID NO: 79), PB2 (SEQ ID NO: 78) vSIV04 H3N2 HA-DO H1-H3 chimera (SEQ ID M (SEQ ID NO: 82), NP (SEQ ID NO: 105); NA-DO (SEQ ID NO: 96); NS1- NO: 81), PA (SEQ ID NO: 80), PB1 DO (SEQ ID NO: 90) (SEQ ID NO: 79), PB2 (SEQ ID NO: 78) vSIV05 H1N1 HA-DO (SEQ ID NO: 91); NA-DO (SEQ NS (SEQ ID NO: 83), M (SEQ ID ID NO: 92) NO: 82), NP (SEQ ID NO: 81), PA (SEQ ID NO: 80), PB1 (SEQ ID NO: 79), PB2 (SEQ ID NO: 78) vSIV06 H1N1 HA-DO (SEQ ID NO: 91); NA-DO (SEQ M (SEQ ID NO: 82), NP (SEQ ID ID NO: 92); NS1-DO (SEQ ID NO: 90) NO: 81), PA (SEQ ID NO: 80), PB1 (SEQ ID NO: 79), PB2 (SEQ ID NO: 78)

Example 2Protection Efficacy of Attenuated Swine Influenza Vaccines in Piglets Against H1N2 Subtype Challenge

(168) Materials & Methods.

(169) The study included fifty Yorkshire crossbred pigs consisting of females and castrated males, confirmed SIV ELISA negative, and approximately four weeks of age on Day 0. Piglets were sourced from Midwest Research Swine, Princeton Sow herd. All pigs had full access to a commercial pelleted pig ration suitable for their size and age and had full access to the water supply through automatic drinkers. Piglets were housed by treatment group in different pens within the same room with no nose-to-nose contact.

(170) On Day 0 all animals were vaccinated intranasally (IN) with 2 mL (1 mL each nostril) of their respective test vaccine. On Day 21 all animals were challenged intranasally with 2 mL SIV H1N2 subtype (1 mL each nostril). Appropriate precautions, techniques and safety practices were followed when handling and administering the experimental products. Blood was collected from pigs for serum titer analysis prior to the start of the study for screening purposes and on Days 0, 21 and 26. Nasal swabs were collected from pigs on Days 1, 7, 22, 24 and 26, and used to detect virus replication by qRT-PCR. On Days 21 (pre-challenge) through 26, rectal body temperatures were collected from pigs. Daily General Health Observations were made and recorded from Day 7 to Day 26. Post-challenge clinical observations were made and recorded from Day 22 to Day 26. All lungs were visually accessed for pathology with an estimate of percent consolidation/pneumonic involvement per lung lobe, by a veterinarian that was blinded to treatment assignment as derived from the following formula and recorded in the raw data.
Overall Percent Consolidation=[(% LA*0.05)+(% LC*0.06)+(% LD*0.29)+(% RA*0.11)+(% RC*0.10)+(% RD*0.34)+(%1*0.05)]*100

(171) A sample of the right middle lobe of each lung was fixed in 10% formalin and assessed for immunohistochemistry (IHC) scores. Also, a similar section of each lung was kept fresh and analyzed by RT-PCR testing.

(172) TABLE-US-00015 TABLE 15 Experimental Vaccine Details (DO = deoptimized sequence); PBS negative control; challenged with SIV 10-0036-1 051515 (H1N2) at 6.0 log 10 TCID50/mL Surface Genes Backbone Titer Genetic Sterility vSIV Subtype (SG) (IG) (TCID50/mL) analysis test vSIV01 H1N2 HA- and TRIG P.2 = 6.10 HA, NA, NS Pass NA- (6.03/6.16)H/C confirmed DO vSIV02 H1N2 HA- and TRIG-NS1 P.2 = 6.09 HA, NA, NS Pass NA- DO (6.07/6.12) confirmed DO vSIV05 H1N1 HA- and TRIG P.2 = 6.55 HA, NA, NS Pass NA- (6.49/6.62) confirmed DO vSIV06 H1N1 HA- and TRIG-NS1 P.2 = 6.59 HA, NA, NS Pass NA- DO (6.70/6.49) confirmed DO

(173) TABLE-US-00016 TABLE 16 Study Groups Dose in Route of (log10) Number Dose Adminis- in of Challenge Group Vaccine Volume tration 1 mL animals D21 1 vSIV01 2 mL IN 6.0 10 H1N2 (H1N2.2) 2 vSIV02 2 mL IN 6.0 10 H1N2 (H1N2.3) 3 vSIV05 2 mL IN 6.0 10 H1N2 (H1N1.2) 4 vSIV06 2 mL IN 6.0 10 H1N2 (H1N1.3) 5 PBS 2 mL IN N/A 10 H1N2

(174) Results.

(175) FIG. 1 shows the boxplot showing overall % consolidation by group. For the purpose of obtaining an incidence assessment for pneumonic tissue, a piglet with percent pneumonic tissue scores10% was categorized as positive and a piglet with percent pneumonic tissue scores<10% was categorized as negative. Importantly, rgSIV containing deoptimized HA (HA-DO) and NA deoptimized (NA-DO) genes (Groups 1, 2, 3 and 4) provide significant protection from lung lesion, as compared to PBS control.

(176) Moreover, the rgSIV containing HA-DO, NA-DO and NS1-DO (Groups 2 and 4) show a trend of enhanced protection over their corresponding rgSIV having only their HA and NA genes deoptimized (Groups 1 and 3, respectively). It is also important to note that since the challenge strain was virulent H1N2 the rgSIV administered to Groups 1 and 2 were essentially being evaluated for their ability to elicit homologous protection, whereas the rgSIV administered to Groups 3 and 4 were essentially being evaluated for their ability to elicit heterologous protection. This explains, at least in part, why the protection elicited in Group 3 and 4 animals was significant when compared to that elicited in Group 5 animals (i.e. the control group), but not so strong as the protection elicited in Group 1 and 2 animals.

(177) Applicants envision that many different combinations deoptimized HA, NA and/or NS1 may be employed in the practice of the invention. For example, if protection from H1N2 is desired, deoptimized HA, NA, and NS1 may be added to the other five TRIG segments (or even added to another SIV backbone strain, as desired), to produce highly effective attenuated H1N2 deoptimized rgSIV.

(178) TABLE-US-00017 TABLE 17 Incidence of positive Pneumonic Tissue score P-value Group (Fisher's Prevented Fraction Name N Negative Positive Exact Test) (95% CI) PBS 10 5 5 0.0325 1.00 vSIV01 10 10 0 (0.32, 1.00) PBS 10 5 5 0.0325 1.00 vSIV02 10 10 0 (0.32, 1.00) PBS 10 5 5 0.1409 0.80 vSIV05 10 9 1 (0.001, 0.98) PBS 10 5 5 0.1409 0.80 vSIV06 10 9 1 (0.001, 0.98)

(179) TABLE-US-00018 TABLE 18 Viral load P-value (Wilcoxon Mitigated Vaccine N Mean Two-sided Z Test) Fraction (95% CI) PBS 10 162341186 0.0002 100% vSIV01 10 32745 (100%, 100%) PBS 10 162341186 0.0003 96% vSIV02 10 177374 (87%, 100%) PBS 10 162341186 0.0017 84% vSIV05 10 2084421 (61%, 100%) PBS 10 162341186 0.0022 82% vSIV06 10 3618562 (58%, 100%)

(180) TABLE-US-00019 TABLE 19 Incidences of Positive PCR Results by Group P-value Group (Fisher's Prevented Fraction Name N Negative Positive Exact Test) (95% CI) PBS 10 0 10 0.0325 0.50 vSIV01 10 5 5 (0.20, 0.79) PBS 10 0 10 0.0325 0.50 vSIV02 10 5 5 (0.20, 0.79) PBS 10 0 10 1.0000 0.10 vSIV05 10 1 9 (0.27, 0.41) PBS 10 0 10 0.4737 0.20 vSIV06 10 2 8 (0.18, 0.55)

(181) TABLE-US-00020 TABLE 20 Incidences Summary Statistics, p-value of the Wilcoxon tests, and Mitigated Fractions for the Comparison of PCR Results of the Vaccinated Groups against the Placebo Group P-value (Wilcoxon Two- Vaccine N Mean sided Z Test) Mitigated Fraction (95% CI) PBS 10 412000 0.0002 100% vSIV01 10 763 (100%, 100%) PBS 10 412000 0.0002 100% vSIV02 10 1029 (100%, 100%) PBS 10 412000 0.0002 100% vSIV05 10 4588 (100%, 100%) PBS 10 412000 0.0003 96% vSIV06 10 24586 (87%, 100%)

(182) TABLE-US-00021 TABLE 21 Least Square Means (LSM) of SIV Serology by Day and Group Day Vaccine LSM StdErr 21 PBS 0.93 0.05 vSIV01 0.53 0.05 vSIV02 0.6 0.04 vSIV05 0.49 0.05 vSIV06 0.47 0.05 26 PBS 0.79 0.05 vSIV01 0.43 0.05 vSIV02 0.42 0.04 vSIV05 0.22 0.05 vSIV06 0.23 0.05

(183) Conclusions.

(184) The post-challenge lung lesion scores were significantly lower for all treatment groups. Groups vSIV01 and vSIV02 aided in the prevention of lung lesions, whereas Groups vSIV05 and vSIV06 aided in the control of lung lesions. For vSIV01 and vSIV02, the mitigated fraction was 100%, demonstrating a complete protection from homologous challenge. Promisingly, the mitigated fractions of vSIV05 and vSIV06 were 70% and 82%, respectively, showing a significant level of cross-protection from lung lesions against a heterologous challenge. Such levels are unpredictable in view of the state of art understanding at the time Applicants developed the disclosed invention. Finally, no abnormal post-vaccination reactions were observed, including depression and anaphylaxis.

Example 3Protection Efficacy of Attenuated Swine Influenza Vaccines in Piglets Against H1N1 or H3N2 Subtype Challenge

(185) This study was generally conducted using the methods described in Example 2, unless otherwise stated (details summarized in Table 22). Briefly, piglets were allocated to one of six (6) treatment groups using litter as a randomization factor. After vaccination, but before challenge, piglets in Groups 1, 2, 4, and 5 were housed in a separate room(s) (all vaccinates in one/two room(s)) separate from the controls. Pigs from different vaccinate groups did not have nose to nose contact. Groups 1 and 4 were housed together prior to challenge however.

(186) Prior to challenge on Day 21, piglets assigned to Groups 1, 2, and 3 were comingled and housed together and piglets assigned to Groups 4, 5, and 6 were comingled and housed together until the end of the study.

(187) TABLE-US-00022 TABLE 22 Study Design No. of Group Vaccine Challenge Route Dose Frequency Animals 1 Trivalent H1N1 IN 1 mL Once on Do 10-12 (MLV IAV vSIV02(H1N2) + vSIV04(H3N2) + vSIV06(H1N1)) 2 H1N1 H1N1 IN 1 mL Once on Do 10-12 (MLV IAV vSIV06) 3 Control (PBS) H1N1 IN 1 mL Once on Do 10-12 4 Trivalent H3N2 IN 1 mL Once on Do 10-12 (MLV IAV vSIV02(H1N2) + vSIV04(H3N2) + vSIV06(H1N1)) 5 H3N2 H3N2 IN 1 mL Once on Do 10-12 (MLV IAV vSIV04) 6 Control (PBS) H3N2 IN 1 mL Once on Do 10-12

(188) In view of the protective efficacy demonstrated by the results presented in Example 2, it was expected that the Group 1, 2, 4 and 5 vaccines would elicit protective immunity that is significantly greater than respective control vaccines, 3 and 6.

(189) Results.

(190) FIG. 14 shows the boxplot showing overall % consolidation by group.

(191) TABLE-US-00023 TABLE 23 P-value of the Wilcoxon test and Mitigated Fractions for the comparison of the overall percent consolidation of Vaccinate Groups against the Control Groups P-value (Wilcoxon Two- Group 25th 75th sided Z Mitigated Group Name N Mean Min Pctl Median Pctl Max Test) Fraction (95% CI) 1 Trivalent 12 3.3 0.2 1.0 1.8 3.2 15.0 0.0001 93% 3 Control 12 21.4 6.7 15.4 22.6 29.6 32.5 (82%, 100%) 2 H1N1 12 4.7 0.0 0.4 1.8 5.0 19.9 0.0005 85% 3 Control 12 21.4 6.7 15.4 22.6 29.6 32.5 (64%, 100%) 4 Trivalent 12 2.2 0.0 0.6 1.0 3.2 7.5 0.0024 74% 6 Control 12 10.3 0.5 5.6 8.8 16.2 21.2 (44%, 100%) 5 H3N2 12 0.7 0.0 0.1 0.4 1.0 3.4 0.0001 93% 6 Control 12 10.3 0.5 5.6 8.8 16.2 21.2 (81%, 100%)

(192) TABLE-US-00024 TABLE 24 P-value of the Wilcoxon test and Mitigated Fractions for the comparison of the microscopic lung IAV lesions of Vaccinate Groups against the Control Groups P-value (Wilcoxon Two- Group 25th 75th sided Z Mitigated Group Name N Mean Min Pctl Median Pctl Max Test) Fraction (95% CI) 1 Trivalent 12 1.3 0.0 0.5 1.0 2.0 3.0 0.0013 74% 3 Control 12 2.6 2.0 2.0 3.0 3.0 3.0 (49%, 100%) 2 H1N1 12 1.4 0.0 1.0 1.0 2.0 3.0 0.0012 74% 3 Control 12 2.6 2.0 2.0 3.0 3.0 3.0 (49%, 100%) 4 Trivalent 12 1.6 0.0 1.0 1.5 2.0 3.0 0.1984 29% 6 Control 12 2.0 1.0 2.0 2.0 2.0 3.0 (12%, 71%) 5 H3N2 12 0.7 0.0 0.0 0.0 1.5 2.0 0.0015 72% 6 Control 12 2.0 1.0 2.0 2.0 2.0 3.0 (46%, 99%)

(193) TABLE-US-00025 TABLE 25 P-value of the Wilcoxon test and Mitigated Fractions for the comparison of the lung IAV IHC Score of Vaccinate Groups against the Control Groups P-value (Wilcoxon Two- Group 25th 75th sided Z Mitigated Group Name N Mean Min Pctl Median Pctl Max Test) Fraction (95% CI) 1 Trivalent 12 1.1 0.0 0.0 1.0 2.0 3.0 0.0142 58% 3 Control 12 2.2 1.0 1.5 2.0 3.0 3.0 (24%, 91%) 2 H1N1 12 0.9 0.0 0.5 1.0 1.0 2.0 0.0019 72% 3 Control 12 2.2 1.0 1.5 2.0 3.0 3.0 (46%, 97%) 4 Trivalent 12 1.0 0.0 0.5 1.0 1.5 2.0 0.7888 6% 6 Control 12 0.9 0.0 1.0 1.0 1.0 2.0 (47%, 35%) 5 H3N2 12 0.5 0.0 0.0 0.0 1.0 2.0 0.0815 39% 6 Control 12 0.9 0.0 1.0 1.0 1.0 2.0 (4%, 81%)

(194) TABLE-US-00026 TABLE 26 P-value of the Fisher's exact test and Prevented Fractions for the comparison of the incidence of viral load in the nasal passage, post-challenge of Vaccinate Groups against the Control Groups P-value Prevented Group (Fisher's Fraction Group Name N Negative Positive exact test) (95% CI) 1 Trivalent 12 9 3 0.0003 75% 3 Control 12 0 12 (45%, 93%) 2 H1N1 12 8 4 0.0013 67% 3 Control 12 0 12 (38%, 88%) 4 Trivalent 12 5 7 0.0373 42% 6 Control 12 0 12 (14%, 71%) 5 H3N2 12 9 3 0.0003 75% 6 Control 12 0 12 (45%, 93%)

(195) Conclusions.

(196) A significant vaccine effect was observed for gross lung lesions for both monovalent vaccines and the trivalent vaccine when compared to the control groups. This was also true for microscopic lesions with the exception of the Group 4 (Trivalent/H3N2 Challenge) which did not show a significant decrease. The score was lower in this group compared to the control group and could be a product of selection bias, however this observation is consistent with the IHC scores observed in the same group described below.

(197) For lung colonization, there was a significant vaccine effect observed with Groups 1 and 2 when compared to the control group challenged with H1N1. A vaccine affect was not observed in Groups 4 and 5 when compared with the controls challenged with H3N2. For nasal shedding, a significant vaccine effect was observed in all vaccinated groups which prevented shedding when compared to the controls. For groups receiving an H1N1 challenge, the clinical respiratory character was lower in the vaccinates than the controls in 4 of 6 observation days. For those groups receiving H3N2 challenge the clinical respiratory character was lower in the vaccinates in 2 of 6 observation days. Depression scores were lower in vaccinates receiving H1N1 challenge when compared to controls, however, for those receiving H3N2 challenge depression was observed in very few pigs and therefore cannot be adequately assessed. Temperatures post-challenge were lower in all vaccinated groups when compared to controls. Finally, no abnormal post-vaccination reactions were observed, including depression and anaphylaxis.

Example 4Development and Implementation of Sentinel Model for Evaluating Effect of Vaccination on Challenge Virus Transmission

(198) This study is generally conducted using the methods described in Example 3, with the addition of positive control sentinel animal comingling, unless otherwise stated (details summarized in Table 27).

(199) In order to evaluate actual virus transmission, instead of merely measuring virus shed (e.g. via nasal swabs and virus detection), it was necessary to develop a Sentinel Model. Applicants contemplated that it could not be predicted with certainty whether the optimal conditions would be produced by comingling control and vaccinated animals with sentinels immediately post challenge, or sometime after challenge. Understanding that peak SIV shedding normally occurred at about 48 hours post exposure to a virulent challenge SIV strain, Applicants reasoned that a good time to begin comingling would be from about 12 hours to about 36 hours. A 24 hour delay was selected for this study. This delay in comingling would allow the challenge virus a sufficient time to be absorbed and dispersed into the housing environment. Alternatively, the animals may be comingled immediately after challenge.

(200) TABLE-US-00027 TABLE 27 Study Design - Sentinel Model Conditions Room placement after Group Vaccine Challenge challenge 1 Trivalent H1N1 1 (MLV IAV vSIV02(H1N2) + vSIV04(H3N2) + vSIV06(H1N1)) 2 Transmission Negative Control Sentinel 1 (no vaccine; PBS only) 3 Trivalent 2 (MLV IAV vSIV02(H1N2) + vSIV04(H3N2) + vSIV06(H1N1)) 4 Transmission Positive Control Sentinel H1N1 2 (no vaccine; PBS only) 5 H1N1 H1N1 3 (MLV IAV vSIV06) 6 Transmission Negative Control Sentinel 3 (no vaccine; PBS only) 7 H1N1 4 (MLV IAV vSIV06) 8 Transmission Positive Control Sentinel H1N1 4 (no vaccine; PBS only) 9 Trivalent H3N2 5 (MLV IAV vSIV02(H1N2) + vSIV04(H3N2) + vSIV06(H1N1)) 10 Transmission Negative Control Sentinel 5 (no vaccine; PBS only) 11 Trivalent 6 (MLV IAV vSIV02(H1N2) + vSIV04(H3N2) + vSIV06(H1N1)) 12 Transmission Positive Control Sentinel H3N2 6 (no vaccine; PBS only) 13 H3N2 H3N2 7 (MLV IAV vSIV04) 14 Transmission Negative Control Sentinel 7 (no vaccine; PBS only) 15 H3N2 8 (MLV IAV vSIV04) 16 Transmission Positive Control Sentinel H3N2 8 (no vaccine; PBS only)

(201) Vaccines are demonstrated to reduce transmission in the following cases:

(202) (a) Comingled Groups 1 & 2

(203) Now that Applicants have developed this approach, any number of vaccines may be tested for their ability to reduce challenge virus transmission. The important difference between the Sentinel Model study design and the study designs disclosed in Examples 2 and 3 is the inclusion of the positive control group (i.e. for each vaccine, there are 2 groups per airspace/housing environment). This feature, along with the option to delay the time between challenge and comingling, allows the Sentinel Model to measure the impact of any SIV vaccine on virus transmission.

Example 5Genetic Stability of the Modified Live Vaccines

(204) Objective.

(205) To evaluate the genetic stability of the modified live vaccine following in vivo co-inoculation with wild-type virus and assess the potential occurrence of VAERD in pigs using an IAV vaccine. Table 28 presents the overall study design.

(206) Primary Variables.

(207) The following were evaluated: 1) genetic stability of the codon de-optimized HA, NA and NS1 genes of the vaccine virus recovered following in vivo passage of the co-inoculated vaccine and challenge viruses; 2) Vaccine Associated Enhanced Respiratory Disease (VAERD) based on assessment of lung lesions and viral shedding from pigs receiving the MLV IAV vaccine following in vivo passage; and 3) efficacy of the test vaccines.

(208) Vaccination & Challenge.

(209) Piglets received 2 doses of the vaccine in the right nare on Day 0 and on Day 21. All piglets received a dose of the appropriate challenge material in the left nare on Day 21.

(210) Daily Clinical Observations: All piglets were observed daily for general well-being and signs of IAV disease (fever, lethargy, dyspnea).

(211) TABLE-US-00028 TABLE 28 Study Design No. Dose Group Animals Vaccination Route Frequency Vol. Challenge 1 10 H1N1 IN Days 0 & 21 1 mL H1N1 2 10 H1N2 IN Days 0 & 21 1 mL H1N1 3 10 Placebo IN Days 0 & 21 1 mL H1N1 4 10 H3N2 IN Days 0 & 21 1 mL H3N2 5 10 Placebo IN Days 0 & 21 1 mL H3N2

Example 6In Vitro Genetic Stability of the Modified Live Vaccines

(212) Vaccines were serially passed in ST cells and as indicated in Table 29, vSIV01, 02, 05 and 06 remained quite stable.

(213) TABLE-US-00029 TABLE 29 Sequence analysis indicated that the vSIV remained stable after 10 passages in ST cells Gene vSIV01 vSIV02 VSIV05 vSIV06 HA No change No change No change 1 nt/aa NA No change No change No change No change NS No change No change No change No change

Example 7Vaccines Formulated as Fine-Grained Powders

(214) Three Master Seed Viruses (MSVs), SIV02 (H1N2), SIV 04 (H3N2) and SIV06 (H1N1), were generated on canine cell line MDCK. Viruses were combined with stabilizing components and lyophilized and/or vitrified using previously-described techniques (see e.g. US 2013/0040370 & US 2016/0256554, both to Merial, Inc.). The desiccated biological materials were then subjected to milling to produce a fine-grained powder. The powders were assayed for stability over time.

(215) TABLE-US-00030 TABLE 30 Stability of monovalent SIV04 (H3N2), formulated as a powder Harvest Titer Post Lyo SIV-04 Blend Titer Process/Post Storage Stability Stability H3N2 Pre-Lyo Mill Conditions 1 month 2 month Pre Blend 7.0 TCID.sub.50 7.0 TCID.sub.50 4 C. 7.0 7.16 7.5 TCID.sub.50 TCID.sub.50 TCID.sub.50

(216) TABLE-US-00031 TABLE 31 Stability of trivalent SIV02 (H1N2) SIV04 (H3N2) SIV06 (H1N1), formulated as a powder Post Harvest Blend Lyo Titer Titer Process Trivalent Pre- (no Storage Stability Stability Stability Formulation Lyo loss) Conditions 1 month 2 month 3 month Pre Blend 6.4 6.5 4 C. 6.5 6.5 6.2 ~7.4 TCID.sub.50 TCID.sub.50 TCID.sub.50 TCID.sub.50 TCID.sub.50 TCID.sub.50

(217) Accordingly, immunological compositions of the present invention are stable when formulated as a dry, fine-grained powder.

(218) Having thus described in detail preferred embodiments of the present invention, it is to be understood that the invention defined by the above paragraphs is not to be limited to particular details set forth in the above description as many apparent variations thereof are possible without departing from the spirit or scope of the present invention.